Ribosom

Sebelumnya Diterbitkan Pekerjaan UC Berkeley
A University of California penulis atau departemen telah membuat artikel ini tersedia secara terbuka.
Berkat Senat Akademik Terbuka Kebijakan Access, banyak sekali publikasi ilmiah UC-menulis
sekarang akan tersedia secara bebas di situs ini. Marilah kita tahu bagaimana akses ini penting bagi
Anda. Kami ingin mendengar cerita Anda! http://escholarship.org/reader_feedback.html
eScholarship menyediakan akses terbuka, layanan penerbitan ilmiah di Universitas California dan memberikan
platform penelitian yang dinamis untuk sarjana di seluruh dunia.
Mengintip pada
Judul: profil Ribosom mengungkapkan apa, kapan, di mana dan bagaimana protein sintesis
Journal Issue: Nature Molecular Cell Biology, 16 (11)
Author: Brar, GA Weissman, JS
Tanggal Publikasi: 2015/10/22
Seri: UC Berkeley Sebelumnya Diterbitkan Pekerjaan
Juga Tersedia: UC San Francisco Sebelumnya Diterbitkan Pekerjaan
Permalink: http://escholarship.org/uc/item/78t9g779
DOI: https://doi.org/10.1038/nrm4069
Identifier lokal: 1.178.381
Abstrak: © 2015 Macmillan Penerbit Limited. Profiling semua hak reserved.Ribosome, yang
melibatkan sequencing dalam fragmen mRNA ribosom dilindungi, adalah alat yang ampuh untuk
memantau terjemahan global in vivo. Metode ini telah memfasilitasi penemuan regulasi ekspresi gen
yang mendasari beragam dan kompleks proses biologis, aspek penting dari mekanisme sintesis
protein, dan bahkan protein baru, dengan menyediakan pendekatan sistematis untuk penjelasan
eksperimental dari daerah coding. Di sini, kami memperkenalkan metodologi profiling ribosom dan
mendiskusikan contoh di mana pendekatan ini telah menjadi faktor kunci dalam
membimbingbiologis,
penemuan termasuk peran penting dalam mengidentifikasi ribuan diterjemahkan Novel rangka baca
terbuka pendek dan produk terjemahan alternatif.
Informasi hak cipta:-undang kecuali dinyatakan lain. Menghubungi penulis atau penerbit asli untuk
setiap izin yang diperlukan. eScholarship bukan pemilik hak cipta untuk karya disimpan. Pelajari
lebih lanjut di http://www.escholarship.org/help_copyright.html#reuse
eScholarship menyediakan akses terbuka, layanan penerbitan ilmiah di Universitas California dan memberikan
platform penelitian yang dinamis untuk sarjana di seluruh dunia.
ULASAN
TECHNOLOGIESDAN TEKNIK profiling
Ribosom mengungkapkan apa, kapan, di mana
dan bagaimana sintesis protein
Gloria A. Brar1,3,4 dan Jonathan S. Weissman2-4
Abstrak | Profil ribosom, yang melibatkan sequencing dalam fragmen mRNA ribosom dilindungi,
adalah alat yang ampuh untuk memantau terjemahan global in vivo. Metode ini telah memfasilitasi
penemuan regulasi ekspresi gen yang mendasari beragam dan kompleks proses biologis, aspek
penting dari mekanisme sintesis protein, dan bahkan protein baru, dengan menyediakan pendekatan
sistematis untuk penjelasan eksperimental dari daerah coding. Di sini, kami memperkenalkan
metodologi profiling ribosom dan mendiskusikan contoh di mana pendekatan ini telah menjadi faktor
kunci dalam membimbing penemuan biologis, termasuk peran penting dalam mengidentifikasi ribuan
diterjemahkan Novel rangka baca terbuka pendek dan produk terjemahan alternatif.
Ribosom jejak kaki mRNA fragmen ~ 30
Translation, yang merupakan proses dimana ribosom
dari posisi ribosom pada saat di mana trans- berbunyi template
mRNA untuk memandu sintesis protein, adalahsebuah
lationdihentikan. Mengukur kepadatandilindungi
nukleotidayang dihasilkan dari
langkah penting dalam ekspresi gen. Terjemahanyang bergairah
fragmenpada transkrip yang diberikan
menyediakan proxy untuk pengobatan nuklease dari
Cally mahal dan karena itu diatur secara ketat untuk melestarikan
laju sintesis protein. Selain itu,
menentukan ribosom menerjemahkan. Ini adalah daerah mRNA yang dilindungi oleh ribosom sebagai mRNA diterjemahkan
ke
sumber daya seluler, serta untuk menghindari kesalahan yang mungkin
posisi fragmen dilindungi memungkinkan untuk menghasilkan
produksi protein beracun. Memang, lebar
empiris mengukur identitas berbagai produk terjemahan negara
penyakit, termasuk neurodegeneration,
(misalnya, di mana mereka mulai dan
akhir danbahkan protein berurutan.
anemiaDan cacat perkembangan tertentu, terjadi ketika
bingkai sedang dibaca). Hal ini telah menyebabkan penemuan
banyak proses translasi dikompromikan (lihatyang dipilih
Novelatau products10-19 protein alternatif. The distribu-
1Jurusan Molekuler dan Biologi Sel, Universitas
ref
1-6).Meskipun banyak yang diketahui tentangstruc-
tionjejak kaki ribosom dapat memberikan wawasan ke dalam
mendatang dan fungsi ribosom,pemahaman kita
mekanismekontrol translasi (misalnya, dapat
California, Berkeley,
dari banyak aspek regulasi terjemahan telah
digunakan untuk mengidentifikasi jeda
translasi peraturan dan California 94720, USA.
jauh lebih terbatas.
diterjemahkan
hulu rangka baca terbuka
2Howard Hughes Medical Institute, Departemen Seluler dan Molekuler Farmakologi, Universitas
Upaya untuk global ekspresi gen memantau secara historis berfokus pada mengukur kadar mRNA ( misalnya, menggunakan
microarrays atau RNA sequencing (RNA- California, San Francisco,
seq)), meskipun kita tahu bahwa kontrol translasi adalah California 94.158, USA. 3Center untuk
RNA Sistem Biologi, University of California, Berkeley, California 94720, USA.
sebuah langkah penting dan diatur dalam menentukan tingkat ekspresi protein. Sampai saat ini, terjemahan pemantauan
tepatnya adalah jauh lebih menantang daripada yang measur- ing tingkat mRNA. Ini telah berubah dengan 4California
Institute mengembangkan- untuk
ment dari ribosom pendekatan profiling, yang pertama kali Biosciences Kuantitatif (QB3),
Universitas
dijelaskan pada tahun 2009
(REF. 7)
California, San Francisco, California 94.158, USA. e-mail: gabrar@berkeley.edu; jonathan.weissman@ucsf.edu doi:
10.1038 / nrm4069 Diterbitkan online 14 Oktober 2015
SIFAT ULASAN | MOLECULAR CELL BIOLOGI VOLUME 16 | November 2015 | 651
© 2015 Macmillan Publishers Limited. Semua hak dilindungi
(uORFs)). Akhirnya, adaptasi novel dengan ribosom profil pendekatan memungkinkan
untuk memantau terjemahan dimediasi oleh set sub ribosom atas dasar lokasi fisik mereka di dalam sel atau mitra interaksi
mereka.
Di sini, kita membahas prinsip-prinsip pendekatan pengajuan ribosom pro, kekuatan dan keterbatasan, dan contoh terbaru di
mana ia telah membimbing penemuan biologis. Kami fokus pada nilai profiling ribosom sebagai alat untuk menginterogasi
apa yang sedang diterjemahkan, bagaimana bahasa dari ini.
tion diatur dan di mana dalam sel penjabaran Ribosom profiling
adalah alat berbasis deep-sequencing
set spesifik protein terjadi. yang memfasilitasi pengukuran rinci
terjemahan global dan di vivo7. Pada inti dari pendekatan ini adalah
Apa profiling ribosom dan apa yang bisa ia mengungkapkan?
pengamatan bahwa ribosom menerjemahkan sangat melindungi
profiling Ribosom mengeksploitasi klasik molekul sekitar 30
nukleotida dari mRNA dariactiv- nuklease
metodedari footprinting8,9 ribosom, di mana in vitro ity8,9.
Sequencing fragmen ribosom dilindungi tersebut,
mRNA diterjemahkan diperlakukan dengan nuklease untuk
menghancurkan jejak kaki ribosom diistilahkan, sehingga memberikan catatan yang tepat
daerah yang tidak dilindungi oleh ribosome7,9 tersebut.
ULASAN
Hulu rangka baca terbuka
seperti daun pengobatan 'jejak kaki' dari ~ 30 nukleotida, ribosom yang dapat dipetakan kembali ke mRNA asli untuk
menentukan lokasi yang tepat dari ribosom menerjemahkan. Profiling ribosom meluas metode ini dengan pemetaan dan
mengukur lengkap in vivo ribosom jejak kaki untuk mengukur sintesis protein baru dan untuk anno- tate daerah coding
globally7,10-12
(Gambar 1,2)
652 | November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio
profiling memiliki berbagai kegunaan, dari alat teomic pro luas untuk probe spesifik terjemahan dalam in vivo (uORFs).
ORFs dalam5
pengaturan'pemimpin,dan sebagai
pelengkap berharga untuk mRNA-seq. wilayah dariditandai
profil Ribosommembutuhkan
koleksi transkrip mRNA fisiologis. Terjemahan dari uORFs dapat mengatur terjemahan dari ORF hilir. Profiling ribosom
memungkinkan
sampel logis; penghambatan terjemahan untuk membekukan somes ribo- dalam tindakan terjemahan; nuklease pencernaan
untuk menghasilkan fragmen ribosom dilindungi; dan isolasi untukidentifikasi empiris
ribosomdan, kemudian, dari
footprints21 ribosom. dari semua diterjemahkan uORFs in vivo di bawah kondisi yang menarik. Meskipun uORFs pendek,
di sini kita tidak memasukkan mereka
dalam.Kemajuan luar biasa dalam sequencing technology20 sekarang
memungkinkan untuk mendalam sampel semua ribosom menerjemahkan. Dalammamalia
jejak kaki Ribosomdikonversi ke sel untai-spesifik, misalnya,
yang mengkodekan ~ 20.000 protein dengan
perpustakaan dan dikenakan generasi sekuensing, rata-rata mRNA
coding wilayah ~ 500 kembar tiga nukleotida,
dan fragmen kemudian dipetakan ke
yang sesuai kelas 'ORFs pendek', yang
nuklease pencernaan semua menerjemahkanribosom-mRNA.
referensi genom Profil ribosom
biasanya mobil-yang pada mRNA yang tidak
kompleks menghasilkan 10 juta jejak kaki mungkin. Mencapai miliaran The
Ried pada sampel split, dengan
perpustakaan paralel con yang diperkirakan sebelumnya untuk mengkodekan protein.
singa dari membaca yang sekarang mungkin dengan generasi
structed untuk mengukur mRNA kelimpahan oleh mRNA-seq.
sequencing memungkinkan kuantifikasi handal dari himpunan
Perbandingan antara tingkat sintesis protein dan jejak kaki ubin di
semua tetapi mRNA paling langka, dan
kelimpahan mRNA memungkinkan untuk menentukan kit baru-
baru dikembangkan memfasilitasi sampel preparation21,22.
efisiensi translasi untuk setiap mRNA7
(Gambar 1a, b; 2b, c)
Dengan informasi dengan mudah dicapai dan kuantitatif
seperti,.Sifat-sifat biofisik umum dari ribosom dan
Cell jenis bunga
In vivo penangkapan menerjemahkan ribosom dan mRNA, lisisnya
sebuah profil Ribosom
b mRNA-seq c
AAAAAAAAAA
aaaaaaaaa
Low density jejak kaki sebelum memulai kodon dan setelah kodon stop (tinggi dalam ke luar / rasio)
AAAAAAAAAA
Ribosom jejak kaki
Agustus Berhenti
Gambar 1 | Gambaran profil ribosom. a | MRNA ribosom terikat terisolasi oleh ukuran dan diperlakukan dengan nuklease
nonspesifik (biasanya RNase I atau nuklease micrococcal), menghasilkan fragmen mRNA yang dilindungi disebut 'jejak
kaki'. Jejak kaki ribosom terisolasi dan dikonversi ke perpustakaan untuk sequencing mendalam. Jejak kaki ribosom
biasanya menunjukkan posisi yang tepat antara awal dan kodon stop dari gen, yang memfasilitasi identifikasi global dan
eksperimental dari daerah coding genom. b | Sebagai perbandingan, mRNA sequencing (mRNA-seq) menangkap fragmen
acak meliputi seluruh transkrip mRNA. Informasi posisi ditentukan oleh standar mRNA-seq
AAAAAAAAAA
Tinggi% dari ORF ditutupi oleh ribosom jejak kaki
AAAAAAAAAAA
aaaaaaaaa
AAAAAAAAAAA
e
sdaer
AAAAAAAAAA
mosobi R
tnirptoof
aaaaaaaaaaaa
aaaaaaaaaaaa
posisiGenomic
Mulai Berhenti
pengobatanNuclease
fragmentasi Acak
aaaaaaaa A
Kodon periodisitas AAAA AAA AAAAAAAAAA
Perpustakaan generasi
generasi Perpustakaan
Jauh sequencing s
sda
Jauh sequencing
AAGCTGCTTACGACCTGCATGCAG
em
daertn
Baca pemetaan
erqes
Baca pemetaan
osobi R
irptoof
5 'pemimpin 3' UTR - ANR m Coding wilayah
posisi Genomic
posisi Genomic
5 'transkrip akhir
3' transkrip akhir (sering menunjukkan
(sering menunjukkan transkripsi awal situs)
transkripsi berhenti situs)
memungkinkan tepat perkiraan dari itu penentuan dikumpulkan oleh Nature ribosom dari Ulasan transkrip profil, batas-
batas, | Molekul karena Cell namun kerugian Biologi itu kurang 5'dan 3'berakhir selama metode generasi fragmen yang
biasanya digunakan. c | Diterjemahkan rangka baca terbuka (ORFs) mengandung organisasi stereotip jejak kaki ribosom.
Density jejak ribosom lebih ORFs dimulai tajam pada awal kodon, berakhir tajam pada kodon stop dan menunjukkan bukti
kodon periodisitas. Daerah diterjemahkan benar cenderung menunjukkan cakupan jejak ribosom selama sebagian besar ORF
dan tidak biasanya di daerah sebelum kodon start diduga dan setelah kodon stop diduga. UTR, diterjemahkan wilayah.
ULASAN
kolam
Contoh mRNA
AAAAAAAAAAA
aaaaaaaaaaaa
AAAAAAAAAA
AAAAAAAAAA aaaaaaaaa
aaaaaaaaaaaa aaaaaaaaaaaa
Terjemahan
uORF sORF berhenti Genome Browser petak
Ribosom jejak berbunyi
penjelasan b Gene
mRNA-seq membaca
c
Transkrip kelimpahan
Protein sintesis tingkat
efisiensiTranslation (steady state)
(sesaat)
(relatif)
stnuoc AN m R
stnuoctnirptoofemosob i R
T Gambar 2 | Data kualitatif dan kuantitatif
yang disediakan oleh profil ribosom. a | Sampel kolam renang beragam mRNA, dibedakan oleh warna, ditampilkan,
bersama-sama dengan perwakilan rencana genom browser yang sesuai dari ribosom profil data yang berasal dari kolam ini.
Perhatikan bahwa profil ribosom memfasilitasi penentuan eksperimental daerah diterjemahkan, termasuk frame pendek
terbuka membaca (sORFs), yang mungkin menjadi sumber baru diidentifikasi penting peptida seluler, dan ORFs hulu
(uORFs), yang dianggap sebagian besar peraturan. Berhenti selama terjemahan elongasi dapat mengakibatkan puncak di
tapak ribosom membaca dalam ORFs. b | Penjelasan gen overlay dan mRNA sequencing (mRNA-seq) data untuk contoh di
bagian yang akan ditampilkan. c | Grafik menunjukkan contoh data kuantitatif yang berasal dari bagian a dan b. Perhatikan
bahwa kelimpahan transkrip mungkin tidak berkorelasi erat dengan tingkat sintesis protein seketika. Pengumpulan data
kuantitatif untuk kedua kelimpahan transkrip dan tingkat sintesis protein memungkinkan efisiensi terjemahan relatif
disimpulkan. Ini dapat bervariasi dari beberapa kali lipat dalam organisme tertentu dalam keadaan tertentu. Efisiensi
terjemahan juga dapat berubah seiring waktu untuk mRNA diberikan, mencerminkan regulasi yang dinamis di tingkat
terjemahan.
© 2015 Macmillan Publishers Limited. Semua hakdilindungi
stnirptoofemosobi R
ANR m
ORFs
ORFs
UlasanORFs Nature | Molecular Cell Biology
kurangnya manipulasi genetik yang diperlukan untuk ini
tikus, tikus, tanaman, virus dan cells7,10-12,19,23-30 manusia.
Pendekatan membuat profil ribosom yang sangat mudah beradaptasi dengan
Bahkan mitokondria terjemahan dalam sel manusia memiliki sel-
sel atau jaringan dari dasarnya setiap organisme, dengan mod-
telah efektif diuji oleh method31 ini, dan modifikasi est serupa.
Organisme yang telah diteliti
pendekatan telah diterapkan untuk kloroplas di cells32 tanaman.
sejauh oleh profiling ribosom meliputi berbagai bacte-
Banyak dari set data telah disusun dan dibuat ria, ragi, protozoa
parasit, ikan zebra, lalat, nematoda,
mudah diakses untuk data mining dan comparison33.
r
a
n
s
l
a
t
i
o
AAAAAAAAAAA
n
e
f
fi
c
i
e
n
c
y
ULASAN
Apa kekuatan dari profil ribosom?
sintesis dan tingkat transkrip kondisi mapan, menyediakan
Meskipun perkembangan baru-baru ini, ribosom profil
kesempatan untuk mengukur in vivo efisiensi terjemahan telah
dengan cepat menjadi alat yang banyak digunakan untuk mengerti-
secara rinci
(Gambar.
2c).ing beragam dan kompleks masalah biologis.
Tiga fitur utama, yang diuraikan di bawah ini, telah memfasilitasi
Apa keterbatasan metode? utilitas luas metode ini.
Kita bahas di bawah kelemahan penting dan peringatan dari profiling ribosom yang harus dipertimbangkan ketika
Sensitivitas dan ketepatan kuantifikasi. Ribosom
menggunakan metode atau menafsirkan data yang berasal dari
profiling menyediakan rentang dinamis yang besar untuk detec-
penggunaannya. tion dan kuantifikasi terjemahan dalam sel
gentar. Sensitivitas dari metode ini, yang dihasilkan dari
eksperimental diperkenalkan distorsi. Kunci techni- kedalaman
sampling yang mungkin dalam sequencing
cal tantangan profil ribosom adalah kebutuhan untuk cepat
penelitian, memfasilitasi pengukuran bahkan relatif
menghambat terjemahan untuk menangkap snapshot dari ribosom
dalam acara terjemahan langka, dengan kisaran deteksi
sebuah kondisi fisiologis tertentu. Keandalan langkah ini
umumnya hanya dibatasi oleh variabilitas penghitungan yang
sangat penting untuk setiap analisis terjemahan terlihat dengan
jumlah yang sangat rendah sequencing berbunyi.
menjeda, sebagai tingkat yang cepat terjemahan elongasi dapat
saling melengkapi metode, termasukberbasis label berdenyut
hasildalam sinyal kabur atau akumulasi spektrometri massa
buatan, analisis distribusi transkrip
ribosom pada posisi tertentu jika penghambatan lambat. pada
gradien polysome dan 35S Met berbasis metabolisme label-
Penggunaan inhibitor terjemahan elongasi (seperti ling,
memungkinkan pengukuran sensitifprotein baru
cycloheximidesyn)dapat berharga; Namun, jelas tesis bahwa;
Namun, yang sangat paralel sequencing pembacaan
inhibitor tersebut dapat mengubah distribusi lokal ribo- dari
semua posisi ribosom yang disediakan oleh ribosom
somes pada mRNA, terutama di dekat terjemahan mulai profiling
biasanya menghasilkanlebih kuantitatif dan
sites7,18,21,41rinci.Meskipun ini tampaknya tidak mengganggu
informasi dari saat ini dapat diakses oleh alternatif
pengukuran global kepadatan ribosom pada metode.
mRNA yang digunakan untuk menentukan tingkat sintesis protein, dapat menyebabkan puncak palsu dari ribosom bind-
Presisi informasi posisional. Selainnya
ingdi situs tertentu. Sejauh ini, flash beku telah dynamic range
luas deteksi, ribosom profil
pendekatan yang paling kuat di berbagai beragam
menyediakanINFORMATION unik yang kaya dan tepat posisi
organismedan telah memungkinkan fisiologis capture tion. Sifat-
sifat biofisik hampir universal ribo-
dari distributions21 ribosom lokal dan global. Secara umum,
somes seluruh spesies menghasilkan ukuran jejak karakteristik
setiap langkah eksperimental - dari pemanenan sel ke nucle- yang
memungkinkan prediksi kodon dalam
r ibosome situs P
ase pencernaan ke generasi perpustakaan - memiliki potensi
(yaitu, posisi peptida pembentukan ikatan) dan
menyebabkan distorsi dalam output data. Ini distor- deteksi kodon
periodicity7
(FIG.
1c).Analisisribo-
tionsharus diperhitungkan dengan hati-hati, karena sejauh
beberapa posisi tapak dapat digunakan untuk mekanis
yang setiap distorsi yang diberikan mungkin bermasalah akan
menyelidiki aspek penerjemahan, sejauh mengidentifikasi banyak
sangat bergantung pada pertanyaan yang ditangani dan contoh
Novel dari frameshifting ribosom, menghentikan
kodonsyste m sedang diselidiki. readthrough, menjeda ribosom,
inisiasi penerjemahan di Polysome gradien
kodon non-Agustus dan uORF translation7,10,12,34-37
(FIG.
2a).
Kebutuhan untuk menyimpulkan
tingkat sintesis protein. Sebuah peringatan untuk con- Sebuah metode untuk ribosom fraksionasi yang terikat untuk mRNA
oleh kecepatan sentrifugasi ekstrak sel pada
Selanjutnya, tahun setelah bertahun-genom awalnya
Sider ketika menafsirkan ribosom profil data yang dijelaskan,
yang tepat posisiinformasi yang diperoleh
tingkatdari sintesis biasanya disimpulkan dari aver- dari ribosom
profil percobaan telah memberikan
usiakepadatan ribosom sepanjang mRNA yang bersangkutan.
Gradiensukrosa, memungkinkan untuk
kesempatan pertama untuk eksperimental menentukanditerjemahkan
akurasidari ukuran ini tergantung pada
premis bahwa pemisahan mRNA yang
ORFs11-13,38,39
(Gambar. 1,2)
semua ribosom menyelesaikan
terjemahan dan bahwa rata-rata, yang berhubungan dengan satu ribosom (monosome) dari orang-orang yang diterjemahkan
oleh beberapa ribosom (polysome).
Tingkat perpanjangan terjemahan serupa di antara mRNA yang berbeda dalam sel. Asumsi ini dapat diuji dan sesuai untuk
berbagai kondisi, tetapi ini akan sukrosa fraksinasi gradien
tidak selalu menjadi kasus. Dikenal
exceptions42-44 - termasuk memfasilitasi analisis kualitatif status terjemahan sel.
build-up dari ribosom di dan segera proksimal kodon start di sebagian cycloheximide tergantung
situsRibosom PSitus dalam sebuahaktif
menjeda terjemahanmanner7 atau diatur dan aborsi di bawah kelaparan conditions45 - dapat diperbaiki untuk
menerjemahkan ribosom yang
meningkat pengukuran akurasi, tapi
mungkin ada kasus biasanya berhubungan dengan tRNA melekat pada rantai peptida berkembang.
di mana ini dan lainnya, saat ini tidak diketahui, pengecualian menimbulkan tantangan untuk analisis data yang tepat.
Kodon periodisitas
Pencemaran fragmen jejak berukuran.
Lain Pola tiga nukleotida hunian ribosom, mencerminkan mRNA translokasi di ribosom oleh kodon
sebagai,sehingga identifikasi kelas baru coding daerah dalam organisme beragam.
Pengukuran seketika. Sebuah properti yang berharga akhir dari profil ribosom adalah sifat sesaat dari informasi yang
dikumpulkan, yang mencerminkan snapshot dari proses dinamis penerjemahan. Meskipun mRNA-seq dan standar
spektrometri massa genom skala KASIH pengalaman- berharga dalam mengikuti ekspresi gen global, pengukuran ini banyak
digunakan melaporkan tingkat mapan mRNA dan protein, masing-masing. Tion INFORMATION ini penting, tetapi
mungkin tidak mencerminkan pengambilan keputusan seluler yang cepat yang menyertai tions transi- perkembangan dan
tanggapan lingkungan. Profiling ribosom memungkinkan deteksi sensitif dari perubahan protein seluler
masalah penting bagi ribosom profil ekspresi percobaan karena
mereka occur7,12,40. Umum, kuantitatif
adalah bahwa jejak kaki yang disimpulkan berdasarkan output
ukuran dari profiling ribosom dan mRNA-seq lebih lanjut
dan hubungan mereka dengan berkumpul (80S) ribosom.
terjemahan terjadi.
memungkinkan untuk perbandingan langsung dari proteinseketika,
Pencemaran fragmen RNA termasuk dari
654 | November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio
© 2015 Macmillan Publishers Limited. Semuahak dilindungi
ULASAN
terstruktur non-coding RNA atau ribonucleopro- besar
belum dapat diterapkan untuk sel tunggal. Keterbatasan ini
kompleks Tein yang co-bermigrasi dalamgradien sukrosa
hasildari langkah pemrosesan tambahan yang diperlukan dengan
ribosom, dapat diproses dengan ribosom
untuk mengisolasi ribosomes21, serta sebagian kecil profil
perpustakaan dan memberikan pembacaan palsu trans -
setiap diberikan molekul mRNA yang sedang diterjemahkan di
lation apapun (lihat informasi Tambahan S1 (gambar)).
diberikan instan dan dengan demikian dapat diperoleh kembali sebagai jejak kaki
(Gambar.
1a).Pendek
atan baru-baru ini, disebut fragmen panjang organisasi
Sangat mungkin bahwa jenis kemajuan teknis yang memiliki nilai
kesamaan (floss) analisis, bertujuan untuk mengidentifikasi seperti
sangat meningkatkan sensitivitas RNA-seq pendekatan fragmen
dan menghapus mereka pasca-eksperimental (yang
kecil jumlah sel juga akan berlaku di masa depan adalah, dalam
silic o) 39. Analisis FLOSS didasarkan pada pengamatan
ke profil ribosom, meskipun ada upaya besar seperti memiliki
yang bonafide ribosom jejak kaki memiliki stereo khas
belum dilakukan. distribusi ukuran tapak (lihat informasi
Tambahan S1 (gambar, bagian a dan b)).distribusi yang
Wawasandisediakan oleh profiling ribosom ukuran tapak khas
80S digunakan dalam analisis floss adalah
Dengan keunggulan ini dan kerugian dalam pikiran, secara
empiris diukur untuk setiap percobaan, olehexam-
aplikasidari profiling ribosom untuk biologi- tertentu ining ukuran
jejak kaki di bahwa samapercobaan
pertanyaancal telah mengkonfirmasi banyak dari apa yang kita
ketahui dari daerah penyandi protein yang diketahui, dan dapat digunakan untuk
sekitar mekanisme terjemahan dari dekade elegan komputasi
mengidentifikasi mencemari fragmen untuk
struktural, biokimia dan genetik studies50. Penghapusan ribosom.
Meskipun demikian, ada contoh di managenu-
profilingjuga telah memungkinkan untuk memonitor bahasa dari
ine 80S mRNA jejak kaki tidak sesuai dengankhas
tiondengan kedalaman belum pernah terjadi sebelumnya dan
presisi, memberikan pola ukuran. Dua kasus terbaru yang menyoroti menarik
yang penting - dan sekaligus mengejutkan - wawasan. Biologi
yang ditentukan oleh analisis alternatif
penerapan metode ini untuk banyak organisme dan jejak kaki
ribosom berukuran menunjukkan efek yangkarena
menyatakan selulertelah memperjelas aspek-aspek fundamental
untuk kedua conformations46 ribosom alternatif danalter-
biologi selyang sebelumnya menantang untuk menyelidiki mRNA
asli properties41 (lihat di bawah). Nuklease proteksi
eksperimental, menyediakan pengukuran untuk berapa banyak tes
tion bisa menjadi kontrol tambahan yang berguna untuk mengidentifikasi
setiap protein disintesis, bagaimana terjemahan Ikutan berbagai
ukuran tapak ribosom dalam-organ baru
lated, di mana sintesis dimulai dan berhenti dan apa yang menjadi
isme atau kondisi, sehingga menginformasikan desain sebuah ribo-
disintesis. beberapa profil percobaan untuk terbaik capture semua
ribosom menerjemahkan dalam sistem tertentu.
Berapa banyak? Pandangan kuantitatif sintesis protein. The
Ribosomal RNA (rRNA) fragmen umumnya menghasilkan
sederhana dan aplikasi luas dari profiling ribosom dari langkah
nuklease-pengobatan profil ribosom
adalah sebagai alat proteomik kuantitatif untuk memantau dan
secara substansial dapat menurunkan jejak ribosom
protein sedang disintesis, dan pada tingkat , sehingga ruang
sequencing di ribosom profil experiment7,
memberikan wawasan molekul yang kaya menjadi negara sel
tertentu. khususnya dalam kondisi di mana terjemahan global
kepadatan jejak Ribosom mencerminkan jumlah tingkat ribo-
rendah. Sedangkan mRNA-seq sering menggunakan poly (A)
somes pada posisi tertentu. Dengan asumsi bahwa rata-rata pilihan
sebagai metode yang efektif untuk isolasi
tingkat perpanjangan terjemahan ini serupa untuk gen yang
berbeda, urutan yang diinginkan, pendekatan ini tidak mungkin dengan
profil ribosom menyediakan langsung, global dan quantita-
ribosom profiling. Pengurangan selektifribosom
pengukuran tivedari tingkat sintesis protein, sehingga fragmen,
bagaimanapun, adalah sangat efektif dan ini merekomendasikan
informasi menangkap yang sebagian besar telah terlihat
diperbaiki, terutama untuk sampel yang kecilNUM
pengukuran ekspresi gendari tingkat mRNA saja . ber dari jejak
berukuran rRNA fragmen tertentu terlihat
massa spektrometri bisa, pada prinsipnya, digunakan untuk
measur e sebagai contaminants21.
tingkat sintesis protein; Namun, ini secara teknis sulit, karena biasanya membutuhkan pelabelan metabolik dan Pemetaan
ambigu membaca. Tantangan umum dalam
beberapa pengukuran per sampel. Analisis analisis data
sequencing adalah menentukanyang benar
posisidari mRNA di gradien polysome memberikan posisi
alignment untuk membaca dariberulang atau sangat
informasi pelengkapberharga untuk yang daerah yang sama
diperoleh, seperti keluarga gen, atau dari alternatif
dengan profiling ribosom, tapi sekali
lagi, metode ini adalah labo- Fragmenpanjang
variantranskrip. Dalam kasus sekuensing genom atau
rious dan biasanya hanya
menghasilkan ukuran kualitatif dari nilai organisasi kesamaan (floss) analisis Sebuah metrik untuk menentukan probabilitas
bahwa ribosom jejak kaki di atas diberikan wilayah
mRNA-seq, lagi membaca atau dipasangkan-end47 pendekatan dapat
sintesis protein . membantu untuk menyelesaikan ambiguitas
tersebut, tetapi inheren pendek
Dalam banyak kasus, kemampuan untuk mengamati ukuran
protein baru syn-jejak kaki ribosom menghalangi inieksperimen
tesissecara global dan kuantitatif memberikan wawasan yang
mendekati. Namun, metode komputasi yang memiliki
tidak jelas dari pengukuran mRNA
abun- (atau set daerah) hasil dari
dikembangkan untuk data mRNA-seq untuk menetapkanmultiply.
tari Operon bakteri memberikan
contoh nyata tentang terjemahan. Analisis ini melibatkan membandingkan distribusi ukuran jejak kaki di atas wilayah query
dan lebih
pemetaan membaca secara probabilistik atas dasar
nilai bisa langsung mengukur tingkat protein keseluruhan
membaca distributions48 dapat diterapkan untukribosom.
sintesis Seperti halnya bagi banyak protein kompleks di profil
data yang untuk mengurangi keterbatasan ini.
bakteri, delapan subunit yang berbeda dari F
o
daerah coding divalidasi dan didasarkan pada konsep bahwa sifat biofisik menerjemahkan ribosom menghasilkan tanda
tangan karakteristik dalam
jumlah Material. Saat ini, keterbatasan utama profiling ribosom dibandingkan dengan pendekatan mRNA-seq adalah
persyaratan untukyang relatif besar
ukuran ribosom jejaksam-.
prinsip keuangan. Berbeda dengan mRNA-seq49, ribosom profil
-ATP syn thase dinyatakan dari mRNA polisistronik tunggal, dan dengan
demikian pengukuran tingkat mRNA akan menyarankan bahwa subunit semua diekspresikan pada tingkat yang sangat mirip.
Profil ribosom, bagaimanapun, menunjukkan bahwa ORFs individu yang mengkodekan subunit F
o
F
1
F
1
-ATP synthase
ULASAN
sebuah E. coli F
o
F
1
-ATP operon synthase
b D. rerio pengembangan zigotik
BEFHAGDC
Nanog (peringkat 25, TF rank 1)
information12. Dalam data ini, gen yang bertanggung jawab untuk kompleks, dilestarikan dan meiosis spesifik proses
rekombinasi homolog dan perakitan kompleks synaptonemal muncul sebagai satu cluster dari 46 gen.
mRNA-seq membaca
10
tnirptoofemos
3)FPH 2 (ecnadn
Sox19b Pou5f1 (rank (peringkat 185, 101, TF TF peringkat peringkat 3) 2)
Pengamatan ini mengejutkan, karena ini cesses pro dikenal diatur secara ekstensif di pos- tingkat translasi, dan juga karena
cluster termasuk obi R
uba
hampir setiap gen yang telah ditemukan melalui dekade
jejak Ribosom membaca
21
skrining genetik dan sitologi intensif terfokus
5.000 10.000 Ibu mRNA oleh peringkat
pada proses ini. cluster ini juga termasuk beberapa gen uncharacterized , dua di antaranya (GMC1 dan GMC2) yang
kemudian terbukti memiliki peran dalam rekombinasi
104
E
Ibu terjemahan
dan formation12,53 kompleks synaptonemal.
contoh terbaru lain yang mencolok dari jenis analisis ini digunakan ribosom profil untuk mengidentifikasi faktor-faktor)
noi
D. rerio hanya (2 hpf;
embrio
Nanog
tahap 64-sel) Sox19b
yang bertanggung jawab untuk inisiasi zigotik mengembangkan-
etarsis
tarenegr
Program mental yangdi zebrafish54
(. Gambar
3b).Inisiasi
Pou5f1
zigotik transkripsi S
(4 hpf; tahap lingkup)
Terutama zigotik terjemahan
2 6 Stoikiometri protein di kompleks
pembangunan zigotik pada vertebrata sangat bergantung
ehtny
epsel
B
C
G
H
A
pada kontrol translasi, sebagai mRNA ibu memberikan kolam mulai dari bahan untuk penerjemahan. Zigotik
ucelom
(F
D
aktivasi kemudian mengharuskan penghancuran ini mRNA nal mater- dan transfer kontrol perkembangan untuk zigot itu
sendiri Untuk menentukan faktor-faktor yang medi- makan gelombang pertama transkripsi zigotik, ribosomhpf.;
0
0 4 8 10
(6 tahap perisai)
.profiling Data dianalisis untuk sampel yang dikumpulkan sebelum aktivasi zigotik studi ini mengidentifikasi Nanog,
Sox19b dan Pou5f1 sebagai tiga transkripsi faktor Gambar 3 | profiling Ribosom memfasilitasi penemuan proteomik
kuantitatif dalam beragam
yang paling banyak diterjemahkan,
dari sistem kolam besar . a | sel bakteri menerjemahkan komponen dari kompleks protein multi-anggota di
mRNA ibu pada tahap ini
(Ga
mbar 3b.) rasio yang sebanding dengan stoikiometri mereka di kompleks ini sebuah contoh penting adalah F|.
o
656 November 2015 | VOLUME 16 www.nature.com/reviews/molcellbio
© 2015 Macmillan Publishers Limited. Semua hak
dilindungi.Setelah
dari satu F
1
-ATP operon. synthase, mRNA yang abundanc e is composed for each of eight gene different is thus similar, proteins but (A
ribosome
to H), translated
profiling reveals intricate translational control. b | Zebrafish zygotic development requires the initiation of zygotic
transcription 2 hours post-fertilization (hpf), although the specific transcription factors responsible for this transcription have
been unclear. Ribosome profiling of embryos at 2 hpf showed that the three most highly translated transcription factors (TFs)
from maternal mRNAs were Nanog, Sox19b and Pou5f1, and subsequent experiments confirmed that these three proteins
drive zygotic activation.
morpholino knockdown experiments showed that specifically blocking translation of these three factors resulted in a
shutdown of the first wave of zygotic transcription and development, indicating that they are the key factors responsible for
the initiation of the zygotic developmenta l programme54.
Other recent studies in disparate systems — from the Drosophila melanogaster oocyte-to-embryo transi- D. rerio, Danio
rerio; E. coli, Escherichia coli; mRNA-seq, mRNA sequencing. Part a is
tion55 to the Trypanosome life
cycle56 to the mamma- modified with permission from REF. 51, Elsevier. Part b is modified from REF. 54, Nature
lian cell cycle57 to plants under
hypoxic conditions27 Publishing Group.
— have used ribosome profiling to identify specific proteins that drive these complex processes. Cases in which ribosome
profiling data provide markedly dif- operon are translated at a ratio of 1:1:1:1:2:3:3:10.
ferent information than can be obtained by traditional
Remarkably, these ratios precisely reflect the stoichiome-
mRNA abundance measurements for gene expression try of these
components in the ATP synthase51,52
(FIG. 3a)
.
tend to fall into two categories: systems in which tran- This
property of proportional synthesis, by which sub-
scriptional regulation is minimal26,54,55; and dynamic units of
multiprotein complexes are synthesized at rates
cellular programmes11,12,27,35,57–59. The latter category that
are proportional to their stoichiometry in the com-
includes cellular differentiation, organismal develop- plex, turns
out to be generally true for Escherichia coli
ment and dynamic responses to cellular stress, which and was also
observed for some (but not all) complexes
are all cases in which the instantaneous and downstream in
budding yeast (Saccharomyces cerevisiae). Such meas-
gene expression measurements provided by ribosome urements of
instantaneous rates of protein synthesis may
profiling are particularly illuminating for understanding prove to
be a general tool for exploring how proteins
molecular control. assemble and function together51.
Quantitative measurement of protein synthesis rates
How? Insights into the mechanism of translational over multiple
time points of a dynamic process can also
control. The basic mechanism by which the riboso- provide
information about specific gene function. For
mal machinery reads codon information in mRNAs to example,
hierarchical clustering of patterns of new pro-
create proteins is conserved, and many features of this tein
synthesis for each gene over the dynamic process of
process are well understood50. Nonetheless, there are meiosis in
budding yeast resulted in an intricate map of
aspects of translational control that are not amenable gene
expression that provided highly detailed functional
to recapitulation in vitro and for which results from
REVIEWS
Wild-type cell dom34Δ mutant cell
that mapped to 3′ UTRs in the absence of Dom34 were
Ribosome footprint reads
(subset of genes)
ORF
3′ UTR
not restricted to a single reading frame
(FIGS. 1c, 4)
. This observation suggested that these footprints did not represent canonical translating ribosomes but were instead likely
to result from a population of ribosomes that had Stop Stop
failed to be released from mRNAs following translation termination
(FIG. 4) Codon periodicity
Codon periodicity No codon periodicity
AAAA
Translating ribosomes
Nature Reviews | Molecular Cell Biology
NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 16 | NOVEMBER 2015 | 657
© 2015 Macmillan Publishers Limited. All rights reserved
. Together, these data indicate that ribosomes are not always automatically released following stop
codon recognition, and that Dom34 has a role in freeing ribosomes from truncated transcripts and 3′ UTRs41.
Another important application of
ribosome pro- AAGCTGCTTACG AAGCTGCTTACG TATGTATATCCAG
filing has been the analysis of the mechanisms of drugs that target translation. Macrolides, for example, are a class of
clinically important antibiotics that are known to bind in the nascent peptide exit channel of the ribosome. Macrolide
activity has long been thought to cause
Ribosomes that fail to be released from mRNA after translation termination
early translational inhibition by blocking the egress of nascent peptides from the ribosome. However, this view has been
overturned by recent ribosome profiling stud-
Figure 4 | Dom34 facilitates the release of 80S ribosomes from a subset of 3ʹ untranslated regions (UTRs). Ribosome
footprints indicative of assembled 80S ribosomes are seen in a subset of 3′ UTRs in dom34Δ mutant cells. Unlike 80S
ribosome footprints from open reading frames (ORFs), however, these do not show codon
Translating ribosomes
ies63–65, which found that macrolides function primarily by selectively affecting the ability of the ribosome to form
peptide bonds in specific sequence contexts. A key observation was that in bacteria that were treated periodicity and
represent ribosomes that have failed to properly release following
with high doses of erythromycin or of
telithromycin, a translation termination.
next-generation macrolide, not all protein synthesis was inhibited. In fact, telithromycin inhibited the translation of fewer
proteins than erythromycin, despite being a genetic approaches alone may be difficult to interpret,
more effective antibiotic64. owing to complex secondary effects
that result from cel-
The application of ribosome profiling to bacterial lular
adaptation to chronic abnormal protein synthesis.
cells treated with erythromycin or telithromycin also Furthermore,
ribosome profiling facilitates the iden-
showed that, even in cases of inhibited translation for tification of
translation mechanisms that vary across
a given mRNA, the ribosome did not always stop trans-
organisms, cellular state and individual transcripts, as
lating early in the transcript, as predicted by the classical well as
the study of the roles of specific translation fac-
model for macrolide action. Rather, ribosome footprint tors.
Several important examples of discovery in trans-
build-up, which is indicative of ribosome stalling, could lation
mechanism have been highlighted in previous
be seen at various regions in the subset of mRNAs that
reviews22,60,61. Here, we focus on just two recent studies
were inhibited. The precise positional information that in which
ribosome profiling has illuminated important
was obtained from these experiments made it possible aspects of
translation.
to determine that these points of translation interruption Dom34 (a
homologue of eukaryotic release factor 1)
were dependent on specific positively charged sequences has been
shown to help to dissociate stalled ribosomes
([R/K]X[R/K]) that were present in the peptidyl trans- in vitro, but
how and where it acted in vivo was unclear.
fer centre of the ribosome. Macrolide-mediated inhi- Recent work
explored the function of this protein
bition of translation thus was not occurring primarily through
ribosome profiling of wild-type and dom34Δ
through obstruction of the peptide exit channel of the budding
yeast cells. The authors reasoned that if Dom34
ribosome but instead was a result of ineffective peptide was either
dissociating ribosomes on truncated tran-
bond formation for certain amino acid sequences. This scripts or
causing multiple ribosomes to stack up owing
effect could be recapitulated precisely in vitro for some to stalling,
then the relevant footprints might be smaller
mRNAs, but poorly for others, suggesting that additional or
larger, respectively, in the absence of Dom34
(REF. 41)
cellular factors might contribute to macrolide action63. (FIG. 4)
. Indeed, in the case of the HAC1 (homologous
This improved understanding of macrolide mechanism to
Atf/Creb1) transcript, which was previously shown
has direct relevance to the development of newer, more to exist in
a truncated form in the cytosol62, ribosome
effective antibiotics. profiling showed that dom34Δ budding yeast
cells accu- mulated ribosomes with abnormal footprint sizes, indi-
Where? Monitoring localized translation. A hallmark of cating a
defect in ribosome recycling at these sites41.
eukaryotic cells is the presence of intricate subcellular The largest
effect that was revealed by ribosome pro-
structures that facilitate the compartmentalization of dif- filing of
dom34Δ cells — the presence of abundant ribo-
ferent biological processes. Localized protein synthesis some
footprints in 3′ untranslated regions (3′ UTRs) on
has a crucial role in creating these subcellular structures a subset
of mRNAs — was unexpected. In contrast to
by allowing proteins to be produced at their sites of ribosome
footprints in coding regions, the footprints
action and in response to local cellular need (see
REF. 66
REVIEWS
synthesis have been limited to bulk interrogations that
Ribosome
AUG
mRNA
AVI
A
A
A
A
cannot uniquely identify proteins or that require careful biochemical fractionation of the compartment of interest, which
limits both the location and the resolution of analyses. Proximity-specific ribosome profiling now ena- bles in vivo
measurement of localized translation within AVI
Nascent peptide chain
Biotinylation
cells. The basis of proximity-specific ribosome profiling
AAAA
is selective biotinylation of ribosomes in a manner that depends on their subcellular location in intact, unper- turbed cells
(FIG. 5)
. The use of in vivo
labelling allows the Cytosol
recovery of ribosomes from defined locations, including those that cannot be purified by classical cell fractiona- ER lumen
Translocon Localized
tion t echniques. Combining this purification strategy biotin ligase
with ribosome profiling provides a tool for the identification of locally translated transcripts and sub-codon
AVI
monitoring of translation at the site of interest.
So far, proximity-specific ribosome profiling has been
AVI
used to probe two processes, translocation into mito-
AV
I
chondria and into the endoplasmic reticulum (ER), with both studies yielding unexpected results67,68. In the case Whole-
cell ribosome
Streptavidin-pulldown
of mitochondria, the approach provided insight into a
profiling
ribosome profiling
long-standing question: do mitochondrial proteins begin translocation co-translationally, or is the predominant Recruitment
of
route of mitochondrial translocation post-translational?
seneg
ribosome to the ER
Proximity-specific ribosome profiling showed that the
de
t
+
ER gene
majority of mitochondrial inner
membrane proteins — fo
vlo
ne
but not proteins targeted to other
mitochondrial sites rebm
ser -
mhci
Position across ORF
— were co-translationally targeted67. These studies also
uN
–
+
no
re
–
Gene-set enrichment
revealed exquisite specificity in protein trafficking, with do C
n
Cytosolic gene
the vast majority of translocated proteins that were identified being targeted exclusively to either the ER or the
Figure 5 | Proximity-specific ribosome profiling at the endoplasmic reticulum (ER). A ribosome subunit is fused to a biotin-
acceptor (AVI) tag and BirA biotin ligase is fused to a localization element that spatially restricts its activity, for example, to
the ER. Only ribosomes that orient AVI towards the ER surface, as seen during their close association with the ER
membrane during protein translocation, are biotinylated when a
mitochondria. A prominent exception was the fumarate reductase Osm1; follow-up studies showed that dual targeting of
this protein resulted from the translation of alternative isoforms with distinct targeting signals67.
Monitoring of translation on the
ER surface deter- controlled pulse of biotin is applied to cells. Cells are then frozen and ribosomes are
mined several principles that are used
by cells to coordi- collected. Ribosome profiling is carried out on all ribosomes and also specifically on
nate translation and ER targeting68
(FIG
. 5) ribosomes pulled down with streptavidin. The pulldown-enriched mRNA population (light blue) represents genes that
are greatly enriched for translation at the ER. The positional data from these analyses also reveals the point in the message at
which a translating ribosome is recruited to the ER. ORF, open reading frame. Modified from Jan, CH, Williams, CC &
Weissman, JS Principles of ER cotranslational translocation revealed by proximity-specific ribosome profiling. Science 346,
1257521 (2014). Reprinted with permission from AAAS.
658 | NOVEMBER 2015 | VOLUME 16 www.nature.com/reviews/molcellbio
. First, this work showed that co-translational targeting to the ER is pervasive and is principally determined by the location
of the hydrophobic targeting sequence within the protein. The observation that co-translationally targeted mRNAs can be
translated at the translocon immediately after or even before translation of their targeting sequence suggested a crucial role
for polysomes in retaining mRNAs at the ER. In addition, distinct translocon complexes for a review). As translation is an
important amplifica-
engage nascent chains at different points during syn- tion step,
localization of a single mRNA molecule can
thesis. ER-targeted nascent chains typically undergo a allow for
correctly localized synthesis of hundreds of
conformational rearrangement within the translocon protein
molecules. In addition, such local synthesis pre-
that results in a 'looped' conformation of the nascent vents
potentially toxic effects of proteins being present
chains, with their amino termini facing the cytosol. — even if only
during transit time — in an inappropri-
However, proximity-specific ribosome profiling revealed ate
cellular compartment. Finally, localized translation
that a subset of proteins, the targeting of which requires allows for
the regulation of protein synthesis on the basis
the translocon-associated factor secretory 66 (Sec66), of a
proximal stimulus, such as that seen in dendrites in
engage the translocon only after 120 amino acids have response to
neuronal stimulation, which is thought to
been synthesized, which facilitates the direct adoption of
contribute to the learning process66.
the looped conformation. Finally,
monitoring the fate of Translocon The proteinaceous tunnel through which nascent proteins cross the endoplasmic
Despite the broad importance of localized translation,
ER-associated ribosomes following translation termina- few gene
expression analysis tools are available that faith-
tion using pulsed biotinylation experiments showed that fully
preserve spatial information. Until recently, global
any given ribosome can exchange readily between the
reticulum membrane.
approaches for studying subcellular control of protein
ER and the cytosol, as ribosomes labelled on the ER are
REVIEWS
able to access the full pool of cytosolic mRNAs following
However, in diverse organisms and conditions, ribo- at most a
few rounds of translation at the ER68.
some footprints are seen that are organized within ORFs In principle,
proximity-specific ribosome profiling
that were not previously known to encode proteins, in a could be
applied to any subcellular location for which
manner that resembles those in canonical coding regions it is
possible to target biotin ligase activity. It can also be
(as in
FIG. 1c
). This indicates that there is greater coding- combined
with approaches that analyse different poly-
region diversity and flexibility than had previously been some
fractions55,69 or with the translating ribosome affinity
recognized10–13. The translated ORFs that have been capture
(TRAP)70–76 strategy. Together, these techniques
defined by such ribosome footprints fall into two broad could
make it possible to explore regulated localized
categories: translated short ORFs (sORFs) in predicted translation
in specific neuronal subtypes in response to
intergenic regions, often on RNAs that had been pro- learning
programmes.
visionally characterized as non-coding; and translated ORFs encoding alternative isoforms of known proteins. What is being
made? Defining translation events.
Both categories could represent major emergent areas Perhaps the
most surprising emergent area of discov-
of biologica l importance. ery that has been facilitated by
ribosome profiling results from the ability of the method to identify, in a
How pervasive is sORF translation? Algorithms for pre-
systematic manner, the full set of ribosome-translated
dicting protein-coding regions typically rely on assump-
polypeptides in a cell. Algorithm-based analyses of the
tions about translated ORF length. The minimum ORF genomic
sequence of an organism alone can direct iden-
length of 100 codons that is used by most computational tification
of probable coding sequences. Such strategies,
annotation approaches was chosen both to minimize however, are
based on assumptions about what a coding
the number of false positive gene calls and to reflect the region
should look like, including start and stop codon
predicted biophysical folding stability of 100-amino-acid identity,
splice junction cues, conservation and the total
proteins relative to shorter amino acid strings. Recently, codon
length of an ORF. Such approaches for identify-
however, several short peptides have
been shown to be Translating ribosome
ing protein-coding genes could miss functional coding
translated and to have crucial
intracellular and extra- affinity capture
sequences, particularly those that are short and/or spe-
cellular roles in metazoans14,82–84.
Concomitant with (TRAP). A method that allows identification of translated mRNAs on the basis of their in vivo association
with a tagged
cies specific77. These approaches might also miss coding
these findings, ribosome profiling data in several sys- regions that
result from translational frame-shifting or
tems, including mouse embryonic stem cells, meiotic stop codon
read-through. Furthermore, translation and
yeast cells, hypoxic plants and virus-
infected human ribosomal subunit that is
protein synthesis have effects beyond the production
fibroblasts, have identified many
ribosome footprints expressed in a cell type-specific manner. This method is a valuable tool for assaying tissue-specific
translation in animal and plant systems.
of stable proteins with discrete molecular functions.
that fall outside canonical coding regions but that cover
Polypeptide products from all cellular translation must
short and discrete regions between an AUG and a stop be
degraded, and non-canonical translation products
codon10–12,16,27,85. These observations suggest that canoni-
yield unanticipated antigens that may have roles in viral
cal protein-coding sequences may be only a subset of the
detection or in autoimmunity39,78. Finally, the process
sequences that are translated in cells.
Nonsense-mediated decay mRNA degradation, which has traditionally been thought to result from stop codons that
of translation can affect the stability of the template
There are, however, some features of the newly iden- message
by triggering co-translational decay pathways
tified translated sORFs that have led to doubts about including
nonsense-mediated decay79. Thus, knowing
their authenticity. First, some are
present on RNAs that terminate translation more 5'
which transcripts are translated has important implica-
were thought to be non-coding10–
12,82,83,86. In many cases, than is usual on an mRNA.
tions for the fate of the mRNA, the ribosome and the
these sORFs are not well conserved13,87,88. They also
Short ORFs (sORFs). Open reading frames
cell. Ribosome profiling provides a unique opportu-
sometimes seem to be translated in overlapping read- nity to
experimentally address this question in a given
ing frames10–12,87,89, a feature that has been thought to be
of fewer than 100 codons on
biologica l system or cell state of interest.
unusual among typical eukaryotic
genes (although ribo- mRNAs that are not known to
Ribosome profiling data from many organisms have
some profiling data have recently been
used to identify encode a canonical (long) protein. sORFs are a class of ORF that have not traditionally been thought to be
frequently
generally provided experimental evidence for the trans-
such cases among canonical genes, as well90). Finally, lation of
ORFs that had already been computationally
translated sORF products are difficult to detect sys- predicted to
encode proteins. These data have also sug-
tematically using mass spectrometry
approaches. The translated, although ribosome
gested a diverse set of translated areas outside canonical
validation or exclusion of these
regions as examples of profiling and other approaches have recently validated the
coding regions (reviewed in
REFS 60,80
translation of thousands of sORFs in a range of organisms.
biologically relevant translation has been a major recent focus of interest.
Several analytical approaches to ribosome pro filing data allow rigorous testing of the degree to which ribo- ORFs encoding
alternative
some footprints over newly predicted
translated sORFs isoforms of known proteins Open reading frames (ORFs) that differ from another ORF
). These include, in some cases, ribosome footprints that are not clearly organized
within ORFs, most commonly in 5′ leader regions and mammalian long non-coding RNAs. The importance of translation of
these regions remains an open question, although the unusual patterns of ribo-
match those that are seen for traditional protein-codin g some
footprints that are often observed suggest that they
sequences
(TABLE 1)
at the same locus in either the
may not reflect regions that are translated into canonical start codon or the stop codon
peptide products. In some cases, the translation that pro- position but share the same reading
frame. Translation of these ORFs may result in, for example, different subcellular
duces these footprints may mediate translational regulation, as is the case for translation of regulatory uORFs.
Alternatively, some such cases may reflect translation
targeting for a similar protein.
that is used to regulate mRNA stability81.
. These analyses often examine whether ORFs that are predicted to be translated by ribosome profiling
show footprint organization that is consistent with the canonical mechanism for translation, such as sharp footprint-
abundance transitions at known start codons and stop codons, and codon perio- dicity12,13,16,38,85,87,91
(FIG. 1c;TABLE 1)
(discussed in
REF. 80
).
REVIEWS
Table 1 | Novel translated ORFs compared with characterized translated ORFs by diverse metrics
Metric Characterized sequences Novel translated ORFs identified by
ribosome profiling
Refs
Non-coding RNAs (such as snoRNAs, tRNAs, XIST and HOTAIR)
Protein-coding sequences
sORFs uORFs
Association between footprint arrangement and putative start codons*
No general association
Footprint-covered regions usually start precisely at AUG codons, occasionally at near-cognate codons
Footprint-covered regions usually start precisely at AUG codons, occasionally at near-cognate codons
Footprint-covered regions often start precisely at AUG and at near-cognate codons
7,11, 12
Association between footprint arrangement and putative stop codons*
No general association
Footprint-covered regions stop precisely at canonical stop codons
7
Footprint abundance relative to mRNA abundance
Very low (especially for properly sized footprints)
Low to high, depending on translation efficiency
7,10, 13,38
Codon periodicity of footprints*
No Yes Yes Often unclear owing to
generally short length
7,13, 41,90
Signatures of protein-coding conservation
No Often Sometimes, difficult
to assess for very short regions
Unclear, primarily owing to short length
13,38, 77,80, 98
Identification of protein product by mass spectrometry
No Often Sometimes (dependent
on length and peptide properties)
Sometimes (dependent on length and peptide properties)
11, 92–97
Stable physical association of transcript with ribosomes
Not generally, but may occur in specific cases (for example, tRNAs)
Yes Yes Yes 17,39
Sensitivity of footprints to translation inhibitors
No Yes Yes Yes 39
FLOSS (fragment length organization similarity score)*
High Low Low Low 39
% putative ORF covered by footprints*
Low High High Difficult to assess owing
to frequent uORF overlap
38
Inside/out ratio (local enrichment of footprints within putative ORF)*
Low High High, difficult to as sess when translated sORFs overlap
Difficult to assess owing to frequent uORF overlap
38
Ratio of footprints at putative start codons to footprints at immediately prior codons*
Low High High High 12
RRS (ribosome release score)
Poor Good Sometimes high, but
particularly poor in cases of translated sORF overlap
Frequent overlap in uORF translation leads to poor scores, difficult to assess
87
Cellular function determined by genetic or molecular analyses
Sometimes Sometimes Rarely, thus far, but
important examples exist
Not assayed in many cases, but a subset are regulatory for translation of other ORFs
14, 82–84
Summary
Likelihood on the basis of the above metrics that regions encode functional proteins or peptides
Low High High for a subset, but
unclear how generally functional the peptide products are. Likely to be a heterogeneous population with diverse roles.
Unclear; uORF regions predicted to be translated by ribosome profiling probably represent true translation, but resultant
peptides may not be stable.
HOTAIR, HOX transcript antisense RNA; ORF, open reading frame; snoRNA, small nucleolar RNA; sORF, short ORF;
uORF, upstream ORF; XIST, X inactive specific transcript. *See the glossary terms, FIG. 1c, FIG. 2 and Supplementary
information S1 (figure) for class definitions and examples.
REVIEWS
Most of these approaches provide support for the pre-
and that their products are processed and presented on dicted
widespread translation of short and alternative
MHC molecules as functional antigens in humans, thus ORFs11–
13,15,16,38,67,85,91
(TABLE 1)
. Nevertheless, even with
expanding the range of epitopes displayed during viral ribosome
profiling data, reliably identifying the full set of
infections. The condition-specific translation of many translated
ORFs remains a challenge, especially in cases
sORFs suggests that they could similarly be used to dis- in which
protein-coding sequences overlap.
tinguish cancer cells from normal cells, with important Numerous
complementary experimental approaches
implications for immunomodulatory therapies. have aimed to
further probe the degree to which newly
The translation of some sORFs could also help to predicted
protein-coding sequences represent true
fuel the evolution of new proteins88. It is possible that cellular
translation
(TABLE 1)
. So far, these approaches
transcriptional noise, together with the propensity of the generally
confirm that the reads that are detected in
ribosome to translate capped cytosolic RNAs, may allow regions
predicted to be translated by ribosome profil-
novel transcripts to engage the ribosome and allow trans- ing
experiments represent translating 80S ribosomes.
lational sampling of new, short motifs. Initially these For
example, ribosome footprints over putative trans-
sORFs may evolve under neutral selection. However, a lated
sORFs tend to respond to translation inhibitors
subset could provide a small fitness advantage, resulting in a
manner comparable to benchmarked translating
in positive selection and possible stabilization through
ribosomes39. Translated mRNA regions predicted from
lengthening over time, until they resemble canonical mouse
ribosome profiling data immunoprecipitate
long protein-coding genes
(FIG. 6c) with tagged 60S ribosomal
subunits in a specific manner, similar to that seen for characterized translated ORFs39. This finding suggests that true
translating ribosomes produce the footprints that are detected by ribosome profiling over ORFs not previously annotated
as being translated, rather than these mRNA fragments being artefacts resulting from the protection of mRNA by scanning
translation initiation complexes or alternative RNA–protein complexes. An important open question is whether these
translated regions produce stable peptides. Suggesting that they may, sORFs identified as being translated by ribosome
profiling that have been carboxy-terminally tagged in yeast and in human cytomegalovirus (HCMV)-infected cells can be
seen to accumulate in a regulated manner that mirrors pre- dictions from ribosome profiling data11,39. Meanwhile,
specialized mass spectrometry approaches continue to identify a subset of peptides resulting from such sORFs in several
systems11,92–97, suggesting that at least some of these sORFs do encode abundant, stable peptides.
Most convincingly, a few sORFs that were predicted to be translated from polysome association and ribosome profiling
data have now been shown to have biological function14,39,83. In D. melanogaster, the peptides encoded by two such
translated sORFs contained in the sarcolamban locus have been shown to directly bind to a calcium transporter in heart cells
and thus regulate normal heart function83
(FIG. 6a)
. Such regions would not necessarily be initially expected to show signatures of protein-
coding conservation
(as in
REF. 98
), and many might not produce a robust mutant phenotype when disrupted,
making their study challenging.
How plastic is translation? Alternative isoforms abound. The results of ribosome profiling in yeast and in mammals have
indicated that many genes may yield two or more protein variants independently of splicing, which indicates that there may
be surprising flexibility in both where translation starts and where it stops in eukaryotes. Such alternative isoforms have been
seen and characterized previously; in budding yeast, for example, both alanyl-tRNA synthetase 1 (ALA1) and glycyl-tRNA
synthase 1 (GRS1) have been shown to exist in two isoforms, providing populations of the protein that are either cytosolic
or mitochondrial, depending on the presence or absence of an N-terminal in-frame extension99,100. These examples are also
detected by ribosome pro filing12 and seem to be just a few of many10,12,67,101, supporting a model in which diverse but
targeted localization might be achieved for many proteins through sometimes small alterations in the site of translation
initiation18,91,101. Conversely, ribosome profiling of several yeast species, and of D. melanogaster embryos and cultured
cells, revealed extensive heterogeneity in translation termination sites15,102,103, resulting from regulated read-through . In
zebrafish, the
of hundreds of genes. As with the N-terminal-extension short
protein Toddler was found to drive gastrulation
isoforms, many of these C-terminal
extensions are pre- Signatures of protein-coding
by functioning as a secreted developmental signal14. In
dicted to confer new subcellular
localizations to the conservation Purifying evolutionary selection results in higher levels of synonymous than
nonsynonymous substitutions,
mammals, a prominent example is the several translated
protei n products15,104. sORFs, predicted on the basis of
ribosome profiling of
Use of ribosome profiling has also facilitated the HCMV-
infected human foreskin fibroblasts, that reside
identification of interesting examples of regulated trun- on the
β2.7 RNA, which has traditionally been defined as
cated protein isoforms10–12,89. In
human cells, a recent specifically among
non-coding11. Peptides resulting from the translation of
study identified a shortened alternative
isoform of mito- homologous coding sequences. The pattern of nonsynonymous to synonymous differences
two of these sORFs have been shown by mass spectrom-
chondrial antiviral signalling protein (MAVS), which is etry to
accumulate during HCMV infection. In addi-
an important player in innate immune signalling89. The tion,
analysis of serum samples from HCMV-positive
alternative MAVS isoform results
from translation ini- among homologous regions
and HCMV-negative blood bank donors showed a
tiation downstream of the canonical
start site to create compared in a phylogenetic group can be used to predict the likelihood that a genomic locus encodes a
translated
robust immune response to the peptides produced
an in-frame truncation, which the authors term 'mini- from several
of these β2.7 sORFs, specifically in the
MAVS'. Whereas full-length MAVS induces interferon HCMV-
positive individuals39
(FIG. 6b)
. This result sug-
production, miniMAVS antagonizes MAVS function by
open reading frame (ORF).
gests that the ribosome-occupied sORFs are translated,
interfering with such production.
REVIEWS
a Regulation of larger protein activity b Antigens
MHC
Cardiac kymograph
Antigen-
class II
presenting
T cell cell – sarcolamban
egatlo V
Peptide from sORF on HCMV β2.7 RNA Ca-P60A SERCA cardiac calcium transporter
c An evolutionary pool for new protein function Time
Translation
sORF
+ sarcolamban
Sarcolamban peptide A or B
Time
Figure 6 | Proposed cellular roles for the peptide products of translated short open reading frames (sORFs) identified by
ribosome profiling. a | The two sarcolamban peptides are 28 and 29 amino acids in length, are conserved from fruit flies to
human and regulate normal heart function in flies through direct binding to the sarcoendoplasmic reticulum Ca2+ ATPase
(SERCA) calcium transporter Ca-P60A in cardiac tissue. b | Sera from human cytomegalovirus (HCMV)-positive blood
donors were used to identify a specific and robust immune response against multiple short peptides translated from the β2.7
RNA, which was previously thought to be a non-coding RNA. c | Spurious translation of short regions may produce a pool
of peptides with weak or no cellular function. New protein domains may evolve through selection for maintenance of
peptides with weak cellular function, followed by stop codon mutation and further selection for increasingly specific and
important cellular function over time. Part a from Magny, EG et al. Conserved regulation of cardiac calcium uptake by
peptides encoded in small open reading frames. Science 341, 1116–1120 (2013). Redrawn with permission from AAAS.
Function of protein
dnanoita
em
sORF
in cell None or minimal, nonspecific
egatl
tum
itrev
Weak, specific o V
nodoc
onoitc
sORF or ORF
Strong, specific
pot S
eles
ORF
Strong, specific
The large and diverse set of unconventional regions of
instantaneous measurement of all translational control in
translation suggested by ribosome profiling shows that
a given system, providing a tool for broad discovery of the there is
considerably more to translational regulation
underlying biology of a cellular process or state of choice. and
cellular content than was previously known. Some
Furthermore, the detailed information that is yielded by of these
regions are likely to be translated into functional
this method provides valuable insight into fundamental proteins,
but it is likely that others will not produce sta-
aspects of how translation works. Despite the conserved ble
protein products that are similar to those from tra-
nature of much of the translation machinery, important ditional
genes. Rather, subsets of these newly identified
open questions about the mechanism of protein syn- regions of
translation may have regulatory, immune
thesis remain, including the basis for most specificity of or
currently neutral cellular roles. Unravelling the set
translation among different mRNAs and the connections of
functions that are carried out by translated genomic
between translation and nascent protein folding. regions poses a
fascinating and daunting challenge.
Finally, owing to the precise genomic positional information provided by ribosome profiling, the pro- Perspective
tein-coding capacity of genomes can now be defined Protein
synthesis consumes a large proportion of cellu-
experimentally. This has led to the identification of a lar resources
and is central to almost every function of a
broad range of non-canonical translation events, includ- cell.
Ribosome profiling allows, for the first time, in vivo
ing the translation of novel sORFs and alternative forms and
global measurement of translation, providing a pre-
of previously annotated proteins, thereby challenging cise and
quantitative account of what cells are translating,
traditional views of protein-coding regions and gene how this
translation is regulated, and when and where
diversity. Analytical advances that facilitate more com- translation
happens. The rich and quantitative nature of
prehensive identification of other non-canonical transla- ribosome
profiling data provide an unprecedented oppor-
tion events, such as those resulting from frame-shifting tunity to
explore and model complex cellular processes.
and stop codon read-through will continue to expand our Although it
has long been known that translational
understanding of the protein-coding capacity of complex
regulation has important roles in development, in cellu-
genomes. The functions of the many novel short and lar responses
to stimuli and in disease, the limited num-
alternatively translated regions that have been identified ber of
well-studied examples of regulation at the level of
so far by ribosome profiling remain an intriguing and protein
synthesis have generally been identified in an
largely open question, the answer to which could funda- ad hoc
manner. When paired with RNA-seq measure-
mentally change the way we think about the encoding of ments of
mRNA levels, ribosome profiling now allows
information in genomes. Newly available CRISPR-based
REVIEWS
methods105 now make it possible to shut down the expression of any transcript106–109 or to introduce nonsense muta-
tions into any ORF. As such, these approaches provide a central tool for efforts to define the functional roles of this broad
array of newly identified translation products.
Specialized alterations to ribosome profiling that will advance its use in complex systems include the analysis of subsets
of ribosomes, either those associated with
specific factors or protein modifications, or those in increasingly specific cell types or subcellular locations. Further
transformative advances are likely to emerge from progressively more sophisticated and creative analysis of the rich data
sets that are generated from ribosome profiling experiments, allowing major surprises to be revealed, even in systems that
were thought to be well characterized.
1. McCann, KL & Baserga, SJ Mysterious
ribosomopathies. Science 341, 849–850 (2013). 2. Cleary, JD & Ranum, LPW Repeat-associated
non-ATG (RAN) translation in neurological disease. Hum. Mol. Genet. 22, R45–R51 (2013). 3. Ellis, SR Nucleolar stress in
Diamond Blackfan
anemia pathophysiology. Biochim. Biophys. Acta 1842, 765–768 (2014). 4. Trainor, PA & Merrill, AE Ribosome biogenesis
in
skeletal development and the pathogenesis of skeletal disorders. Biochim. Biophys. Acta 1842, 769–778 (2014). 5. Bolze, A.
et al. Ribosomal protein SA
haploinsufficiency in humans with isolated congenital asplenia. Science 340, 976–978 (2013). 6. Kondrashov, N. et al.
Ribosome-mediated specificity in
Hox mRNA translation and vertebrate tissue patterning. Cell 145, 383–397 (2011). 7. Ingolia, NT, Ghaemmaghami, S.,
Newman, JRS & Weissman, JS Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome
profiling. Science 324, 218–223 (2009). This work defines the ribosome profiling method and details its specificity,
precision and utility. 8. Wolin, SL & Walter, P. Ribosome pausing and
stacking during translation of a eukaryotic mRNA. EMBO J. 7, 3559–3569 (1988). 9. Steitz, JA Polypeptide chain initiation:
nucleotide
sequences of the three ribosomal binding sites in bacteriophage R17 RNA. Nature 224, 957–964 (1969). 10. Ingolia, NT,
Lareau, LF & Weissman, JS
Ribosome profiling of mouse embryonic stem cells reveals the complexity and dynamics of mammalian proteomes. Cell
147, 789–802 (2011). 11. Stern-Ginossar, N. et al. Decoding human
cytomegalovirus. Science 338, 1088–1093 (2012). 12. Brar, GA et al. High-resolution view of the yeast
meiotic program revealed by ribosome profiling. Science 335, 552–557 (2012). References 11 and 12 describe the
application of ribosome profiling to physiological dynamic cellular processes, the HCMV infection cycle in human
cells and meiosis in budding yeast, respectively. In these disparate systems, both studies identified many new
examples of translational control, uORF translation and the translation of many sORFs and alternative ORFs in
genomic regions that were thought to be non-coding. 13. Bazzini, AA et al. Identification of small ORFs in vertebrates
using ribosome footprinting and evolutionary conservation. EMBO J. 33, 981–993 (2014). 14. Pauli, A. et al. Toddler:
an embryonic signal that
promotes cell movement via Apelin receptors. Science 343, 1248636 (2014). 15. Dunn, JG, Foo, CK, Belletier, NG,
Gavis, ER & Weissman, JS Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila
melanogaster. eLife 2, e01179 (2013). 16. Aspden, JL et al. Extensive translation of small open
reading frames revealed by Poly-Ribo-Seq. eLife 3, e03528 (2014). 17. Smith, JE et al. Translation of small open reading
frames within unannotated RNA transcripts in Saccharomyces cerevisiae. Cell Rep. 7, 1858–1866 (2014). 18. Lee, S. et al.
Global mapping of translation initiation
sites in mammalian cells at single-nucleotide resolution. Proc. Natl Acad. Sci. USA 109, E2424–E2432 (2012). 19. Andreev,
DE et al. Translation of 5′ leaders is pervasive in genes resistant to eIF2 repression. eLife 4, e03971 (2014).
20. Van Dijk, EL, Auger, H., Jaszczyszyn, Y. & Thermes, C. Ten years of next-generation sequencing technology. Trends
Genet. 30, 418–426 (2014). 21. Ingolia, NT, Brar, GA, Rouskin, S., McGeachy, AM
& Weissman, JS The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-
protected mRNA fragments. Nat. Protoc. 7, 1534–1550 (2012). 22. Kuersten, S., Radek, A., Vogel, C. & Penalva, LO
Translation regulation gets its 'omics' moment. Wiley Interdiscip. Rev. RNA 4, 617–630 (2013). 23. Oh, E. et al. Selective
ribosome profiling reveals the
cotranslational chaperone action of trigger factor in vivo. Cell 147, 1295–1308 (2011). 24. Arias, C. et al. KSHV 2.0: a
comprehensive annotation
of the Kaposi's sarcoma-associated herpesvirus genome using next-generation sequencing reveals novel genomic and
functional features. PLoS Pathog. 10, e1003847 (2014). 25. Stadler, M. & Fire, A. Wobble base-pairing slows
in vivo translation elongation in metazoans. RNA 17, 2063–2073 (2011). 26. Bazzini, AA, Lee, MT & Giraldez, AJ
Ribosome
profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish. Science 336, 233–237 (2012).
27. Juntawong, P., Girke, T., Bazin, J. & Bailey-Serres, J.
Translational dynamics revealed by genome-wide profiling of ribosome footprints in Arabidopsis. Proc. Natl Acad. Sci.
USA 111, E203–E212 (2014). 28. Jensen, BC et al. Extensive stage-regulation of
translation revealed by ribosome profiling of Trypanosoma brucei. BMC Genomics 15, 911 (2014). 29. Caro, F., Ahyong,
V., Betegon, M. & DeRisi, JL
Genome-wide regulatory dynamics of translation in the Plasmodium falciparum asexual blood stages. eLife 3, e04106
(2014). 30. Schafer, S. et al. Translational regulation shapes the
molecular landscape of complex disease phenotypes. Nat. Commun. 6, 7200 (2015). 31. Rooijers, K., Loayza-Puch, F.,
Nijtmans, LG &
Agami, R. Ribosome profiling reveals features of normal and disease-associated mitochondrial translation. Nat. Commun. 4,
2886 (2013). 32. Zoschke, R., Watkins, KP & Barkan, A. A rapid
ribosome profiling method elucidates chloroplast ribosome behavior in vivo. Plant Cell 25, 2265–2275 (2013). 33. Michel,
AM et al. GWIPS-viz: development of a ribo-
seq genome browser. Asam Nukleat Res. 42, D859–D864 (2014). 34. Liu, X., Jiang, H., Gu, Z. & Roberts, JW High-
resolution view of bacteriophage lambda gene expression by ribosome profiling. Proc. Natl Acad. Sci. USA 110, 11928–
11933 (2013). 35. Gerashchenko, MV, Lobanov, AV & Gladyshev, VN Genome-wide ribosome profiling reveals complex
translational regulation in response to oxidative stress. Proc. Natl Acad. Sci. USA 109, 17394–17399 (2012). 36. Li, G.-W.,
Oh, E. & Weissman, JS The anti-Shine–
Dalgarno sequence drives translational pausing and codon choice in bacteria. Nature 484, 538–541 (2012). 37.
Woolstenhulme, CJ, Guydosh, NR, Green, R. &
Buskirk, AR High-precision analysis of translational pausing by ribosome profiling in bacteria lacking EFP. Cell Rep. 11,
13–21 (2015). 38. Chew, G.-L. et al. Ribosome profiling reveals
resemblance between long non-coding RNAs and 5′ leaders of coding RNAs. Development 140, 2828–2834 (2013).
39. Ingolia, NT et al. Ribosome profiling reveals
pervasive translation outside of annotated protein- coding genes. Cell Rep. 8, 1365–1379 (2014). 40. Andreev, DE et al.
Oxygen and glucose
deprivation induces widespread alterations in mRNA translation within 20 minutes. Genome Biol. 16, 90 (2015). 41.
Guydosh, NR & Green, R. Dom34 rescues ribosomes
in 3′ untranslated regions. Cell 156, 950–962 (2014). 42. Shalgi, R. et al. Widespread regulation of translation
by elongation pausing in heat shock. Mol. Cell 49, 439–452 (2013). 43. Han, Y. et al. Ribosome profiling reveals sequence-
independent post-initiation pausing as a signature of translation. Sel Res. 24, 842–851 (2014). 44. Liu, B., Han, Y. & Qian,
S.-B. Cotranslational response
to proteotoxic stress by elongation pausing of ribosomes. Mol. Cell 49, 453–463 (2013). 45. Subramaniam, AR, Zid, BM &
O'Shea, EK
An integrated approach reveals regulatory controls on bacterial translation elongation. Cell 159, 1200–1211 (2014).
This work probes position-specific changes in ribosome distribution among various cellular conditions, concluding
that tRNA abundances do not account for elongation rates for most codons, and that pausing of ribosomes during
starvation may result in translation abortion. 46. Lareau, LF, Hite, DH, Hogan, GJ & Brown, PO
Distinct stages of the translation elongation cycle revealed by sequencing ribosome-protected mRNA fragments. eLife
3, e01257 (2014). This work identifies a class of short ribosome footprints that may be enriched by treatment with
translation elongation inhibitors and that are likely to represent a distinct conformation of the ribosome at a specific
stage of the elongation cycle. 47. Siegel, AF, van den Engh, G., Hood, L., Trask, B. &
Roach, JC Modeling the feasibility of whole genome shotgun sequencing using a pairwise end strategy. Genomics 68, 237–
246 (2000). 48. Roberts, A., Schaeffer, L. & Pachter, L. Updating RNA-
Seq analyses after re-annotation. Bioinformatics 29, 1631–1637 (2013). 49. Saliba, A.-E., Westermann, AJ, Gorski, SA &
Vogel, J. Single-cell RNA-seq: advances and future challenges. Asam Nukleat Res. 42, 8845–8860 (2014). 50. Green &, R.
& Noller, HF Ribosomes and translation.
Annu. Rev. Biochem. 66, 679–716 (1997). 51. Li, G.-W., Burkhardt, D., Gross, C. & Weissman, JS Quantifying
absolute protein synthesis rates reveals principles underlying allocation of cellular resources. Cell 157, 624–635 (2014). 52.
Aris, JP, Klionsky, DJ & Simoni, RD
The synthase F
o
subunits are sufficient of the Escherichia to form a functional coli F
1
F
o
-ATP
proton pore. J. Biol. Chem. 260, 11207–11215 (1985). 53. Humphryes, N. et al. The Ecm11–Gmc2 complex
promotes synaptonemal complex formation through assembly of transverse filaments in budding yeast. PLoS Genet. 9,
e1003194 (2013). 54. Lee, MT et al. Nanog, Pou5f1 and SoxB1 activate
zygotic gene expression during the maternal-to-zygotic transition. Nature 503, 360–364 (2013). 55. Kronja, I. et al.
Widespread changes in the
posttranscriptional landscape at the Drosophila oocyte-to-embryo transition. Cell Rep. 7, 1495–1508 (2014). 56. Vasquez, J.-
J., Hon, C.-C., Vanselow, JT, Schlosser, A. & Siegel, TN Comparative ribosome profiling reveals extensive translational
complexity in different Trypanosoma brucei life cycle stages. Asam Nukleat Res. 42, 3623–3637 (2014).
REVIEWS
© 2015 Macmillan Publishers Limited. All rights reserved 57. Stumpf, CR,
Moreno, MV, Olshen, AB,
77. Reinhardt, JA & Jones, CD Two rapidly evolving
96. Menschaert, G. et al. Deep
proteome coverage based Taylor, BS & Ruggero, D. The translational landscape
genes contribute to male fitness in Drosophila.
on ribosome profiling aids
mass spectrometry-based of the mammalian cell cycle. Mol. Cell 52, 574–582
J. Mol. Evol. 77, 246–259 (2013).
protein and peptide
discovery and provides evidence (2013).
78. Starck, SR et al. Leucine-tRNA initiates at CUG start
of alternative translation
products and near-cognate 58. Stadler, M. & Fire, A. Conserved translatome
codons for protein synthesis and presentation by MHC
translation initiation events.
Mol. Cell. Proteomics 12, remodeling in nematode species executing a shared
class I. Science 336, 1719–1723 (2012).
1780–1790 (2013).
developmental transition. PLoS Genet. 9, e1003739
79. Rebbapragada, I. & Lykke-Andersen, J. Execution of
97. Vanderperre, B. et al. Direct
detection of alternative (2013).
nonsense-mediated mRNA decay: what defines a
open reading frames
translation products in human 59. Liu, B. & Qian, S.-B. Translational reprogramming in
substrate? Curr. Opin. Sel Biol. 21, 394–402 (2009).
significantly expands the
proteome. PLoS ONE 8, cellular stress response. Wiley Interdiscip. Rev. RNA 5,
80. Pauli, A., Valen, E. & Schier, AF Identifying (non-)
e70698 (2013). 301–305
(2014).
coding RNAs and small peptides: challenges and
98. Lin, MF, Jungreis, I. &
Kellis, M. PhyloCSF: a 60. Ingolia, NT Ribosome profiling: new views of
opportunities. BioEssays 37, 103–112 (2015).
comparative genomics
method to distinguish protein translation, from single codons to genome scale.
81. Ulitsky, I. & Bartel, DP lincRNAs: genomics,
coding and non-coding
regions. Bioinformatics 27, Nat. Rev. Genet. 15, 205–213 (2014).
evolution, and mechanisms. Cell 154, 26–46
i275–i282 (2011). 61.
Michel, AM & Baranov, PV Ribosome profiling: a
(2013).
99. Huang, H.-Y., Tang, H.-L.,
Chao, H.-Y., Yeh, L.-S. & Hi-Def monitor for protein synthesis at the genome-
82. Kondo, T. et al. Small peptides switch the transcriptional
Wang, C.-C. An unusual
pattern of protein wide scale. Wiley Interdiscip. Rev. RNA 4, 473–490
activity of Shavenbaby during Drosophila
expression and localization
of yeast alanyl-tRNA (2013).
embryogenesis. Science 329, 336–339 (2010).
synthetase isoforms.
Mol. Microbiol. 60, 189–198 62. Cox, JS & Walter, P. A novel mechanism for
This paper identifies key roles in fly development
(2006). regulating activity
of a transcription factor that
for several short peptides (from 11 to 32 amino
100. Chang, K.-J. & Wang, C.-
C. Translation initiation from a controls the unfolded protein response. Cell 87,
acids) translated from sORFs on a transcript that
naturally occurring non-
AUG codon in Saccharomyces 391–404 (1996).
was previously thought to be non-coding.
cerevisiae. J. Biol.
Chem. 279, 13778–13785 63. Kannan, K. et al. The general mode of translation
83. Magny, EG et al. Conserved regulation of cardiac
(2004). inhibition by
macrolide antibiotics. Proc. Natl Acad.
calcium uptake by peptides encoded in small open
101. Wan, J. & Qian, S.-B.
TISdb: a database for alternative Sci. USA 111, 15958–15963 (2014).
reading frames. Science 341, 1116–1120 (2013).
translation initiation in
mammalian cells. Nucleic Acids 64. Kannan, K., Vázquez-Laslop, N. & Mankin, AS
84. Anderson, DM et al. A micropeptide encoded by a
Res. 42, D845–D850
(2014). Selective protein synthesis by ribosomes with a
putative long noncoding RNA regulates muscle
This work presents a
database of alternative drug-obstructed exit tunnel. Cell 151, 508–520 (2012).
performance. Cell 160, 595–606 (2015).
translation initiation
sites that have been identified 65. Davis, AR, Gohara, DW & Yap, M.-NF Sequence
85. Ruiz-Orera, J., Messeguer, X., Subirana, JA &
by ribosome profiling in
mammalian cells. selectivity of macrolide-induced translational
Alba, MM Long non-coding RNAs as a source of
102. Artieri, CG & Fraser, HB
Evolution at two levels of attenuation. Proc. Natl Acad. Sci. USA 111,
new peptides. eLife 3, e03523 (2014).
gene expression in yeast.
Genome Res. 24, 411–421 15379–15384 (2014).
86. Xu, Y. & Ganem, D. Making sense of antisense:
(2014). 66. Jung, H.,
Gkogkas, CG, Sonenberg, N. & Holt, CE
seemingly noncoding RNAs antisense to the master
103. Jungreis, I. et al. Evidence
of abundant stop codon Remote control of gene function by local translation.
regulator of Kaposi's sarcoma-associated herpesvirus
readthrough in Drosophila
and other metazoa. Cell 157, 26–40 (2014).
lytic replication do not regulate that transcript but
Genome Res. 21, 2096–
2113 (2011). 67. Williams, CC, Jan, CH & Weissman, JS
serve as mRNAs encoding small peptides. J. Virol. 84,
104. Schueren, F. et al.
Peroxisomal lactate dehydrogenase Targeting and plasticity of mitochondrial proteins
5465–5475 (2010).
is generated by translational
readthrough in revealed by proximity-specific ribosome profiling.
87. Guttman, M., Russell, P., Ingolia, NT, Weissman, JS
mammals. eLife 3, e03640
(2014). Science 346, 748–751 (2014).
& Lander, ES Ribosome profiling provides evidence
105. Jinek, M. et al. A
programmable dual-RNA-guided 68. Jan, CH, Williams, CC & Weissman, JS
that large noncoding RNAs do not encode proteins.
DNA endonuclease in
adaptive bacterial immunity. Principles of ER cotranslational translocation revealed
Cell 154, 240–251 (2013).
Science 337, 816–821
(2012). by proximity-specific ribosome profiling. Science 346,
88. Carvunis, A.-R. et al. Proto-genes and de novo gene
106. Zalatan, JG et al.
Engineering complex synthetic 1257521 (2014).
birth. Nature 487, 370–374 (2012).
transcriptional programs
with CRISPR RNA scaffolds. 69. Arava, Y. et al. Genome-wide analysis of mRNA
In this work, the authors present evidence to
Cell 160, 339–350 (2015).
translation profiles in Saccharomyces cerevisiae.
support the protogene hypothesis, according to
107. Gilbert, LA et al. CRISPR-
mediated modular Proc. Natl Acad. Sci. USA 100, 3889–3894 (2003).
which new proteins can evolve through the selection
RNA-guided regulation
of transcription in eukaryotes. 70. Heiman, M., Kulicke, R., Fenster, RJ, Greengard, P. &
and elongation of ORFs encoding peptides
Cell 154, 442–451 (2013).
Heintz, N. Cell type-specific mRNA purification by
translated from putative intergenic transcripts.
108. Gilbert, LA et al. Genome-
scale CRISPR-mediated translating ribosome affinity purification (TRAP).
89. Brubaker, SW, Gauthier, AE, Mills, EW,
control of gene repression
and activation. Cell 159, Nat. Protoc. 9, 1282–1291 (2014).
Ingolia, NT & Kagan, JC A bicistronic MAVS
647–661 (2014). 71.
Heiman, M. et al. A translational profiling approach
transcript highlights a class of truncated variants in
109. Qi, LS et al. Repurposing
CRISPR as an RNA-guided for the molecular characterization of CNS cell types.
antiviral immunity. Cell 156, 800–811 (2014).
platform for sequence-
specific control of gene Cell 135, 738–748 (2008).
90. Michel, AM et al. Observation of dually decoded
expression. Cell 152,
1173–1183 (2013). 72. Inada, T. et al. One-step affinity purification of the
regions of the human genome using ribosome profiling yeast ribosome and
its associated proteins and
data. Genome Res. 22, 2219–2229 (2012).
Acknowledgements mRNAs.
RNA 8, 948–958 (2002).
91. Noderer, WL et al. Quantitative analysis of
The authors wish to thank
C. Jan and E. Ünal for helpful com- 73. Zanetti, ME, Chang, I.-F., Gong, F., Galbraith, DW
mammalian translation initiation sites by FACS-seq.
ments on this manuscript and N.
Ingolia for development of & Bailey-Serres, J. Immunopurification of
Mol. Syst. Biol. 10, 748 (2014).
the original ribosome profiling
protocol and helpful discus- polyribosomal complexes of Arabidopsis for global
92. Schwaid, AG et al. Chemoproteomic discovery of
sions. This work was partially
supported by the Winkler analysis of gene expression. Tanaman Physiol. 138,
cysteine-containing human short open reading
Family Biological Sciences
Award to GAB and Howard 624–635 (2005).
frames. Selai. Chem. Soc. 135, 16750–16753
Hughes Medical Institute
and Center for RNA Systems 74. Mustroph, A., Zanetti, ME, Girke, T. &
(2013).
Biology funding to JSW Bailey-
Serres, J. Isolation and analysis of mRNAs
93. Slavoff, SA et al. Peptidomic discovery of short open from specific cell
types of plants by ribosome
reading frame-encoded peptides in human cells.
Competing interests statement
immunopurification. Methods Mol. Biol. 959,
Nat. Chem. Biol. 9, 59–64 (2013).
The authors declare competing
interests: see Web version 277–302 (2013).
94. Ma, J. et al. Discovery of human sORF-encoded
for details. 75. Thomas, A.
et al. A versatile method for cell-specific
polypeptides (SEPs) in cell lines and tissue. profiling of translated mRNAs
in Drosophila.
J. Proteome Res. 13, 1757–1765 (2014). PLoS ONE 7, e40276 (2012).
95. Crappé, J. et al. Combining in silico prediction and
SUPPLEMENTARY
INFORMATION 76. Housley, MP et al. Translational profiling through
ribosome profiling in a genome-wide search for
See online article: S1 (figure)
biotinylation of tagged ribosomes in zebrafish. Development 141, 3988–3993 (2014).
novel putatively coding sORFs. BMC Genomics 14, 648 (2013).
ALL LINKS ARE ACTIVE IN THE ONLINE PDF

Ribosom

Diunggah oleh

Informasi Dokumen

Judul Asli

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Ribosom

Diunggah oleh

Hak Cipta:

Format Tersedia

Sebelumnya Diterbitkan Pekerjaan UC Berkeley

Anda mungkin juga menyukai