Anda di halaman 1dari 12

LETAK HSP 27 PADA ZEBRAFISH

Letak heat shock protein (Hsp27) dan alpha-B crystallin dalam zebrafish pada jaringan embrio termasuk
otot rangka dan jantung. Namun, fungsi dari protein ini selama perkembangan embrio tidak dipahami,
Baru-baru ini telah menunjukkan konstitutif dan menekankan ekspresi diinduksi dari homolog Hsp27
manusia dalam ikan zebra dewasa, model eksperimental penting proses perkembangan vertebrata. Di
sini, kami menilai dinamika temporospatial dari ikan zebra Hsp27 (hsp27) dan alpha-B crystallin (cryab)
ekspresi gen menggunakan reverse-transcriptase PCR (RT-PCR) dan ekspresi hsp27 oleh hibridisasi in
situ. Hasil kami menunjukkan bahwa peningkatan regulasi awal ekspresi hsp27 terjadi selama gastrulasi
di awal dan Ekspresi hsp27 terdeteksi secara sementara dalam mengembangkan miotom, lensa dan
otak, dan lebih terus-menerus dalam mengembangkan jantung.
EKSPRESI DAN FUNGSI DARI HEAT SHOCK PROTEIN HSP27 selama embriogenesis ikan zebra

DAFTAR PUSTAKA
Gene Expr Patterns. 2006 Jan;6(2):127-33. Epub 2005 Dec 2.
Developmentally regulated gene expression of the small heat
shock protein Hsp27 in zebrafish embryos.
http://www.ncbi.nlm.nih.gov/pubmed/16326146/

Ekspresi konstitutif dari Hsp27 telah dibuktikan dalam embrio vertebrata, terutama dalam
mengembangkan otot rangka dan jantung. Hasil beberapa penelitian sebelumnya telah menunjukkan
bahwa Hsp27 bisa memainkan peran dalam pengembangan jaringan ini. Sebagai contoh, penghambatan
ekspresi Hsp27 telah dilaporkan menyebabkan pengembangan cacat myoblasts mamalia in vitro dan in
vivo embrio katak. Sebaliknya, tikus transgenik kekurangan Hsp27 berkembang secara normal. Di sini,
kita meneliti distribusi protein Hsp27 dalam mengembangkan dan ikan zebra dewasa dan efek menekan
ekspresi Hsp27 menggunakan oligonukleotida phosphorodiamidate morfolino (PMO) pada
pengembangan ikan zebra. Konsisten dengan analisis kami sebelumnya ekspresi hsp27 RNA, kami
mendeteksi protein Hsp27 dalam otot jantung, halus, dan tulang dari kedua ikan zebra embrio dan
dewasa. Namun, embrio kurang terdeteksi Hsp27 setelah injeksi antisense hsp27 PMO dipamerkan tarif
denyut jantung sebanding dengan embrio kontrol dan morfologi jantung tidak bisa dibedakan dengan
adanya atau tidak adanya Hsp27. Kehilangan Hsp27 juga tidak berpengaruh pada struktur miotom otot
rangka pada embrio berkembang. Akhirnya, embrio disuntik dengan antisense hsp27 dan orak-arik
kontrol PMO ditampilkan motilitas sama. Kami menyimpulkan bahwa Hsp27 adalah dibuang untuk
morfogenesis ikan zebra tapi bisa memainkan peran dalam perawatan jangka panjang jantung dan otot
jaringan.

Kata kunci: Hsp27, Hsp70, otot, jantung, Zebrafish
Ke:
PENDAHULUAN
Heat shock protein memainkan peran penting dalam semua tahap kehidupan organisme. Fungsi
terkenal heat shock protein termasuk lipat protein baru lahir dan pelipatan protein rusak akibat cedera
termal dan tekanan lainnya. Fungsi vital lainnya termasuk partisipasi sebagai kofaktor dalam sinyal
reseptor-mediated (Pearl dan Prodromou 2006), protein perancah untuk sinyal elemen (Rane et al.
2003), pemeliharaan pengurangan / oksidasi seluler (redoks) negara (Arrigo 2001), dan stabilisasi array
cytoskeletal (untuk review perwakilan, lihat Mounier dan Arrigo 2002). Tinggi berat molekul protein heat
shock menggunakan energi adenosin trifosfat (ATP) untuk mengubah atau menstabilkan konformasi
protein lainnya, sehingga mencegah misfolding atau memulihkan lipat yang normal protein target.
Sebaliknya, heat shock protein kecil (sHsps) kurang aktivitas ATPase tetapi dapat menjalani tergantung
fosforilasi transisi antara oligomer berat molekul tinggi dan subunit kecil (Lambert et al. 1999).

Hsp27, juga dikenal sebagai HspB1, adalah salah satu protein heat shock dinyatakan paling banyak dan
didistribusikan kecil. Ekspresi Hsp27 diregulasi dalam menanggapi cedera subletal oleh epitel (Kiriyama
et al 2001;. Bonham et al 2003.), Neuronal (Costigan et al 1998;. Dodge et al 2006.), Otot (Knoll et al
1994;. Van . de Klundert et al 1998), dan jenis sel lain, dan orthologs dari Hsp27 manusia ditemukan
pada mamalia, burung, ikan, dan amfibi (Gernold et al 1993;. Norris et al 1997;. Kawazoe et al 1999;.
Mao et al 2005;. Tuttle et al 2007).. Ekspresi Perubahan dan peraturan Hsp27 telah dibuktikan dalam
saraf dan otot jaringan sebagai konsekuensi dari cedera (Yoshida et al 1999;. Sakamoto et al, 2000.),
Penyakit, dan penuaan (Chung dan Ng 2006 (Clemen et al 2005.); Yamaguchi et al. 2007). Berbagai
fungsi untuk Hsp27 dalam sel terluka telah diusulkan, termasuk fungsi pendamping, modulasi sinyal
kaskade apoptosis (Garrido et al 1999 (Jakob et al 1993.);. Charette et al 2000;. Pandey et al 2000;. Rane
et al 2003), dan pengaturan tingkat redoks selular dan glutathione (Arrigo 2001;. Escobedo et al 2004)..
Selain itu, Hsp27 dapat berinteraksi dengan elemen-elemen cytoskeletal dan menstabilkan array
cytoskeletal dalam sel terluka (Lavoie et al. 1993a, b). Banyak fungsi-fungsi ini juga dilakukan oleh heat
shock protein lainnya, dan ada bukti bahwa heat shock protein kecil dapat bertindak, setidaknya
sebagian, sebagai cochaperone untuk berat molekul tinggi heat shock protein seperti Hsp70 (untuk
review, lihat Haslbeck et al. 2005).

Selain stres-diinduksi ekspresi, hsp27, bersama dengan gen untuk sejumlah heat shock protein terkait
kecil, dinyatakan dalam beberapa jaringan tanpa adanya stres, termasuk semua jenis sel-sel otot
(Dillmann 1999; Benndorf dan Welsh 2004). Peran konstitutif Hsp27 tidak sepenuhnya dipahami.
Upregulation ekspresi hsp27 terlihat dalam membedakan myoblasts in vitro (Davidson dan Morange
2000;. Ito et al, 2001), serta sel-sel otot berkembang dari murine dan amfibi embrio (Gernold et al
1993;.. Tuttle et al 2007). Demikian pula, kita dan orang lain telah melaporkan ekspresi otot-sel spesifik
Hsp27 di miotom mengembangkan embrio ikan zebra (Mao et al 2005;. Marvin et al 2008.). Antisense
hsp27 messenger RNA (mRNA) ekspresi juga menghambat pengembangan myoblasts murine (Davidson
dan Morange 2000) dan menginduksi kematian sel sel induk embrionik (Mehlen et al. 1997) in vitro.
Baru-baru ini, knockdown ekspresi Hsp27 menggunakan oligonukleotida phosphorodiamidate morfolino
(PMO) dilaporkan menyebabkan cacat dalam pembentukan jantung dan arsitektur miofibril di kedua
otot rangka dan jantung berkembang embrio katak (Brown et al. 2007). Bersama-sama, hasil ini
menunjukkan bahwa Hsp27 mungkin diperlukan untuk diferensiasi sel-sel otot. Sebaliknya, Drosophila
embrio kurang homolog Hsp27 manusia berkembang secara normal dan, yang mengejutkan, hilangnya
Hsp27 tidak mengubah resistensi lalat panas shock atau luka oksidatif (Hao et al. 2007). The Drosophila
homolog Hsp27 tidak memiliki serines terfosforilasi dilestarikan antara homolognya vertebrata dari
Hsp27 (Ingolia dan Craig 1982) dan menampilkan lokalisasi konstitutif ke inti sel di bawah kondisi kontrol
(Marin dan Tanguay 1996) tidak khas vertebrata Hsp27. Oleh karena itu, tidak jelas bahwa perbandingan
langsung antara peran vertebrata dan Drosophila Hsp27 sesuai. Namun, perkembangan normal tikus
yang kekurangan Hsp27 akibat gangguan gen juga telah dilaporkan (Huang et al. 2007). Dengan
demikian, saat ini ada data yang bertentangan mengenai peran Hsp27 selama embriogenesis.

Dalam penelitian ini, kami telah meneliti konsekuensi seluler dan fisiologis sementara Hsp27 knockdown
pada embrio ikan zebra menggunakan injeksi antisense hsp27 PMO. Kami juga telah menghasilkan
antiserum cocok untuk immunolocalization dan imunoblotting deteksi ikan zebra Hsp27. Data yang
disajikan di bawah ini menunjukkan bahwa morfogenesis otot rangka dan fungsi dalam embrio ikan
zebra kurang terdeteksi Hsp27 yang bisa dibedakan dari embrio disuntik dengan kontrol PMO spesifik.
Penilaian frekuensi denyut jantung dan morfologi juga gagal menunjukkan fenotipe menyimpang dalam
ketiadaan Hsp27. Ekspresi konstitutif dan stres yang disebabkan dari Hsp70 tidak terpengaruh oleh
hilangnya Hsp27 dalam percobaan kami. Namun, Hsp27 diungkapkan dalam jaringan otot embrio dan
dewasa baik serta sejumlah kecil lokasi lain. Data ini menunjukkan bahwa Hsp27 memainkan peran
diabaikan dalam morfogenesis dari ikan zebra dan memberikan perspektif baru tentang pentingnya
fungsional Hsp27 in vivo. Secara khusus, temuan kami konsisten dengan peran Hsp27 dalam
pemeliharaan homeostasis jaringan otot.

Ke:
BAHAN DAN METODE
Peternakan ikan zebra dan eksperimental ikan zebra stres Dewasa, Danio rerio, dipelihara dan
dipertahankan seperti yang dijelaskan sebelumnya (Mao et al. 2005). Embrio dikumpulkan dari tipe liar
salib dan dipertahankan pada 26 ° C dalam media embrio seperti yang dijelaskan oleh Westerfield
(1993). Embrio yang panas terkejut pada 36 h postfertilization (hpf) dalam bak air beredar (IsoTemp
2150, Fisher Scientific, Pittsburgh, PA, USA) di parafilm-disegel 35-mm cawan Petri selama 30 menit
pada 39 ° C dan dibiarkan untuk memulihkan pada 26 ° C selama 14 jam sebelum pengambilan. Protokol
untuk penggunaan hewan dalam percobaan ini telah disetujui oleh Universitas Perawatan Hewan dan
Penggunaan Komite Washington State dan sesuai dengan Institut Nasional Standar kesehatan yang
ditetapkan oleh Pedoman Perawatan dan Penggunaan Hewan Percobaan.

Produksi Antiserum mendeteksi ikan zebra Hsp27 A coding DNA komplementer untuk ikan zebra Hsp27
(Mao et al. 2005) dikloning ke dalam vektor prokariotik pET45b (Novagen, Madison, WI, USA) dan
disajikan dalam Escherichia coli, saring BL21. Protein 6-Nya-tagged fusi dimurnikan menggunakan Talon
resin afinitas logam (Clontech Laboratories, Palo Alto, CA, USA) dan digunakan untuk menghasilkan
poliklonal Hsp27 antiserum (αHsp27) seperti yang dijelaskan oleh Monteville et al. (2003). Pre-kekebalan
dan αHsp27 sera diuji untuk pengakuan dimurnikan protein rekombinan dan ikan zebra Hsp27 disajikan
dalam fibroblast NIH3T3 (Mao et al. 2005) oleh Western blotting dan immunolocalization tidak langsung,
masing-masing (data tidak ditampilkan).

Elektroforesis gel SDS-poliakrilamid dan Western blotting Untuk analisis ekspresi selama
pengembangan, kolam sepuluh atau lebih embrio yang dingin dan disonikasi pada es sodium dodesil
sulfat poliakrilamida gel elektroforesis (SDS-PAGE) penyangga sampel (62,5 mM Tris / HCl (pH 6,8) , 2%
SDS, 0,01% bromofenol biru, 10% gliserol) dan sampel dibersihkan dengan sentrifugasi pada 10.000 xg
selama 10 menit pada 4 ° C. Untuk analisis jaringan (Gambar. 6), ikan zebra jantan dewasa yang
eutanasia dalam air es dan dibedah untuk memperoleh pilih jaringan. Potongan Jaringan direndam
dalam SDS-PAGE penyangga sampel yang mengandung 2,5 mM asam ethylenediaminetetraacetic (EDTA)
dan 1: 200 pengenceran Protease Inhibitor Cocktail (SigmaAldrich P8340). Konsentrasi protein diukur
menggunakan Bio-Rad DC Protein Assay Kit. Setelah menambahkan β-mercaptoethanol untuk
konsentrasi akhir 4%, protein dipisahkan menggunakan 4% akrilamida susun dan 12% berjalan gel.
Protein Terselesaikan dipindahkan ke membran (NitroBind, 0.22 pm, GE Air & Proses Technologies,
Philadelphia, PA, USA) dan diwarnai dengan Ponceau S untuk mengkonfirmasi beban merata dan
transfer protein. Imunoblotting dilakukan dengan menggunakan serum αHsp27 dijelaskan di atas,
antibodi anti-Hsp70 (poliklonal kelinci SPA-812, Stressgen, Inc), atau aktin antibodi antisarcomeric
(SigmaAldrich, clone 5C5) dan antibodi sekunder peroxidase-label. Bercak dikembangkan dan dianalisis
seperti yang dijelaskan sebelumnya (Mao et al. 2005). Setiap percobaan dilakukan setidaknya tiga kali.

Gambar. 6
Gambar. 6
Hsp27 immunolocalization dalam jaringan ikan zebra dewasa tanpa tekanan. Hsp27 terdeteksi di seluruh
miokardium jantung (Hrt) dan otot rangka, terutama di otot lambat-kedutan dan pada perbatasan
antara lambat dan internal yang otot berkedut cepat eksternal (...
Phosphorodiamidate microinjections morfolino oligonukleotida PMO diperoleh dari GeneTools, Inc
(Corvallis, OR, USA). Urutan PMO adalah: Hsp27 antisense (hsp27i), 5'GTTTTGAAGAGTTGTT
TTTCGGCTC3 ', dan orak-arik kontrol (scr), 5'GGAGCTTAGTGATGTTCTGTTCTTT3'. The hsp27i PMO yang
digunakan dalam studi kami adalah melengkapi bp -11-36 daerah 5'-diterjemahkan dari urutan hsp27
mRNA ikan zebra. Morfolino orak memiliki komposisi nukleotida identik dalam urutan acak. Sebuah
pencarian BLASTN lebih 37 juta urutan nukleotida ikan zebra dijelaskan diidentifikasi hanya satu urutan
(hsp27 / hspB1) dengan homologi yang signifikan untuk hsp27i. PMO dilarutkan dalam air steril baik
suling (lihat Gambar. 1c dan and3) 3) atau penyangga injeksi (0,4 mM MgSO4, 0,6 mM CaCl2, 0,7 mM
KCl, 58 mM NaCl, 25 mM HEPES pH 7.1) dan aliquot dibekukan pada -80 ° C. Embrio ikan zebra yang
disuntikkan seperti yang dijelaskan oleh Liu et al. (2007) pada satu sampai empat sel tahap
menggunakan mikromanipulator kasar Narishige dan MMPI-2 regulator tekanan pneumatik (Terapan
Ilmiah Instrumen, Inc, Eugene, OR, USA). Jarum ditarik dari tabung borosilikat kapiler (1.00 × 0.78 mm x
10 cm, Sutter Instrumen Co, Novato, CA, USA) menggunakan Sutter Instrumen pipet penarik (Model P-
87). Volume Injection (dinilai dengan menyuntikkan solusi menjadi minyak mineral dan menghitung
volume tetesan) adalah sekitar 1,8 nl. Dalam penelitian pendahuluan, penyuntikan kedua hsp27i dan scr
PMO pada konsentrasi 1 mM menyebabkan toksisitas embrio setara, yang dinyatakan sebagai
pengurangan ukuran pada 24 hpf, penampilan normal, jantung dan perkembangan otot batang, dan
bercak putih dari sel-sel mati, khususnya dalam mengembangkan otak (data tidak ditampilkan). Injeksi
PMO hsp27i pada konsentrasi 0.02 mM atau kurang memiliki sedikit atau tidak berpengaruh pada Hsp27
ekspresi (Gbr. 1b). Injeksi hsp27i PMO pada konsentrasi 0,1 dan 0,15 mM menghambat ekspresi Hsp27
tanpa mempengaruhi perkembangan atau perilaku embrio, relatif terhadap pelarut atau embrio scr-
PMO-disuntikkan (lihat "Hasil").

Gambar. 1
Gambar. 1
Deteksi Western blot Hsp27 dan Hsp70 pada embrio ikan zebra. kursus waktu perkembangan ekspresi
Hsp27. Angka adalah waktu sampel panen di jam postfertilization (hpf). b efek orak (scr) Konsentrasi dan
antisense hsp27 (hsp27i ...
Gambar. 3
Gambar. 3
Morfologi embrio ikan zebra tidak diubah oleh Hsp27 knockdown. morfologi keseluruhan embrio 24-hpf
setelah injeksi pada satu atau dua tahap sel dengan 0.15 mM-arik (scr) atau antisense hsp27 (hsp27i)
PMO. Skala bar = 1 mm. ...
Pelabelan Fluorescent embrio Untuk memvisualisasikan myofibrils, embrio difiksasi dalam
paraformaldehyde 4% di phosphate-buffered saline (PBS) selama 2 jam pada suhu kamar. Embrio
Seluruh diwarnai dengan rhodamine-berlabel Phalloidin (0,1 mg / ml) diencerkan dalam buffer lisis (20
mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM etilena glikol asam tetraacetic, 0,5% Triton X-100, pH 7.3)
semalam pada 4 ° C, kemudian dibilas dua kali selama 1 jam di PBS yang mengandung 0,5% Tween 20
(PBST). Embrio yang terpasang pada slide dengan Mowiol mengandung agen antifade (DABCO, Sigma
Chemical Co). Untuk memvisualisasikan miofibril jantung, ekor telah dihapus dari embrio berlabel dan
thorax dipasang di agarose. Gambar embrio diperoleh dengan menggunakan Zeiss LSM 510M mikroskop
confocal (Carl Zeiss Inc, Thornwood, NY, USA) dan × 20 1.2 NA tujuan gliserol perendaman. Serangkaian
melalui fokus gambar dalam dimensi Z dikumpulkan untuk setiap embrio pada interval 3-um. Untuk
deteksi Hsp27 in situ, seluruh embrio atau jaringan dewasa dibedah yang tetap selama 30 menit di 4%
formaldehida dalam PBST, permeabilized untuk> 2 jam dalam lisis penyangga dan kemudian dibekukan
dalam 100% OCT dengan pencelupan dalam nitrogen cair. Dua belas untuk cryosections 15-um-tebal
dipotong menggunakan cryotome Reichert-Jung (Cryocut Model 1800) dan ditempatkan pada coverslips
krom-gelatin subbed. Cryosections yang tetap untuk tambahan 10 menit di 4% formalin dan kemudian
diperiksa dengan αHsp27 serum dan antibodi sekunder fluorescein isothiocyanate-berlabel. Phalloidin
Fluorescent digunakan sebagai counterstain a. Gambar cryosections diperoleh dengan menggunakan
Zeiss Axiovert 200M dan didinginkan kamera charge-coupled device ORCA AG (Hamamatsu Photonics,
Bridgewater, NJ, USA). Waktu eksposur yang berbeda digunakan untuk fluorescein- gambar dan probe
rhodamine-label, tapi gambar itu dinyatakan diperoleh dengan menggunakan satu set kamera dan
pencahayaan parameter untuk semua embrio atau olahan jaringan. Postprocessing dilakukan dengan
menggunakan AxioVision 4.1 (Carl Zeiss, Inc) untuk mengatur intensitas gambar latar belakang menjadi
hitam. Manipulasi ini diterapkan secara simultan dan ekuivalen untuk semua gambar.

Uji motilitas dan jantung berdetak pengukuran batch tunggal embrio dibuahi dikumpulkan dan disuntik
dengan scr atau hsp27i PMO di 01:59 tahap sel. Embrio secara manual dechorionated pada 50 hpf dan
ditempatkan dalam sebuah piring berisi media embrio 10-cm Petri (Westerfield 1993) dalam ruang suhu
dikontrol pada 28,5 ° C. Gerakan ini diprakarsai oleh menyentuh embrio di sisi dan direkam
menggunakan camcorder digital (Panasonic Model PU-GS32). Video yang didigitalkan menggunakan
Jendela Movie Maker versi 5.1 (Microsoft Corp) pada 30 frame per detik dan disimpan sebagai file AVI,
kemudian dikonversi ke seri gambar menggunakan Quicktime player Pro untuk Windows versi 7.5.5
(Apple Inc). Potret yang diimpor pada enam frame per detik ke ImageJ versi 1.37 (Wayne Rasband,
National Institute of Health, Bethesda, MD, USA) untuk analisis lebih lanjut. The X dan Y koordinat
masing-masing embrio di setiap frame video ditandai dengan stylus digital dan diekspor ke Microsoft
Excel. Excel digunakan untuk menghitung total jarak antara posisi embrio dalam bingkai berurutan.
Tingkat rata-rata maksimal gerakan untuk setiap embrio dihitung dengan rata-rata tiga pengukuran
kecepatan tertinggi dari masing-masing tingkat swim.Heart diukur dengan menghitung denyut jantung
selama 15-s interval embrio 50-52-hpf. Denyut jantung dihitung dengan mata menggunakan mikroskop
(SMZ-2T, Nikon, USA). Data diperoleh dari total 30 embrio di masing-masing kelompok uji dalam tiga
percobaan independen.

Myotome pengukuran luas Untuk analisis daerah myotome, myotome menemukan dorsal ke ujung ekor
dari usus berkembang (the myotome 12) dipilih untuk analisis karena dapat andal diidentifikasi dalam
tinggi perbesaran gambar confocal daerah batang embrio. Luas myotome 12 untuk setiap embrio diukur
dengan menggunakan ImageJ.

Analisis statistik rata-rata nilai yang dihasilkan dari analisis kuantitatif kami disajikan dengan standar
deviasi dihitung atau kesalahan standar dari mean seperti yang ditunjukkan. Nilai rata-rata diukur untuk
embrio scr-PMO-disuntikkan dibandingkan dengan nilai yang terukur dari embrio hsp27i-PMO-
disuntikkan, menggunakan uji T atau uji Z Student di tempat yang ditentukan. Dihitung nilai p kurang
dari atau sama dengan 0,05 dianggap indikasi perbedaan signifikan secara statistik nilai rata-rata.

Ke:
HASIL
Ekspresi Hsp27 selama embriogenesis ikan zebra

Kami sebelumnya menunjukkan ekspresi ikan zebra embrio hsp27 mRNA sedini 8 hpf, dengan ekspresi
maksimal diamati pada 24 hpf. Gambar Figure1a1a menunjukkan Western blot jumlah yang sama dari
total protein yang diisolasi dari embrio pada usia yang berbeda. Sebuah band tunggal pada ukuran
prediksi ikan zebra Hsp27 (22 kDa) terdeteksi pada bercak diperiksa dengan αHsp27 serum pada sampel
dipanen sedini 8 hpf, konsisten dengan analisis kami sebelumnya ekspresi hsp27 mRNA. Nilai
densitometri (tidak ditampilkan) menunjukkan bahwa Hsp27 tingkat protein meningkat sekitar tujuh kali
lipat antara 9 dan 24 hpf. Tidak seperti tingkat ekspresi hsp27 mRNA yang mengalami penurunan mulai
36 hpf, Hsp27 tingkat protein tetap konstan antara 24 hpf dan menetas pada 72 hpf (Gbr. 1a), meskipun
ekspresi berkurang, sebagai proporsi dari total protein, terlihat oleh 1 minggu postfertilization (data
tidak ditampilkan).

Morpholino knockdown dari Hsp27 pada embrio ikan zebra

Untuk menyelidiki peran potensial untuk Hsp27 dalam morfogenesis, kita disuntikkan embrio ikan zebra
di 01:59 tahap sel dengan antisense Hsp27 (hsp27i) atau orak-arik kontrol (scr) PMO. Gambar
Figure1b1b menunjukkan efek suntikan PMO di berbagai konsentrasi awal ekspresi Hsp27, dievaluasi
oleh Western blotting. Injeksi hsp27i PMO dibatalkan ekspresi terdeteksi Hsp27 pada embrio pada
konsentrasi> 0,05 mM. Sebaliknya, injeksi scr PMO di semua konsentrasi yang diuji tidak berpengaruh
pada Hsp27 ekspresi (Gbr. 1b).

Gambar Figure1c1c menunjukkan bahwa suntikan hsp27i PMO pada konsentrasi 0.15 mM menghambat
ekspresi Hsp27 pada semua titik waktu perkembangan diperiksa dalam penelitian ini. Sebaliknya, tidak
ada perbedaan dalam Hsp27 ekspresi protein terdeteksi ketika membandingkan scr-PMO- dan embrio
air disuntikkan pada semua titik waktu. Gambar Figure1c1c juga menunjukkan imunoblotting untuk
mendeteksi aktin sarcomeric dalam sampel yang diperoleh dari embrio disuntik dengan hsp27i PMO,
PMO scr, atau air. Tidak ada perbedaan nyata dalam tingkat ekspresi aktin sarcomeric pada setiap titik
waktu perkembangan embrio antara mengekspresikan dan kurang Hsp27, menunjukkan bahwa
hilangnya Hsp27 tidak mempengaruhi perkembangan otot pada tingkat ekspresi aktin sarcomeric.

Gambar Figure1d1d memeriksa apakah Hsp27 knockdown menggunakan 0,1 mM hsp27i PMO
mempengaruhi ekspresi protein heat shock berat molekul tinggi, Hsp70. Hsp70 memiliki dua isoform
dalam ikan zebra, konstitutif Hsc70 dan stres diregulasi Hsp70. Ekspresi Hsc70 (lower band) adalah tidak
berubah setelah Hsp27 knockdown di kedua embrio tanpa tekanan dan embrio pulih dari kejutan panas.
Selain itu, Hsc70 ekspresi protein tidak berubah oleh heat shock, konsisten dengan laporan sebelumnya
(Evans et al. 2005). Seperti yang diharapkan, diinduksi Hsp70 ekspresi protein (band atas) yang diregulasi
dalam embrio pulih dari kejutan panas. The knockdown dari Hsp27 tidak berpengaruh terhadap ekspresi
Hsp70 setelah kejutan panas.

Deteksi imunofluoresen dari Hsp27 pada embrio 50-hpf

Gambar Figure22 menunjukkan cryosections embrio ikan zebra 50-hpf diperiksa dengan αHsp27 serum
dan antibodi sekunder neon. Embrio disuntik dengan konsentrasi yang sama (0,1 mM) dan volume orak
(scr, baris atas dan menengah) atau hsp27i PMO (baris bawah) pada satu atau dua tahap sel. Konsisten
dengan data yang diterbitkan pada ekspresi hsp27 mRNA (Mao et al 2005;.. Marvin et al 2008), embrio
disuntik dengan scr PMO menunjukkan tingkat rendah di mana-mana ekspresi Hsp27 dan tingkat yang
lebih tinggi di otot-otot wajah berkembang (kiri atas, panah, dan inset ). Lokalisasi Hsp27 dalam
cryosections ekor embrio scr-PMO-disuntikkan (tengah atas) juga menunjukkan di mana-mana ekspresi
tingkat rendah di seluruh mengembangkan miotom dan ekspresi yang lebih tinggi dalam subset dari
miosit di tepi luar dari myotome tersebut. Hal ini paling terlihat di dekat garis lateral berkembang
embrio di mana subset dari miosit menunjukkan tingkat tinggi ekspresi Hsp27 (tengah atas, panah). Sel-
sel ini secara positif diidentifikasi sebagai miosit dengan counterstaining dengan Phalloidin neon, probe
untuk filamen aktin F-(data tidak ditampilkan). Akhirnya, dalam kondisi kontrol, tingkat tertinggi Hsp27
fluoresensi diamati di jantung (kanan atas). Embrio Scrambled-PMO-disuntikkan panas terkejut (30
menit pada suhu 37 ° C) pada 36 hpf dan memungkinkan untuk pulih selama 14 jam menunjukkan
peningkatan global dalam ekspresi Hsp27 di semua jaringan, termasuk otot-otot batang, jantung, otak,
sumsum tulang belakang, dan eye (tengah baris). Sebaliknya, embrio diproses untuk Hsp27
immunolocalization setelah identik heat shock dan pemulihan periode tampilan hampir tidak ada
fluoresensi menggunakan parameter pencitraan yang sama (baris bawah) hsp27i-PMO-disuntikkan.
Percobaan kontrol negatif ini lebih lanjut menunjukkan efektivitas PMO hsp27i dan utilitas serum
αHsp27 kami untuk imunofluoresensi lokalisasi Hsp27.
Gambar. 2
Gambar. 2
Immunolocalization dari Hsp27 pada embrio ikan zebra 50-hpf. Semua gambar yang diperoleh dengan
pengaturan pencahayaan dan kamera identik. Top baris: Hsp27 ekspresi terdeteksi di kepala (kiri),
batang (tengah), dan jantung (kanan) dari 0,1 mM orak-arik ...
Pengembangan morfologi ikan zebra normal tanpa adanya Hsp27

Penelitian sebelumnya telah menyimpulkan bahwa Hsp27 dapat memainkan peran dalam mengatur
diferensiasi atau kelangsungan hidup beberapa jenis sel embrio vertebrata. Namun, perbandingan
morfologi keseluruhan ikan zebra yang dikembangkan setelah injeksi dengan volume yang sama dari
0,15 mM scr dan hsp27i PMO tidak mengungkapkan perubahan dalam penampilan yang dihasilkan
embrio (Gambar. 3a). Untuk memberikan penilaian kuantitatif morfologi embrio ini, kami mengukur
panjang ekor (Gambar. 3b), diameter lensa (Gambar. 3c), dan dua dimensi (2-D) area kuning telur
massa, ukuran tidak langsung dari metabolisme keseluruhan (Gambar. 3d) embrio 24-hpf. Tidak ada
perbedaan yang signifikan dalam nilai-nilai diukur terdeteksi (p> 05).

Morfologi dan fungsi otot jantung dan rangka yang berubah dengan knockdown dari Hsp27

Hsp27 sangat disajikan dalam jaringan otot rangka dan jantung (Gbr. 2) dan laporan sebelumnya telah
menunjukkan bahwa Hsp27 knockdown menggunakan phosphorodiamidate oligonukleotida morfolino
dapat mengganggu perkembangan jaringan ini di katak (Brown et al. 2007). Di sini, kita telah meneliti
efek dari Hsp27 knockdown pada morfologi dan karakteristik fungsional dari jaringan ini di embrio ikan
zebra. Gambar Figure4a4a menunjukkan gambar perwakilan, berpusat pada myotome 12, dari otot
rangka pada embrio 50-hpf diwarnai dengan Phalloidin neon. Tidak ada perbedaan morfologi
keseluruhan dalam arsitektur otot rangka terlihat ketika membandingkan 0,1 mM hsp27i dan embrio
scr-PMO-disuntikkan. Kami juga mengukur area 2-D dari myotome-12 di 30 scr- dan 30 embrio hsp27i-
PMO-disuntikkan (Gambar. 4b). Analisis nilai-nilai ini tidak menunjukkan perbedaan yang signifikan
secara statistik (p ≥ 0,05) antara kelompok-kelompok embrio.

Gambar. 4
Gambar. 4
Lurik arsitektur otot dan detak jantung pada embrio 50-hpf tidak diubah oleh Hsp27 knockdown.
pewarnaan Phalloidin otot rangka pada embrio. Gambar-gambar ini berpusat pada myotome 12. b Luas
myotome 12 diukur dari 30 embrio disuntikkan ...
Gambar Figure4c4c menunjukkan proyeksi Z-series confocal dari Phalloidin fluoresensi dalam hati
embrio 50-hpf scr- dan hsp27i-PMO-disuntikkan. Miokardium menebal dari ventrikel adalah struktur
yang paling jelas. Gambar-gambar ini adalah wakil dari empat proyeksi Z-series dihasilkan untuk embrio
dalam setiap kelompok. Meskipun dalam contoh ini jantung embrio scr-PMO-disuntikkan muncul sedikit
lebih besar dan lebih cerah bernoda, perbedaan ini tidak diamati secara konsisten. Yang penting,
gambar ini mewakili dalam menunjukkan tidak ada perbedaan dalam morfologi keseluruhan ventrikel
atau prevalensi myofilament, organisasi, atau ketebalan. Sebagai uji fungsi, kami juga menganalisis
tingkat detak jantung di 40 scr dan 40 embrio hsp27i-PMO-disuntikkan pada 50 hpf dalam total tiga
percobaan independen (Gambar. 4d). Analisis nilai-nilai ini menunjukkan tidak ada perbedaan yang
signifikan dalam tingkat denyut jantung antara kelompok-kelompok embrio (p> 05).

Kecepatan berenang larva ikan zebra tidak berubah oleh Hsp27 knockdown

Sebagai ukuran tidak langsung dari kedua kerangka fungsi otot dan neuron motorik, kita diuji berenang
motilitas selama respon kaget embrio dechorionated pada 50 hpf, awal perkembangan titik waktu ketika
perilaku berenang kuat diamati dalam kontrol uninjected (data tidak ditampilkan). Gambar Figure5a5a
menunjukkan jalan perwakilan pergerakan scr dan embrio hsp27i-PMO-disuntikkan. Tidak ada
perubahan nyata dalam parameter seperti jarak atau arah ketekunan diamati. Gambar Figure5b5b
menunjukkan analisis kuantitatif dari kecepatan renang maksimal rata ditampilkan oleh 0,1 embrio mM
PMO-disuntikkan (n> 30 untuk setiap kelompok). Tidak ada perbedaan dalam nilai rata-rata terdeteksi (p
≥ 0,05) ketika membandingkan scr dan embrio hsp27i-PMO-disuntikkan.

Gambar. 5
Gambar. 5
Motilitas embrio 50-hpf tidak diubah oleh Hsp27 knockdown. a Jejak motilitas oleh embrio disuntik
dengan 0,1 mM arik (scr) atau antisense hsp27 (hsp27i) PMO. Jejak mewakili setidaknya 30 embrio per
kelompok diukur dalam tiga independen ...
Hsp27 yang terus-menerus dinyatakan dalam jaringan ikan zebra dewasa

Karena Hsp27 tampaknya memainkan peran dalam morfogenesis jaringan ikan zebra, kami
mempertimbangkan apakah ekspresinya mungkin terlibat dalam pemeliharaan homeostasis jaringan
ikan zebra selama waktu yang lebih lama. Untuk mulai menguji hipotesis ini, kami melakukan
immunolocalization dan imunoblotting studi ekspresi Hsp27 pada jaringan tanpa tekanan dewasa ikan
zebra (Gbr. 6). Immunolocalization dari Hsp27 di cryosections jaringan paling jelas dalam ventrikel
miokardium (Hrt) dan agak lebih jelas dalam serat otot perifer daripada interior (Gbr. 6, Hrt).
Cryosections otot rangka juga menunjukkan tingkat yang relatif tinggi Hsp27 (Gbr. 6, Ske). Level tertinggi
dari ekspresi dalam jaringan ini secara konsisten diamati dalam irisan lateral yang luar otot yang
sebelumnya ditunjukkan dalam sejumlah spesies ikan, termasuk ikan zebra, terdiri dari lambat-kedutan,
atau merah, otot (Greer-Walker dan Tarik 1975). Menariknya, tingkat terbesar ekspresi di bagian otot
rangka terdeteksi pada subset dari miosit ditemukan di perbatasan antara lambat dan jaringan otot
berkedut cepat (Ske, panah). Hsp27 juga terdeteksi, meskipun tingkat yang jauh lebih rendah, di lapisan
jaringan yang ditemukan di lapisan luar dari saluran usus (Int, panah). Counterstaining dengan Phalloidin
neon menunjukkan bahwa lapisan ini memiliki jaringan otot polos (data tidak ditampilkan). Struktur
internal dewasa otak ikan zebra yang sebagian besar tanpa ekspresi Hsp27. Namun, lapisan epitel luar
otak orang dewasa ditampilkan lapisan tipis Hsp27-positif fluoresensi (Br, panah). Akhirnya, Hsp27
terlokalisasi dalam sel sekitar tubulus seminiferus di testis (Gbr. 6, Test). Namun, tidak ada Hsp27-
mengekspresikan sel yang diamati dalam struktur tubulus. Untuk mengkonfirmasi pola-pola ekspresi
keseluruhan dalam ikan zebra dewasa, kami menganalisis tingkat ekspresi Hsp27 pada jaringan ikan
zebra dewasa menggunakan bercak Barat. Imunoblotting dari Hsp70 dilakukan untuk perbandingan.
Ekspresi Hsp27 tertinggi dalam jaringan jantung, otot rangka, dan lensa tapi juga terdeteksi pada tingkat
yang lebih rendah di semua jaringan diperiksa. Ekspresi Hsp27 juga secara konsisten lebih tinggi pada
otot merah daripada otot putih. Menariknya, Hsp70 juga konstitutif disajikan dalam jaringan dewasa,
dengan tingkat tertinggi dari ekspresi terdeteksi di otak, testis, dan jaringan usus, sedangkan sedikit atau
tidak ada ekspresi Hsp70 terdeteksi di jantung, lensa, atau otot rangka.

Ke:
PEMBAHASAN
Hsp27 tidak diperlukan untuk pengembangan ikan zebra dalam kondisi kontrol

Ekspresi Hsp27 diregulasi dalam otot dan beberapa jaringan lain embrio vertebrata berkembang dengan
tidak adanya stres (Gernold et al 1993;. Norris et al 1997;. Kawazoe et al 1999;. Mao et al 2005;. Tuttle
et al 2007. ). Hasil sebelumnya dalam studi in vitro telah menunjukkan bahwa ekspresi Hsp27 dapat
diperlukan untuk diferensiasi myoblasts dan jenis sel embrio lain (Mehlen et al 1997;. Davidson dan
Morange 2000); Namun, in vivo data yang menangani hipotesis ini terbatas dan bertentangan. Huang et
al. (2007) menunjukkan tidak ada efek hsp27 penghapusan gen pada pengembangan mouse, sementara
Brown et al. (2007) telah melaporkan bahwa knockdown transien Hsp27 menyebabkan bifida kardia dan
cacat miofibril dalam katak. Kami sebelumnya telah menunjukkan bahwa pangsa ikan zebra dengan
vertebrata lainnya ekspresi hsp27 mRNA di otot jantung dan rangka awal dalam pengembangan dan
kemampuan ikan zebra Hsp27 untuk melindungi sel kultur dari cedera termal (Mao et al. 2005). Dalam
penelitian ini, kami telah melakukan studi fungsional Hsp27 dalam ikan zebra menggunakan PMO hsp27i
untuk menghambat ekspresi selama embriogenesis. Seperti hasil yang dipublikasikan sebelumnya untuk
kedua tikus dan Xenopus (Brown et al 2007;.. Huang et al 2007), pola global perkembangan embrio itu
berubah dengan hilangnya Hsp27 di ikan zebra. Kehadiran dan dua studi sebelumnya muncul untuk
memberikan konsensus bahwa Hsp27 adalah dibuang untuk keseluruhan vertebrata perkembangan dan
dengan demikian bahwa hasil yang diperoleh dari penelitian in vitro peran protein stres selama
pengembangan harus dilihat dengan hati-hati. Salah satu interpretasi dari literatur yang tersedia adalah
bahwa diferensiasi mungkin lebih sulit bagi sel-sel in vitro dibandingkan in vivo. Untuk mendukung
pandangan ini, stres oksidatif pada sel kultur telah didokumentasikan dengan baik (Halliwell 2003).
Ekspresi Hsp dapat mempromosikan kelangsungan hidup dan fungsi sel selama diferensiasi in vitro,
dengan implikasi untuk bioteknologi jaringan dan organ.

Kardia bifida dan cacat dalam organisasi miofibril yang ditunjukkan di Xenopus embrio kurang Hsp27
akibat penipisan morfolino (Brown et al. 2007). Pengembangan jantung ikan zebra diatur oleh jaringan
faktor transkripsi yang berbagi berurutan dan homologi fungsional dengan mereka yang terlibat dalam
pengembangan hati pada vertebrata lainnya, termasuk katak, tikus, dan manusia (Weinstein dan
Fishman 1996). Selain itu, seperti hati vertebrata lainnya, jantung ikan zebra berkembang dari bidang
bilateral hati yang bermigrasi ke arah dan sekering di garis tengah embrio untuk membentuk tabung
jantung primitif, dan cacat dalam gerakan ini morphogenic mengakibatkan kardia bifida dalam embrio
ikan zebra (Chen et al. 1996;. Yelon et al 1999; Trinh dan Stainier 2004; Wang et al 2005;. Matsui et al
2007).. Serupa dengan studi tikus yang kekurangan Hsp27 sebagai akibat dari penghapusan gen (Huang
et al. 2007), penelitian kami menunjukkan bahwa peristiwa-peristiwa ini tidak memerlukan ekspresi
Hsp27 pada embrio ikan zebra dalam kondisi kontrol. Selain itu, tidak seperti hasil dari penelitian embrio
katak, arsitektur miofibril dalam hati dan otot rangka tidak detectably berbeda antara hsp27i- dan scr-
PMO-disuntikkan embrio ikan zebra. Hsp27 juga telah ditunjukkan untuk memainkan peran dalam
pengembangan dan perlindungan dari sistem neuron motorik yang muncul in vitro (Williams et al.
2006). Namun, hasil kami menunjukkan tidak ada perbedaan dalam motilitas embrio ikan zebra kurang
Hsp27 dibandingkan kontrol. Karena berenang membutuhkan fungsi yang tepat dari kedua otot dan
sistem saraf, hasil ini menunjukkan bahwa tidak hanya otot rangka, tetapi juga motor neuron yang
fungsional utuh. Salah satu kemungkinan interpretasi data yang tersedia adalah bahwa mamalia dan
ikan zebra, tapi tidak katak, protein express yang dapat mengkompensasi hilangnya Hsp27. Manusia dan
tikus memiliki gen selama sepuluh heat shock protein kecil terkait (Fontaine et al. 2003), dan ikan zebra
memiliki gen untuk 15 protein seperti (Elicker dan Hutson 2007). Pada mamalia, ekspresi αB crystallin
terkait dalam jaringan otot rangka dan jantung telah didokumentasikan dengan baik (lihat Inaguma et al.
(1993), misalnya), dan protein ini memiliki beberapa fungsi umum (Jakob et al. 1993). Kami dan lain-lain
telah melaporkan bahwa αB crystallin tidak terdeteksi dalam jaringan otot ikan zebra (Posner et al
1999;. Mao dan Shelden 2006). Namun, mRNA untuk empat sHsps lain (Hspb7, Hspb8, Hspb9, Hspb11)
terdeteksi di somit embrio ikan zebra. Dalam jaringan jantung, hspb7 dan hspb12 mRNA disajikan
melalui setidaknya 48 jam pembangunan (Marvin et al. 2008). Jumlah protein yang berpotensi
pelengkap disajikan dalam amfibi belum ditentukan, tetapi dapat dibayangkan bahwa katak dan amfibi
lainnya menunjukkan lebih mengandalkan Hsp27 selama pengembangan dari ikan zebra dan tikus. Atau,
interpretasi hasil sebelumnya mungkin telah rumit oleh isu-isu yang berkaitan dengan terdokumentasi
dengan baik toksisitas morfolino (Heasman 2002). Untuk mengatasi masalah ini, sekarang studi
digunakan antiserum mendeteksi ikan zebra Hsp27 untuk menentukan konsentrasi PMO minimal efektif
dalam mengurangi ekspresi Hsp27 di ikan zebra. Selain itu, kami membandingkan hasil percobaan kami
menggunakan hsp27i PMO dengan PMO kontrol yang mengandung nukleotida identik dalam urutan
acak.

Penelitian kami saat ini memiliki beberapa keterbatasan penting. Studi kami mungkin memiliki
kekurangan sensitivitas yang diperlukan untuk analisis perubahan halus dalam hati atau fungsi otot
rangka, sehingga kita tidak bisa mengabaikan kemungkinan peran unik untuk Hsp27 dalam
embriogenesis ikan zebra. Studi kami juga tidak membahas kemungkinan peran untuk Hsp27 pada tahap
selanjutnya dari pembangunan, seperti pematangan seksual, dan tidak secara langsung menjawab
kinerja jaringan ini setelah kerusakan stres atau cedera yang disebabkan. Isu-isu ini berada di bawah
pertimbangan di laboratorium kami. Namun, diambil bersama-sama, ekspresi Hsp27 pada jaringan otot
aktif secara metabolik, ditambah dengan tidak adanya cacat morfologi pada embrio kurang Hsp27
selama perkembangan paling kuat mendukung pandangan bahwa Hsp27 memiliki peran dalam
melindungi miosit terhadap stres mekanik atau oksidatif, daripada harus peran langsung dalam modulasi
morfogenesis atau organisasi sistem myofilament.

Pola ekspresi Hsp27 mendukung peran dalam pemeliharaan homeostasis jaringan

Meskipun pola ekspresi Hsp27 telah banyak diteliti dalam beberapa spesies mamalia, penelitian
sebelumnya dari ekspresi Hsp27 di ikan zebra dan katak telah terbatas pada analisis pola distribusi
hsp27 mRNA (Mao dan Shelden 2006; Tuttle et al 2007;.. Marvin et al 2008) atau reporter gen
konstruksi pada embrio ikan zebra dan larva (Wu et al. 2008). Misalnya, ekspresi mRNA hsp27 terdeteksi
dalam mengembangkan jaringan jantung, otot kraniofasial dan lensa embrio (Marvin et al. 2008). Dalam
batang embrio ikan zebra 48-hpf, hsp27 mRNA meningkat pada otot rangka dangkal. Wilayah ini berisi
mengembangkan otot lambat-kedutan, memimpin Marvin et al. menunjukkan bahwa ekspresi Hsp27
mungkin secara khusus meningkat pada serat otot lambat-kedutan. Hasil kami mengkonfirmasi bahwa
Hsp27 ekspresi protein meningkat pada embrio ikan zebra, dibandingkan dengan jaringan sekitarnya,
pada otot jantung dan kraniofasial dan subset dari serat otot yang ditemukan di margin lateral batang
dan otot ekor jaringan embrio. Namun, antibodi kita juga terdeteksi di mana-mana tingkat rendah
Hsp27 ekspresi, tidak terlihat dalam studi sebelumnya, dalam embrio yang dibesarkan dalam kondisi
kontrol. Ekspresi luas protein Hsp27 terdeteksi oleh imunofluoresensi pada embrio ikan zebra dalam
penelitian ini, terutama di sumsum otak dan tulang belakang berkembang, tak terduga dan awalnya
mendorong kami untuk mempertimbangkan apakah pola ini dapat terjadi akibat nonspesifik mengikat
serum αHsp27 digunakan dalam studi kami . Namun, penelitian Western blotting kami menguatkan
perubahan relatif dalam ekspresi Hsp27 dilihat oleh immunostaining selama pengembangan, setelah
kejutan panas, dan dalam jaringan dewasa. Selain itu, sedikit atau tidak ada pewarnaan terdeteksi pada
embrio dengan imunofluoresensi setelah knockdown dari Hsp27 dalam studi kami. Data ini
menunjukkan bahwa ada ekspresi konstitutif signifikan Hsp27 di sebagian besar jaringan embrio ikan
zebra.

Hanya beberapa studi telah meneliti ekspresi Hsp27 sebagai fungsi dari jenis serat otot. Pada mamalia,
Hsp27 dan terkait protein αB crystallin atau tingkat mRNA umumnya lebih tinggi dalam jaringan otot
mengandung didominasi lambat-kedutan otot dibandingkan yang mengandung sebagian besar otot
berkedut cepat (Inaguma et al 1993;. Huey et al 2007;. Ishihara et al. 2008). Namun, sebaliknya juga
telah dilaporkan (Kim et al. 2004). Selain itu, ekspresi Hsp27 dalam didominasi otot berkedut cepat telah
terbukti bervariasi sebagai funcion usia, dengan ekspresi menurun berhubungan positif dengan
peningkatan usia (Gupte et al. 2008). Penelitian ini menunjukkan bahwa Hsp27 ekspresi protein lebih
tinggi dalam serat otot lambat-kedutan lateralis daripada otot berkedut cepat lebih sentral di kedua
embrio 50-hpf dan, untuk pertama kalinya, dalam jaringan otot ikan zebra dewasa. Hasil ini
menunjukkan bahwa ekspresi Hsp27 dan fungsi dalam serat otot lambat-kedutan telah dilestarikan
antara ikan dan mamalia dan ikan zebra karena itu mungkin model yang berguna di mana untuk
mengatasi signifikansi fungsional ekspresi ini. Namun, beberapa perbedaan juga dapat diamati. Sebagai
contoh, beberapa studi telah menunjukkan bahwa Hsp70 juga sangat disajikan dalam jaringan otot
lambat-kedutan mamalia (Tupling et al 2007;.. Ishihara et al 2008) (. Blechinger et al 2002), namun hasil
kita sekarang konsisten dengan laporan sebelumnya menunjukkan bahwa ekspresi konstitutif signifikan
Hsp70 tidak terdeteksi dalam jaringan otot ikan zebra. Selain itu, kedua jaringan otot lambat dan cepat-
kedutan pada mamalia mengekspresikan tingkat signifikan dari αB crystallin terkait, tapi ekspresi αB
crystallin terdeteksi hanya dalam lensa ikan zebra (Posner et al 1999;. Mao dan Shelden 2006). Saat ini,
tidak jelas apakah Hsp27 memainkan peran yang lebih signifikan dalam jaringan otot ikan zebra
dibandingkan mamalia atau jika heat shock protein lain yang ditemukan pada spesies ikan melakukan
peran yang dimainkan oleh Hsp70 dan αB crystallin pada mamalia.

Pola Ekspresi Hsp27 dan Hsp70 berbeda dalam ikan zebra dalam kondisi kontrol

Akhirnya, perhatian baru-baru telah difokuskan pada peran potensial Hsp27 sebagai cochaperone untuk
berat molekul tinggi Hsp70. Sebagai contoh, beberapa penelitian telah menunjukkan bahwa Hsp27 dan
heat shock protein kecil lainnya dapat mencegah ireversibel terungkapnya protein rusak in vitro
(Haslbeck et al 2005;. Bryantsev et al 2007.) Dan sel berbudaya dan bahwa (Bryantsev et al 2007.) Hsp27
sinergis dapat mempromosikan pemulihan sel-sel ketika coexpressed dengan Hsp70 (Riordan et al.
2004). Fungsi ini mungkin akan membutuhkan ekspresi gabungan spasial dan temporal dan
colocalization dari kedua protein. Konsisten dengan hipotesis ini, baik Hsp70 dan Hsp27 tingkat ekspresi
yang ubiquitously diinduksi dalam embrio ikan zebra setelah cedera termal subletal (Adam et al 2000;.
Mao dan Shelden 2006). Namun, bercak Barat disajikan di sini menunjukkan bahwa hanya testis,
jaringan usus, dan otak mengekspresikan Hsp27 dan Hsp70 pada tingkat terdeteksi tanpa adanya stres.
Selain itu, ekspresi Hsp27 mencolok lebih tinggi dalam jaringan kurang terdeteksi Hsp70 dibandingkan
pada mereka yang Hsp70 adalah mudah terdeteksi. Oleh karena itu data yang kami memiliki implikasi
untuk memahami baik regulasi dan fungsi Hsp27 dan Hsp70 pola ekspresi dalam ikan zebra. Kami
menyarankan bahwa fungsi Hsp27 pada jaringan otot ikan zebra, setidaknya di bawah kondisi kontrol,
tidak memerlukan Hsp70 ekspresi gabungan. Data ini juga memiliki beberapa implikasi untuk memahami
regulasi ekspresi Hsp27. Misalnya, kurangnya ekspresi gabungan protein dalam kondisi kontrol
menunjukkan regulasi diferensial ekspresi gen tanpa adanya stres. Oleh karena itu, transkripsi hsp27
dalam kondisi kontrol mungkin mencerminkan aktivitas faktor spesifik jaringan sebagai lawan regulasi
stres responsif umum. Kesimpulan ini juga menunjukkan bahwa Hsp27 melakukan fungsi dalam jaringan
otot yang mungkin berbeda dari yang terlibat dalam perlindungan stres.

Ke:
RINGKASAN
Studi kami menunjukkan bahwa Hsp27 tidak diperlukan untuk diferensiasi sel otot atau pembentukan
arsitektur sel normal, termasuk dari sel-sel otot, selama pengembangan. Namun, hasil kami
mengkonfirmasi penelitian sebelumnya dari distribusi hsp27 mRNA menunjukkan bahwa Hsp27 yang
istimewa disajikan dalam sel otot rangka dan jantung di ikan zebra dan menunjukkan ekspresi yang
dalam jaringan ini terus berlanjut sepanjang kehidupan hewan. Data ini tampaknya mendukung
pandangan bahwa Hsp27 mempromosikan integritas arsitektur sel otot atau kelangsungan hidup dalam
kondisi regangan mekanis atau stres oksidatif. Kesamaan dalam pola ekspresi dan makna fungsional dari
Hsp27 diamati pada ikan zebra dalam penelitian ini dan dalam sistem mamalia menunjukkan bahwa ikan
zebra mungkin model yang berguna yang dapat digunakan untuk membangun hubungan timbal balik
antara anggota keluarga protein heat shock kecil.