Acta Physiol Plant (2015) 37:81 DOI 10.

1007 / s11738-015-1829-4
KERTAS ASLI
Struktur, profil ekspresi, dan evolusi keluarga gen sukrosa synthase dalam
persik (Prunus persica)
Chunhua Zhang1 • Mingliang Yu1 • Ruijuan Ma1 • Zhijun Shen1 • Binbin Zhang1 • Nicholas Kibet Korir2
Menerima: 12 Mei 2014 / Direvisi: 15 Maret 2015 / Diterima: 16 Maret 2015 / Diterbitkan online: 26 Maret 2015 Ó Franciszek Go ́rski Institut
Fisiologi Tumbuhan, Akademi Polandia dari Sciences, Krako ́w 2015
Abstrak Pesan utama Keluarga gen SUS terdiri dari enam gen dalam persik, PpSus1 hingga PpSus6. PpSus1 hingga PpSus6
dikategorikan mewakili tiga kelompok, kelompok I, II, dan III. PpSus menunjukkan karakteristik konservatif dengan Sus
pada tanaman lain. PpSus menunjukkan pola ekspresi yang berbeda dalam jaringan pada empat tahap perkembangan.
Abstrak Sukrosa sintase (SUS) telah disarankan untuk memainkan peran kunci dalam metabolisme sukrosa tanaman dengan
penelitian baru-baru ini melaporkan bahwa sejumlah kecil gen yang mengkode isozim Sus yang berbeda ada di sebagian
besar spesies tanaman. Meskipun demikian, informasi tentang gen yang mengkode iso- kim yang berbeda dari Sus in peach
(Prunus persica) masih sedikit. Dalam penelitian ini, kami melaporkan prediksi, isolasi, karakteristik struktural, koneksi
filogenetik dan garis besar ekspresi enam gen Sus dalam persik (PpSus1 hingga 6). Keenam gen PpSus ditemukan
didistribusikan di perancah 1, 3, 5, 7, dan 8. Analisis ekson / intron mengungkapkan bahwa gen PpSus mengandung banyak
intron yang berkisar antara 11 hingga 13 dan menampilkan tingkat konservasi yang tinggi sesuai Gen sus dalam spesies
tanaman lain.komparatif
Pemutaranmotif dalam protein PpSus menunjukkan konsumsi tinggi dalam hal jumlah, lebar dan urutan motif di antara
protein PpSus, yang secara tidak langsung menunjukkan bahwa enam protein PpSus memang anggota keluarga SUS.
Analisis filogenetik mengungkapkan bahwa PpSus2 hingga PpSus4 terkait dengan kelompok II dari keluarga Sus, PpSus5
dan PpSus6 dikelompokkan ke dalam kelompok III, dan kelompok I hanya berisi satu gen persik (PpSus1) bersama dengan
anggota dari 10 spesies tanaman lainnya. Analisis tingkat ekspresi dari enam gen PpSus mengungkapkan bahwa transkrip
PpSus1 paling tidak terdeteksi pada daun dan pada floem yang lebih tua, sedangkan PpSus2 dan PpSus4 hampir tidak
terdeteksi pada bunga. Tiga gen PpSus lainnya muncul secara berbeda di semua jaringan yang diperiksa dan terdeteksi pada
berbagai tahap perkembangan jaringan. Hasil yang diperoleh dari penelitian ini akan berguna dalam memilih kandidat gen
PpSus untuk analisis fungsional lebih lanjut di jalur metabolisme sukrosa dalam persik dan khususnya dalam karakterisasi
mutan knockout / knockdown gen PpSus.
Kata kunci Peach Á Sukrosa sintase Á Karakteristik Á Analisis filogenetik Á Pola ekspresi
Dikomunikasikan oleh M. Stobiecki.
Singkatan DABF Hari setelah mekar penuh Bahan pelengkap elektronik Versi online dariini artikel(doi:10.1007 /

s11738-015-1829-4) berisipelengkap bahan, yang tersedia untuk pengguna yang berwenang.

Basis Data Genom GDR untuk Rosaceae Server Tampilan Struktur Gen GSDS Server GRAVY Rata-rata besar hidropati &
Ruijuan Ma
HMM Tersembunyi model Markov rjmajaas@aliyun.com
kDa Kilodalton
1 Institut Hortikultura, AkademiPertanian
Ilmu PengetahuanJiangsu, Laboratorium Kunci Jiangsu untuk Tanaman Hortikultura
NG Grup baru PI Isoelectric point Peningkatan Genetik, Nanjing 210014, Jiangsu, Cina
qRT-PCR Kuantitatif real-time PCR
2 Departemen Ilmu Pengetahuan dan Teknologi Pertanian,
TAIR Sumber Daya Informasi Arabidopsis Universitas Kenyatta, PO Box 43844-00100, Nairobi, Kenya
Sus Sucrose synthase
123
81 Page 2 dari 15 Acta Physiol Plant (2015) 37:81

UTR Wilayah yang belum

diterjemahkan
Pendahuluan `nggi
(Lerchl et al 1995;.Hae dan Fleming 2001). Diusulkan bahwa
bersamaan dengan kompleks selulosa sintase, pembelahan sukrosa
Sukrosa adalah produk fotosintesis utama yang diekspor dari daun
oleh Sus memasok UDP-glukosa, yang merupakan prekursor untuk
sumber ke berbagai jalur metabolisme seluler pada sebagian besar
banyak senyawa, untuk biosintesis dinding sel (Amor dkk. 1995;
spesies tanaman (Lutfiyya et al. 2007). Sukrosa sintase (SUS, EC
Ruan dkk. 2003; Lee dkk. . 2007;Coleman et al 2009)..Aktivitas
2.4.1.13) ada di mana-mana pada tanaman tingkat tinggi dan secara
Sus juga terkait dengan organ penyimpanan bak cuci, menunjukkan
luas dianggap penting untuk partisi sukrosa, impor, dan / atau
korelasi positif dengan kandungan pati dalam pericarp tomat dan
metabolisme dalam mengembangkan organ tanaman (Koch et al.
dengan konversi dari sukrosa menjadi pati dalam kentang (Wang et
1996; Schrader dan Sauter 2002), juga seperti untuk memasok
al. 1993; Geigenberger 2003).
karbon asimilasi ke dalam metabolisme sink (Lingle 1999). Sus
mahir mengkatalisasi konversi reversibel tetapi lebih suka Isolasi dan analisis properti gen yang mengkode Sus adalah
mengubah sukrosa dan UDP menjadi UDP-glukosa dan fruktosa fondasi yang diperlukan dalam memahami fungsi gen ini dan
(Schmalstig dan Hitz 1987; Joshi et al. 2004; Kleczkowski et al. mekanisme regulasi yang terlibat dalam pengembangan tanaman.
2010). Telah diterima secara luas bahwa protein Sus dicirikan Sejumlah penelitian telah menunjukkan bahwa keluarga SUS
secara simultan oleh keberadaan sukrosa sintase dan domain adalah keluarga kecil tetapi multigene yang terdiri lebih dari tiga
glikosiltransferase yang terkait erat. Dalam poplar (Poplus gen Sus di sebagian besar spesies tanaman. Ara-bidopsis, Lotus
tricocarpa) semua anggota keluarga PtrSUS memiliki domain japonicus, dan pohon karet semuanya mengandung keluarga gen
sukrosa sintase dan glukosiltransferase yang khas, di samping situs Sus dengan enam gen Sus aktif yang berbeda (Baud dkk. 2004;
fosforilasi Ser yang diduga (Zhang et al. 2011) sementara di Horst dkk. 2007; Xiao dkk. 2013). Demikian pula, di Zea mays dan
Ara-bidopsis, semua enam urutan asam amino dari Keluarga Solanum tuberosum, setidaknya lima gen telah diidentifikasi dalam
AtSUS juga berbagi dua domain karakteristik ini (Baud et al. 2004).keluarga SUS, sementara dalam beras, Populus trichocarpa, dan
Demikian pula, semua sekuens asam amino GaSus dalam kapas Gossypium arboretum tujuh gen Sus telah dilaporkan (Cho et al.
memiliki domain sukrosa sintase dan glikosiltransferase yang 2011; Zhang et al. 2011; Chen et al. 2012). Studi tentang kelayakan
dikonservasi dan juga memiliki residu Ser yang dilestarikan di fisik dan kimia anggota Sus dan afiliasi filogenetik mereka telah
wilayah terminal N (Chen et al. 2012). Dari hubungan filogenetik menunjukkan adanya konservasi struktural dan keragaman
dan analisis struktur dari urutannya, protein Sus tanaman telah fungsional dalam keluarga SUS selama evolusi. Dalam banyak
dibagi menjadi tiga kelompok utama (SusA, Sus1, dan Grup Baru) spesies tanaman anggota keluarga gen Sus memiliki fungsi
(Baud dkk. 2004; Hirose dkk. 2008). Dalam beberapa penelitian, beragam dan diekspresikan secara berbeda selama pengembangan
masing-masing kelompok ini telah berganti nama menjadi Sus I, II, tanaman. Akibatnya, pengetahuan menyeluruh tentang perilaku
dan III, untuk tujuan penyatuan dan penyederhanaan (Zhang et al. keluarga SUS selama pengembangan tanaman diperlukan untuk
2011, 2013a). Untuk kelompok Sus I, gen monokotil dan dikotil mempercepat pemahaman kita tentang peran Sus yang terlibat
telah dipisahkan menjadi dua cabang, yang selanjutnya dalam metabolisme sukrosa dan proses perkembangan lainnya.
memunculkan subklas Sus I spesifik-monokot dan spesifik. Meskipun studi gen Sus dalam beberapa spesies tanaman tersedia,
pemahaman kita tentang famili gen Sus dalam persik, dan
Aktivitas Sus di berbagai tanaman telah dipelajari dan
khususnya evolusi dan berbagai fungsi dalam pertumbuhan dan
terbukti memainkan peran penting dalam metabolisme energi dan
perkembangan, perlu ditingkatkan.
dalam masuknya sukrosa ke jalur yang merupakan pusat dalam
biosintesis, respons stres, dan pengembangan tanaman (Sturm dan Persik (Prunus persica L.) adalah salah satu spesies buah
Tang 1999; Cermain et al. 1997; Harada et al. 2005; Zrenner et al. batu yang paling banyak ditanam dan populer di keluarga Rosaceae.
1995). Pentingnya isoform yang berbeda dari Sus dapat bervariasi Dibandingkan dengan fungsi-fungsi yang banyak diselidiki dari
dari organ ke organ, dan tanaman ke tanaman, dan bahkan berubah Sus dalam Arabidopsis, hanya satu gen Sus persik (PpSus1,
selama beberapa tahap perkembangan dalam organ yang sama JQ412752) baru-baru ini dikloning dan dikarakterisasi (Zhang et al.
(Sturm dan Tang 1999). Menurut Tupy dan Primot(1982),aktivitas2013b) tanpa analisis rinci dan sistematis untuk keluarga SUS. telah
Sus pri-fungsi marily ke arah sintesis sukrosa dan, karena itu, dilakukan pada buah persik. Analisis tersebut akan mencakup
bertindak sebagai faktor menangkal sukrosa identifikasi anggota, organisasi genom, dan struktur gen. Kami
melaporkan isolasi dan karakterisasi anggota keluarga SUS dalam
buah persik berdasarkan Genometersedia untuk umum
123
katabolisme dalam lateks pohon disadap secara teratur. Sus tivity
ac- juga telah dilaporkan berhubungan dengan katabolisme sukrosa
di daun dan muncul untuk menghasilkan energi dalam substansi
kompleks saringan sel tabung-pendamping untuk loading floem
Acta Physiol Plant yang(2015) 37:81 Halaman 3 dari 15 81
Database untuk Rosaceae (GDR) dan The Arabidopsis In-
the Sus gen family dalam Pfam adalah database PF00862 (http: // pfam. Formation Resource (TAIR). Hasil kami mungkin
sanger.ac.uk/). Dengan bantuan profil HMM, pencarian memberikan informasi dasar untuk karakteristik fungsional lebih
lanjut
terhadap database protein persik dalam GDR dilakukan analisis terisasi dari gen Sus ini dan untuk masa depan
menggunakan protein yang teridentifikasi dari keluarga SUS dalam modifikasi Arabidopsis dalam kadar gula dan dalam
metabolisme sukrosa
sebagai urutan kueri. Ini menghasilkan sepuluh aspek transkrip persik dari persik menggunakan gen-gen ini.
ID dari keluarga SUS diperoleh setelah menghapus transkrip dengan nilai e [e-10. Sepuluh urutan protein dengan ID transkrip
kemudian diunduh dari GDR. Bahan dan metode
Untuk lebih jauh mengkonfirmasi protein keluarga SUS yang diprediksi ini, urutan protein ini kemudian dicari untukspesifik
bahan Tumbuhan yang
domaindikandung oleh keluarga SUS menggunakan InterProScan (http://www.ebi.ac.uk/Tools/InterProScan/) Tujuh
tanaman 'Troubador' persik berumur tahun diNasional
pencariandan CD (Marchler-Bauer et al. 2011server web). Repositori Peach Germplasm di Nanjing, Cina (Jiangsu
Akhirnya, urutan genomik yang berhubungan dengan Akademi Ilmu Pertanian, JAAS) digunakan dalamdi
protein keluarga SUS yang diprediksiatas diambil dari penelitian ini. Pohon-pohon tumbuh di bawahsama
database Phytozome v9.1 yang(http://www.phytozome.net/). kondisi lapangan umum. Buah-buahan, fraksi yang diperkaya
floem (disingkat menjadi floem dalam penelitian ini), dan daun
Verifikasi gen keluarga PpSus dari simpul yang sama semuanya diambil dari kanopi pohon terluar selatan mulai dari 30 hari
setelah penuh
Berdasarkan 6 prediksi Urutan CDS dari gen Sus mekar (DAFB) hingga pematangan buah. Daun kelima dari
persik, primer spesifik (Tabel 1) dirancang menggunakan puncak diambil dalam tunas berbuah satu tahun di
perangkat lunak Primer Premier 5.0, disintesis oleh Invitrogen setiap kali pengambilan sampel. Floem di atas dan di bawah
Biotechnology Co. Ltd. (Shanghai, Cina), dan digunakan pada simpul daun ini dikupas, sementara buah-buahan dari simpul
mengkloning urutan kerangka baca terbuka (ORF). PCR dari daun-daun yang diambil sampel diambil dan dicincang
menjadi
reaksi dilakukan dalam 25 ll volume reaksi, setelah batu dikeluarkan. Semua sampel dengan segera menerima
2,5 ll 109 buffer PCR; 2,5 ll dNTP campuran dibekukan dalam nitrogen cair dan kemudian disimpan pada -70 ° C sampai
(2,5 mM); 1,5 ll MgCl2; 0,2 ll penggunaan high-fidelity PrimeSTARÒ .
HS DNA Polymerase (5 U / ll) (Takara Biotechnology Co. Ltd., Dalian, Cina); 2,0 ll cDNA; 1,0 ll dari setiap ekstraksi
gen-RNA dansintesis cDNA
primer spesifik; dan 14,3 ll air bebas RNase. PCR dilakukan dalam Cycler Thermal Eppendorf Resmi Total RNA diekstraksi
dari buah, floem, dan daun
menggunakan program berikut: 94 ° C pra-denaturasi untuk jaringan pada berbagai tahap pengembangan persik
menggunakan
5 menit, diikuti oleh 38 siklus 94 ° C selama 1 menit, Tm untuk metode TRIzol (Invitrogen Corp., Carlsbad, CA, USA).

30 s (Tm seperti yang ditunjukkan pada Tabel 1), 72 ° C selama 3 menit, dan RNA yang diekstraksi diukur secara
spektrofotometri
72 ° C selama 10 menit. Produk PCR dipisahkan dengan dan kemudian diperiksa secara elektroforesis pada 1,0% gel agarosa
elektroforesis pada gel agarosa 2,0%, dan divisualisasikan dengan memverifikasi integritas sampel. Setelah itu RNA dirawat
pewarnaan dengan etidium bromida. Fragmen DNA target dengan DNase I dan terbalik ditranskripsi menggunakan
Perdana dimurnikan menggunakan Kit Ekstraksi Gel DNA AxyprepTM ScriptTM RT Reagent Kit dengan gDNA Eraser
(Takara
(Aygen Biosains, Union, CA, USA), kemudian diikatkan ke Biotechnology Co. Ltd, Dalian, Cina) mengikuti
vektor pEASY-T3 (TransGen Biotech Co Ltd, Beijing, instruksi pabrik. Semua sampel cDNA adalah di-
China), dan akhirnya diubah menjadi sel E. coli (DH5a). luted 1:10 dengan air bebas RNase dan diverifikasi olehsemi-
klonpositif yang diidentifikasi dengan analisis PCR diurutkan RT-PCR kuantitatif. Semua cDNA disimpan pada -20 ° C
 oleh Invitrogen Biotechnology Co. Ltd (Shanghai, Cina). sebelum digunakan sebagai templat dalam kloning dan dalam
realitas kuantitatif-
Kesamaan antara gen Sus dalam persik dan gen waktu PCR (qRT-PCR).
di pabrik lain ditentukan menggunakan NCBI BLAST. Urutan yang diperoleh kemudian diserahkan ke Prediksi NCBI
anggotakeluarga PpSus
databasedan diberi nomor aksesi, JQ412752 untuk PpSus1, dan KJ493331 ke KJ493331 untuk KJ493335 untuk PpSus2 ke
PpSus6. Menggunakan protein gen Sus yang diidentifikasi dalam Arabidopsis.
Selain itu, penyelarasan berganda dari asam amino yang disimpulkan thaliana dan dalam Oryza sativa (enam), serta
dalamPopulus
urutandari enam gen dilakukan menggunakan DNAMAN trichocarpa (tujuh), model Markov tersembunyi(HMM)
Perangkat lunak(versi 6.0) (http://www.lynnon.com/) dan profil keluarga SUS diekstraksi dari Pfam sebagai
ClustalW2 (http://www.ebi.ac.uk/Tools/msa / clustalw2 /) dijelaskan oleh Wang et al. (2010) (nomor tambahan
program, dengan penalti celah default.
123
81 Halaman 4 dari 15 Acta Physiol Plant (2015) 37:81

Tabel 1 Urutan primer dan karakteristik

amplikon dirancang untuk kloning gen
Sus dalam Persik 'Troubador'
 123
0)
Ukuran produk diperkuat (bp) Tm (° C)

GAGCATTGAAGACA 2403 58,0

GCTCATCAACAGCC PpSus3 ATGTTCCGTAACAAAGATTCATTG 1923 56,0
TCACTCATCACTTGCTGAAGGAAC PpSus4 ATGGGATTCAGCACATATATTT 2274 60,0
CTACTGTGTCATACTGGGAAGG PpSus5 ATGGCTTCAGGAGCAGC 2502 56,0
TTAGTTTAGATTAACATGCCTTGG PpSus6 ATGGCTTCTACCCCGGC 269758,0
TTAGTTGTAGTTGTACATATTCC
bersama dengan perangkat lunak MEGA 6.0, menggunakan metode
Karakteristikdan analisis struktural gen keluarga PpSus. tetangga-bergabung (NJ) dan bootstrap dari 1000 ulangan (Tamura
et al. 2011).
Urutan genomik, distribusi gen pada perancah, dan lokasi genom
gen Persik diperoleh dari basis data Phytozome Tingkat ekspresi gen PpSus di jaringan yang berbeda
(memanjanghttp://www.phytozome.net/peach. php), sedangkan
ORFini. gen dianalisis menggunakan ORF Finder di NCBI. Primer spesifik gen untuk amplifikasi qRT-PCR dirancang
Struktur masing-masing gen ini, termasuk exon dan nomor dan berdasarkan urutan ORF yang disebutkan di atas menggunakan
lokasi intron, dibangun dan ditampilkan menggunakan Server perangkat lunak Primer Premier 5.0. Ukuran produk yang
Tampilan Struktur Gen (GSDS) (http://gsds.cbi.pku.edu.cn/). diamplifikasi dirancang 100-200 bp untuk menjamin efisiensi
polimerisasi yang tinggi dan untuk meminimalkan efek integritas
Karakteristik dan analisis struktural protein keluarga PpSus RNA pada tingkat ekspresi relatif gen. Selain itu, salah satu primer
dioptimalkan untuk ditempatkan di 30 daerah yang tidak
Karakteristik fisik dan kimia dasar (struktur primer) protein Sus diterjemahkan (UTR) untuk memastikan kekhususan primer.
peach termasuk jumlah asam amino, berat molekul, prediksi titik Sebelum qRT-PCR, setiap pasangan primer diperiksa melalui
iso-elektrik teoritis (PI teoritis), indeks alifatik, dan rata-rata besar RT-PCR standar dan elektroforesis pada gel agarosa bernoda 2,0%
dari hidropati (GRAVY) dihitung menggunakan alat ProtParam bernoda etidium bromida untuk memverifikasi ukuran produk yang
online (http://www.expasy.org/tools/ protparam.html) sementara diamplifikasi. Subunit RNA polimerase (RP II, TC1717) dan
analisis struktur tersier dilakukan pada server ExPaSy Swiss-ModelTerjemahan elongation factor 2 (TEF2, TC3544) digunakan sebagai
server (http: // swiss model. expasy.org). Versi ExPaSy secara gen referensi berdasarkan penelitian oleh Tong et al. (2009) dan
otomatis memungkinkan sekuens asam amino untuk membentuk mengikuti pedoman yang diterbitkan oleh Bustin et al. (2009).
struktur protein tersier melalui pemodelan homologi (Kiefer et al. Urutan primer, ukuran produk yang diamplifikasi, dan suhu leleh
2009). Alat MEME online (Versi 4.9.0) digunakan untuk mencari optimal untuk qRT-PCR dari masing-masing gen adalah seperti
motif yang dikonservasi yang dibagikan oleh protein Sus (http:yang tercantum dalam Tabel 3.
//meme.nbcr .net / meme / cgi-bin / meme.cgi) melalui Reaksi tersebut dilakukan pada Sistem PCR Real-Time
mengunggah file enam asam amino urutan dari keluarga SUS di Biosystems Terapan 7500 menggunakan Kit SYBER Premix Ex
peach (Bailey et al. 2006). Parameter ditetapkan sebagai berikut: Taq (Takara Biotechnology Co. Ltd., Dalian, China) sesuai dengan
nol atau satu kemunculan motif tunggal per urutan; kisaran lebar instruksi pabrik. Volume reaksi qRT-PCR adalah 20 ll, mengandung
motif 60–300 aa; dan 4 sebagai jumlah maksimum motif untuk 2,0 ll cDNA terencerkan, 0,4 ll masing-masing primer, 10,0 ll
ditemukan. Semua parameter lain ditetapkan secara default. campuran induk, dan 7,2 ll air bebas RNase. Kondisi siklus termal
ditetapkan dengan langkah aktivasi polimerase awal selama 30
Analisis filogenetik protein PpSus dan tumbuhan lainnya Sus detik pada 95 ° C, diikuti oleh 40 siklus 5 detik pada 95 ° C untuk
homolog denaturasi templat, dan 34 detik pada 60 ° C untuk anil

Urutan asam amino yang disimpulkan dari gen Sus di Arabidopsis

diunduh dari basis data TAIR,dari sus geen
sedangkan sekuens asam amino yang disimpulkanSus di sembilan
spesies lainnya diunduh dari NCBI (Tabel 2). Sebuah analisis
penyelarasan ganda dan pohon phylo-genetik dari protein keluarga
SUS dari 11 spesies dibangun menggunakan alat Clustal W,
Acta Physiol Plant (2015) ) 37:81 Halaman 5 dari 15 81
Tabel 2 Daftar protein Sus yang digunakan untuk pembangunan
phy- Tabel 2 melanjutkan pohon logenetik dalam penelitian ini
Takson Nama urutan Nomor aksesi Nomor takson Nama nomor akses
Bambusa oldhamii BoSus1 AF412036 Dicot plant
BoSus2 AF412038 Arabidopsis thaliana AtSus1 At5g20830
BoSus3 AF412037 AtSus2 At5g49190
BoSus4 AF412039 AtSus3 At4g02280 AtSus4 At3g43190 AtSus5 At5g37180 AtSus6 At1g73370 Pisum sativum PsSus1 AJ012080 PsSus2
AJ001071 PsSus3 AJ311496 PsSus4 AF079851 Solanum tuberosum StSus1 M18745
StSus2 AY205084 StSus3 U24088
(pengukuran fluoresensi). Tahap 3 ditetapkan selama 15 detik pada 95 ° C, diikuti oleh 1 menit pada 60 ° C dan 15 detik pada
95 ° C. Setiap pengujian diulang tiga kali dengan ulangan jaringan yang sesuai dengan sampel jaringan dari salah satu dari
tiga plot di kebun. Data fluoresensi mentah yang diambil dari sistem deteksi PCR 7500 Real-Time diekspor ke perangkat
lunak Microsoft Excel, dan tingkat ekspresi kuantifikasi relatif dari enam gen akhirnya dianalisis menggunakan metode
2ÀDDCT (Livak dan Schmittgen 2001).
StSus4 U24087 StSus5 AJ537575
Hasil Jeruk unshiu CuSus1 AB022092 CuSusA AB022091
Verifikasi gen keluarga PpSus Populus tomentosa PtSus1 GU559727 PtSus2 GU559728
Dengan bantuan profil HMM dan setelah menghapus re- Populus trichocarpatrus, pontuen yang
ada di tempat lain.
genom persik. Semua sepuluh kandidat Sus secara manual PtrSus3 GU559731
dianalisis menggunakan program InterProScan danonline PtrSus4 GU559732
alat pencarian CDuntuk memverifikasi keberadaan domain yang dikonservasi. PtrSus5 GU559733
Sebagai hasilnya, dua sukrosa sintase yang dilestarikan danglukosil- PtrSus6 GU559734
domain transferase, yang telah dilaporkan sebagaikhas PtrSus7 GU559735
propertidari protein keluarga Sus, hanya ditemukan pada enam Gossypium arboreum GaSus1 JQ995522
genPpSus gen. Kelima cDNA yang mengkode Sus adalah lebih lanjut GaSus2 JQ995523
diverifikasi dari perpustakaan cDNA yang dibuat dari buah GaSus3 JQ995524
persik melalui amplifikasi dan kloning PCR (PpSus1 memiliki GaSus4 JQ995525
sudah dikloning dalam makalah yang diterbitkan sebelumnya). The GaSus5 JQ995526
lima yang baru diisolasi fragmen gen bersama-sama dengan satu pra GaSus6 JQ995527
viously kloning gen diberi nama PpSus1 untuk PpSus6, ulang GaSus7 JQ995528
spectively, sesuai dengan prinsip penamaan untuk gen dari monokotil tanaman yang
keluarga diberikan dalam spesies tanaman yang paling. Informasi terperinci
Oryza sativa OsSus1 AK100334
mengenai gen keluarga SUS dalam persik, termasuk nilai e,
OsSus2 AK072074
skor, homolog tertinggi, ID pertandingan untuk homolog, dan posisi
OsSus3 AK100306
awal yang tepat untukdan posisi akhir asam amino untuk sukrosa
Zea mays OsSus4 OsSus5 OsSus6 OsSus7 ZmSus1 ZmSus2 ZmSus3 ZmSus4 ZmSus5 AK102158 AK063304 AK065549 HQ895725 L29418
L22296 BT069288 NM_001111941 EU971052
domain synthase / glucosyltransferase, tercantum dalam Tabel 4. Menggunakan perangkat lunak DNAMAN, keberpihakan
berganda dari sekuens asam amino yang disimpulkan dari enam gen menunjukkan bahwa enam protein PpSus sangat
dilestarikan dan bahwa PpSus5 dan PpSus6 memiliki wilayah terminal C yang diperluas yang tidak diamati pada empat
protein PpSus lainnya ( Gambar 1). Hasil ini menunjukkan bahwa jumlah total PpSus adalah enam pengkodean enam isozim
Sus dalam persik.
Menggunakan program ClustalW2, beberapa urutan keselarasan mengungkapkan bahwa PpSus2 bersama tingkat yang jauh
lebih tinggi
123
81 Halaman 6 dari 15 Acta Physiol Plant (2015) 37:81
Tabel 3 urutan Primer dan karakteristik amplikon dirancang untuk QRT-PCR gen PpSus di 'Troubador'
123
nama Urutan gen (50-30)Ukuran produk diperkuat (bp) Tm (° C)
PpSus1 CCGCATTATTATTCTCAC 117 60,0
GTTCTAAAGGGAACACGA PpSus2 TCACTCTTCCTGGGCTGTATC 189 60,0
CAATATGCTCCTCATTCTGCT PpSus3 ATGCGTTGATGTTGAATGA 197 60,0
AGAGGGTGTCTCGGGTGGA PpSus4 TGTTACCCGACTAATACCTGA 194 60,0
CAATTTCATTCGAGGCATCCT PpSus5 TTTGACATCTATCCCTACCTT 162 60,0
AATAGTTGCCTGAGTAATCCC PpSus6 GGGCTGACCAATCTGTCTACT 126 60,0
CTGCCAAATATCCTATGTGCT TEF2 GGTGTGACGATGAAGAGTGATG 129 60,0
TGAAGGAGAGGGAAGGTGAAAG RP II TGAAGCATACACCTATGATGATGAAG 128 60,0
CTTTGACAGCACCAGTAGATTCC
Tabel 4 Informasi mengenai gen keluarga SUS di peach
Gene nama Gene ID Score e nilaitertinggi
homolog
Pertandingan ID Aksesi tidak ada. Sucrose
Glycosyl synthase domain
transferase domain (start-end)
(start-end)
PpSus1 ppa001535m 1516.6 0 Glycine max SUSY_SOYBN JQ412752 7–554 565-735 PpSus2 ppa001573m 1490.6 0
Arabidopsispus330pengantuksangatpenggunauntukpususpintuspauspususpususpususpususkususpususpususkususpususpususkpususppus3dppppu
suspususterusususpus001535m 1516.6 0. SUS2_PEA KJ493332 1-386 397-560 PpSus4 ppa001845m 1398,0 0 Arabidopsis thaliana
SUS2_ARATH KJ493333 16-503 507-672 PpSus5 ppa017606m 1540,5 0 Pisum sativum SUS2_PEA KJ493334 9-558 567-736 PpSus6
ppa001135m 1507,1 0 Pisum sativum SUS2_PEA KJ493335 9-559 567-736
kesamaan / identitas asam amino / nukleotida
perbandingan antara genom dan sekuens cDNA dengan PpSus3 dan dengan PpSus4 (skor yang dicapai
menggunakan utilitas GSDS mengungkapkan bahwa enam gen PpSus 81,41 dan 88,77 pada tingkat asam amino dan 78,63
dan
mengandung beberapa intron berkisar antara 11 hingga 13. Meskipun 91,03 pada tingkat nukleotida, masing-masing)
dibandingkan dengan
ada perbedaan dalam jumlah dan ukuran exo. n / paralog lainnya (Tabel 5). Secara khusus, PpSus2 hingga 4 memiliki
intron di antara enam gen PpSus, tingkat konservasi yang lebih tinggi, hubungan yang lebih dekat. Selain itu, pasangan dekat
lain
dalam organisasi ekson / intron dapat diamati, yang merupakan identitas asam amino atau kesamaan diamati untuk PpSus5
mirip dengan kesamaan tinggi yang diamati oleh multiple align- dan PpSus6 (masing-masing 75,51 dan 76,54). Hasil ini
termasuk di antara enam sekuens asam amino. Seperti yang ditunjukkan dalam sedikit sesuai dengan program DNAMAN
Gambar. 2 dan dalam Tabel 6, PpSus1, PpSus4, dan PpSus5 semua perataan ganda, seperti yang ditunjukkan pada Gambar.
1.
mengandung 12 intron di daerah pengkodeannya, sedangkan PpSus2 dan PpSus6 dicirikan oleh satu intron lagi (13 in-
Karakteristik dan struktur tron gen keluarga PpSus
). Namun, PpSus3 dicirikan oleh hanya 11 in-trons. Secara khusus, PpSus4 hingga PpSus6, yang dimulai dari ORF gen
PpSus dalam persik berkisar dari 1923 bp
ekson dan berakhir sebagai ekson, semua tidak memiliki hulu atau (PpSus3, Ppa002723mm) hingga 2697 bp (PpSus6,
Ppa001135m)
urutan hilir . dengan rata-rata 2377 bp (Tabel 6). Gen PpSus1 ke PpSus6 didistribusikan di seluruh perancah 7, 1, 8, 1, 3,
Karakteristik dan struktur keluarga PpSus dan 5, masing-masing. Analisis komprehensif dari panjang
protein dan posisi ekson / intron untuk gen dapat memberikan informasi penting untuk memahami mekanisme
evolusipisikme
. Analisis perhitungan darikimia dan kimia yang mendasari genesis keluarga gen ini. Sebuah
rameter mengungkapkan bahwa enam protein diduga dari
Acta Physiol Plant (2015) 37:81 Halaman 7 dari 15 81keselarasan
Gambar. 1 Analisisurutan asam amino diprediksi dari enam
karakteristik sukrosa synthase domain (garis bawah rusak) dan protein PpSus. Analisis keselarasan urutan dilakukan dengan menggunakan
domain glikosil transferase (garis bawah tunggal) yang diidentifikasi oleh program pelurusan berganda perangkat lunak DNAMAN 6.0.identik
Algoritma InterProScan(http://www.ebi.ac.uk/Tools/pfa/iprscan/) asam amino diarsir, dan celah ditunjukkan oleh titik-titik. Dilestarikankesamaan
 Tabel 5 Identity / matriks dari enam PpSus nukleotida / aminoasam
Skoridentitas untuk
Skor kesamaan untuk sekuens asam amino nukleotida urutan
PpSus1 PpSus2 PpSus3 PpSus4 PpSus5 PpSus6 sekuens
PpSus1 - 69,5 73,12 68,82 56,95 56,08 PpSus2 71,33-81,41 88,77 57,62 56,62 PpSus3 71,14 78,63-79,22 61,56 61,72 PpSus4 71,46 91,03
78,42-58,12 57,33 PpSus5 66,75 66,87 69,63 67,28-75,51 PpSus6 66,5 66,00 68,75 67,59 76,54 -
Tabel 6 karakteristik gen SUS keluarga dan protein dalam persik
Nama Gene ID Genome lokasi ORF
Exon
Intron
No.
Molekuler
Teoritis
alifatik
SAUS(bp)

No
amino
berat
PI
asam indeks
(kDa)
PpSus1 ppa001535m 7: 18.751.831 ... 18757844 2421 13 12 806 92,62 6,00 92,74PpSus2 ppa001573m 1: 9.918.131 ... 9.923.492 2403 14 13 800
91,31 5.73 94.32 -0.243 PpSus3 ppa002723m 8: 21434978 ... 21439332 1923 12 11 640 73.08 6.06 87.61 -0.286 PpSus4 ppa001845m 1:
9912782 ... 9917014 2274 13 12 757 86.58 6.00 92.31 -0.145 PpS us5 ppa017606m 3: 149555 ... 153309 2502 13 12 833 94.72 6.56 87.11 -0.339
PpSus6 ppa001135m 5: 18201753 ... 18206006 2697 14 13 898 101.40 6.68 84.21
-0.289 Gen PpSus terdiri dari indeks asam amino bersama dengan asam amino alifatik. mulai dari 84,21 hingga 94,32. Massa
molekul yang diprediksi dari keenam protein tersebut berkisar antara
123
73,08 hingga 101,40 kDa, sedangkan PI teoretis mereka yang diprediksi dihitung berada di antara 5,73 (PpSus2) dan 6,68
(PpSus6), mirip dengan hasil analisis untuk protein Sus dari
81 Halaman 8 dari 15 Acta Physiol Plant (2015) 37:81
memiliki satu rantai polipeptida utama. Setiap struktur untuk
sebagian besar tanaman (Tabel 6). Indeks GRAVY menunjukkan PpSus1 hingga PpSus6 memiliki dua domain berbeda, domain
bahwa semua protein dalam keluarga SUS adalah hidrofilik. sukrosa dan domain glikosiltransferase. Hasil yang diperoleh dari
Swiss Model dan alat InterProScan menunjukkan domain pertama
Keenam urutan protein dari keluarga SUS dalam persik
yang terletak di residu 7-554, 1-545, 1–386, 16–503, 9–558, 9–559
menjadi sasaran analisis distribusi motif mereka yang dilestarikan
untuk PpSus1 hingga PpSus6, masing-masing (Tambahan Gambar.
menggunakan server web MEME. Keenam anggota tidak hanya
S1. S1. ). Adapun domain glikosiltransferase, diamati berada di
berbagi setidaknya empat komposisi motif umum tetapi juga
residu 565-735, 549-729, 398-560, 507-672, 567-736, dan 567-736,
memiliki urutan pengaturan motif yang sama (3,1,4,2) (Gbr. 3).
masing-masing (Tambahan Gambar. S2).
Selain itu, motif 3 dan 1 di setiap urutan protein terhubung erat dan
memiliki lebar yang sama, 166 aa (Gbr. 4). Namun, keduanya Struktur protein keluarga SUS dalam buah persik terdiri
memiliki jarak dari motif 4 dan 2. Hasil ini menunjukkan dari heliks, helai b, dan gulungan. Jumlah heliks-a dan helai-b yang
konservasi dalam struktur dan kemungkinan kesamaan fungsionalterkandung dalam setiap struktur adalah (127, 111), (127, 108),
antara protein dalam keluarga SUS persik. (104, 84), (119, 108), (35, 28), dan (34, 28) ) untuk PpSus1 ke
PpSus6, masing-masing. Struktur PpSus5 dan PpSus6 tidak
Struktur tersier dari protein keluarga SUS yang diprediksi
memiliki ikatan heliks yang relatif kompak dibandingkan dengan
dalam persik dibangun melalui alat berbasis web Swiss-Model
struktur PpSus1 hingga PpSus4. Sebagai contoh, struktur yang
(http://swissmodel.expasy.org/). Seperti ditunjukkan pada Gambar.
diamati dari domain sukrosa sintase dalam PpSus5 dimulai pada
5, PpSus1 hingga PpSus4 memiliki struktur tersier yang serupa
residu 10 dan berakhir pada residu 558 dengan 23 heliks-a dan 21
tetapi memiliki sedikit perbedaan dalam panjang dan komposisi
helai-b.tersebut.
asam amino unit yang membentuk struktur tersier. Struktur untuk
PpSus1 hingga PpSus4 memiliki dua tetramer simetris dan terdiri
dari empat rantai polipeptida utama. PpSus5 dan PpSus6 memiliki
struktur tersier monomer yang serupa dan masing-masing hanya
Gambar 2 Exon / intron organisasi gen dari keluarga persik SUS. Exon dan I, II, and III, respectively. The results of phylogenetic ana- lysis
intron ditunjukkan oleh kotak hijau yang diisi dan oleh garis tunggal, indicated that these Sus genes had a relatively deep evolutionary
masing-masing. Ukuran ekson dan intron sebanding dengan panjang urutannya.
root accompanied by the more recent dupli- cation events.
Angka-angka menunjukkan fase splicing dari

Expression level of PpSus genes in different tissues

123
domain glikosiltransferase dalam PpSus5 memanjang dari residuThe results of the expression analysis of SUS family genes at
570-736 dengan 12 heliks-a dan 7 b-helai (Suplementasi Gambar.different growth periods in the same or different tissues may be
S1 dan Gambar. S2). Struktur tersier PpSus5 atau PpSus6 hanyaused in predicting their potential roles in various developmental and
sekitar seperempat dari yang ada di PpSus1 hingga PpSus4 (Gbr. 5).metabolic processes in plants. To better understand the possible
roles of the six PpSus genes in 'Troubador', the transcription levels
Phylogenetic relationship between PpSus proteins and other of these genes were examined in four kinds of tissues (fruits, leaves,
plant Sus homologs phloem, and flowers) in different stages of development using qRT-
PCR analysis. As shown in Fig. 7, except for PpSus1, whose
To further categorize the PpSus protein family, and execute atranscripts were almost undetectable in leaves and in older phloem
detailed investigation of evolutionary relationships among SUStissues examined, and PpSus2 and PpSus4,
family genes in peach and ten other plants, a phylogenetic tree
based on multiple sequence alignment of the Sus proteins from
dicots and monocots (Table 2), as well as peach, was generated
(Fig. 6). Following the group classification of genes in Arabidopsis
in a previous report (Baud et al. 2004) and the phylogenetic tree
from eleven species with 55 protein sequences in this study, six Sus
proteins in peach were distinguished to be 3 groups categorized as I,
II, and III, which correspond to groups I to III as earlier classified in
the SUS genes, with 0 referring to phase 0, 1 to phase 1, and 2 to phase 2.
Populus (Zhang et al. 2011), cotton (Chen et al. 2012), SaccharumUpstream and downstream are indicated by thick blue lines at the ends (color
(Zhang et al. 2013a), and barley (Cristina et al. 2011). PpSus1,figure online)
PpSus2 to PpSus4, PpSus5, and PpSus6 were classified into groups
Acta Physiol Plant (2015) 37:81 Page 9 of 15 81

Fig. 3 Motif distribution of SUS family proteins in peach. Motifs of SUS family
proteins were elucidated using the MEME web server. Each motif is represented
by a number in the colored box. The height
Fig. 4 Summary sequence LOGO and regular expression of each motif shared by of the stack. The black letter below the sequence logo is a regular expression
SUS family proteins in peach. Sequence logo contains stacks of letters at each (RE) describing the motif. In each column, all letters with observed frequencies
position in the motif. The total height of the stack is the ''information content'' of greater than 0.2 are shown; less-frequent letters are not included in the RE.
that position in the motif in bits. The height of the individual letters in a stack is MEME regular expressions are interpreted as follows: single letters match that
the probability of the letter at that position multiplied by the total information letter; groups of letters in square brackets match any of the letters in the group
content

whose transcripts could not be detected in flowers, the other

PpSus3, PpSus5, and PpSus6 transcripts were ob- served in all
tissues and showed distinct expression patterns as the tissues
developed. PpSus1 showed clear tissue- specific expression
characteristics, being undetectable in leaves, but it also had
developmental stage-specific ten- dency where its transcripts were
almost unnoticeable in phloem collected 70 DAFB and extremely
weak at 105 DAFB. Its expression was, however, quite high in
mature fruit. Similarly, the transcript level for PpSus3 was highest
in mature fruit, although it had gradually decreased from the 30
DAFB to the 70 DAFB. In leaves, PpSus3 showed

123
equal levels of transcripts as the leaf developed from the 45 DAFB
to the 105 DAFB, which was twofold that seen at 30 DAFB. Both
PpSus5 and PpSus6 transcripts showed the highest level in young
fruit, and then a gradual increase was observed as the fruit
developed until harvest. In ad- dition, PpSus5 and PpSus6 had
similar expression ten- dencies in leaves at different stages of
development. Expression of PpSus5 exhibited a gradual decrease as
the phloem developed from 30 DAFB to 105 DAFB. The highest
abundance of transcripts for PpSus6 was observed in phloem on the
70 DAFB, followed by levels at 105 DAFB with both levels being
far higher than those in other
of the motif ''block'' is proportional to -log (p value), truncated at the height for a
motif with ap value of 1e-10. The details of individual motif are provided in
Table 6 (color figure online)
81 Page 10 of 15 Acta Physiol Plant (2015) 37:81
 Discussion

Verification of PpSus family gene

With the public release of whole-genome sequence of model plants,

more and more genes of SUS family have been purified and
characterized from different plant spe- cies. Although peach, as a
model representative of the Rosaceae family, has a complete
genome sequence avail- able, information concerning the entire
family of Sus genes in peach is limited. As a result, prediction and
charac- terization of peach SUS family gene is a necessary and

123
workable research. A single gene encoding the Sus isoform PpSus1
(Accession No. JQ412752) had earlier been iden- tified in the peach
'Xiahui6' (Zhang et al. 2013b). In this study, a comprehensive
analysis of genes encoding Sus proteins in the peach genome was
performed, resulting in the identification of six PpSus family genes,
including PpSus1. The sequence similarity of amino acid, position
of intron/exon, and structure of protein, as well as the ex- pression
profile in different tissues, was characterized. Sequences of the six
amino acids all had the typical feature of SUS family verified in
previous studies, particularly with the sucrose synthase and the
Fig. 5 Tertiary structures of all SUS family proteins in peach. Analysis of tertiary glucosyltransferase do- mains, which were identified from the pfam
structures was done using the online server ExPaSy Swiss-Modelprotein families database (Finn et al. 2014). The number of Sus
(http://swissmodel.expasy.org), which auto- matically causes amino acid
genes in peach is typical of that in other plants.
sequences to form tertiary protein structures through homology-modeling
tertiary structures. The
Phylogenetic relationship between PpSus proteins and other
stages of phloem development. PpSus4 was highly ex- pressed in plant Sus homologs
phloem at 70 DAFB and had lower expression levels in phloem at
the other three stages examined. Overall, PpSus4 was slightly The availability of the complete genome sequence of peach and the
expressed in fruits but was almost undetectable in fruits on the 70 previous identification of SUS family genes from other plant
DAFB. In addition, transcripts of PpSus4 increased with leaf species (Cristina et al. 2011; Zhang et al. 2011, 2013a; Chen et al.
development from the 30 DAFB to the 70 DAFB but declined at 2012) facilitated a comparison of PpSus gene and group, using the
fruit harvest. The transcripts of PpSus1, PpSus3, and PpSus5 all classification of these genes in Arabidopsis (Baud et al. 2004) as a
showed increased tendency during flower development, whereas criterion. Historically,
the transcript level measured for PpSus6 were constant in the structures in the circles at bottom left corners are the thumbnail with size 3.23 9
flowers studied. 3.23 cm of that for PpSus5 and PpSus6, respectively. Estimated per-residue
inaccuracy is visualized using a color gradient from blue (more reliable regions)
to red (potentially unreliable region) (color figure online)
Acta Physiol Plant (2015) 37:81 Page 11 of 15 81
 dicots and monocots species ap- peared before the duplication
events of multiple genes. Furthermore, PpSus1 was clustered with
the first branch next to Pisum sativum, citrus, and other homologs
of dicots in our phylogenetic tree, which suggests that a gene du-
plication event that generated PpSus1 appeared before the
separation of cotton/citrus/Arabidopsis/Popular/Pisum

It is widely considered that the length and position of in- tron–exon

provide valuable information regarding evolu- tionary relationships
of genes (Hu and Liu 2011). Our schematic structure analysis
indicates that having 11–13 introns for Sus genes is a feature in
peach (Table 6; Fig. 2). This finding in peach is consistent with that
studied pre- viously in cotton, where five (71 %, GaSus1, GaSus3,
GaSus4, GaSus6, GaSus7) out of seven Gossypium ar- boreum
SUS members had 11–14 introns in their coding regions and the
other two contained 9 (GaSus5) and 10 (GaSus2) introns (Chen et
al. 2012). Similarly, the number of introns in the coding sequence
ranged from 11 to 14 among the seven PtrSus genes of Populus
trichocarpa (Zhang et al. 2011). Moreover, AtSus1, AtSus5,
PpSus1, and PpSus5 each have 12 introns (Baud et al. 2004). These
observations indicate that these similar characteristics of SUS
family genes among plants (both dicots and mono- cots) may
contribute to their functional similarity within the same group.
The MEME tool is widely used to analyze uploaded
sequences for similarities among DNA or protein se- quences and to
Fig. 6 Phylogenetic analysis of PpSus proteins and other plant Sus homologs. form a motif for each sequence. The combined p value represents
Unrooted phylogenetic tree of plant Sus proteins con- structed using thethe combined best matches of a sequence to a group of motifs. In
neighbor-joining method with the MEGA 6.0 program. The accession numbers this study, p value of the six peach proteins appeared to be zero (Fig.
of Sus genes and their correspond- ing plant species are listed in Table 3 3), indicating that the sequence similarity among these proteins is
ex- tremely high. This result may confirm that members within a
given family could have common and recent evolutionary origins.
Sus proteins of a family are divided into three subfamilies or groups
In contrast, among the six proteins in the peach SUS family, there is
through comparison of phylogenetic and mole- cular structure of
no motif repeated twice or thrice with members of a protein having
sequences found in other plant species. In this study, the
the same number of motifs. Remarkably, all the motif positions for
phylogenetic analysis result of peach PpSus genes together with
each member are invariant or highly conserved without any
other plant homologs corroborated this classification, and was
insertion or deletion an indication that Sus proteins have the
consistent with previous statement that higher plant species may
potential to recognize the same target genes. However, the highly
have at least one gene for each of the three groups (Hirose et al.
conserved motif number and position among members in SUS
2008) (Fig. 6). All these similar traits indicate that the SUS family
family in peach also implies that these members may have similar
genes have a highly conserved feature during evolution or during
functions or a complex pattern of overlapping functions because, as
the separation process of various plant species. The presence of
concluded previously, members of a protein family that share same
PpSus1 in the SUS group I, which was grouped together with 20
motifs seem to have similar functions (Hu and Liu 2011).
other genes of dicot SUS I and separated from 12 genes of monocot
SUS I, is an obvious illustration that the divergence within both
sativum/Solanum tuberosum from a common ancestor. Because all
the three groups are present in monocot and in dicot systems, it is
probable that the major diversification of this family predates the
monocot–dicot divergence. Considering the phylogenetic tree and
the intron–exon or- ganization, it can be deduced that the PpSus1
might have an earlier divergent evolution than the PpSus2 to
 PpSus6 from the same ancestor.

Characteristics and structure of members of the

PpSus family
81 Page 12 of 15 Acta Physiol Plant (2015) 37:81
 peach. Relative transcript levels were measured by quantitative real-time PCR,
using TEF2 and RPII as reference genes. The tissues used in this study were
fruits, leaves, phloem, and flowers

The diversity of three-dimensional protein folds ob- served

in nature is the result of the differences in physical– chemical
properties of amino acid sequences or the primary

123
structure composed of side chains. Early studies reported that the
three-dimensional structure of a protein depends on its amino acid
sequence (Anfinsen et al. 1961; Anfinsen
collected on the 7th of May, the 22nd of May, the 16th of June, and the 22nd of
July, respectively. All values are the means of at least three measurements

Fig. 7 Relative expression profile of six PpSus genes in different tissues of

Acta Physiol Plant (2015) 37:81 Page 13 of 15 81
1973). Although the protein sequences in the SUS family
new group (group III) together with AtSus5/6 of Ara- are different, the protein tertiary structures are similar for
bidopsis and with OsSus5/6 of rice, which have been ob- PpSus1 to PpSus4 in this study (Fig. 5). This observation
served to be mainly expressed in leaves (Zhang et al. 2011; can be somewhat explained because protein sequences are
Hirose et al. 2008). However, for group III members in less conserved than their protein structures, and two se-
peach, PpSus5 and PpSus6, more transcripts were observed quences that share more than 30 % identity are found to
in the phloem compared with those levels in leaves at have similar tertiary structures (Mona 2001).
different developmental stages. In addition, in Arabidopsis, With molecular weight of 92.62, 91.31, 73.08, and
Baud et al. (2004) did not found high expression level of 86.58 kDa, the four Sus isoforms (PpSus1 to PpSus4) are
AtSus5 and AtSus6 in leaf. These findings indicated that the found to be tetramers. These structural properties are
expression levels of the paralogous genes, which belong to consistent with those observed for Sus in other plant spe-
the same group in a given tissue among species, were not cies, such as sugarbeet root (Klotz et al. 2003), Arabidopsis
conserved. We deduced that numerous aspects influence (Zheng et al. 2011), sugarcane (Schafera et al. 2005), and
the expression of these genes because their roles and sugar pear (Tanase and Yamaki 2000). Consistent with previous
content can differ from species to species and can change report in Arabidopsis (Zheng et al. 2011), each tetramer for
during the development of a given tissue. In addition, the PpSus1 to PpSus4 is a rather flat oligomer and displays two
differences in expression patterns of paralogous genes classes of subunit interfaces (Fig. 5), which results in a
might result from the structural differences. As proved in large hole in the center of the oligomer. PpSus5 and
potato previously, the leader intron and combined functions PpSus6, with molecular mass 94.72 and 101.40 kDa, have
of the 50 flanking and 30 sequences were all essential for similar monomeric forms. These biophysical analyses
expression level of Sus4, because all these factors can af- indicated that not all Sus is a tetrameric enzyme with a
fect the regulation in the transcriptional and post-transla- 80–94 kDa subunit as reported by Matic et al. (2004).
tional level by sugars (Fu et al. 1995a, b). Similar to findings obtained by Duncan and Huber (2007)
AtSus5 and AtSus6, which belong to group III, showed who stated that Sus can form both dimers and tetramers,
not only the same expression tendency but also the same our data suggested that the six peach Sus isozymes iden-
expression levels in the roots, stems, leaves, and flowers. tified in this study exist both in tetramer and monomer
Moreover, AtSus2 and AtSus3, which belong to group II, forms, the majority form of PpSus being tetramer.
also exhibited almost identical expression tendency and levels in the same four tissues (Baud et al. 2004). In our Expression
level of PpSus genes at different
study, this phenomenon was also observed for PpSus5 and developmental stages
PpSus6 in fruits and leaves in peach but not in phloem and flowers. These observations indicated that the expression The six
PpSus genes displayed differential but partially
levels of the paralogous genes, which belong to the same overlapping expression patterns (Fig. 7). The transcription
group in a given species among different tissues, were data indeed provide direct evidence for the strong expres-
somewhat conserved. sion of some PpSus genes (PpSus1, PpSus3, and PpSus5)
Contrary to PpSus1, PpSus5 was expressed at higher in peach fruit (Fig. 7). The relative high expression levels
level in early developing fruits compared with the other of these PpSus genes suggested that PpSus plays a key role
developmental stages in fruit and displayed gradual in- in fruit development and in sucrose metabolism in peach.
creasing tendency from the 45 DAFB to the 70 DAFB in Among the six PpSus family members, PpSus1 was pre-
fruits. These suggest that PpSus5 may play not only a dominantly expressed in mature fruits compared with the
major role in the early stage of fruit development but also other paralogs in peach, suggesting that PpSus1 may be
some roles in the subsequent stages of development. The associated with fruit development and with sucrose meta-
strong transcription levels of PpSus4 and PpSus6 in phloem bolism. Both CuSus1 in citrus and PpSus1 belong to group
implies that PpSus4 and PpSus6 may play important role in I, whereas PpSus2 to PpSus4 and CuSusA belong to group
regulating developmental process of phloem and supplying II in the phylogenetic tree (Komatsu et al. 2002). However,
energy for phloem loading in peach. Interestingly, of the the transcript level of CuSus1 was maximal for fruit at the
six PpSus genes, PpSus1 is not only the oldest duplicated immature stage, whereas PpSus1 exhibited the highest
gene but also the only one that is highly expressed in fruit level in mature fruit. In addition, the transcript level of
but not detectable in leaf. CuSusA was low in edible tissue at the immature stage and
In conclusion, this research has taken us a step further in increased with maturation. PpSus2 to PpSus4 showed the
understanding basic information regarding the SUS family lowest transcript levels in the fruit on the 70 DAFB, fol-
in peach. Phylogenetic and comparative analyses of SUS lowed by an increase until the fruit matured. Similarly,
genes and proteins in peach will act as an important step PtrSus4/5 and PtrSus6/7 were closely clustered in class
toward further functional analysis of the Sus gene family
123
81 Page 14 of 15 Acta Physiol Plant (2015) 37:81
by reverse genetic approaches. We also deduce that these PpSus genes might play different roles in the sucrose metabolism
pathway of different tissues or even different developmental stages of the same tissue. Characterizing the knockout or
overexpression mutants of these PpSus genes would be helpful in verifying such functional estimation. The results will assist
in mining candidate genes for de- tailed characterization and provide useful information re- garding the breeding of new
peach cultivars that may have a sweeter flavor.
Author contribution statement CHZ and MLY con- tributed to the experimental design and manuscript draft- ing. CHZ, ZJS
performed the HMM analysis, primer design, Sus genes cloning and qRT-PCR validation. CHZ and BBZ performed the
RNA extraction and bioinformat- ics analysis. RJM and KNK contributed to the manuscript editing and revision. All authors
have read and approved the final manuscript.
Acknowledgments This research was financially supported by the Independent Innovation Scientific Research Foundation of Jiangsu Province (No.
CX(13)5018) and China Agriculture Research System (No. CARS-31). The authors also thank Prof. Jinggui Fang from Nanjing Agricultural
University for providing valuable comments and suggestions for the manuscript.
Conflict of interest The authors declare that they have no com- peting interests.
References
Amor Y, Haigler CH, Johnson S, Wainscott M, Delmer DP (1995) A membrane-associated form of sucrose synthase and its potential role in
synthesis of cellulose and callose in plants. Proc Natl Acad Sci USA 92:9353–9357 Anfinsen BC (1973) Principles that govern the folding of protein
chains. Science 181(4096):223–230 Anfinsen BC, Haber E, Sela M, White F (1961) The kinetics of formation of native ribonuclease during
oxidation of the reduced polypeptide chain. Proc Natl Acad Sci 47:1309–1314 Bailey TL, Williams N, Misleh C, Li WW (2006) MEME:
discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res 34:369–373 Baud S, Vaultier MN, Rochat C (2004) Structure and
expression profile of the sucrose synthase multigene family in Arabidopsis. J Exp Bot 55:397–409 Bustin SA, Benes V, Garson JA, Hellemans J,
Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009) The MIQE guidelines: minimum
information for publication of quantitative real-time PCR experiments. Clin Chem 55(4):611–622 Cermain V, Ricard B, Raymond P, Saglio PH
(1997) The role of sugars, hexokinase, and sucrose synthase in the determination of hypoxically induced tolerance to anoxia in tomato roots. Plant
Physiol 14:167–175 Chen AQ, He S, Li FF, Li Z, Ding MQ, Liu QP, Rong JK (2012) Analyses of the sucrose synthase gene family in cotton:

123
structure, phylogeny and expression patterns. BMC Plant Biol 12:85 Cho JI, Kim HB, Kim CY, Hahn TR, Jeon JS (2011) Identification and
characterization of the duplicate rice sucrose synthase genes OsSUS5 and OsSUS7 which are associated with the plasma membrane. Mol Cells
31:553–561 Coleman HD, Yan J, Mansfield SD (2009) Sucrose synthase affects carbon partitioning to increase cellulose production and altered cell
wall ultrastructure. Proc Natl Acad Sci USA 106:13118–13123 Cristina BS, Sara HA, Pablo GM, Pilar C (2011) Structure, expression profile and
subcellular localisation of four different sucrose synthase genes from barley. Planta 234:391–403 Duncan KA, Huber SC (2007) Sucrose synthase
oligomerization and F-actin association are regulated by sucrose concentration and phosphorylation. Plant Cell Physiol 48(11):1612–1623 Finn RD,
Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, Heger A, Hetherington K, Holm L, Mistry J, Sonnhammer ELL, Tate J, Punta M (2014)
The pfam protein families database. Nucleic Acids Res (Database Issue) 42:222–230 Fu HY, Kim SY, Park WD (1995a) A potato Sus3 sucrose
synthase gene contains a context-dependent 30 element and a leader lntron with both positive and negative tissue-specific effects. Plant Cell
7:1395–1403 Fu HY, Kim SY, Park WD (1995b) High-leve1 tuber expression and sucrose lnducibility of a potato Sus4 sucrose synthase gene
require 50 and 30 flanking sequences and the leader intron. Plant Cell 7:1387–1394 Geigenberger P (2003) Regulation of sucrose to starch
`
conversion in HaE nggi growing E, Fleming potato AJ tubers. (2001) J Exp Sucrose Bot 54(382):457–465
synthase expression pattern in young maize leaves: implications for phloem transport. Planta 214:326–329 Harada T, Satoh S, Yoshioka T, Ishizawa
K (2005) Expression of sucrose synthase genes involved in enhanced elongation of pondweed (Potamogeton distinctus) turions under anoxia. Ann
Bot 96:683–692 Hirose T, Scofield GN, Terao T (2008) An expression analysis profile for the entire sucrose synthase gene family in rice. Plant Sci
174:534–543 Horst I, Welham T, Kelly S, Kaneko T, Sato S, Tabata S, Parniske M, Wang TL (2007) TILLING mutants of Lotus japonicus reveal
that nitrogen assimilation and fixation can occur in the absence of nodule-enhanced sucrose synthase. Plant Physiol 144:806–820 Hu LF, Liu SQ
(2011) Genome-wide identification and phylogenetic analysis of the ERF gene family in cucumbers. Genetics Mol Biol 34(4):624–633 Joshi CP,
Bhandari S, Ranjan P, Kalluri UC, Liang XE, Fujino T, Samuga A (2004) Genomics of cellulose biosynthesis in poplars. New Phytol 164:53–61
Kiefer F, Arnold K, Ku ̈nzli M, Bordoli L, Schwede T (2009) The SWISS-MODEL repository and associated resources. Nucleic Acids Res
37:D387–D392 Kleczkowski LA, Kunz S, Wilczynska M (2010) Mechanisms of UDP-Glucose synthesis in plants. Crit Rev Plant Sci 29:191–203
Klotz KL, Finger FL, Shelver WL (2003) Characterization of two sucrose synthase isoforms in sugarbeet root. Plant Physiol Biochem 41:107–115
Koch KE, Wu Y, Xu J (1996) Sugar and metabolic regulation of genes for sucrose metabolism: potential influence of maize sucrose synthase and
soluble invertase responses on carbon partitioning and sugar sensing. J Exp Bot 47:1179–1185 Komatsu A, Moriguchi T, Koyama K, Omura M,
Akihama T (2002) Analysis of sucrose synthase genes in citrus suggests different roles and phylogenetic relationships. J Exp Bot 53:61–71
Acta Physiol Plant (2015) 37:81 Page 15 of 15 81
Lee JJ, Woodward AW, Chen ZJ (2007) Gene expression changes and
Sturm A, Tang GQ (1999) The sucrose-cleaving enzymes of plants early events in cotton fibre development. Ann Bot 100:
are crucial for development, growth and carbon partitioning. 1391–1401
Trends Plant Sci 4:401–407 Lerchl J, Geigenberger P, Stitt M, Sonnewald U (1995) Impaired
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S photoassimilate partitioning caused by phloem-specific removal
(2011) MEGA5: molecular evolutionary genetics analysis using of phyrophosphate can be complemented by a phloem-specific
maximum likelihood, evolutionary distance, and maximum cytosolic yeast-derived invertase in transgenic plants. Plant Cell
parsimony methods. Mol Biol Evol. doi:10.1093/molbev/msr121 7:259–270
Tanase K, Yamaki S (2000) Purification and characterization of two Lingle SE (1999) Sugar metabolism during growth and development
sucrose synthase isoforms from Japanese pear fruit. Plant Cell in sugarcane internodes. Crop Sci 39(2):480–486
Physiol 41:408–414 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
Tong ZG, Gao ZH, Wang F, Zhou J, Zhang Z (2009) Selection of data using real-time quantitative PCR and the 2ÀDDCT method.
reliable reference genes for gene expression studies in peach Methods 25:402–408
using real-time PCR. BMC Mol Biol 10:1–13 Lutfiyya LL, Xu NF, D'Ordine RL, Morrell JA, Miller PW, Duff
Tupy J, Primot L (1982) Sucrose synthetase in the latex of Hevea SMG (2007) Phylogenetic and expression analysis of sucrose
brasiliensis Muell Arg. J Exp Bot 33:988–995 phosphate synthase isozymes in plants. J Plant Physiol
Wang F, Sanz A, Brenner ML, Smith A (1993) Sucrose synthase, 164:923–933
starch accumulation, and tomato fruit sink strength. Plant Marchler-Bauer A, Lu SN, Anderson JB, Chitsaz F, Derbyshire MK,
Physiol 101:321–327 DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR,
Wang YJ, Deng DX, Bian YL, Lv YP, Xie Q (2010) Genome-wide Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F,
analysis of primary auxin-responsive Aux/IAA gene family in Marchler GH, Mullokandov M, Omelchenko MV, Robertson
maize (Zea mays. L.). Mol Biol Rep 37:3991–4001 CL, Song JS, Thanki N, Yamashita RA, Zhang D, Zhang N,
Xiao XH, Tang CR, Fang YJ, Yang M, Zhou BH, Qi JY, Zhang Y Zheng C, Bryant SH (2011) CDD: a conserved domain database
(2013) Structure and expression profile of the sucrose synthase for the functional annotation of proteins. Nucleic Acids Res
gene family in the rubber tree: indicative of roles in stress Matic 39:D225–D229
̊
S, A kerlund HE, Everitt E, Widell S (2004) Sucrose synthase

123 response and sucrose utilization in the laticifers. FEBS J 281:291–305 isoforms in cultured tobacco cells. Plant Physiol Biochem
Zhang DQ, Xu BH, Yang XH, Zhang ZY, Li BL (2011) The sucrose 42:299–306
synthase gene family in Populus: structure, expression, and Mona S (2001) Predicting protein secondary and supersecondary
evolution. Tree Genetics Genomes 7:443–456 structure. Princeton University, CRC Press, LLC 29:3–5
Zhang JS, Arro J, Chen YQ, Ming R (2013a) Haplotype analysis of Ruan YL, Llewellyn DJ, Furbank RT (2003) Suppression of sucrose
sucrose synthase gene family in three Saccharum species. BMC synthase gene expression represses cotton fiber cell initiation,
Genomics 14:314 elongation, and seed development. Plant Cell 15:952–964
Zhang CH, Shen ZJ, Zhang YP, Han J, Ma RJ, Nicholas KK, Yu ML Schafera WE, Rohwerb JM, Bothac FC (2005) Partial purification and
(2013b) Cloning and expression of genes related to the sucrose characterisation of sucrose synthase in sugarcane. J Plant Physiol
metabolizing enzymes and carbohydrate changes in peach. Acta 162:11–20
Physiol Plant 35:589–602 Schmalstig JG, Hitz WD (1987) Contributions of sucrose synthase
Zheng Y, Anderson S, Zhang YF, Garavito RM (2011) The structure and invertase to the metabolism sucrose in developing leaves.
of sucrose synthase-1 from Arabidopsis thaliana and its func- Plant Physiol 85:407–412
tional implications. J Biol Chem 41:36108–36118 Schrader S, Sauter JJ (2002) Seasonal changes of sucrose-phosphate
Zrenner R, Salanoubat M, Willmitzer L, Sonnewald U (1995) synthase and sucrose synthase activities in poplar wood (Populus
Evidence of the crucial role of sucrose synthase for sink strength 9 Canadensis Moench 'robusta') and their possible role in
using transgenic potato plants (Solanum tuberosum L.). Plant J carbohydrate metabolism. J Plant Physiol 159(8):833–843
7:97–107