Anda di halaman 1dari 12

312 Vol. 5, No.

2, 2005 The Journal of Applied Riset


Evaluasi Hewan Asal Sel
Budaya untuk In Vitro Budidaya
noroviruses
Yashpal S. Malik, BVSc, PhD *
Sunil Maherchandani, BVSc, PhD *
Paul B. Allwood, MPH, PhD
Sagar M. Goyal, BVSc, PhD *
*
Departemen Kedokteran Hewan Penduduk Medicine, College of
Veterinary Medicine,
University of Minnesota, St. Paul, Minnesota

Divisi Kesehatan Lingkungan, Minnesota Departemen Kesehatan, St.


Paul, Minnesota

PENGANTAR
Noroviruses adalah kelompok tunggal
terdampar,, virus non-menyelimuti RNA
milik keluarga Caliciviridae.
1-2
Baru-baru ini virus ini telah muncul sebagai
patogen penting dalam kelembagaan dan
pengaturan grup termasuk rumah sakit, keperawatan
rumah, tempat penitipan anak, sekolah,
ruang perjamuan, kapal pesiar, kamp-kamp, dan
lapangan olahraga.
3-4 A relatif rendah menular
dosis, stabilitas di lingkungan
dan beberapa mode transmisi,
membuat sulit untuk mengendalikan wabah penyakit
disebabkan oleh noroviruses.
3-9 Sampai
baru-baru ini, noroviruses diyakini
menjadi sangat spesies-spesifik untuk humans10
tetapi laporan dari Japan11 dan
Belanda,
12-13 telah menunjukkan
terjadinya virus norovirus seperti di
babi, monyet dan betis. Hewan

ABSTRAK
Noroviruses adalah penyebab utama akut
gastroenteritis non-bakteri seluruh
Dunia. Sejauh ini, in vitro pertumbuhan
virus ini belum tercapai di
baris sel berasal dari manusia dan terbatas
upaya telah dilakukan untuk mengevaluasi
kerentanan hewan cultures.The sel asal
Tujuan utama dari penelitian ini
adalah untuk mengevaluasi primer dan didirikan
kultur sel dari berbagai hewan
spesies untuk pertumbuhan in vitro manusia
noroviruses. Sebanyak 19 kultur sel
dari 11 spesies binatang yang berbeda yang
dievaluasi. monolayers sel diinokulasi
dengan salah satu dari dua sampel tinja
diketahui mengandung noroviruses.The
monolayers sel yang terinfeksi diamati
setiap hari hingga 5 hari untuk cytopathological setiap
Efek (CPE) setelah itu
suspensi sel yang terinfeksi diinokulasi
dalam sel segar masing-masing untuk total
lima bagian buta. Pada bagian buta kelima
RT-PCR digunakan untuk mendeteksi
kehadiran RNA norovirus. Tidak ada
bagian buta dalam kultur sel menunjukkan bukti apapun morfologi
perubahan. Ketika diuji oleh RT-PCR,
kelima bagian kultur sel dari semua sel
negatif untuk RNA norovirus.
Hasil ini menunjukkan bahwa 19 sel
jenis yang digunakan dalam penelitian ini tidak rentan
untuk noroviruses dan penelusuran yang
harus terus untuk kultur sel cocok
sistem di mana noroviruses dapat
terisolasi, disebarkan, dan dititrasi.

14
Sampai saat noroviruses telah
dilaporkan non-cultivatable baik dalam
kultur sel dan model hewan kecuali
untuk keberhasilan yang terbatas di beberapa non-manusia
primata. Sebagian besar penelitian tentang
noroviruses didasarkan pada penggunaan
relawan manusia atau model pengganti
misalnya, calicivirus kucing.
15-17 Baru-baru ini, penelitian
berdasarkan noroviruses rekombinan telah
disorot klinis dan publik mereka
pentingnya kesehatan, kemampuan untuk menyebabkan infeksi
melalui sejumlah rute, dan mereka
keragaman genetik yang cukup.
18
Meskipun berulang kali mencoba, eksperimental
infeksi hewan yang berbeda
spesies, termasuk primata non-manusia,
tikus, burung, babi, sapi, dan anjing, dengan
noroviruses belum successful.19-23
upaya terbatas telah dilakukan untuk
mengevaluasi penggunaan sel asal hewan
budaya untuk pertumbuhan noroviruses.
Studi dijelaskan di sini didasarkan pada
premis bahwa passaging berurutan
noroviruses di primer atau didirikan
baris sel yang berasal dari hewan dapat menyebabkan nya
pertumbuhan in vitro. Jika berhasil, sel tersebut
budaya akan memfasilitasi deskriptif
studi tentang patogenesis
noroviruses dan akan menggantikan penggunaan
dari model hewan maupun manusia.

BAHAN DAN METODE


Sumber Norovirus
Dua EM dan ELISA dikonfirmasi
strain Minnesota dari noroviruses
diperoleh dari wabah gastroenteritis
(Ramah disediakan oleh
Minnesota Departemen Kesehatan, St.
Paul, MN) yang digunakan. Sampel di
bentuk tinja manusia dan selanjutnya
dikonfirmasi mengandung norovirus
genom oleh RT-PCR di laboratorium kami.
25
inokulum Persiapan
Suspensi 10% dari kotoran itu
dibuat dalam buffer fosfat saline (pH
7.2) dan suspensi disaring
melalui 0,45 nm filter membran
(Millipore, Bedford, MA). filtrat
digunakan untuk menyuntik kultur sel.

Budaya sel
Kultur sel primer dan didirikan
digunakan dalam penelitian ini ditunjukkan pada
Tabel 1. kultur sel primer yang
porcine makrofag alveolar, babi
fibroblas ginjal, sapi, dan kulit llama,
dan sapi, unggas, dan mouse
embryos.The sel hewan didirikan
garis BHK-21, BGM, MA-104, Vero, BT,
PK-15, ST, CRFK, Frhk, QT-35, RK-13,
ED, dan MDCK telah digunakan dengan sukses
untuk mengolah berbagai manusia dan
viruses24 hewan dan dievaluasi di
penelitian ini untuk pertumbuhan noroviruses.
Sebagian besar kultur sel ditumbuhkan dalam
Media DMEM
(MEM) (Celox, St. Paul, MN) ditambah
dengan 8% serum janin sapi
(FBS), penisilin (100 U / mL), streptomycin
(1mg / mL), dan Fungizone (100
pg / mL) .suatu media yang sama digunakan untuk
sel Frhk kecuali bahwa konsentrasi
dari FBS adalah 16%. alveolar Porcine
makrofag yang tumbuh di RPMI 1640
dilengkapi dengan 8% FBS, penisilin
(100 U / mL), streptomisin (1 mg / mL),
dan Fungizone (100 ug / mL). sel-sel
ditumbuhkan dalam 24-baik piring mikro
dan masing-masing juga awalnya diunggulkan dengan
sekitar 1 x 106 sel / mL dalam mereka
masing piring pertumbuhan media.The
diinkubasi pada 37 C di CO2 5%
inkubator selama 24 jam dan diamati untuk
pembentukan monolayers setelah
mereka digunakan untuk sampel inokulasi.

Desain eksperimental
budaya satu-hari-tua yang terkandung dalam 24-
piring juga dibilas dua kali dalam Hanks
larutan garam seimbang (HBSS). Kedua
strain norovirus diinokulasi di
duplikat sumur di 0,2 mL / baik. virus
diizinkan untuk menyerap ke sel oleh
mengagitasi piring pada platform pengocok

pada 100 rpm pada 37 C selama 90 minutes.Two


sumur mock-diinokulasi untuk setiap kultur sel
digunakan sebagai controls.The negatif
virus inokulum didekantasi dan sel
dibilas dua kali dengan HBSS untuk menghapus
sel virus.The un-teradsorpsi kemudian
dibanjiri 1 mL pemeliharaan
media yang mengandung 1% FBS diikuti oleh
inkubasi pada 37C. Sel diinokulasi yang
diamati setiap hari hingga 5 hari untuk setiap
Efek cytopath1ological (CPE). setelah 5
hari, sel-sel dari duplikat sumur yang
dikumpulkan secara individual, beku-dicairkan
dua kali, dan 0,2 ml lisat yang digunakan
untuk bagian buta berikutnya dalam sel segar
budaya. Sebuah alikuot sel dikumpulkan dari
setiap bagian disimpan pada -70C untuk
penggunaan masa depan.

Nucleic Acid Ekstraksi


asam nukleat dari bagian kelima dari semua
kultur sel virus-diinokulasi adalah
diekstrak menggunakan RNA virus QIAamp
Mini kit (Qiagen, Valencia, CA) berikut
instruksi pabrik. Secara singkat,
140 uL suspensi sel dicampur
dengan 560 uL AVL lisis penyangga, vortexed
sebentar, dan diinkubasi selama 15 menit
pada suhu kamar diikuti oleh
penambahan 560 uL mutlak
etanol dan campuran vortexing.This adalah
melewati QIAamp kolom berputar
diikuti oleh dua dicuci dengan 500 uL
cuci buffer (AWI-1 dan AWI-2).
RNA terikat berputar cartridge kolom
dielusi dalam 60 uL QIAamp AVE
elusi buffer.The asam nukleat adalah
disimpan pada -20C sampai digunakan.

RT-PCR
deteksi molekuler dari noroviruses adalah
dilakukan oleh RT-PCR menggunakan diterbitkan
pasangan primer.
25 Pasangan primer
urutan yang digunakan dalam penelitian adalah JV 12
(5'-3 'ATACCACTATGAT GCAGATTA)
dan JV 13 (5'-3 'CATCATCACCATAGAAAGAG) .Untuk
menghindari cross
kontaminasi, satu tabung RT-PCR
Metode diadopsi menggunakan Qiagen tunggal
tabung RT-PCR kit. amplifikasi adalah
dilakukan dalam volume reaksi 50
uL mengandung 10 uL 5X RT penyangga
(12,5 mM MgCl2
), 2 uL campuran dNTP
(10 mM setiap dNTP), 2 uL enzim
mencampur dan 2 uL larutan Q, 1 uL masing-masing
primer (50 pmol masing-masing), 10 uL RNA
dan 22 uL air nuklease bebas untuk
membuat volume reaksi campuran 50 mL.
transkripsi terbalik dilakukan pada
50C selama satu jam diikuti oleh inaktivasi yang
enzim reverse transcriptase
di 95C selama 15 menit. kondisi PCR
yang digunakan adalah, 40 siklus 94C selama 1 menit
(Denaturasi), 53C selama 1 menit
(Anil) dan 72C selama 2 menit
(Ekstensi) diikuti oleh ekstensi akhir
di 72C selama 5 menit setelah selesai
dari 40 siklus PCR amplifikasi di
Perkin Elmer, sistem GeneAmp PCR
9600. elektroforesis pemisahan PCR
produk dilakukan selama satu jam pada
101 volt atas 3% agarose gel di 1X-TAE
penyangga diikuti dengan pewarnaan dengan etidium
bromida. Para amplikon divisualisasikan
di bawah UV trans-illuminator. Untuk
memperkirakan panjang produk, 1 Kb DNA
tangga (Invitrogen, Carlbad, CA) adalah
digunakan sebagai marker.To menentukan
spesifisitas primer spesifik virus, mock
diinokulasi ekstrak kultur sel juga
diuji.

HASIL
Tak satu pun dari kultur sel yang diinokulasi
menunjukkan perubahan cytopathological di
salah satu dari lima bagian. Sebagai tambahan,
asam nukleat diekstrak dari sel kelima
bagian budaya tidak menunjukkan amplifikasi
dari norovirus genome.The primer
pasang yang digunakan dalam penelitian ini tidak memperkuat
noroviruses dalam sampel tinja asli
digunakan untuk menginfeksi semua kultur sel dengan
diharapkan amplikon dari 326 ukuran bp. Tidak
amplifikasi diamati pada salah satu
kultur sel kontrol yang terinfeksi mock.

DISKUSI
calicivirus enterik telah dirlaporkan
Malik-Goyal-vol5no2 6/1/05 09:03 Halaman 314
Journal of Penelitian Terapan Vol. 5, No. 2, 2005 315
pada babi, monyet, sapi, anjing, dan ayam.
26-28 Namun, upaya untuk eksperimental
menginfeksi host non-manusia dengan
noroviruses manusia sebagian besar telah
gagal kecuali untuk beberapa menggembirakan
Hasil pada simpanse, kera, dan
monyet rhesus.
19-23 Sejauh ini, tidak ada in vitro
sistem untuk pertumbuhan noroviruses memiliki
pernah described.18 Terakhir berbagai
metode telah mencoba untuk tumbuh
noroviruses in vitro berdasarkan saat ini
pemahaman tentang mengikat dan replikasi
situs noroviruses in vivo.
31
Banyak lambung, duodenum, dan enterocyte
budaya telah dicoba dengan atau tanpa
penambahan suplemen seperti
insulin, DMSO dan asam butirat untuk
meniru in vivo environment.31 usus
Namun, tidak satupun dari
pendekatan telah berhasil sejauh ini.
Tabel 1. Sel culture Digunakan untuk Perbanyakan
Norovirus.
Nama Singkatan Asal Sumber atau
Jumlah ATCC digunakan
jika tersedia
budaya utama
Bovine embrio BE sapi -
sel fibroblast kulit sapi BSF sapi -
Porcine ginjal primer PPK Porcine -
alveolar Porcine Makrofag PAM Porcine -
Embrio ayam fibroblast CEF Avian -
Llama sel fibroblast ILF Llama -
Embrio tikus ME Mouse -
baris sel terus menerus
Bayi hamster ginjal BHK-21 Hamster CCL 10
BGM * BGM Monyet -
MA 104 MA-104 Monyet CRL 2378
Afrika monyet hijau Vero Monyet CCL 81
Bovine konka BT sapi CRL 1390
Porcine ginjal PK-15 Porcine CCL 33
Babi testis ST Porcine CRL 1746
Feline Ginjal Crandell CRFK Feline -
ginjal Feline Frhk kucing -
tumor puyuh * QT-35 Avian -
Kelinci ginjal RK-13 kelinci CCL 37
Equine dermal ED Equine CCL 57
Madin Darby anjing ginjal MDCK Canine CCL 34
* Sel-sel yang diperoleh dari National Veterinary Services Laboratories,
Ames, Iowa.
Sel-sel yang diberikan oleh Douglas Weit, University of North Carolina,
NC
Malik-Goyal-vol5no2 6/1/05 09:03 Halaman 315
316 Vol. 5, No. 2, 2005 The Journal of Applied Riset
Lampiran virion dengan mereka
reseptor spesifik pada sel inang adalah
penentu utama dari kisaran inang dan
tropisme jaringan virus.
29-30 Memiliki
baru-baru ini menemukan bahwa rekombinan
virus Norwalk seperti partikel
(RNVLPs) menggumpalkan sel darah merah.
Sejak antigen kelompok histo-darah
diekspresikan pada usus mukosa serta sel darah merah,
Sistem haemagglutination rNVLPs memiliki
telah digunakan sebagai model untuk mempelajari
lampiran noroviruses untuk sel untuk mengidentifikasi
potensi norovirus reseptor.
32-33
Dalam penelitian ini, 19 hewani
baris sel dari 11 spesies yang berbeda
dengan waktu adsorpsi 90 menit dan
gemetar konstan inokulum yang
digunakan untuk mencapai virus adsorpsi dan
pertumbuhan. Namun, semua upaya itu tidak berhasil.
Strategi lain seperti diubah
waktu adsorpsi, masa inkubasi lebih lama,
penggunaan budaya roller, metode
persiapan virus inokulum, kondisi
untuk pemeliharaan monolayers sel,
aditif dalam medium pemeliharaan,
Metode inokulasi sel, dan
pengobatan tripsin, dll juga belum
sukses dalam budidaya
noroviruses.
31 Kami menyimpulkan bahwa upaya
harus terus menemukan yang cocok
sistem budidaya norovirus.

UCAPAN TERIMA KASIHa