Anda di halaman 1dari 10

Modifikasi Gen Insulin (menggunakan PCR)

Membuat desain primer 1. Desain forward Primer Situs Restriksi : BamHI Start Kodon : ATG Overlap dengan gen of interest 2. Desain reverse Primer Situs Restriksi : HindIII Stop Kodon : TAA Overlap dengan gen of interest
B-chain gene : TTT GTG AAC CAA CAC CTG TGC GGC TCA CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC A-chain gene :

GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC

Urutan basa pada gen insulin

Situs Restriksi BamHI

Situs Restriksi XBaI

Sticky End

Desain primer

Temperature Melting
Suhu dimana setengah dari primer sudah menempel pada DNA template Tm untuk kedua primer sama atau selisih 2-4 C dan diatas 60C

GC Content
Kandungan GC dalam primer harus berada diantara 40 - 60%.

Desain primer B-Chain Gene


Desain forward primer Gen Insulin (5end) GGATCCATGTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTA
Situs Start Restriksi BamHI Kodon

17 Basa Gen Insulin

Desain reverse primer Gen Insulin (3-end)


TCTAGATTAAAACACTTGGTTGTGGACACGCCGAGTGTGGACCACCTTCGAGAGATGGAT

Situs Stop Restriksi Kodon XBaI

17 Basa Gen Insulin

Desain primer A-Chain Gene


Desain forward primer Gen Insulin (5end) GGATCCATGGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAG)

Start Situs Restriksi Kodon BamHI

17 Basa Gen Insulin

Desain reverse primer Gen Insulin (3-end)


TCTAGATTACCGTAACACCTTGTTACGACATATGGTCGTAGACGAGGGAGATGGTCGACCTC

Situs Stop Restriksi Kodon XBaI

17 Basa Gen Insulin

Proses PCR B-Chain Gene


Kriteria desain primer
Temperature Melting (TM) - TM forward primer : 76C - TM reverse primer : 74C Selisih TM : 2C GC Content - GC forward primer : 53,3% - GC reverse primer : 48,33%

Memenuhi

3 Primer

Proses PCR A-Chain Gene


Kriteria desain primer
Temperature Melting (TM) - TM forward primer : 76C - TM reverse primer : 74C Selisih TM : 2C GC Content - GC forward primer : 55% - GC reverse primer : 50%

Memenuhi

Ikatan Disulfida
Pada tahap terakhir, kedua rantai A dan B insulin yang telah murni kemudian direaksikan dengan proses oksidasi untuk membentuk jembatan disulfida yang merupakan bagian dari struktur insulin, sehingga akan diperoleh hormon insulin hasil rekombinan yang identik dengan insulin yang terdapat pada manusia Proses oksidasi berlangsung sebagai berikut: Rantai A dan B dioksidasi, bila tidak terbentuk protein yang diinginkan maka direduksi kembali. Proses oksidasi-reduksi ini memakan waktu dan tidak efisien

Ikatan disulfida

penambahan insert Penambahan alkalinfosfatase


penambahan buffer

inkubasi campuran larutan

penambahan DNA ligase

penambahan air (pelarut)

Metode ligasi

proses pemotongan dengan enzim restriksi agar dapat menghasilkan ujung yang tidak rata (sticky end).

Metode ligasi