Anda di halaman 1dari 220

DISERTASI

POLIMORFISME GEN insl3 DAN lgr8, KADAR HORMON


INSL3 DAN ESTRADIOL SEBAGAI FAKTOR RISIKO
KRIPTORKISMUS PADA ANAK

I WAYAN BIKIN SURYAWAN

PROGRAM PASCASARJANA
UNIVERSITAS UDAYANA
DENPASAR
2011

DISERTASI

POLIMORFISME GEN insl3 DAN lgr8, KADAR HORMON


INSL3 DAN ESTRADIOL SEBAGAI FAKTOR RISIKO
KRIPTORKISMUS PADA ANAK

I WAYAN BIKIN SURYAWAN


NIM 0790271001

PROGRAM DOKTOR
PROGRAM STUDI ILMU KEDOKTERAN
PROGRAM PASCASARJANA
UNIVERSITAS UDAYANA
DENPASAR
2011

Halaman Prasyarat Gelar DOKTOR

POLIMORFISME GEN insl3 DAN lgr8, KADAR HORMON


INSL3 DAN ESTRADIOL SEBAGAI FAKTOR RISIKO
KRIPTORKISMUS PADA ANAK

Disertasi untuk Memperoleh Gelar Doktor


pada Program Doktor, Program Studi Ilmu Kedokteran,
Program Pascasarjana Universitas Udayana

I WAYAN BIKIN SURYAWAN


NIM 0790271001

PROGRAM DOKTOR
PROGRAM STUDI ILMU KEDOKTERAN
PROGRAM PASCASARJANA
UNIVERSITAS UDAYANA
DENPASAR
2011
ii

Halaman Persetujuan Promotor dan Kopromotor


Lembar Pengesahan

DISERTASI INI TELAH DISETUJUI


TANGGAL 28 Juni 2011

Promotor,

Prof.dr.Soetjiningsih, Sp.A(K), IBCLC


NIP. 19450124 197106 2 001

Kopromotor I,

Kopromotor II,

Prof.Dr.dr.Ketut Suastika,Sp.PD-KEMD

Prof.Dr.dr.Joserizal Latief Batubara,Sp.A(K)

NIP. 19550329 198012 1 001

NIP. 19520121 197703 1 001

Mengetahui
Ketua Program Studi Ilmu Kedokteran

Direktur

Program Pascasarjana

Program Pascasarjana

Universitas Udayana,

Universitas Udayana,

Dr.dr.I Wayan Putu Sutirta Yasa, M.Si

Prof.Dr.dr.A.A.Raka Sudewi, Sp.S (K)

NIP. 19570513 198601 1 001

NIP. 19590215 198510 2 001


iii

Halaman Penetapan Panitia Penguji Disertasi

Disertasi Ini Telah Diuji dan Dinilai pada Ujian Tertutup


Tanggal 16 Juni 2011
Panitia Penguji Disertasi Berdasarkan SK Rektor Universitas Udayana
No : 1055 / UN14.4 /HK/2011, Tanggal: 7 Juni 2011

Panitia Penguji Disertasi Tahap I (Ujian Tertutup) Program Doktor (S3)


Ilmu Kedokteran Program Pascasarjana Universitas Udayana adalah:
Ketua

: Prof. Dr.dr.N. Adiputra, M.OH

Anggota :
1.
2.

Prof. dr. Soetjiningsih, Sp.A(K), IBCLC


Prof. Dr. dr. Ketut Suastika, Sp.PD-KEMD

3.

Prof. Dr. dr. Joserizal Latief Batubara, Sp.A(K)

4.

Prof. Dr. dr. I Gde Raka Widiana, Sp.PD-KGH

5.

Prof. Dr. Ir. I Gede Putu Wirawan, M.Sc

6.

Prof. Dr. dr. A. A. Gede Sudewa Djelantik, Sp.PK(K)

7.

Prof. drh. I Nyoman Mantik Astawa, Ph.D

iv

UCAPAN TERIMA KASIH

Pertama-tama perkenankanlah penulis memanjatkan Puji Syukur ke hadapan Ida sang


Hyang Widhi Wasa/Tuhan Yang Maha Esa, karena atas asung wara nugraha-Nya/kurnia-Nya,
disertasi ini dapat diselesaikan.
Pada kesempatan ini perkenankanlah penulis mengucapkan terima kasih yang sebesarbesarnya kepada Yth:
(1) Prof. dr. Soetjiningsih, Sp.A(K), IBCLC selaku promotor yang dengan penuh perhatian
telah memberikan dorongan, semangat, bimbingan, dan saran selama penulis mengikuti
program doktor, khususnya dalam penyelesaian disertasi ini. Terima kasih sebesar-besarnya
pula penulis sampaikan kepada yth Prof. Dr. dr. Ketut Suastika, Sp.PD-KEMD selaku
kopromotor 1 dan kepada yth Prof. Dr. dr. Joserizal Latief Batubara, Sp.A(K) selaku
kopromotor 2, yang penuh perhatian dan kesabaran telah memberikan bimbingan dan saran
kepada penulis.
(2) Rektor Universitas Udayana Prof. Dr. dr. I Made Bakta, Sp.PD-KHOM atas kesempatan dan
fasilitas yang diberikan kepada penulis untuk mengikuti dan menyelesaikan pendidikan
program doktor di Universitas Udayana.
(3) Direktur Program Pascasarjana Universitas Udayana Prof.Dr.dr.A.A.Raka Sudewi, Sp.S(K);
Asisten Direktur I Program Pascasarjana Universitas Udayana Prof. Dr. Made Budiarsa,
MA; Asisten Direktur II Program Pascasarjana Universitas Udayana Prof. Dr. Ir. Budi
Surusa, MS; dan stap PPS UNUD atas kesempatan yang diberikan untuk kuliah di tingkat
pendidikan terakhir.
(4) Ketua dan Sekretaris Program Doktor Program Studi Ilmu Kedokteran Dr.dr. I Wayan Putu
Sutirta Yasa, M.Si dan Dr. dr. Dewa Made Sukrama, Sp.MK, M.Si atas pemberian semua
fasilitas pendidikan sejak awal proses kuliah.
(5) Direktur RSUD Wangaya Prof.Dr.dr. I Gede Raka Widiana, Sp.PD-KGH, Kepala SMF
Anak RSUD wangaya dr. Putu Paramita Rahayu, Sp.A, dan kepada bagian Anak IKA FK
UNUD dr. BNP Arhana, Sp.A(K) atas ijin yang diberikan untuk mengikuti pendidikan
Doktor.
(6) Para penguji disertasi, yaitu: Prof.Dr.dr.N.Adiputra, M.OH,

Prof.Dr.dr. I Gede Raka

Widiana, Sp.PD-KGH, Prof.Dr.Ir.I Gede Putu Wirawan, M.Sc, Prof.Dr.dr.A.A.Gede


v

Sudewa Djelantik, Sp.PK(K), Prof.drh. I Nyoman Mantik Astawa, Ph.D, atas masukan,
saran, sanggahan, dan koreksi yang telah diberikan.
(7) Kepada Dr.dr. Iswari Setianingsih, Sp.A dan dr Nanis Sacharin,Sp.A yang telah
membimbing kami selama belajar genetika di Lembaga Biomolekuler Eijkman Jakarta.
(8) Seluruh dosen pengajar Program Doktor, Program Studi Ilmu Kedokteran, Program
Pascasarjana, Universitas Udayana, staff tata usaha dan seluruh teman teman mahasiswa S3
Kedokteran khususnya angkatan 2007/2008.
(9) Kepada teman-teman dokter spesialis anak di RSUD Wangaya, RSUP Sanglah dan IDAI
Cabang Bali yang telah memberikan dorongan dan dukungan kepada penulis. Kepada
perawat zal Kaswari RSUD Wangaya, petugas Laboratorium Prodia Denpasar,
Laboratorium Biomolekuler FK UNUD, YAYASAN GENNEKA Eijkman Institute for
Molekuler Biology di Jakarta, Laboratorium Kedokteran Hewan F.KH UNUD yang telah
membantu penelitian ini. Terima kasih kepada pasien yang dipakai sebagai kasus dan
kontrol dengan suka rela pada penelitian ini.
(10) kepada seluruh guru-guru yang telah membimbing penulis, mulai dari sekolah dasar sampai
perguruan tinggi dan semua pihak yang tidak dapat disebutkan satu persatu.
(11) Penulis juga mengucapkan terima kasih kepada ayah dan ibu yang telah mengasuh dan
membesarkan penulis, memberikan dasar dasar berpikir logik dan suasana demokratis
sehingga tercipta suasana yang baik untuk berkembangnya kreativitas. Akhirnya penulis
sampaikan terima kasih kepada istri tercinta Ni Made Muliasih, SE, serta anak-anak: Putu
Siska Suryaningsih dan Kadek Adi Suryamulyawan tersayang, yang dengan penuh
pengorbanan telah memberikan kepada penulis kesempatan untuk lebih berkonsentrasi
menyelesaikan disertasi ini.
Semoga Ida sang Hyang Widhi Wasa/ Tuhan Yang Maha Esa selalu melimpahkan rahmat-Nya
kepada semua pihak yang telah membantu pelaksanaan penyelesaian disertasi ini, serta kepada
penulis sekeluarga.

Denpasar,

Juni 2011

I Wayan Bikin Suryawan


vi

POLIMORFISME GEN insl3 DAN lgr8, KADAR HORMON INSL3 DAN ESTRADIOL
SEBAGAI FAKTOR RISIKO KRIPTORKISMUS PADA ANAK
Oleh: I Wayan Bikin Suryawan
Di bawah bimbingan: Soetjiningsih, Ketut Suastika, Joserizal Latief Batubara
Abstrak
Kriptorkismus disebabkan multifaktorial dan peran polimorfisme gen insl3 dan lgr8,
hormon INSL3 dan estradiol masih belum jelas. Penelitian ini bertujuan mengetahui frekuensi
polimorfisme (exon 1, exon 2) gen insl3, frekuensi polimorfisme (exon 8, exon 12, exon 13) gen
lgr8 pada anak kriptorkismus dan membuktikan polimorfisme (exin 1, exon 2) gen insl3,
polimorfisme (exon 8, exon 12, exon 13) gen lgr8, kadar hormon INSL3 dan estradiol sebagai
faktor risiko kriptorkismus.
Penelitian ini merupakan penelitian observasional case control study, di poliklinik anak
dua Rumah Sakit Umum dan satu Rumah Bersalin mulai September 2010 sampai Maret 2011,
menggunakan 31 anak kriptorkismus sebagai kasus dan 31 anak sehat sebagai kontrol yang di
matching usia kehamilan dan usia anak. Polimorfisme gen diperiksa dengan sequenzing hasil
PCR, hormon diperiksa dengan ELISA. Frekuensi dianalisis dengan prosentase, polimorfisme
dianalisis dengan odds ratio berpasangan, kadar hormon dianalisis dengan paired student t test
dengan program komputer, hipotesis dengan tingkat kepercayaan ( ) diterima bila p<0,05.
Penelitian ini menghasilkan frekuensi polimorfisme exon1(A9A=19,36%;T60T= 51,61%,
T60A= 25,81%), exon 2 (E146E= 9,68%) gen insl3. Frekuensi polimorfisme exon 8 (kdn
stp223M= 3,23%), exon 12 ( E319E= 100%; L331L= 48,39%), exon 13 ( S337A= 54,84%;
P340P= 41,94%; H345P= 61,29%; K346K= 90,32%; Q354K= 16,13%; Q356P= 29,03%;
S357S= 48,39%) gen lgr8. Polimorfisme T60T exon 1 gen insl3, polimorfisme E319E, L331L
exon 12 gen lgr8 dan polimorfisme S337A, H345P, Q356P, S357S exon 13 gen lgr8, kadar
hormon INSL3 rendah (< 0,42 ng/ml) dan kadar hormon estradiol tinggi (>10,22 ng/ml)
ditemukan lebih banyak bermakna pada anak dengan kriptorkismus dibandingkan dengan
kelompok control.
Simpulan penelitian ini polimorfisme T60T, S357S dan E319E, L331L merupakan
marker baru dan marker dan polimorfisme S337A, H345P dan Q356P, kadar hormon INSL3
rendah dan kadar hormon estradiol tinggi merupakan faktor risiko kriptorkismus. Penelitian ini
diharapkan dapat dipakai menentukan pilihan terapi, prognosis dan dasar penelitian lebih lanjut.
Kata kunci : Polimorfisme gen insl3, polimorfisme gen lgr8, hormon INSL3, hormon estradiol,
kriptorkismus, anak

vii

POLYMORPHISMS OF THE insl3 AND lgr8 GENE, HORMONAL LEVEL OF INSL3


AND ESTRADIOL AS RISK FACTORS FOR CRYPTORCHIDISM IN CHILDREN
By: I Wayan Bikin Suryawan
Supervised by: Soetjiningsih, Ketut Suastika, Joserizal Latief Batubara
Abstract

Cryptorchidism has a multifactorial etiology and the role of insl3 and lgr8 gene
polymorphism, INSL3 and estradiol hormonal remains unclear. This study aims to know the
frequency of polymorphism (exon 1, exon 2) of insl3 gene, the frequency of polymorphism
(exon 8, exon 12, exon 13) of lgr8 gene in children with cryptorchidism, and to examine whether
polymorphism (exon 1, exon2) of insl3 gene and polymorphism (exon 8, exon 12, exon 13) of
lgr8 gene, INSL3 and estradiol hormonal could be implied as risk factors for cryptorchidism.
This is an observational case control study, conducted at the childrens ambulatory services
of two general hospitals and one maternity clinic from September 2010 until March 2011, with
31 children with cryptorchidism and 31 healthy children as controls who were matched by
gestational age and age of the children. Polymorphism of genes insl3 and lgr8 was examined by
DNA sequencing using PCR, hormonal was examined by ELISA. Frequency was analyzed by
percentages; polymorphism was analyzed by paired odd ratios, hormonal was analyzed by paired
student t rest and computerized programmes, hypothesis with () and p<0,05.
We found the following frequencies: polymorphisms of exon 1 (A9A= 19.36%; T60T=
51.61%, T60A= 25.81%), and of exon 2 (E146E= 9.68%) of insl3 gene. The frequency of
polymorphism of exon 8 (stop codon 223M= 3.23%), exon 12 (E319E= 100%; L331L=
48.39%), exon 13 (S337A= 54.84%; P340P= 41.94%; H345P= 61.29%; K346K= 90.32%;
Q354K= 16.13%; Q356P= 29.03%; S357S= 48.39%) of lgr8 gene. Both polymorphisms T60T of
exon 1 insl3 gene, and polymorphisms E319E, L331L of exon 12 lgr8 gene and polymorphisms
S337A, H345P, Q356P, and S357S of exon 13 lgr8 gene, INSL3 hormonal level low (<0,42
ng/ml) and estradiol hormonal level high (>10,22 ng/ml) were found significantly more often in
children with cryptorchidism compared with those of the control group.
In conclusion, polymorphisms T60T, S357S and E319E, L331L are respectively a new
marker and a marker; and polymorphism S337A, Q356P and H345P, INSL3 hormonal level low
and estradiol hormonal level high are risk factors for cryptorchidism. Hope this study can be use
choise of therapy, prognosis and base are for the next study
Keywords : insl3 gene polymorphism, lgr8 gene polymorphism, INSL3 hormonal, estradiol
hormonal, cryptorchidism, children

viii

9.Halaman Daftar Isi


Halaman
1.Halaman Sampul Dalam ..

2.Halaman Prasyarat Gelar Doktor .

ii

3.Halaman Persetujuan Promotor/Kopromotor .

iii

4.Halaman Penetapan Panitia Penguji..

iv

5.Halaman Ucapan Terima Kasih ....

6.Halaman Abstrak ......

vii

7.Halaman Abstract .

viii

8.Halaman Daftar Isi .

ix

9.Halaman Daftar Tabel .

xiii

10.Halaman Daftar Gambar

xiv

11.Halaman Daftar Singkatan

xvi

12.Halaman Daftar Lampiran .

xviii

BAB I

PENDAHULUAN

1.1.Latar Belakang ..

1.2.Rumusan masalah ..

1.3.Tujuan penelitian

1.4.Manfaat penelitian .

BAB II KAJIAN PUSTAKA .

2.1. Gonadotropin-Releasing Hormon dan Gonadotropin .....

2.2. Gonad ..

2.2.1. Embriyogenesis gonad ..

2.2.2. Hipospadia dan kordae .

10

2.2.3. Mikropenis

11

ix

2.2.4. Hormon testosterone .

12

2.2.5. Anti mullerian hormone (AMH) .

16

2.2.6. Genitofemoral nerve (GFN) dan Calcitonin gen-related peptide (CGRP)

16

2.2.7. Hormon estradiol ..

17

2.2.8. Hormon INSL3 .

19

2.2.9. Reseptor LGR8 ...

22

2.3. Pertumbuhan Gubernakulum

24

2.4. Penurunan Testis ..

26

2.5. Gen dan Genom

31

2.5.1. Struktur dan fungsi gen ..

32

2.5.2. Gen yang berperan pada penurunan testis .

33

2.5.3. Gen Insl3

33

2.5.3.1. Polimorfisme gen Insl3 ..

35

2.5.4. Gen Lgr8

36

2.5.4.1. Polimorfisme gen Lgr8

38

2.5.5. Identifikasi gen pada genom manusia

39

2.6. Polimorfisme Gen

39

2.6.1. Single nucleotide polymorphism (SNPs) ..

40

2.6.2. Mikrosatelit ..

43

2.6.3. Minisatelit .

44

2.6.4. Dilesi, duplikasi dan insersi pada lokus yang tidak diulang (Indel) .

45

2.6.5. Bagaimana mendeteksi perubahan allel pada sepanjang lokus

47

2.7. Kriptorkismus ..

48

2.7.1. Definisi kriptorkismus

48

2.7.2. Insiden kriptorkismus ...

49

2.7.3. Etiologi dan pathogenesis kriptorkismus ..

50

2.7.4. Klasifikasi kriptorkismus ..

51

2.7.5. Komplikasi kriptorkismus .

54

2.7.6. Terapi pada kriptorkismus ..

57

2.8. Teknik Enzyme-linked Immune-sorbent Assay(ELISA)untuk Asai Hormon

60

2.9. Polymerase Chain Reaction (PCR)

63

BAB III. KERANGKA BERPIKIR, KONSEP, DAN HIPOTESIS PENELITIAN

BAB IV.

64

3.1. Kerangka Berpikir ..

64

3.2. Konsep Penelitian

65

3.3. Hipotesis Penelitian ..

66

METODE PENELITIAN

67

4.1. Rancangan Penelitian Observasional dengan Case Control Study ..

67

4.2. Lokasi dan Waktu Penelitian

68

4.3. Penentuan Sumber Data .

68

4.4. Variabel Penelitian ..

70

4.5. Bahan Penelitian ..

73

4.6. Instrumen Penelitian

73

4.7. Prosedur Penelitian ..

74

4.8. Analisis Statistik ..

84

4.9. Keterangan Kelaikan Etik (Ethical Clearance) dan Ijin Penelitian ..

85

BAB V. HASIL PENELITIAN

86

5.1.Karakteristik Sampel Penelitian

86

5.2.Polimorfisme Gen Insl3

88

5.2.1.Polimorfisme exon 1 gen insl3.

88

5.2.2.Polimorfisme exon 2 gen insl3

91

xi

5.3.Polimorfisme Gen Lgr8 .

94

5.3.1.Polimorfisme exon 8 gen lgr8 .

94

5.3.2.Polimorfisme exon 12 gen lgr8

95

5.3.3.Polimorfisme exon 13 gen lgr8.

98

5.4.Kadar Hormon INSL3

104

5.5.Kadar Hormon Estradiol

105

BAB VI PEMBAHASAN 107


6.1.Frekuensi Polimorfisme ..

110

6.2.Polimorfisme Exon 1,Exon 2 Gen insl3 dan Kriptorkismus .

112

6.3.Polimorfisme Exon 8, Exon 12, Exon 13 Gen lgr8 dan Kriptorkismus .

115

6.4.Kadar Hormon INSL3, Hormon Estradiol dan Kriptorkismus ..

117

6.5. Hubungan Polimorfisme Gen insl3, Kadar Hormon Estradiol Plasma yang Tinggi,
Kadar Hormon INSL3 Plasma yang Rendah dan Adanya
Polimorfisme Gen
lgr8 dengan Kejadian Kriptorkismus
.. 120
6.6.Kebaharuan Penelitian ( Novelty)

125

6.7.Keterbatasan Penelitian .

126

BAB VII SIMPULAN DAN SARAN

127

7.1.Simpulan .

127

7.2.Saran ..

128

DAFTAR PUSTAKA

129

xii

9.Halaman Daftar Tabel


Halaman
Tabel 2.1 Kadar hormon pada anak-anak dan pubertas

15

Tabel 2.2 Perbandingan Undescended testis, testis ektopik dan testis retraktil

54

Tabel 5.1 Karakteristik Subyek Penelitian Kelompok Kasus dan Kelompok Kontrol ...

86

Tabel 5.2 Jenis dan Lokasi Kriptorkismus pada Kelompok Kasus ..

86

Tabel 5.3 Frekuensi Polimorfisme Gen Insl3, Gen lgr8 pada Kelompok Kasus
dan Kontrol ..

87

Tabel 5.4 Hubungan antara Frekuensi Polimorfisme Exon 1 Gen Insl3 dan Kejadian
Kriptorkismus pada Anak Laki laki .

90

Tabel 5.5 Hubungan antara Frekuensi Polimorfisme Exon 2 Gen Insl3 dan Kejadian
Kriptorkismus pada Anak Laki-laki .

93

Tabel 5.6 Hubungan antara Frekuensi Polimorfisme Exon 12 Gen lgr8 dan Kejadian
Kriptorkismus pada Anak Laki-laki..

97

Tabel 5.7 Hubungan antara Frekuensi Polimorfisme Exon 13 Gen lgr8 dan Kejadian
Kriptorkismus pada Anak pada Laki-laki

102

Tabel 5.8.1 Beda Kadar Hormon INSL3 Plasma antara Kasus dan Kontrol pada Anak
Laki-laki .

104

Tabel 5.8.2 Beda Frekuensi Kadar Hormon INSL3 Plasma yang Rendah antara Kasus
dan Kontrol pada Anak Laki-laki .

104

Tabel 5.9.1 Beda Kadar Hormon Estradiol Plasma antara Kasus dan Kontrol pada
Anak Laki-laki

105

Tabel 5.9.2 Beda Frekuensi Kadar Hormon Estradiol Plasma yang Tinggi antara
Kasus dan Kontrol pada Anak Laki-laki

106

xiii

10.Halaman Daftar Gambar


Halaman
Gambar 2.1 Kelainan enzim pada biosintesis testosterone

15

Gambar 2.2

Susunan asam amino estradiol 17-beta-dehydrogenase 1 ..

19

Gambar 2.3

Peran hormon INSL3 pada penurunan testis .

20

Gambar 2.4

Susunan asam amino hormon INSL3

22

Gambar 2.5 Susunan asam amino reseptor LGR8 .

23

Gambar 2.6 Penurunan testis transabdominal dan transinguinal .

25

Gambar 2.7 Peran gubernakulum pada penurunan testis.

26

Gambar 2.8 Migrasi testis transabdominal .

29

Gambar 2.9 Migrasi testis transinguinal .

30

Gambar 2.10 Struktur gen

33

Gambar 2.11 Bentuk normal exon 1 gen Insl3 .

34

Gambar 2.12 bentuk normal exon 2 gen Insl3 .

35

Gambar 2.13 Bentuk normal exon 8 gen Lgr8 .

37

Gambar 2.14 Bentuk normal exon 12, exon 13 gen Lgr8

38

Gambar 2.15 Single nucleotide polymorphism (SNPs).

43

Gambar 2.16 Mikrosatelit .

44

Gambar 2.17 Minisatelit ..

45

Gambar 2.18 Indel

46

Gambar 2.19 Diagnosis dan terapi pada UDT ..

60

Gambar 3.1

Kerangka Berpikir.

64

Gambar 3.2

Konsep Penelitian ..

65

Gambar 4.1 Bagan Rancangan penelitian observasional dengan case control study ...

67

Gambar 4.2 Bagan alur penelitian

76

xiv

Gambar 4.3

Skema pengambilan darah ..

79

Gambar 5.1

Hasil PCR exon 1 gen insl3 (panjang 451 pasang basa) .

88

Gambar 5.2 Sequenzing exon 1 gen insl3 normal dan polimorfisme T60T(ACCNCC)

89

Gambar 5.3

Frekuensi Polimorfisme Exon 1 Gen insl3 .

91

Gambar 5.4

Hasil PCR exon 2 gen insl3 (panjang 455 pasang basa).

92

Gambar 5.5 Sequenzing exon 2 gen insl3 normal dan polimorfisme E146E
(GAGNAG) .

92

Gambar 5.6 Hasil PCR exon 8 gen lgr8 (panjang 229 pasang basa) ...

94

Gambar 5.7 Sequenzing exon 8 gen lgr8 normal dan polimorfisme kdstp223M
(AGAANA)

95

Gambar 5.8 Hasil PCR exon 12-13 gen lgr8 ( panjang 439 pasang basa) ..

96

Gambar 5,9 Sequenzing exon 12 gen lgr8 normal dan polimorfisme E319E( GAAGAG)
L331L (CTACTG) ..

96

Gambar 5.10 Frekuensi Polimorfisme E319E, L331L Exon 12 Gen lgr8

98

Gambar 5.11 Sequenzing exon 13 gen lgr8 normal dan polimorfisme S337A (TCAGCA),
H345P (CACCCC) . 101
Gambar 5.12 Sequenzing exon 13 gen lgr8 normal dan polimorfisme Q356P (CAGCCG),
S357S (TCTTCC) ..

101

Gambar 5.13 Frekuensi Polimorfisme S337A, H345P, Q356P, S357S Exon 13 Gen lgr8

103

Gambar 5.14 Kurve ROC Kadar Hormon INSL3 Plasma

105

Gambar 5.15 Kurve ROC Kadar Hormon Estradiol Plasma ..

106

xv

11. Halaman Daftar Singkatan

AMH

Anti Mullerian Hormone

BMI

Body mass index

CGRP

Calcitonin gen-related peptide

CSL

Cranial Suspensari Ligament

DHT

Dehydrotestosterone

DNA

Deoxy nuckeic acid

dNTP

Deoxyribonucleosida triphosphate

EIA

Enzym immune antibody

ELISA

Enzyme-linked immune-sorbent assay

FSH

Follicle Stimulating Hormone

GABA

Gamma Amino Buteric Acid

GFN

Genitofemoral nerve

GnRH

Gonadotropin Releasing Hormone

hCG

Human Chorionic gonadotropin

HHG

Hipothalamus Hipofise Gonad

HRD

Horse radice peroxidase

INSL3

Leydig Insulin Like hormone/ Insulin 3 Hormone Sel Leydig

insl3

Gen Leydig insulin like hormone

JAK3

Jenis Kinase3

LGR8

Reseptor Leucine-rich repeat-contaiing G Protein Coupled Receptor 8

lgr8

Gen leucine-rich repeat-contaiining G Protein Coipled Receptor 8

LH

Luteinizing Hormone

LHRH

Luteinizing Hormone Releasing Hormone

MIS

Mullerian Inhibitory Substance

mRNA

Mesennger Ribo nucleic acid


xvi

PCR

Polymerase chain reaction

RLF

Relaxin-like factor

RLFP

Restriction fragment lengt polymorphism

Sf1

Steriogenic factor 1

SNPs

Singe nucleotide Polymorfhisms

SSR

Simple skuenzing repeate

TMB

Tio metal benzidine

tRNA

= Tranfer Ribonucleic Acid

UDT

Undescended testicle

wt1

Willem tumor 1

xvii

12.Halaman Daftar Lampiran

HASIL SEQUENZING EXON 1 GEN Insl3


HASIL SEQUENZING EXON 2 GEN Insl3
HASIL SEQUENZING EXON 8 GEN Lgr8
HASIL SEQUENZING EXON 12-13 GEN Lgr8
ANALISIS STATISTIK
DATA KARAKTERISTIK SUBYEK PENELITIAN
DATA POLIMORFISME EXON 1, 2 GEN insl3, EXON 8, 12, 13 GEN lgr8
KADAR HORMON INSL3 PLASMA, HORMON ESTRADIOL PLASMA PADA SAMPEL
TIME TABLE PENELITIAN
KUISIONER PENELITIAN
INFORMASI MENGENAI PENELITIAN KEPADA ORANG TUA RESPONDEN
PERNYATAAN KESEDIAAN MENJADI RESPONDEN
KETERANGAN KELAIKAN ETIK ( ETHICAL CLEARANCE )
SOP PENGAMBILAN SAMPEL DARAH
SOP PEMERIKSAAN DNA
DAFTAR PENELITIAN

xviii

BAB I

1.1

PENDAHULUAN

Latar Belakang
Lokasi testis dalam skrotum sangat diperlukan untuk proses spermatogenesis dan
fungsi epididimis, karena suhunya yang lebih rendah 1,5-2,0 derajat C dibandingkan
dengan suhu tubuh. Dengan adanya testis dalam skrotum pemantauan ke arah keganasan
testis dapat dilakukan dan adanya hernia inguinalis dapat dicegah di samping untuk
pemantauan kesehatan yang lainnya. Pada saat bayi dilahirkan dalam keadaan normal
kedua testis sudah berada di skrotum, bila kedua testis pada saat bayi lahir belum ada di
skrotum akan menjadi problem untuk kesehatan selanjutnya. Turunnya testis dari rongga
abdomen ke skrotum terjadi selama kehamilan, dan penurunan itu dipengaruhi oleh faktor
hormonal dan faktor mekanik (Wales dkk, 2003).
Pada tikus pertumbuhan gubernakulum dipengaruhi secara langsung oleh Leydig
insulin like hormone (INSL3), regresi cranial suspensory ligament (CSL) dan penebalan
gubernakulum menghasilkan migrasi transabdominal, yang mana membawa testis pada
cincin inguinalis interna pada usia 3 bulan kehamilan. Fase penurunan testis
transabdominal ini lebih banyak terjadi pada saat embrio (Kaefer, 2004). Pada fase
migrasi transinguinal penurunan testis dimulai bulan ke 7 kehamilan dan sudah komplit
pada akhir trimester 3 kehamilan. Antara bulan ke 7 dan ke 9 kehamilan testis cepat
masuk ke kanalis inguinalis, kemudian secara perlahan-lahan ke skrotum. Selama waktu
ini terjadi regresi gubernakulum yang dipengaruhi hormon testosteron dan diikuti
persistennya ligamen gubernakulum. Secara normal prosesus vaginalis menutup komplit
sebelum bayi lahir, tetapi apabila testis tidak turun maka prosesus vaginalis biasanya

masih menetap. Pada prematuritas sering diikuti penurunan testis secara inkomplit dan
penutupan prosesus vaginalis bersifat sementara. Penurunan testis pascanatal pada
kriptorkismus terjadi sampai usia 1 tahun, namun penurunan terbanyak terjadi selama
usia 3 bulan pertama (Wales dkk., 2003; Kaefer, 2004; McGlynn dkk., 2005).
Kriptorkismus

merupakan

kelainan

saluran

genitourinaria

berupa

tidak

sempurnanya penurunan testis ke dalam skrotum, testis yang tidak turun ke skrotum dapat
berada pada saluran yang normal di antara ginjal dan bagian dalam skrotum (Kaefer,
2004); atau testis terletak pada salah satu tempat sepanjang jalur desensus yang normal,
tetapi tidak mencapai tempat kedudukannya yang normal di dalam skrotum (Styne,
2002).
Pada bayi prematur insiden kriptorkismus ditemukan 30% dari bayi laki-laki yang
prematur, insiden ini menurun menjadi 3 - 5% pada bayi yang lahir cukup bulan,
kemudian pada usia 3 bulan insidennya menjadi 1-3% dan pada usia 1 tahun insiden
tinggal 0,8% (Kaefer, 2004; Acerini dkk., 2009).

Setelah usia 3 bulan insiden

kriptorkismus bisa meningkat lagi karena adanya acending testis yang jumlahnya hampir
seimbang dengan jumlah kriptorkismus testis kongenital (Acerini dkk., 2009;
Sijstermans dkk., 2008; Toppari, 2009; Wohlfart-Veje dkk., 2009). Penelitian Virtanen
dan Toppari tahun 2008 didapatkan insiden kriptorkismus 2-9% dari bayi laki-laki yang
lahir cukup bulan dan insidennya juga ditemukan meningkat pada bayi prematur.
Penelitian di Inggris pada bayi laki-laki yang lahir cukup bulan ditemukan insiden
kriptorkismus meningkat dua kali dari tahun 1905 ke tahun 1980. Secara regional ada
perbedaan yang bermakna antara satu Negara dengan Negara lainnya di mana insiden
kriptorkismus paling rendah di Finlandia dan tertinggi di Denmark dan perbedaan ini

sebagian besar disebabkan oleh faktor lingkungan ( Toppari dkk., 2001). Kaefer tahun
2004 mengatakan kriptorkismus unilateral insidennya dua kali kriptorkismus bilateral,
kriptorkismus dektra insidennya dua kali yang sinistra.
Komplikasi kriptorkismus berupa infertilitas, keganasan, hernia inguinalis, torsi
testis dan masalah psikologis. Insiden azoospermia lebih tinggi pada kelompok
kriptorkismus bilateral daripada unilateral dan keadaan semen lebih baik pada yang
unilateral (Moldenhauer dkk., 2003; Moretti dkk., 2007).
Leydig insulin like hormone atau INSL3 merupakan faktor auto-parakrin yang
menyebabkan formasi gubernakulum menjadi normal, dan formasi

gubernakulum

menentukan turunnya testis. Pada tikus percobaan dilesi gen insl3 menyebabkan
kriptorkismus. Pada manusia polimorfisme

gen insl3 banyak ditemukan tetapi

hubungannya dengan kriptorkismus masih belum jelas ( Toppari dkk., 2001). Kekacauan
genetik gen insl3 atau reseptornya gen lgr8 yang ada pada gubernakulum pada tikus
percobaan menyebabkan tingginya kriptorkismus intraabdominal. Analisis mutasi gen
insl3 dan gen lgr8 pada pasien kriptorkismus hanya ditemukan beberapa mutan dan
khusus pada allel dengan single nucleotide polymorphysm (SNPs). Jadi dasar genetik dari
kriptorkismus pada manusia masih tidak jelas

(The Endocrine society, 2005). Adapun

faktor risiko kriptorkismus adalah bayi lahir prematur dan bayi lahir berat badan rendah.
(Virtanen & Toppari., 2008).
Canto dkk (2003) melakukan 2 penelitian yaitu pertama dengan melakukan
transgenik tikus dengan target dilesi gen insl3 menyebabkan terjadinya kriptorkismus
bilateral. Penelitian kedua dari 150 pasien dengan kriptorkismus idiopatik diobservasi gen
insl3 dan ditemukan mutasi misen pada exon 2, di mana terjadi substitusi nukleotida

2560, dan perubahan asparagin menjadi lisin pada codon 86, mutasi ini terletak pada
rantai A protein INSL3. Pada penelitian ini ditemukan juga tiga polimorfisme pada exon
1 dari gen insl3.
Penelitian Krausz dkk (2000) di Paris dengan melakukan sequenzing gen insl3
pada 31 anak laki-laki yang menderita kriptorkismus idiopatik unilateral dan bilateral,
hanya ditemukan variasi perubahan asam amino pada molekul C peptide. Namun
perubahan ini ditemukan juga pada anak yang dipakai kontrol. Penelitian Bogatcheva dkk
(2003) mendapatkan mutasi exon 1 dan exon 2 gen insl3 yaitu pada P49S, P93L, R102C,
N110K, R102H dan R73X. Penelitian Lim dkk (2001) dan Garlov dkk (2002) di
Denmark menemukan tidak adanya kesuaian polimorfisme gen insl3 pada A 36T dengan
isolated kriptorkismus.
Ferlin dkk (2003) menemukan satu mutasi missen T222P pada exon 8 gen lgr8,
pada 4 kasus anak dengan kriptorkismus namun pada kontrol tidak ditemukan mutasi.
Keempat kasus yang mengalami mutasi menunjukkan fenotip yang berbeda-beda. Pada
gen lgr8 ditemukan juga polimorfisme baik pada exon maupun pada intron, namun
polimorfisme ini juga ditemukan pada kelompok kontrol. Adapun polimorfisme gen lgr8
ditemukan pada intron 2, exon 3 (261G>A) namun asam aminonya tetap (A87A), intron
4, exon 12 ( 957 G>A) dengan asam amino ( E319E), exon 12 ( 993A>G) dengan asam
amino (L331L), intron 12, exon 12 berdekatan dengan exon13, exon 17 (1810 A>G)
dengan asam amino (I160V) dan exon 18.
Pada tikus, pemberian hormon estrogen dapat menghambat proses penurunan
testis transabdominal. Pada ibu hamil yang mendapat pengobatan estrogen sintetik

(diethylstilbestrol) menunjukkan peningkatan insiden kriptorkismus pada anak lakilakinya (Kaefer, 2004). Penurunan testis secara signifikan dihambat oleh hormon
estradiol atau diethylstilbesterol (estrogen non steroid). Pengaruh estrogen diperkirakan
sebagai mediasi penekanan perkembangan sel leydig pasien yang menghasilkan
penurunan produksi testosteron dan INSL3. Sebagai alternatif estrogen dapat secara
langsung mempengaruhi perkembangan CSL dan gubernaculum (The Endocine society,
2005). Penelitian di Denmark menunjukkan ekspresi INSL3 secara substansi menurun
oleh obat diethylstilbesterol ( Ferline dkk., 2003 ). Alat reproduksi laki-laki mengalami
gangguan oleh xenobiotik dan khususnya xenoestrogen dimana fetus dan testis neonatus
sangat sensitif terhadap estrogen karena terjadi inaktisipasi estrogen reseptor

alfa,

meningkatkan steriodogenesis dan inaktivasi estrogen reseptor beta (Delbes dkk., 2006 ).
Penelitian pada tikus yang diobati dengan diethylstilbesterol kasus kriptorkismus
ditemukan meningkat, ini terjadi karena adanya peningkatan inkomplit dari INSL3/RLF
mRNA pada testis fetus. Hormon estrogen dapat menurunkan regulasi produksi INSL3
dan penurunan kinerja INSL3 (Main dkk., 2006 ). McGlynn dkk (2005) mendapatkan
peningkatan estrogen ibu hamil tidak berhubungan dengan meningkatnya risiko
kriptorkismus dan kemungkinan berhubungan dengan menurunnya risiko kriptorkismus.
Dari uraian di atas dapat dikatakan kriptorkismus kasusnya cukup tinggi dan
sebagian masih dapat turun spontan terutama pada usia 3 bulan pertama kelahiran, di
samping itu insiden kriptorkismus meningkat dari tahun ke tahun dan ada perbedaan
insiden antara satu Negara dengan negara lainnya. Kriptorkismus merupakan kelainan
kongenital yang menjadi faktor risiko dan penyebab mayor terjadinya infertilitas dan
keganasan testis di samping faktor risiko lainnya pada usia dewasa (The Endocrine

society, 2005). Kriptorkismus disebabkan oleh multifaktorial dan penyebab pasti masih
belum jelas. Sampai saat ini belum ada data frekuensi polimorfisme gen insl3 dan gen
lgr8, penelitian yang menghubungkan antara polimorfisme pada (exon 1, exon 2) gen
insl3, polimorfisme pada (exon 8, exon 12, exon 13) gen lgr8 dengan kriptorkismus pada
manusia belum ada. Begitu juga dengan penelitian yang menghubungkan kadar hormon
estradiol plasma, kadar hormon INSL3 plasma dengan kriptorkismus pada manusia
belum ada.
1.2

Rumusan Masalah
Berdasarkan latar belakang di atas dapat dirumuskan masalah penelitian sebagai berikut :
1. Berapa frekuensi polimorfisme (exon 1, exon 2) gen insl3, ( exon 8, exon 12, exon 13 )
gen lgr8 pada anak laki-laki yang kriptorkismus ?
2. Apakah polimorfisme ( exon 1, exon 2) gen insl3 merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki ?
3. Apakah polimorfisme (exon 8, exon 12, exon 13) gen lgr8 merupakan faktor risiko
kejadian kriptorkismus pada anak laki-laki ?
4. Apakah kadar hormon INSL3 plasma yang rendah merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki ?
5. Apakah kadar hormon estradiol plasma yang tinggi merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki ?

1.3

Tujuan Penelitian

1.3.1

Tujuan umum
Mengetahui frekuensi polimorfisme dan faktor faktor risiko kejadian kriptorkismus
pada anak laki-laki.

1.3.2
1.

Tujuan khusus
Mengetahui frekuensi polimorfisme (exon 1, exon 2) gen insl3, polimorfisme (exon 8,
exon 12, exon 13 ) gen lgr8 pada anak laki-laki yang kriptorkismus.

2. Membuktikan polimorfisme (exon 1, exon 2) gen insl3 sebagai faktor risiko kejadian
kriptorkismus pada anak laki-laki.
3. Membuktikan polimorfisme ( exon 8, exon 12, exon 13) gen lgr8 sebagai faktor risiko
kejadian kriptorkismus pada anak laki-laki.
4. Membuktikan kadar hormon INSL3 plasma yang rendah sebagai faktor risiko kejadian
kriptorkismus pada anak laki-laki.
5.

Membuktikan kadar hormon estradiol plasma yang tinggi sebagai faktor risiko kejadian
kriptorkismus pada anak laki-laki.

1.4

Manfaat Penelitian

1.4.1 Manfaat akademik / teoritis


Untuk mendapatkan data dasar frekuensi polimorfisme (exon 1,exon 2) gen
insl3, (exon 8, exon 12, exon 13) gen lgr8 pada anak laki-laki yang kriptorkismus.
Bila terbukti polimorfisme (exon 1, exon 2) gen insl3, (exon 8, exon 12, exon
13) gen lgr8 sebagai faktor risiko kriptorkismus pada anak laki-laki, akan menambah
kasanah teoritis bahwa polimorfisme ( exon 1, exon 2) gen insl3 dan ( exon 8, exon 12,
exon 13) gen lgr8 akan mempengaruhi kadar hormon INSL3 dan mengurangi
kemampuan hormon INSL3 dalam merangsang pertumbuhan gubernakulum.
Bila terbukti hormon estradiol plasma yang tinggi sebagai faktor risiko
kriptorkismus pada anak laki-laki, akan memperkuat teori hormon estradiol plasma yang
tinggi menghambat pertumbuhan gubernakulum.
1.4.2

Manfaat praktis
Bila terbukti Polimorfisme (exon 1, exon 2) gen insl3, (exon 8, exon 12, exon 13)
gen lgr8 sebagai faktor risiko kriptorkismus pada anak laki-laki, ini bisa menjadi marker
dalam target terapi hormon hCG dan untuk meramalkan prognosis.
Bila terbukti hormon estradiol plasma yang tinggi sebagai faktor risiko
kriptorkismus pada anak laki-laki, bisa disarankan untuk menghindarkan diri dari paparan
hormon estradiol pada saat ibu hamil.

BAB II

KAJIAN PUSTAKA

2.1 Gonadotropin-Releasing Hormon dan Gonadotropin


Hipotalamus memproduksi gonadotropin-releasing hormone (GnRH), yang
merangsang kelenjar hipofise anterior memproduksi luteinizing hormone (LH) dan folliclestimulating hormone (FSH). LH merangsang sel Leydig dalam testis untuk menghasilkan
testosteron, dan FSH meningkatkan reseptor LH pada membrane sel Leydig. Bila terdapat
gangguan pada tingkat hipotalamus pada sintesis gonadotropin releasing hormone seperti
pada sindrom Kallman, sindrom Prader Willi, anencephali maka akan terjadi hipogonad.
Hipotalamus dalam memproduksi GnRH dipengaruhi oleh, gamma amino buteric acid
(GABA), hormon leptin, kelaparan, infeksi kronis dan tekanan psikososial (Kaefer, 2004).
Pengukuran kadar FSH dan LH basal sering dilakukan pada saat evaluasi biokimia pertama
kali untuk menilai aksis hipotalamus-hipofise- gonad (Muller, 2003).
2.2 Gonad
2.2.1 Embriyogenesis gonad
Formasi gonad dimulai pada usia bayi lima bulan kehamilan dan potensial gonad
terdiri dari epithel coelomic dan medial mesencym mesonefros. Dua sel penting dari testis
dapat diidentifikasi pada usia kehamilan 8 minggu yaitu : sel Sertoli yang terletak pada
garis tubulus seminiferus, dan sel Leydig yang terletak pada jaringan interstitiil. Hormon
pertama yang dihasilkan oleh sel Sertoli adalah mullerian inhibitory substance (MIS, juga
dikenal sebagai anti mullerian hormone atau AMH) . Sekresi dari MIS menyebabkan
involusi system duktus muleri ipsilateral. Interstitial sel Leydig menghasilkan testosteron

10

yang dimulai pada usia 9 minggu kehamilan. Produksi testosteron meningkat dengan cepat
dan kadar tertingginya pada usia 15 sampai 18 minggu kehamilan dan kemudian setelah itu
kadar testosteron menurun sampai kelahiran, produksi testosteron dipengaruhi oleh enzim
3-hydroxysteroid dehydrogenase. Walaupun human chorionic gonadotropin (hCG) tidak
dibutuhkan untuk memulai fungsi sel Leydig, namun hCG mempertahankan rangsangan
steroidogenesis pada hamil muda. Ketika kadar hCG menurun pada trimester tiga
kehamilan, aksis hipotalamus-hipofise mempertahankan kontrol produksi testosteron.
Tidak ada atau tidak sempurnanya aksis hipotamaus-hipofise menyebabkan kegagalan
perkembangan genitalia pada fetus. Testis fetus harus mampu mempertahankan produksi
testosteron yang tinggi selama beberapa minggu sampai lengkapnya defrensiasi traktus
genitalia. Pada saat lahir kadar testosteron plasma lebih tinggi pada bayi laki-laki
dibanding bayi perempuan. Sesaat setelah lahir, plasma testosteron meningkat lagi kedua
kalinya akibat rangsangan aksis hipotalamus-hipofise-gonad. Kadar yang tinggi ini
bertahan selama 3 bulan, setelah 3 bulan kadarnya menurun lagi sampai mulainya pubertas.
2.2.2 Hipospadia dan kordae
Hipospadia merupakan tidak sempurnanya penutupan uretra pada ventral penis
yang disebabkan berhentinya perkembangan spongiosum uretra dan bagian ventral penis.
Pada anak yang mengalami hipospadia orifisium uretra eksterna tidak terletak pada ujung
penis melainkan terletak pada pangkal bagian vental penis. Hipospadia biasanya juga
diikuti oleh kordae yang merupakan lipatan kulit yang terbentang antara ventral penis dan
skrotum sehingga penis kelihatan melekat pada krotum. Prevalensi hipospadia pada bayi
laki-laki yang baru lahir adalah 3-4 kasus per seribu bayi laki-laki yang lahir hidup,
sedangkan prevalensi kordae pada penis prevalensinya lebih banyak. Penyebab pasti dari

11

kasus hipospadia sendiri masih belum jelas, dikatakan gen yang berhubungan dengan
hipospadia terletak pada kromosom 7q32.2q36.1. Mutasi gen

wilm tumor 1(Wt1)

dikatakan menyebabkan hipospadia. Gen Wt1 dan gen steriogenic factor 1 (Sf1) berfungsi
membentuk urogenital ridge, sedangkan bipotensial gonad yaitu pemisahan 46xx dan 46xy
dipengaruhi oleh gen Wt1, gen Sf1, gen SRY dan gen Sox 9. Gen Sf1 mengatur sel leydig
dalam memproduksi hormon testosteron, dan hormon testosteron berfungsi dalam
menstabilisasi struktur duktus wolffian, dikatakan pembentukan struktur duktus wolffian
terjadi pada trimester pertama kehamilan, adanya hipospadia dan kordae menandakan tidak
sempurnanya pembentukan struktur duktus wolffian pada trimester pertama kehamilan,
yang berarti adanya gangguan produksi hormon testosteron pada trimester pertama
kehamilan yang kemungkinan disebabkan oleh mutasi salah satu gen di atas (Hughes,
2009).
2.2.3 Mikropenis
Mikropenis merupakan kelainan dalam ukuran panjang penis ( dari pangkal penis
ke ujung gland penis) dengan ditarik lebih besar dari 2,5 standar deviasi (SD) dibawah
panjang penis rata-rata sesuai usia anak, untuk usia neonatus sampai usia 5 bulan dikatakan
mikropenis bila panjang penis dibawah 1,9 cm dan juga dikatakan mikropenis bila panjang
penis 2,5 cm atau lebih rendah saat penis ditarik (Hughes, 2009). Mikropenis sering
berhubungan dengan sindrom sindrom kelainan kongenital. Pertumbuhan penis sangat
dipengaruhi oleh kelainan pada biosintesis hormon testosteron dan aktivitas hormon
testeosteron. Hormon testosteron dalam merangsang pertumbuhan gitalia eksterna terutama
panjang penis dirubah menjadi hormon dehydrotestosterone (DHT) dan gangguan dalam
perubahan ini disebabkan kekurangan enzim 5 alfa reduktase, di samping itu hormon

12

testosteron dalam menjalankan aktivitasnya dipengaruhi oleh reseptor testosteron yang ada
di penis, kelainan atau mutasi gen reseptor androgen menyebabkan complit androgen
insensitivity syndrome (CAIS) dan partial androgen insensitivity syndrome (PAIS). Jadi
gangguan pada produksi maupun aktivitas testosteron baik pada bayi dalam kandungan
setelah trimester pertama maupun pada masa bayi dan anak akan menyebabkan ukuran
penis kecil atau mikropenis (Hughes, 2009).
2.2.4 Hormon testosteron
Fungsi hormon testis sangat penting selama kehidupan fetus dalam kandungan.
Adanya determinasi kromosom Y pada gonad memberikan efek terjadinya penentuan
gender. Selama masa anak-anak sampai usia 6 bulan sebelum mulainya pubertas produksi
hormon testosteron minimal. Pada saat pubertas terjadi peningkatan produksi hormon
testosteron karena rangsangan dari hormon gonadotropin yang merangsang aktivitas sel
Leydig, pada saat pubertas terjadi sekresi inhibin dari tubulus seminiferus. Beberapa
kelainan
biosistessis

kongenital banyak disebabkan kelainan genetik, sebagai contoh kelainan


testosteron,

kelainan

reseptor

androgen

atau

sindroma

Kalman

(hipogonadotropik hipogonadism). Pada bayi yang maskulin atau kelaki-lakian dapat


terjadi kerusakan yang menimbulkan gangguan pada fetus dan fungsi testis pubertas. Pada
saat pubertas beberapa kelainan dari fungsi testis dan defek klainan tersebut adalah
virilisasi dan maskulin meningkat pada perempuan (Honour & Savage., 2003).
Sintesis testosteron dan produksinya pada fetus laki-laki dimulai pada kira-kira usia 8
minggu usia fetus dan kadarnya maksimal pada usia 12 sampai 13 minggu kehamilan.
Selama periode kritis dari perkembangan alat genitalia, sekresi sel Leydig terutama

13

disetimulasi oleh hormon yang dihasilkan plasenta berupa hCG (Gallagher & Oberfield.,
2004). Di perifer terjadi konversi dari hormon testosteron oleh enzim mikrosomal 5reduktase menghasilkan circulating dehydrotestosteron, hal ini sangat dibutuhkan juga
untuk perkembangan prostat, palus (penis) dan skrotum (Honour & Savage., 2003, Nuver
dkk., 2005). Volume testis yang besar dengan kadar inhibin B yang tinggi menunjukkan
volume tubulus seminiferus membesar (Main dkk., 2006-a). Penelitian yang dilakukan di
Denmark dan Finlandia, di Denmark kasus kriptorkismus dan hipospadianya tinggi diikuti
oleh tingginya ca testis, kecilnya volume testis, kadar semen rendah dan kadar inhibin B
postnatal juga rendah berlawanan dengan di Finlandia (Main dkk., 2006-b)
Secara klinis pemeriksaan perabaan gonad adalah sangat penting, diikuti dengan
pemeriksaan laboratorium dari fungsi testis. USG mungkin dapat membantu lokasi testis
atau tidak terabanya testis. Kelainan testis unilateral kebanyakan disebabkan kelainan
kongenital. Ukuran penis dapat bervarisi mulai dari normal klitoris sampai penis normal
(Honour & Savage., 2003).
Pada saat lahir konsentrasi plasma testosteron dapat meningkat sampai 15 nmol/L
apabila diukur saat ekstraksi. Konsentrasi plasma testosteron menurun setelah minggu
pertama kehidupan dan hormon hCG juga hilang dari sirkulasi. Mulai usia 2 minggu
sampai 2 bulan setelah lahir konsentrasi plasma testosteron dan dihydrotestosteron
meningkat sampai batas di bawah nilai normal dari konsentrasi laki-laki dewasa dan
menurun setelah usia 3-4 bulan. LH menstimulasi sekresi testosteron selama periode ini.
Pada bayi yang prematur, konsentrasi plasma testosteron sesuai dengan keadaan bayi.
Kecepatan dari konsentrasi testosteron pada periode postnatal segera akan meningkat
setelah lahir . Selama masa anak-anak kadar testosteron adalah < 1 nmol, dan kadar

14

dehydotestosteron < 0,5 nmol/L dan meningkat secara progresif pada awal pubertas
terutama pada malam hari (Honour & Savage., 2003). Pengukuran testosteron pada hari
pertama

pada

male

pseudohermaprodite,

kadar

testosteronnya

rendah

akan

mengidenfikasikan adanya indikasi kerusakan sintesis hormon berupa disgenesis testis


dan apabila normal atau meningkat kemungkinan indikasi adanya defek aktivitas androgen
perifer. Pada posnatal peningkatan kadar FSH, LH kemungkinan disebabkan androgen
insensibility sindrom (AIS). Yang kedua bayi dengan mikropenis kemungkinan menderita
sindroma Kallman disertai dengan rendahnya kadar testosteron dan hormon gonadotropin.
Testosteron sebaiknya diukur pada usia 3 hari setelah lahir atau selama 3 bulan setelah hari
pertamaa ( Honour & Savage., 2003). Selanjutnya diuraikan kelainan enzim pada
biosintesis testosteron, serta tabel kadar testosteron, androstenedion, DHT, FSH dan LH

15
Cholesterol
1

Pregnenolone
2

17-Hydroxypregnenolone
3

Progesteron

DHA
4

17-Hydroxyprogesteron

Androstenedione

1=20-Hydroxylase;22-Hydroxylase;20,22-desmolase

Oestrone

2=3-Hydroxysteroid dehydrogenase

Testosteron

3=17-Hydroxylase

5
Oestradiol

4=17,20-Lase

Dihydrotestosterone

5=17-Hydroxysteroid dehydrogenase , 6 = Aromatase, 7 = 5-Reduktase

Gambar 2.1 Kelainan enzim pada biosintesis testosteron, dipetik dari Honour & Savage, 2003
Tabel 2.1

Kadar hormon pada anak-anak dan pubertas, dipetik dari Honour & Savage., 2003
Umur

testosteron,
nmol/l

androstenedion,
nmol/l

DHT, nmol/l

LH, IU/l

FSH, IU/l

1-3 hari

Naik 12

4-10

1,5-4,5

hCG terukur

0-10

4-7 hari

0,5-3,0

1-2,4

0,1-0,8

0-1

0-5

0,5-4 bln

4-14

0,5-2,5

0,2-4,5

0-1

0-28

5 bln-9 thn

0,2-0,5

0,1-0,7

0,05-2

0-1

0-7

P1

0,1-1

0,5-1,2

0-0,2

0,5-2,5

0,5-3

P2

0,1-2

1-2,5

0,1-0,2

1-4 *

0,5-4

P3

0,3-15*

1,5-3,5

0,2-0,8

1-5 *

2,5-4,5

P4

5-25

1,5-5

0,5-2

2-8

3-5,5

P5

9-32

2-5

0,5-2,5

2-8

2-5,5

* konsentrasi sebelum jam 10 pagi, peak ditemukan selama malam hari

16

2.2.5 Anti mullerian hormone (AMH)


Anti-mullerian hormone (AMH) atau Mullerian inhibiting substance (MIS) berupa
glikoprotein dihasilkan oleh sel sertoli sangat esensial untuk deferensiasi normal dari alat
genitalia laki-laki, karena aktivitas AMH menekan perkembangan struktur duktus mulleri
(Honour & Savage., 2003). AMH ini berperan pada fase penurunan testis transabdominal.
Apabila terjadi kelainan genetik pada gen AMH atau reseptornya akan terjadi duktus
muleri persisten, testis tidak turun disertai gubernakulum tipis dan mengalami elongasi,
namun pengaruh AMH pada pertumbuhan gubernakulum minimal (Foresta dkk., 2008).
2.2.6 Genitofemoral nerve (GFN) dan Calcitonin gen-related peptide (CGRP)
Selain hormon testis, genitofemoral nerve (GFN) mempunyai fungsi yang sangat
penting dalam menghasilkan neurotransmitter calcitonin gen-related peptide (CGRP)
(Bajpai&Menon.,2008). GFN

diperlukan dalam maskulinisasi dan CGRP diperlukan

untuk kontraksi ritmik gubernakulum, karena reseptor CGRP ditemukan pada


gubernakulum. Testosteron yang dihasilkan oleh sel leydig testis mempunyai efek
maskulinisasi pada nucleus sensoris dari GFN (Ganglia L1 dan L2), selanjutnya
mensintesis dan mengeluarkan CGRF dari ujung saraf sensoris dan GFN diperlukan pada
penurunan testis transinguinal, begitu juga pengobatan dengan antiandrogen (flutamide)
saat hamil dapat menurunkan secara signifikan CGRP pada tikus laki-laki ( Foresta dkk.,
2008).

17

2.2.7 Hormon estradiol


Hormon estradiol diketahui mempunyai potensi sebagai regulator reproduksi lakilaki dan kematian sel germinal. Hormon estradiol dapat menimbulkan gangguan pada
konsentrasi sirkulasi hormon gonadotropin dan testosteron, selanjutnya menyebabkan
apoptosis pada sel germinal secara tidak langsung (Pentikainen dkk., 2003). Xenobiotik
khususnya xenoestrogen dapat mengganggu

alat reproduksi laki-laki, xenoestrogen

konsentrasinya tinggi dalam lingkungan dan makanan, secara epidemiologi, klinis dan
penelitian eksperimen diperkirakan terpapar secara berlebihan oleh estrogen dan
xenoestrogen. Selama masa fetus dan perkembangan neonatal estrogen bisa merangsang
kelainan perkembangan testis dan memicu kejadian fertilitas pada dewasa. Penelitian ini
menjelaskan testis fetus dan neonatus sangat sensitif terhadap estrogen, inaktivasi estrogen
reseptor alfa meningkatkan steriogenesis dan inaktivasi estrogen reseptor beta
meningkatkan perkembangan sel germinal (Delbes dkk., 2006; Cederroth dkk., 2007).
Toppari (2003) mengatakan hormon estrogen menekan regulasi gen Insl3 dan akan bisa
menyebabkan kriptorkismus pada beberapa kasus.
Penurunan testis secara signifikan dihambat oleh hormon estradiol atau
diethylstilbesterol (estrogen non steroid), pengaruh estradiol diperkirakan sebagai mediasi
penekanan perkembangan sel leydig pasien dan menyebabkan menurunnya produksi
hormon testosteron dan hormon INSL3 (The endocrine society, 2005). Penelitian pada
tikus yang diobati dengan diethylstilbesterol saat hamil kasus kriptorkismus ditemukan
meningkat, diperkirakan adanya estrogen dalam fetus dapat menimbulkan penekanan
ekspresi INSL3 dan adanya estrogen dalam testis menyebabkan feedbac inhibisi terhadap

18

axis hipothalamus hipofise gonad sehingga terjadi hipoandrogenisme (Ivell & Hartung.,
2003).
Thonneau dkk (2003) mendapatkan pencemaran lingkungan oleh bahan- bahan
yang mengandung estrogen atau anti androgen akan mempengaruhi kesehatan reproduksi
laki-laki. Watanabe dkk (2007) mengatakan gen estrogen reseptor 1 dapat meningkatkan
kepekaan perkembangan kelainan alat genitalia laki-laki dihubungkan dengan responnya
terhadap hormon estrogen. Menurut Delbes dkk ( 2005) estrogen reseptor merupakan
mediasi yang menghambat secara invivo pengaruh estrogen endogen pada perkembangan
steriodogenesis testis selama fase janin dan neonatus pada tikus percobaan, karena
produksi androgen merupakan satu-satunya kunci dari mekanisme difrensiasi testis lakilaki di samping diperlukan untuk pertumbuhan traktus reproduksi. Hal ini mendukung
hipotesis fetus dan neonatus yang terpapar dengan lingkungan xenoestrogen dapat
mengganggu maskulinisasi sistem urogenital laki-laki dan fertilitas pada laki-laki dewasa.
Penghambatan biosintesis estrogen pada kriptorkismus unilateral pada binatang percobaan
dengan kadar estrogen testis yang tinggi, bisa memperbaiki secara signifikan pengaruh
estrogen pada fungsi testis. Pada penelitian Galan dkk

(2007) menemukan Polimorfisme

estrogen reseptor 1 dan polimorfisme single nukleotida 12 tidak berhubungan dengan


infertilitas laki-laki yang berat, padahal pada populasi di Italia diperkirakan estrogen
reseptor 1 dan single nukletida polimorfisme 12 mempunyai efek protektif pada
kriptorkismus. Selanjutnya diuraikan gambaran susunan asam amino hormon estradiol 17beta-dehydrogenase sebagai berikut:

19
1
61
121
181
241
301

martvvlitg
etlqldvrds
rmlqaflpdm
lsliecgpvh
fltalrapkp
gagpgaedea

cssgiglhla
ksvaaarerv
krrgsgrvlv
tafmekvlgs
tlryftterf
grgavgdpel

vrlasdpsqs
tegrvdvlvc
tgsvgglmgl
peevldrtdi
lpllrmrldd
gdppaapq

fkvyatlrdl
naglgllgpl
pfndvycask
htfhrfyqyl
psgsnyvtam

ktqgrlweaa
ealgedavas
faleglcesl
ahskqvfrea
hrevfgdvpa

ralacppgsl
vldvnvvgtv
avlllpfgvh
aqnpeevaev
kaeagaeagg

Atau
1 Met-Ala-Arg-Thr-Val-Val-Leu-Ile-Thr-Gly-Cys-Ser-Ser-Gly-Ile-Gly-Leu-His-Leu-Ala21 Val-Arg-Leu-Ala-Ser-Asp-Pro-Ser-Gln-Ser-Phe-Lys-Val-Tyr-Ala-Thr-Leu-Arg-Asp-Leu41 Lys-Thr-Gly-Gly-Arg-Leu-Trp-Glu-Ala-Ala-Arg-Ala-Leu-Ala-Cys-Pro-Pro-Gly-Ser-Leu61 Glu-Thr-Leu-Gln-Leu-Asp-Val-Arg-Asp-Ser-Lys-Ser-Val-Ala-Ala-Ala-Arg-Glu-Arg-Val81 Thr-Glu-Gly-Arg-Val-Asp-Val-Leu-Val-Cys-Asn-Ala-Gly-Leu-Gly-Leu-Leu-Gly-Pro-Leu101 Glu-Ala-Leu-Gly-Glu-Asp-Ala-Val-Ala-Ser-Val-Leu-Asp-Val-Asn-Val-Val-Gly-Thr-Val121 Arg-Met-Leu-Gln-Ala-Phe-Leu-Pro-Asp-Met-Lys-Arg-Arg-Gly-Ser-Gly-Arg-Val-Leu-Val141 Thr-Gly-Ser-Val-Gly-Gly-Leu-Met-Gly-Leu-Pro-Phe-Asn-Asp-Val-Tyr-Cys-Ala-Ser-Lys161 Phe-Ala-Leu-Glu-Gly-Leu-Cys-Glu-Ser-Leu-Ala-Val-Leu-Leu-Leu-Pro-Phe-Gly-Val-His181 Leu-Ser-Leu-Ile-Glu-Cys-Gly-Pro-Val-His-Thr-Ala-Phe-Met-Glu-Lys-Val-Leu-Gly-Ser201 Pro-Glu-Glu-Val-Leu-Asp-Arg-Thr-Asp-Ile-His-Thr-Phe-His-Arg-Phe-Tyr-Gln-Tyr-Leu221 Ala-His-Ser-Lys-Gln-Val-Phe-Arg-Glu-Ala-Ala-Gln-Asn-Pro-Glu-Glu-Val-Ala-Glu-val241 Phe-Leu-Thr-Ala-Leu-Arg-Ala-Pro-Lys-Pro-Thr-Leu-Arg-Tyr-Phe-Thr-Thr-Glu-Arg-Phe261 Leu-Pro-Leu-Leu-Arg-Met-Arg-Leu-Asp-Asp-Pro-Ser-Gly-Ser-Asn-Tyr-Val-Thr-Ala-Met281 His-Arg-Glu-Val-Phe-Gly-Asp-Val-Pro-Ala-Lys-Ala-Glu-Ala-Gly-Ala-Glu-Ala-Gly-Gly301 Gly-Ala-Gly-Pro-Gly-Ala-Glu-Asp-Glu-Ala-Gly-Arg-Gly-Ala-Val-Gly-Asp-Pro-Glu-Leu321 Gly-Asp-Pro-Pro-Ala-Ala-Pro-Gln
Gambar 2.2 Susunan asam amino estradiol 17-beta-dehydrogenase 1, dipetik dari NCBI estradiol,
2010

2.2.8 Hormon INSL3


Sel leydig memproduksi dua hormon yang penting untuk penurunan testis ke
kantong skrotum. Yang pertama hormon testosteron yang diperlukan untuk involusi dari
ligamen suspensori kranial dan untuk migrasi testis transinguinal. Yang kedua hormon
INSL3 disebut juga relaxin-like factor (RLF) yang merangsang pertumbuhan
gubernakulum (Toppari, 2003). Hormon INSL3 merupakan hormon peptida yang baru
dari relaxin-insulin family. Pada mamalia laki-laki hormon INSL3 merupakan produksi
mayor sel Leydig testis dan pada testis dewasa ekspresi hormon INSL3 merupakan
marker yang baik untuk mengetahui fungsi sel leydig . Hormon INSL3 ekspresinya
melemah pada sel leydig prepubertas yang immatur atau sel leydig yang mengalami

20

hypertropi atau perubahan bentuk. Pada tikus percobaan yang mengalami kriptorkismus
kadar hormon INSL3 konsentrasinya menurun ( Ivell & Bathgate., 2002).

Selanjutnya

diuraikan gambar peran hormon INSL3 pada penurunan testis sebagai berikut:

Gambar 2.3 Peran hormon INSL3 pada penurunan testis, dipetik dari Bott, 2006
Identifikasi hormon INSL3 yang normal menandakan fungsi gen Insl3 adalah
baik (Klonisch dkk., 2003). Sejak diketahui hormon INSL3 dapat mencegah apoptosis
pada sel germinal, selanjutnya diperkirakan hormon INSL3 bisa berfungsi juga sebagai
kontrasepsi pada laki-laki ( Amory dkk., 2007). Bott (2006) mengatakan hormon INSL3
dihasilkan oleh sel leydig testis sebelum proliferasi mesenchym dan pertumbuhan
gubernakulum. Transgenik gen Insl3 pada tikus percobaan menyebabkan terjadinya
kriptorkismus dengan gubernakulum yang tidak tumbuh, namun kasus kriptorkismus
yang berhubungan dengan mutasi pada gen Insl3 atau reseptornya s ditemukan sedikit.

21

Pada laki-laki yang normal dan pada tikus percobaan yang organ seksualnya
sudah matur hormon INSL3 konsentrasinya di sirkulasi dapat terdeteksi maksimum 1
ng/ml, sedangkan konsentrasi hormon INSL3 dalam vena spermatika alalah > 14 ng/ml,
karena hormon Insl3 merupakan hormon autokrin-parakrin ( Anand-Ivell dkk., 2006 ).
Hormon INSL3 merupakan marker penting untuk mengetahui fungsi sel leydig dan status
difrensiasinya, ekpresi hormon INSL3 meningkat pada masa fetus,

menurun setelah

bayi lahir dan kemudian ekspresi INSL3 meningkat lagi saat remaja. Kekurangan hormon
INSL3 sangat penting sebagai tanda dari adanya hipogonad ( Foresta dkk., 2008 ).
Konsentrasi hormon INSL3 dalam sirkulasi meningkat pada tikus laki-laki yang dimulai
pada usia 10 hari dan terus meningkat sampai konsentrasi hormon INSL3 mencapai kadar
dewasa pada usia 39 hari setelah lahir. Testis turun ke sekrotum selama fase peningkatan
konsentrasi INSL3. Hormon INSL3 merupakan produksi dari sel leydig fetus dan sel
leydig testis setelah lahir, dan juga pada perempuan hormon INSL3 merupakan produksi
sel theca dan sel luteal dari ovarium setelah lahir. Hormon INSL3 bisa juga berfungsi
sebagai endokrin dan parakrin pada jaringan yang lain (Kumagai dkk., 2002-a).
Selanjutnya diuraikan gambar susunan asam amino hormon INSL3
1 mdprlpawal vllgpalvfa lgpaptpemr eklcghhfvr alvrvcggpr wstearrpat
61 ggdrellqwl errhllhglv adsnltlgpg lqplpqtshh hrhhraaatn parycclsgc
121 tqqdlltlcp y

22

Atau:
1. Met-Asp-Pro-Arg-Leu-Pro-Ala-Trp-Ala-Leu-Val-Leu-Leu-Gly-Pro-Ala-Leu-Val-Phe-Ala21. Leu-Gly-Pro-Ala-Pro-Thr-Pro-Glu-Met-Arg-Glu-Lys-Leu-Cys-Gly-His-His-Phe-Val-Arg41. Ala-Leu-Val-Arg-Val-Cys-Gly-Gly-Pro-Arg-Trp-Ser-Thr-Glu-Ala-Arg-Arg-Pro-Ala-Thr61. Gly-Gly-Asp-Arg-Glu-Leu-Leu-Glu-Trp-Leu-Glu-Arg-Arg-His-Leu-Leu-His-Gly-Leu-Val81. Ala-Asp-Ser-Asn-Leu-Thr-Leu-Gly-Pro-Gly-Leu-Gln-Pro-Leu-Pro-Gln-Thr-Ser-His-His101. His-Arg-His-His-Arg-Ala-Ala-Ala-Thr-Asn-Pro-Ala-Arg-Tyr-Cys-Cys-Leu-Ser-Gly-Cys121. Thr-Gln-Gln-Asp-Leu-Leu-Thr-Leu-Cys-Pro-Tyr

Gambar 2.4 Susunan asam amino hormon INSL3, dipetik dari NCBI INSL3 protein , 2010

2.2.9 Reseptor LGR8


Leucine-rich repeat-containing G Protein Coupled Receptor 8 (LGR8 /GREAT)
merupakan reseptor dari hormon INSL3 (Ferline dkk., 2003; Nuti dkk., 2007). Hormon
INSL3 dan reseptor LGR8 memainkan peran penting pada penurunan testis fase
transabdominal (Kumagai dkk., 2002). Reseptor LGR8 tesebar di testis, ligamen
gubernakulum dan pada epididymis (Anand- Ivell dkk., 2006 ), dan menurut Kumagai
dkk (2002-b) reseptor LGR8 tersebar pada testis, otak, ginjal, otot, tiroid, uterus, sel
darah perifir dan sumsum tulang. Selanjutnya diuraikan gambar susunan asam amino
reseptor LGR8
1
61
121
181
241
301
361
421
481

mivflvfkhl
rafhcdgkdd
elecvngdlk
ffglcnlqil
vnnylealpk
fsslknlgel
erieipnint
fvwviafitc
qyqkyallwm

fslrlitmff
cgngadeenc
svpmisnnvt
ylnhncittl
qmcaqmpqln
dlssntitel
rmfqpmknls
fgnlfvigmr
esvqcrlmgf

llhfivlinv
gdtsgwatif
llslkknkih
rpgifkdlhq
wvdlegnrik
sphlfkdlkl
hiyfknfryc
sfikaentth
lamlstevsv

kdfaltqgsm
gtvhgnansv
slpdkvfiky
ltwlilddnp
yltnstflsc
lqklnlssnp
syaphvricm
amsikilcca
llltyltlek

itpscqkgyf
altqecflkq
tklkkiflqh
itrisqrlft
dsltvlflpr
lmylhknqfe
pltdgissfe
dclmgvylff
flvivfpfsn

pcgnltkclp
ypqccdcket
ncirhisrka
glnslfflsm
nqigfvpekt
slkqlqsldl
dllannilri
vgifdikyrg
irpgkrqtsv

23
541
601
661
721

iliciwmagf
afliivfsyi
slfrveipdt
slstsivwie

liavipfwnk
tmfcsiqkta
mtswiviffl
dssslklgvl

dyfgnfygkn
lqttevrncf
pvnsalnpil
nkitlgdsim

gvcfplyydq tedigskgys lgiflgvnll


grevavanrf ffivfsdaic wipvfvvkil
ytlttnffkd klkqllhkhq rksifkikkk
kpvs

Atau:
1
21
41
61
81
101
121
141
161
181
201
221
241
261
281
301
321
341
361
381
401
421
441
461
481
501
521
541
561
581
601
621
641
661
681
701
721
741

Met-Ile-Val-Phe-Leu-Val-Phe-Lys-His-Leu-Phe-Ser-Leu-Arg-Leu-Ile-Thr-Met-Phe-PheLeu-Leu-His-Phe-Ile-Val-Leu-Ile-Asn-Val-Lys-Asp-Phe-Ala-Leu-Thr-Gln-Gly-Ser-MetIle-Thr-Pro-Ser-Cys-Gln-Lys-Gly-Tyr-Phe-Pro-Cys-Gly-Asn-Leu-Thr-Lys-Cys-Leu-ProArg-Ala-Phe-His-Cys-Asp-Gly-Lys-Asp-Asp-Cys-Gly-Asn-Gly-Ala-Asp-Glu-GLu-Asn-CysGly-Asp-Thr-Ser-Gly-Trp-Ala-Thr-Ile-Phe-Gly-Thr-Val-His-Gly-Asn-Ala-Asn-Ser-ValAla-Leu-Thr-Gln-Glu-Cys-Phe-Leu-Lys-Gln-Tyr-Pro-Gln-Cys-Cys-Asp-Cys-Lys-Glu-ThrGlu-Leu-Glu-Cys-Val-Asn-Gly-Asp-Leu-Lys-Ser-Val-Pro-Met-Ile-Ser-Asn-Asn-Val-ThrLeu-Leu-Ser-Leu-Lys-Lys-Asn-Lys-Ile-His-Ser-Leu-Pro-Asp-Lys-Val-Phe-Ile-Lys-TyrThr-Lys-Leu-Lys-Lys-Ile-Phe-Leu-Gln-His-Asn-Cys-Ile-Arg-His-Ile-Ser-Arg-Lys-AlaPhe-Phe-Gly-Leu-Cys-Asn-Leu-Gln-Ile-Leu-Tyr-Leu-Asn-His-Asn-Cys-Ile-Thr-Thr-LeuArg-Pro-Gly-Ile-Phe-Lys-Asp-Leu-His-Gln-Leu-Thr-Trp-Leu-Ile-Leu-Asp-Asp-Asn-ProIle-Thr-Arg-Ile-Ser-Gln-Arg-Leu-Phe-Thr-Gly-Leu-Asn-Ser-Leu-Phe-Phe-Leu-Ser-MetVal-Asn-Asn-Tyr-Leu-Glu-Ala-Leu-Pro-Lys-Gln-Met-Cys-Ala-Gln-Met-Pro-Gln-Leu-AsnTrp-Val-Asp-Leu-Glu-Gly-Asn-Arg-Ile-Lys-Tyr-Leu-Thr-Asn-Ser-Thr-Phe-Leu-Ser-CysAsp-Ser-Leu-Thr-Val-Leu-Phe-Leu-Pro-Arg-Asn-Gln-Ile-Gly-Phe-Val-Pro-Glu-Lys-ThrPhe-Ser-Ser-Leu-Lys-Asn-Leu-Gly-Glu-Leu-Asp-Leu-Ser-Ser-Asn-Thr-Ile-Thr-Glu-LeuSer-Pro-His-Leu-Phe-Lys-Asp-Leu-Lys-Leu-Leu-Gln-Lys-Leu-Asn-Leu-Ser-Ser-Asn-ProLeu-Met-Tyr-Leu-His-Lys-Asn-Gln-Phe-Glu-Ser-Leu-Lys-Gln-Leu-Gln-Ser-Leu-Asp-LeuGlu-Arg-Ile-Glu-Ile-Pro-Asn-Ile-Asn-Thr-Arg-Met-Phe-Gln-Pro-Met-Lys-Asn-Leu-SerHis-Ile-Tyr-Phe-Lys-Asn-Phe-Arg-Tyr-Cys-Ser-Tyr-Ala-Pro-His-Val-Arg-Ile-Cys-MetPro-Leu-Thr-Asp-Gly-Ile-Ser-Ser-Phe-Glu-Asp-Leu-Leu-Ala-Asn-Asn-Ile-Leu-Arg-IlePhe-Val-Trp-Val-Ile-Ala-Phe-Ile-Thr-Cys-Phe-Gly-Asn-Leu-Phe-Val-Ile-Gly-Met-ArgSer-Phe-Ile-Lys-Ala-Glu-Asn-Thr-Thr-His-Ala-Met-Ser-Ile-Lys-Ile-Leu-Cys-Cys-AlaAsp-Tys-Leu-Met-Gly-Val-Tyr-Leu-Phe-Phe-val-Gly-Ile-Phe-Asp-Ile-Lys-Tyr-Arg-GlyGln-Tyr-Gln-Lys-Tyr-Ala-Leu-Leu-Trp-Met-Glu-Ser-Val-Gln-Cys-Arg-Leu-Met-Gly-PheLeu-Ala-Met-Leu-Ser-Thr-Glu-Val-Ser-Val-Leu-Leu-Leu-Thr-Tyr-Leu-Thr-Leu-Glu-LysPhe-Leu-Val-Ile-Val-Phe-Pro-Phe-Ser-Asn-Ile-Arg-Pro-Gly-Lys-Arg-Gln-Thr-Ser-ValIle-Leu-Ile-Cys-Ile-Trp-Met-Ala-Gly-Phe-Leu-Ile-Ala-Val-Ile-Pro-Phe-Trp-Asn-LysAsp-Tyr-Phe-Gly-Asn-Phe-Tyr-Gly-Lys-Asn-Gly-Val-Cys-Phe-Pro-Leu-Tyr-Tyr-Asp-GlnThr-Glu-Asp-Ile-Gly-Ser-Lys-Gly-Tyr-Ser-Leu-Gly-Ile-Phe-Leu-Gly-Val-Asn-Leu-LeuAla-Phe-Leu-Ile-Ile-Val-Phe-Ser-Tyr-Ile-Thr-Met-Phe-Cys-Ser-Ile-Gln-Lys-Thr-AlaLeu-Gln-Thr-Thr-Glu-Val-Arg-Asn-Cys-Phe-Gly-Arg-Glu-Val-Ala-Val-Ala-Asn-Arg-PhePhe-Phe-Ile-Val-Phe-Ser-Asp-Ala-Ile-Cys-Trp-Ile-Pro-Val-Phe-Val-Val-Lys-Ile-LeuSer-Leu-Phe-Arg-Val-Glu-Ile-Pro-Asp-Thr-Met-Thr-Ser-Trp-Ile-Val-Ile-Phe-Phe-LeuPro-Val-Asn-Ser-Ala-Leu-Asn-Pro-Ile-Leu-Tyr-Thr-Leu-Thr-Thr-Asn-Phe-Phe-Lys-AspLys-Leu-Lys-Gln-Leu-Leu-His-Lys-His-Gln-Arg-Lys-Ser-Ile-Phe-Lys-Ile-Lys-Lys-LysSer-Leu-Ser-Thr-Ser-Ile-Val-Trp-Ile-Gln-Asp-Ser-Ser-Ser-Leu-Lys-Leu-Gly-Val-LeuAsn-Lys-Ile-Thr-Leu-Gly-Asp-Ser-Ile-Met-Lys-Pro-Val-Ser

Gambar 2.5 Susunan asam amino reseptor LGR8, dipetik dari NCBI LGR8 protein, 2010

24

2.3 Pertumbuhan Gubernakulum


Gubernakulum melekat pada gonad pada daerah inguinoskrotal dan ini menjadi
bagian dari penurunan testis. Gubernakulum tumbuh dengan cepat pada fetus laki-laki,
namun pada fetus perempuan pertumbuhan gubernakulum tidak sempurna. Faktor yang
mungkin berperan pada pertumbuhan gubernakulum adalah: hormon INSL3, hormon
testosteron. Tidak sempurnanya pertumbuhan gubernakulum berhubungan dengan aktivitas
mitosis sel pada bulbus gubernakulum dari fetus laki-laki dan fetus perempuan.
Gubernakulum dapat dibagi menjadi: bagian kranial, tali gubernakulum, bagian caudal,
kantong gubernakulum atau gubernakulum bulb. Gubernakulum bulb mengandung inti
mesenchym dengan pembungkus otot. Pada mamalia yang besar seperti babi, manusia,
gubernakulum hanya mengandung sel mesenchym. Orchidektomi pada fetus dapat
mencegah pertumbuhan keluar dari gubernakulum (Emmen dkk., 2000). Gubernakulum
perannya sangat menentukan pada mekanisme yang komplek dari turunnya testis dan
tertutupnya hernia inguinalis (Hutson dkk.,

2004). Selanjutnya diuraikan gambar

penurunan testis transabdominal dan transinguinal serta gambar peran gubernakulum pada
penurunan testis sebagai berikut:

25

Gambar 2.6 Penurunan testis transabdominal dan transinguinal, dipetik dari Foresta dkk.,2008
Gambar A menunjukkan posisi testis sebelum penurunan transabdominal, dimana testis pada
bagian cranial dipegang oleh CSL yang melekat pada dinding belakang abdomen dan bagian
caudal dipegang oleh gubernakulum yang ujungnya pada cincin inguinalilis pada dinding
abdomen. Gambar B penurunan testis transabdominal oleh karena terjadi pertumbuhan
gubernakulum yang dipengaruhi hormon Insl3 dan regresi CSL yang dipengaruhi testosteron,
dan regresi duktus mulleri yang dipengaruhi AMH. Gambar C penurunan testis transinguinal
karena regesi gubernakulum yang dipengaruhi oleh hormon testosteron dan GFN. Gambar D
testis sudah di skrotum dan sudah terjadi regesi penuh gubernakulum.

26

Gambar 2.7

Peran gubernakulum pada penurunan testis, dipetik dari Bott, 2006

2.4 Penurunan Testis


Turunnya testis merupakan proses yang kompleks antara faktor anatomi dan
faktor hormonal. Penurunan testis terjadi karena ada proses perkembangan testis, testis
bergerak dari posisi semula intraabdominal turun ke dasar skrotum. Proses ini umumnya

27

terdiri dari 2 fase, yang pertama disebut fase pertama atau fase transabdominal terjadi
sebelum bayi dilahirkan, pada fase transabdominal testis bergerak menuju abdomen
bagian bawah. Fase kedua disebut juga fase transinguinal, pada fase transinguinal testis
bergerak dari bagian bawah abdomen menuju dasar skrotum. Ada 2 ligamen yang
mempengaruhi pergerakan testis seperti CSL yang melekat dengan gonad pada dinding
perut bagian belakang, dekat dengan tulang rusuk paling bawah.Sedangkan
gubernakulum melekat dengan testis melalui epididymis kemudian masuk dari
intraabdominal menuju cincin bagian dalam canalis inguinalis. Selama fase
transabdominal gubernakulum pada laki-laki berkembang dengan membesar pada cavum
abdomen dan di bawah tekanan pertumbuhan organ visceral pada abdomen serta di
bawah pengaruh hormonal terjadi regresi CSL dan pada saat ini pertumbuhan
gubernakulum bagian caudal yang disebut gubernakulum bulb, pertumbuhan keluar
gubernakulum menyebabkan terjadinya migrasi testis ke inguinal dan testis memilih
tempat dibelakang leher kandung kencing (Emmen dkk., 2000; Foresta dkk.,2008;
Virtanen & Toppari.,2008). Pada fase penurunan testis transinguinal testis bergerak dari
inguinal menuju sekrotum. Pada fase ini terjadi pemendekan gubernakulum cord dan
pemendekan pertumbuhan keluar dari gubernakulum bulb. Fase transabdominal terjadi
antara usia kehamilan 10-23 minggu sedangkan fase transinguinal terjadi antara usia
kehamilan 26-28 minggu dan saat lahir. Pada fase transabdominal yang diperlukan
hormon INSL3 sedangkan pada fase traninguinal yang diperlukan hormon testosteron
(Foresta, dkk., 2008).

28

Proses turunnya testis dibagi menjadi :


2.4.1

Migrasi testis transabdominal


Perkembangan gonad testis dimulai pada dinding abdomen, dengan ligament suspensory
pada bagian kranial dan ligament genitalia atau gubernakulum pada bagian caudal, hal ini
terjadi paling lambat pada minggu ke tujuh kehamilan. Gubernakulum berhubungan
dengan ujung bawah testis-epididimis pada bagian cranial kanalis inguinalis dan hal ini
penting untuk perkembangan normal dari prosesus vaginalis. Mekanisme terputusnya
bagian distal gubernaculum merupakan hasil dari berkurangnya perkembangan prosesus
vaginalis. Regresi dari ligament suspensory cranial dan penebalan gubernakulum
menghasilkan migrasi transabdominal. Keadaan ini membawa testis ke cincin inguinal
interna pada usia tiga bulan kehamilan. Selama bulan ke empat sampai ke lima
kehamilan, kantong luar peritoneum berkembang sepanjang bagian kaudal dari
gubernakulum meluas lewat kanalis inguinalis kedalam skrotum (Achermann, 2005;
Kaefer, 2004).
Emmen dkk tahun 2000 menemukan pada penelitiannya dengan menggunakan
tikus percobaan bahwa hormon INSL3 dan hormon androgen mempunyai peran yang
sangat esensial pada pertumbuhan keluar dari gubernakulum selama penurunan testis
transabdominal, diperkirakan gen Insl3 berperan sebagai perantara pada aktivitas
perkembangan gubernakulum. Gubernakulum memainkan peran yang esensial pada
mekanisme yang komplek dari penurunan testis dan tertutupnya hernia inguinalis (Hutson
dkk., 2004). Selanjutnya diuraikan migrasi testis transabdominal sebagai berikut:

29

Gambar 2.8 Migrasi testis transabdominal, dipetik dari Amann &Veeramachaneni, 2007
2.4.2

Migrasi testis transinguinal


Pase kedua dari penurunan testis dimulai pada bulan ke tujuh kehamilan dan

biasanya lengkap pada trimester ketiga. Antara bulan ketujuh dan kesembilan kehamilan
penurunan testis secara cepat pada kanalis inguinalis dan pelan-pelan masuk ke skrotum.
Selama waktu ini, terjadi regresi gubernakulum atau kejadian ini dipengaruhi proses
androgen dan tetap menetap di ligament gubernakulum. Dalam keadaan normal prosesus
vaginalis menutup komplit sebelum bayi lahir, apabila testis tidak turun, prosesus
vaginalis biasanya masih tertinggal jelas ( secara tidak langsung menjadi hernia
inguinalis). Pada bayi prematur penurunan testis kedalam skrotum banyak tidak lengkap
(Kaefer,
berikut:

2004). Selanjutnya diuraikan gambar migrasi testis transinguinal sebagai

30

Gambar 2.9 Migrasi testis transinguinal, dipetik dari Amann & Veeramachaneni, 2007
2.4.3

Migrasi testis setelah lahir


Kira-kira dua pertiga bayi lahir dengan kriptorkismus testisnya menurun secara

spontan kedalam skrotum. Walaupun penurunan testis masih tetap berlangsung sampai
usia 12 bulan, kebanyakan kasus penurunan testis ditemukan antara usia 4 sampai usia 6
bulan ( dengan asumsi bayi lahir cukup bulan). Terjadinya penurunan testis setelah lahir
diperkirakan disebabkan oleh peningkatan kadar testosteron setelah lahir. Peningkatan
kadar testosteron selama 3 bulan pertama kehidupan merupakan aktivitas kedua dari aksis
hypothalamus-hipofise dengan hilangnya feeback negatif dari pengaruh lingkungan
hormon ibunya (Kaefer, 2004; Suomi 2006).
Suomi dkk tahun 2006 melakukan penelitian prospektif pada bayi laki-laki yang
lahir dengan kriptorkismus diikuti selama 3 bulan, kemudian pada usia tiga bulan

31

dilakukan pemeriksaan hormon FSH, hormon LH dan inhibin B kemudian dibandingkan


dengan kontrol, pada pasien pasien yang kadar hormon FSH, hormon LH yang meningkat
dan produksi inhibin B yang rendah kejadian kriptorkismusnya menetap, sehingga
disimpulkan kriptorkismus sesuai dengan kelainan primer pada testis.
2.5 Gen dan Genom
Salah satu perbedaan antara jasad prokariot dan eukariot adalah pada organisasi
bahan genetiknya. Pada kelompok prokariot, umumnya hanya ada satu unit bahan genetik
utama yang membawa semua informasi genetik yang diperlukan untuk kelangsungan
pertumbuhan jasad tersebut. Sebaliknya, pada kelompok eukariot, bahan genetik utama
terdiri atas beberapa unit independen yang terpisah namun semua unit bahan genetik
merupakan satu kesatuan genom yang menentukan kelangsungan hidup jasad. Gen
merupakan unit molekul DNA atau RNA dengan panjang minimum tertentu yang membawa
informasi mengenai urutan asam amino yang lengkap suatu protein, atau yang menentukan
struktur lengkap suatu molekul rRNA atau tRNA. Genom merupakan salah satu kesatuan
gen yang secara alami dimiliki oleh satu sel atau virus, atau kesatuan kromosom jasad
eukariot dalam fase haploid. Dengan batasan ini maka sepotong molekul DNA yang tidak
membawa informasi genetik yang lengkap tidak dapat disebut sebagai gen melainkan hanya
sebagai fragmen DNA. Demikian juga satu kromosom suatu jasad yang mempunyai lebih
dari satu kromosom juga tidak dapt disebut sebagai genom jasad tersebut ( Yuwono, 2005).

32

2.5.1 Struktur dan fungsi gen


Molekul DNA merupakan dasar untuk metabolisme sel dan pembelahan sel,
maupun memberikan dasar untuk sifat-sifat yang diwariskan. Struktur dan fungsi
sejumlah gen telah ditemukan, dan penetapan urutan nukleotida pada sepasang gen utuh
telah dimungkinkan. Suatu rantai tunggal DNA terdiri dari unit-unit gula deoksiribose
yang dihubungkan oleh gugus fosfat. Basa purinnya adalah adenin (A) dan guanin (G)
sedangkan basa pirimidinnya adalah sitosin (C) dan timin (T) dan urutan basa sepanjang
molekul ini menyusun kode genetik. Kode DNA adalah bersifat umum untuk semua
organisme, dengan perkecualian pada DNA mitokondria yang mempunyai sejumlah
kodon yang berbeda. Urutan kode pada gen tidaklah bersifat kontinu, tetapi diselangseling oleh urutan bukan pengkode sebagai penyela yang jumlah dan panjangnya
beraneka ragam sedangkan fungsinya masih belum diketahui. Urutan pengkode disebut
exon dan urutan penyela disebut intron. Ukuran dan kerumitan gen manusia adalah
berbeda-beda. Suatu mutasi genetik dapat memberikan efek pada setiap tingkat dalam
proses trnskripsi dan translasi, yang akan menghasilkan mRNA yang tidak stabil atau
mRNA yang tidak bisa ditranslasi kedalam molekul polipeptida yang berfungsi. Banyak
jenis mutasi yang dikenal pada penyakit genetik manusia, yang meliputi mutasi titik,
dielesi, inserti dan penyusun kembali dan duplikasi (Kopp, 2009). Selanjutnya diuraikan
gambar struktur gen yang terdiri dari exon dan intron sebagai berikut:

33

Gambar 2.10 Struktur gen, dipetik dari Arya, 2007


2.5.2 Gen yang berperan pada penurunan testis
Adapun gen yang berperan pada penurunan testis: gen SRY, gen insl3, gen igr8,
gen Steriogenic faktor 1 (Sf1), gen Hoxa10, gen Willem tumor 1 (Wt1), gen Sox9, gen
Gata4 (Kaleva & Toppari., 2003; Virtanen & Toppari., 2008).
2.5.3 Gen Insl3
Gen insl3 terletak pada kromosom 19 P13.1-13.3. Gen insl3 mempunyai panjang
beaspear: 4.998 bp atau 4,9 kbp (dari 5001 9999), mempunyai 2 exon : exon 1
panjangnya 194 bp ( dari 5001 5195 ) dan exon 2 panjangnya 546 bp ( dari 9453
9999) (NCBI, 2010) dengan intronnya yang terputus pada daerah code C peptide.
Adapun promoter dari gen Insl3 mengalami restriksi dalam intron 23 dari gen JAK3.
Dipastikan bagian yang pendek hanya 500-700 basefare dan mempunyai intron yang
cukup untuk menentukan ekspresi gen spesifik Insl3 bila terjadi tumor sel leydig ( Ivell

34

& Bathgate., 2002). Gubernakulum memanjang ke sekrotum diikuti masukknya testis ke


kanalis inguinalis dipengaruhi hormon INSL3. Secara klinis perubahan pada gen Insl3
menyebabkan kegagalan testis secara normal masuk ke skrotum selama perkembangan
embriyo ( Ferline dkk., 2003 ). Hal yang menarik ekspresi INSL3 merupakan regulasi
faktor genetiK lainya. Hormon iNSL3 mempunyai struktur yang sangat menyerupai
peptide hormon relaktin atau insulin. Estrogen dapat menurunkan regulasi produksi
iNSL3 dan mengganggu aktivitas gen insl3(Kaleva & Toppari., 2003 ). Primer untuk
Insl3 pada testis manusia adalah: 5!-(CCCAAGCTT)C-CACCATGGACCCCCGT-3!
dan 5!-(CCCAGA TCT)GTAGG-GACAGAGGGTCAGCA-3! (Bogatcheva dkk., 2003).
Sedangkan primer untuk exon 1 gen Insl3, Forward: 5!CTCGTTGCCCAGTGCTCCC3!,
dan Reverse: 5!CATGCAAACCTGCCCACC3! dimana exon 1 panjangnya 195 bp
(5001..5195) terdiri dari 65 kodon dan mengkode 63 asam amino, sedangkan gen insl3
yang diamplifikasi sepanjang 490 pasang basa, selanjutnya diuraikan gambar bentuk
normal exon 1 gen insl3 sebagai berikut:
Forward
4801
4861
4921
4981
5041
5101
5161
5221
5281
Reverse

aaagactcgt
gaaaggctct
ctgtcccttc
cttggccccg
gctgggccct
gttgtgcggc
caccgaagcc
gctctgggaa
tgggcaggtt

tgcccagtgc
ggcactaacc
tccaaggccc
gcgccaccca
gccctggtgt
caccacttcg
aggaggcctg
gccgaggtgg
tgcatgcatg

tccctctggg
ccacccttga
ccagctggga
ccaccatgga
tcgcgttggg
tacgcgcgct
cgaccggagg
ggcaggtgca
tgcccagggc

agaagtacat
cctttttcct
cggcccaggc
cccccgtctg
ccccgcgccc
agtgcgcgtg
cgaccgtgag
cgtaggcgca
tcacctgccg

ccaaggccct
gggcggtcct
gcctataaag
cccgcctggg
accccagaga
tgcgggggcc
tggggacggg
gatgcacacg
gctgcgtgca

ggccctggga
gaagaatgtt
ggggtccccg
cgctggtgct
tgcgtgagaa
cccgctggtc
cagggacagc
tgcagggagg
cagatcgtgg

Gambar 2.11 Bentuk normal exon 1 gen insl3, dipetik dari NCBI gen bank insl3, 2010

35

primer untuk exon 2 gen insl3, Forward: 5!GGATTCGTGCACATGCAGC 3!,


dan Reverse: 5!GGCCTGTAGATGCGAGAC3! dimana exon 2 panjangnya 547pasang
basa (9453..9999) terdiri dari 182 kodon, sedangkan panjang gen insl3 yang diamplifikasi
sepanjang 383 pasang basa, selanjutnya diuraikan gambar bentuk normal exon 2 gen
Insl3 sebagai berikut:
Forward
9361
9421
9481
9541
9601
9661
9721
Reverse
9781
9841
9901
9961

tcagtgggat
tccgttccag
acatctgctc
cctgccccag
ctactgctgc
cctccttggg
tgaggccaca

gtgtgtggat
ctgagtttca
catgggctgg
acctctcacc
ctcagtggct
tgcagcctca
cagcaccata

tcgtgcacat
ctctgtcccc
tggccgacag
atcaccgcca
gtacccaaca
gagtggcctg
aagtctcgca

gcagcatggg
aggtgagttg
taatctcacg
ccaccgtgca
agacctgctg
aggcccagag
tctacaggcc

gtagcatgtc
ctacagtggc
ctgggacctg
gctgccacca
accctctgtc
ggtctggtct
tttgattacc

ctctgtcgtt
tggagagacg
gcctgcagcc
accctgcacg
cctactgatt
ggtgagctcc
tcctgggatg

ggtgctcact
aaatcacacc
gccaaatgtc
cttcttgctg

atctacccca
ctagccctgg
ctcactccag
tctcttagta

gaccaatgcc
cttggaggat
gggagcccca
aataaacgac

acctgcagcc
ccccgctttc
gacgctccgc
ccaaagcagc

tgtggagtca
acagatgctg
tccctgcatg
ttcctgcatt

actgcagaat
gacactgaca
tgtaacaccc
ttctctagaa

Gambar 2.12 Bentuk normal exon 2 gen insl3, dipetik dari NCBI gen bank insl3, 2010
2.5.3.1 Polimorfisme gen Insl3
Dipastikan bagian yang pendek gen Insl3 hanya 500-700 basefare dan
mempunyai intron yang cukup untuk menentukan ekspresi gen insl3 bila diperlukan
tumor sel leydig. Kekacauan genetik dari gen insl3 pada tikus percobaan menyebabkan
tingginya kriptorkismus intraabdominal. Analisis mutasi gen insl3 pada allel dengan
single nucleotide polymorphisme (SNPs) pada pasien kriptorkismus hanya ditemukan
beberapa mutan, jadi dasar genetik dari kriptorkismus pada manusia masih tidak jelas
(The Endocine society, 2005).

Pada penelitian Ferline dkk (2003) dengan

menggunakan 87 pasien kriptorkismus dan 80 kontrol, kemudian dilihat gen insl3


dengan melakukan skuenzing ditemukan 3 mutasi gen insl3 pada 4 pasien. Pasien yang

36

mengalami mutasi menunjukkan perbedaan fenotip dari normosperma sampai komplit


azoosperma, dan dari kriptorkismus bilateral sampai testis retraktil dengan fungsi
endokrin yang masih normal. Pada penelitian Vinci dkk (2004) dengan menggunakan
14 pasien dengan anorchia, peneliti gagal menemukan mutasi pada gen insl3 namun
dilaporkan adanya polimorfisme menghasilkan perubahan asam amino dari Alanin ke
Treonin pada kodon 60 yang ditemukan pada beberapa kasus, namun perubahan ini
tidak menyebabkan anorchia, kemungkinan polimorfisme merupakan risiko faktor
genetik untuk kelainan kongenital lainnya. Penelitian di Denmark oleh Lim dkk (2001)
menemukan tidak adanya kesuaian polimorfisme gen Insl3 pada A36T dengan isolated
kriptorkismus. Penelitian ini menunjukkan ekspresi murin Insl3 secara substansi
menurun oleh obat diethylstilbesterol. Pada penelitian Bogatcheva dkk (2003) dengan
menggunakan 600 kasus didapatkan 4 varian mutan dari insl3 yaitu pada P49S, P93 L,
R10ze dan Nii0K, dimana asam amino pertamanya berhubungan dengan codon pada
lengan yang komplit. Walaupun mutasi gen insl3 yang ditemukan sedikit yang
menyebabkan kriptorkismus, namun adanya faktor pembawa yang dapat dijelaskan
dengan adanya polimorfisme menjadi pertimbangan terjadinya kriptorkismus.

2.5.4 Gen Lgr8


Gen Lgr8 ( Leucine-rich repeat-containing G protein-coupled receptor 8) disebut
juga Relaxin / insulin- like family peptide receptor 2 (RXFP2) atau G Protein coupled
receptor affecting testicular descent. Gen Lgr8 terdiri dari 18 exon dan terletak pada
kromosom 13 yaitu 13q13.1 yang mempunyai panjang 63.330 bp atau 63,3 kbp ( dari 5001
68331 ). exon 1 (5001-5165), exon 2 (23717-23863), exon 3 (27183-27260), exon 4

37

(30496-30601), exon 5 (31415-31486), exon 6 (40079-40150), exon 7 (40777-40848),


exon 8 (42835-42906), exon 9 (43971-44042), exon 10 (47130-47201), exon 11 (4813548206), exon 12 (51842-51913), exon 13 (52025-52096), exon 14 (54581-54652), exon
15 (57265-57494), exon 16 (58137-58547), exon 17 (62660-62878), exon 18 (6760568331) ( NCBI, 2010). Selanjutnya diuraikan gambar bentuk normal exon 8 gen lgr8
dengan panjang 72 pasang basa (42835 .42906) yang terdiri dari 24 kodon, exon 8 gen
lgr8 diamplifikasi dengan premer: Forward 5!ACACAAAGGAGTAGGCCAGG3! dan
Reverse 5!CTAGTGCTAGATGTCATTGC3!, daerah yang diamplifikasi sepanjang 224
pasang basa, untuk jelasnya bisa dilihat pada gambar di bawah ini:
Forward
42721 caggtgagcc aagtatggaa gcacacaaag gagtaggcca ggtgttgagg ggaggcaggt
42781 tttatttcac aaatgtctct aatattggaa atgtttcttg atacattttg tcagaattct
42841 agatgacaat ccaataacca gaatttcaca gcgcttgttt acgggattaa attccttgtt
42901 tttcctgtaa gtattcatca acctttcaat acatctatcg atacattgca atgacatcta
42961 gcactagctt acaaaaagaa cttttaaaaa aatcaagccc acaaaaattt ttattagtca
Reverse

Gambar 2.13 Bentuk normal exon 8 gen lgr8, diperik dari NCBI gen bank Lgr8, 2010
Berikut ini diuraikan gambar bentuk normal exon 12 gen lgr8 yang terdiri dari 72
pasang basa ( 51842.. 51913) dan dibagi menjadi 24 kodon, sedangkan exon 13 terdiri dari 72
pasang basa (52025..52096 ) dan dibagi menjadi 24 kodon . Exon 12 dan exon 13 gen Lgr8
berdekatan sehingga diamplifikasi dengan primer: Forward
5!GGATGATGATAATTGTGAGG3! dan Reverse 5!CTGAAATGCATGCTCCTGTG3!
sedangkan daerah yang diamplifikasikan dari exon 12 dan exon 13 gen lgr8 sebesar: 439 pasang
basa. Selanjutnya dapat dilihat bentuk normal exon 12 dan exon 13 gen lgr8 sebagai berikut:

38

Forward
51721 gttggttaaa ttggattcat attttctgtt acatcaaatg ggatgatgat aattgtgagg
51781 agtaataagt ctgtcattta cttccaaagt aattgctttg ggttttcatt gtcgtcaaca
EXON

12

51841 gggatctgtc tagcaatacg ataacggaac tatcacctca cctttttaaa gacttgaagc


51901 ttctacaaaa gctgtaagtt ctacttctca ccataatcag atttaaaggg caatattttg
51961 agctttcaaa ataataatac cttcaaactt cttttcctct ctcatctaat ggtaaaaaaa
EXON

13

52021 aaaggaacct gtcatccaat cctcttatgt atcttcacaa gaaccagttt gaaagtctta


52081 aacaacttca gtctctgtaa gtgaaatatt acaattatat tgattataat tttagtggat
52141 gtacttagag acacatttat ttttaaatgg gtattttgca cacaggagca tgcatttcag

Reverse
Gambar 2.14 Bentuk normal exon 12,exon 13 gen lgr8,dipetik dari NCBI gen bank lgr8, 2010

2.5.4.1 Polimorfisme gen lgr8


Analisis mutasi gen lgr8 dideteksi dengan SNPs, pada tikus percobaan perubahan
susunan nukleotida gen lgr8 menyebabkan tingginya kasus kriptorkismus intraabdominal,
dan pada penelitian kohort dengan menggunakan 87 pasien
kontrol, dengan melakukan skuenzing

kriptorkismus dan 80

gen lgr8 ditemukan 1 mutasi pada 4 pasien

(Ferline dkk., 2003). Menurut Vinci dkk ( 2004) diketahui gen lgr8 pada manusia
berhubungan dengan penurunan testis, namun kriptorkismus jarang yang disebabkan oleh
mutasi gen lgr8. Pada penelitian Nuti dkk (2007) menemukan mutasi T222P gen lgr8 dan
polimorfisme gen lgr8 yang dicurigai sebagai faktor risiko kriptorkismus. Kejadian
mutasi gen lgr8 adalah 2,9% (28 dari 979 kasus) dan paling banyak pada T222P, namun
fenotip dari mutasi ini berfariasi dari kriptorkismus bilateral, unilateral dan lokasi testis
pada mutasi gen lgr8 juga bervariasi abdominal atau inguinal ( Foresta dkk., 2008)

39

2.5.5

Identifikasi gen pada genom manusia


Gen biasanya diisolasi pertama-tama pada peta gen dari kromosom spesifik dan
juga pada lokasi subkromosom. Lokasi spesifik gen pada kromosom diidentifikasi dengan
bermacam macam teknik. Kira kira 100.000 atau lebih gen pada genom manusia.
Pemetaan dan klonning gen yang normal dan persilangan gen disesuaikan dengan
penyakit dimana step pertama yang menentukan sesuai dengan proses berkembangnya
terapi gen. Fungsi normal gen dan karakteristik produksi proteinnya harus diketahui
(Kopp, 2009).

2.6 Polimorfisme Gen


Manusia menunjukkan hal yang istimewa berupa variasi genetik. Variasi ini
ditunjukkan dari variasi tekanan darah, tinggi badan, warna kulit dan spektrum variasi
genetik penyakit. Semua variasi genetik yang alamiah dari proses ini dikenal sebagai mutasi
yang didefinisikan perubahan dari sequenzing DNA. Perbedaan skuenzing menentukan allel,
dan lokasi gen pada kromosom disebut lokus. Bila individu mempunyai allel yang sama
pada pasangan kromosom individu tersebut disebut homosigot dan bila allelnya berbeda
pada sequenzing DNA maka individu tersebut disebut heterosigot. Allel ditemukan berada
pada lokus dan mempengaruhi genotip dari lokus tersebut. Beberapa lokus kemungkinan
keberadaannya secara individual, dan bila lokus mempunyai dua atau lebih allel yang
keberadaannya secara berulang lebih dari 1% populasi maka lokus itu disebut polimorfik,
dan lokus yang polimorfik sering disebut polimorfisme (Jorde dkk., 2006). Ada hubungan
antara perlekatan polimorfisme dengan situs dari DRR1, dan kemampuan perlekatan ini
berhubungan dengan dua parameter dan tempat perlekatan tersebut dalam visum gen (Jing

40

dkk.,2005). Keanekaragaman urutan basa (polimorfisme) pada DNA bukan pengkode adalah
sangat sering terdapat pada seluruh genom. Apabila polimorfisme tadi mengenai sisi
pemutus enzim restriksi, maka akan diperoleh fragmen DNA dengan ukuran yang berbedabeda setelah digesti DNA oleh endonuklease restriksi. Alel yang berbeda-beda yang
dihasilkan disebut polimorfisme panjang fragmen restriksi ( restriktion fragment length
polymorphism) (RLFP).
Polimorfisme gen DNA dikatagorikan menjadi 4 klas berbeda yaitu: single nucleotide
polymorphism, mikrosatelit, minisalelit, Indel.
2.6.1

Single nucleotide polymorphism (SNPs),


Single nucleotide polymorphism atau SNPs merupakan perubahan genetik atau
variasi yang kecil dan dapat ditemukan pada sequenzing DNA manusia, mempunyai code
genetik yang spesifik dengan 4 nukleotida, yaitu: A (adenine), C (cytosine), T (thymine),
dan G (guanine). Variasi SNPs ditemukan apabila satu nukleotida seperti A diganti
dengan salah satu dari tiga nukleotida (C atau G atau T). Sebagai contoh SNPs adalah
segmen DNA, AAGGTTA menjadi ATGGTTA, dan kejadian SNPs pada populasi
manusia lebih dari 1% dan hanya 3-5% dari code sequenzing DNA manusia
menghasilkan protein, sebagian besar SNPs berada di luar code sequenzing, SNPs yang
berada pada code sequenzing menjadi perhatian khusus peneliti karena dia mempengaruhi
fungsi protein. Walaupun kebanyakan SNPs tidak berpengaruh pada perubahan fisik,
pada penelitian ini SNPs sebagai faktor predisposisi penyakit dan respon penyakit
terhadap obat. DNA polimorfisme khususnya SNPs akan digunakan membantu peneliti
dalam memahami dan menjelaskan mengapa individu berbeda kemampuannya dalam

41

menerima suatu obat, demikian juga menjelaskan mengapa individu mempunyai


pengalaman efek samping yang berbeda pada obat. Selanjutnya SNPs tidak hanya
digunakan untuk proses deteksi obat tetapi untuk pencegahan dan pengobatan yang
praktis. Para peneliti menemukan kebanyakan SNPs tidak berhubungan dengan penyakit
tertentu. SNPs merupakan marker biologi untuk terjadinya penyakit pada genom manusia
tertentu, sebab SNPs biasanya terletak dekat dengan gen yang menyebabkan penyakit,
ada kalanya SNPs secara aktual menyebabkan penyakit, dan selanjutnya dapat digunakan
serta diteliti sebagai penyakit yang disebabkan oleh gen (SNPs NCBI, 2007).
SNPs bersifat sederhana, prevalensinya banyak dan umumnya merupakan bagian
dari polimorfisme DNA yang tumbuh dari substitusi pasang basa tunggal. Perubahan
pasang basa, yang dapat dirangsang oleh mutan kimia atau kerusakan replikasi DNA,
berhubungan dengan SNPs dan jumlahnya sangat banyak dari total variasi. Kebanyakan
SNPs hanya mempunyai 2 allel dan rasio kedua allel pada populasi berkisar antara 1: 100
sampai 50 : 50. SNPs dapat diidentifikasi dengan melakukan skuenzing pada regio yang
sama dari genom pada beberapa individu. Walaupun SNPs sudah mempunyai kode
skuenzing, namun SNPs masih berhubungan dengan gene yang berhubungan langsung
dengan fenotip, dan sebagian besar SNPs ditemukan locusnya anonim. Ditemukan lokus
anonimus artinya tidak berhubungan secara langsung dengan fenotip. Beberapa kelainan
pada gen yang lain berhubungan dengan perubahan fenotip secara signifikan yang
merupakan marker DNA. Lokus DNA yang spesifik dengan variasi yang teridentifikasi
pada penelitian medis dapat digunakan sebagai marker untuk identifikasi dan follow up
perbedaan fenotip pada kelompok masyarakat (Hartwell dkk., 2008). SNPs bisa
digunakan sebagai marker untuk mengenal adanya mutasi allel pada gen yang tidak

42

sempurna atau cacat pada individu dengan kelainan genetik dan sebagian diantaranya
diwariskan pada keluarga yang lain sebagai karier. Dengan analisis DNA individu yang
palsu dan yang ada hubungannya dengan keluarga bisa dipisahkan mana allel yang
normal dan mana yang mutasi (Hickey dkk., 2007). Selanjutnya diuraikan 3 bentuk
gambar SNPs sebagai berikut:

43

SNPs
- - Cys - - - Asn - - - Arg - - ___ A -

T G T -

A A T -

A G A -___

___ A -

T G T -

G A T -

A G A -___

- - Cys - - - Asp - - - Arg - - functioning or non-functioning protein?


Gambar 2.15 single nucleotida polymorphism (SNPs), dipetik dari Wikipedia SNPs, 2010
2.6.2

Mikrosatelit
Mikrosatelit merupakan pengulangan nukleotida dan pengulangan segmen yang
dideteksi dengan cara sequensing, biasanya sederhana, berisi dua, tiga atau empat
nukleotida yang diulang, nukleotida ini bisa diulang 10-100 kali. kejadian mikrosatelit
sering ditemukan pada manusia dan genom lainnya, biasanya kejadiannya setiap seribu
pasang basa, ada allel yang bervariasi dalam genom (microsatellite Wikipedia, 2010).
Unit pada genom dari manusia atau organisme yang komplek lainnya, berada
pada lokus yang didapat dengan cara skuenzing yang berulang. Mikrosatelit disebut juga
SSRs ( simple sekuensing repeate ). Mikrosatelit meningkat secara spontan dari

44

pemeriksaan random pada awal produksi dengan empat dari lima pengulangan.
Mikrosatelit merupakan polimorfisme dengan banyaknya allel yang berbeda pada locus
mikrosatelit. Allel yang baru timbul pada lokus mikrosatelit rata-rata 10-3 per lokus
gamet. Frekwensi dari peningkatan variasi rata-rata 10-9 dan menghasilkan variasi besar
pada populasi. Pada saat yang sama rata-rata mutasi mikrosatelit adalah rendah (Hartwell
dkk., 2008). Selanjutnya diuraikan gambar mikrosatelit sebagai berikut:

Gambar 2.16 Mikrosatelit, dipetik dari Wikipedia Microsatellite, 2010


2.6.3

Minisatelit
Merupakan katagori penting yang ke dua dari pengulangan DNA yang merupakan
bentuk yang lebih besar. Pengulangan unit tersebut antara 20 100 base-pare dan unit
trersebut diulang sampai seribu perlokus. Disini diberikan lokus minisatelit jumlah
panjang lokus 0,5-20 kb. Baik mikrosatelit maupun minisatelit meningkat dari kejadian
random beberapa ribu genom pada semua vertebrata. Minisatelit lokus kejadian
polimorfisme tinggi sekali disebabkan kromosom yang homogen dengan bagian dari
banyaknya pengulangan yang pendek sampai yang panjang. Secara genetik banyaknya
lokus minisatelit yang melakukan penyilangan hybrid 5-10 lokus yang menjadi distribusi
genom. Dengan menggunakan beberapa minisatelit yang sekuensingnya di hibridisasi

45

dapat ditunjukan pada genom. Prekwensi multi lokus adalah 1 : 100.000 base-pare dari
30.000 genum pada manusia (Hartwell

dkk., 2008). Selanjutnya diuraikan gambar

minisatelit sebagai berikut:

Gambar 2.17 Minisatelit, dipetik dari Wikipedia Minisatelit, 2010


2.6.4

Dilesi, duplikasi dan insersi pada lokus yang tidak diulang ( Indel)
Perubahan DNA pada katagori yang luas menghasilkan kejadian mutasi yang
luas atau tidak berulangnya lokus DNA oleh delesi, duplikasi atau insersi satu atau lebih
base-pair. Mutasi ini umumnya disebut indels, besarnya berkisar antara satu atau lebih
base-pair sampai multipel megabase-pair. Dilesi yang kecil dan duplikasi dari sebagian
kecil base-pair sampai kilo base-pair yang sangat panjang sering meningkat dari
ketidaksamaan penyilangan antara tempat non homolog selama rekombinasi miotik.
Bahan dilesi yang hilang dari satu homolog akan ditambahkan dengan duplikasi yang
lainnya. Insersi yang kecil besarnya berkisar dari ratusan sampai ribuan base-pair dapat

46

juga disebabkan oleh pemindahan elemen yang terintegrasi secara random ke dalam
genom.

SNPs, mikrosatelit, minisatelit dan indels yang tidak berulang pada penyiapan

lokus merupakan dasar mendeteksi perbedaan genotif diantara individu. Satu


perbandingan sekuensing DNA atau penelitian analitik mempunyai identifikasi DNA
yang berfariasi atau kumpulan dari variasi atau penelitian yang dapat digunakan. Ini
merupakan tehnik pertama untuk mendeteksi langsung polimorfisme DNA (Hartwell
dkk., 2008).

Selanjutnya diuraikan gambar indel sebagai berikut:

Gambar 2.18 Indel, dipetik dari Wikipedia Indel, 2010

47

2.6.5

Bagaimana mendeteksi perubahan allel pada sepanjang lokus


SNPs dari polimorfisme DNA ditegaskan oleh beberapa bagian dari sequenzing
DNA, yang menghasilkan semua cara deteksi didasarkan pada kemampuan mendeteksi
variasi nukleotida. Dapat dikatagorikan tiga katagori DNA Polimorfisme yaitu
mikrosatelit, minisatelit dan delesi / duplikasi/ insersi semuanya merupakan variasi secara
actual ukuran dari lokus. Allel yang besarnya berbeda dari satu alell lainnya dapat secara
langsung dan dengan mudah dikenal dengan elektroporesis gel. Apabila perbedaan
besarnya antara allel lebih kecil dari 1 kb, penentuan genotip dapat dengan mudah dan
cepat dapat diikuti. Pengerjaannya mulai dengan menggunakan sepasang

primer

tambahan untuk sequenzing pada salah satu pinggiran dari polimorfisme sebenarnya
diperjelas dengan PCR pada lokus dari DNA secara individual. Kemudian produksi PCR
dilakukan ekektroporesis gel untuk memisahkan fragmen DNA menurut besarnya.
Setelah deberikan ethidium bromide allel menunjukan gerombolan yang spesifik. Semua
kemungkinan genotip yang homozygote dan heterozygote dapat dikenal dengan jalan ini.
Peneliti tunggal dapat menggunakan protokol ini untuk ratusan genotip dari sampel pada
satu hari, tanpa peralatan khusus. Protokol ini juga dapat dipertanggungjawabkan
menggunakan fluresensi primer tagged dan elektroporesis pada peralatan yang sama yang
digunakan untuk sekuensing DNA secara otomatis. Sekarang fokus perhatian pada
katagori khusus dari mikrosatelit dan minisatelit yang mana keduanya ditentukan sebagai
polmorfisme yang berbeda pada jumlah dan pengulangan elemen (Hartwell dkk., 2008).

48

2.7. Kriptorkismus
2.7.1 Definisi kriptorkismus:
Kriptorkismus

merupakan

kelainan

saluran

genitourinaria

berupa

tidak

sempurnanya penurunan testis ke dalam skrotum yang sering ditemukan pada anak kecil.
Testis yang tidak turun ke skrotum dapat berada pada saluran yang normal di antara ginjal
dan bagian dalam skrotum (Kaefer, 2004), atau testis terletak pada salah satu tempat
sepanjang jalur desensus yang normal, tetapi tidak mencapai tempat kedudukannya yang
normal di dalam skrotum (Styne, 2002). Kriptorkismus merupakan kondisi patologi berupa
kegagalan testis turun ke dalam skrotum, kadang-kadang karena kriptorkismus terjadi
atropi tubulus semineferus dan lokasi testis pada kriptorkismus dapat berada di canalis
inguinalis, daerah preskrotal atau daerah abdomen (Moretti dkk., 2007; Hutson, 2007).
Istilah kriptorkismus berasal dari kata Yunani cryptos yang berarti tersembunyi, dan
orchis yang dalam bahasa latin disebut sebagai testis. Kriptorkismus murni sering
ditemukan pada bayi prematur, namun testis masih dapat turun selama satu tahun pertama
kehidupannya (Wales dkk., 2003). Pada pemeriksaan

Ultrasonografi (USG), banyak

penulis yang meragukan kemampuan ultrasonografi untuk menditeksi testis intraabdominal oleh karena masih ada musuh utama bagi transduser USG ialah bayangan usus
dan udara di dalam abdomen yang dapat memberikan artefak dan menghalangi identasi
struktur organ disekitarnya.

49

2.7.2 Insiden kriptorkismus


Oleh karena menurunnya testis terjadi selama kehidupan fetus, maka insiden dari
kriptorkismus tergantung dari usia kehamilan dari bayi tersebut. Maksimum 30% bayi lakilaki yang prematur mempunyai testis yang tidak turun. Insiden ini menurun menjadi 3
sampai 5% pada bayi yang lahir cukup bulan. Penurunan testis akan terus berlangsung
pada beberapa pasien selama satu tahun kehidupannya, yang mana pada usia satu tahun
insiden kriptorkismus maksimal 0,8%. Penurunan testis pada bayi setelah lahir kebanyakan
karena pengaruh testosteron neonatus dalam usia 3 bulan pertama. Walaupun sebelumnya
testis dapat turun sampai usia satu tahun setelah lahir, kebanyakan testis akan turun secara
spontan dalam 3 bulan pertama kelahiran. Kriptorkismus unilateral insiden biasanya dua
kali kriptorkismus bilateral, dan kriptorkismus dektra insiden biasanya dua kali
kriptorkismus yang sinistra. Disamping itu tidak ditemukan adanya perbedaan insiden
antara ras (Kaefer, 2004). Penelitian prospektif mendapatkan prevalen kriptorkismus pada
bayi dengan berat lahir lebih atau sama dengan 2500 gram, meningkat di United Kingdom
dari 2,7% menjadi 4,1% antara tahun 1950 dan tahun 1990. Pada Negara lain dengan
penelitian yang sama selama dua decade bervariasi antara 2,1% menjadi 8,4%. Selanjutnya
terjadi penurunan testis spontan dan tinggal 0,9% sampai 1,8 %

pada usia 3 bulan

(Virtanen & Toppari., 2008), dilain pihak kriptorkismus ditemukan 1-4% pada bayi lakilaki yang lahir (McGlynn dkk., 2005).

50

2.7.3 Etiologi dan patogenesis kriptorkismus


Kausa kriptorkismus ialah multiple dan mungkin berbeda pada kasus yang satu
dengan yang lain, beberapa hal yang dianggap menentukan ialah: Meliputi kelainan axis
hipotalamus-hipofise-testis.

Hipotalamus

menghasilkan

GnRH,

Hipofise

anterior

menghasilkan FSH, dan LH, sedangkan testis terdiri dari sel sertoli yang menghasilkan
AMH, dan sel leydig yang menghasilkan hormon testosteron dan hormon INSL3. Desensus
testis tidak terjadi pada mamalia yang hipofisenya telah diangkat, ini menandakan bahwa
kekurangan FSH dan LH menyebabkan terjadinya kriptorkismus. Pemberian hormon
gonadotropin pada pengobatan kriptorkismus ternyata efektif, maka itu dikemukan
anggapan bahwa kriptorkismus disebabkan oleh defisiensi sekresi gonadotropin.
Kekurangan hormon INSL3 akan mengakibatkan kriptorkismus karena

hormon INSL3

menyebabkan pertumbuhan gubernakulum dan terjadinya desensus testis tranabdominal,


demikian juga kekurangan AMH akan menyebabkan kriptorkismus karena AMH terjadi
regresi duktus mulleri, demikian juga halnya kekurangan hormon testosteron akan
menyebabkan kriptorkismus juga karena hormon testosteron menyebabkan regresi CSL
dan regresi gubernakulum untuk desensus testis traninguinal (Foresta dkk., 2008).
Peningkatan hormon estrogen dicurigai akan menekan rangsangan untuk turunnya testis
karena hormon estrogen dicurigai menekan sel leydig testis dalam memproduksi INSL3
dan testosteron (McGlynn dkk., 2005).
Menurut Wales dkk (2003) kriptorkismus dapat disebabkan oleh faktor-faktor
mekanik atau kegagalan hormonal . Kadang-kadang bisa juga disebabkan oleh mutasi gen
Insl3 yang mengontrol kontraksi gubernakulum. Frekuensi kriptorkismus meningkat pada :
defisiensi gonadotropin, disgenesis testis termasuk kelainan kromosom, malformasi

51

congenital dan sindrom-sindrom. Pada aplasia hipofise ditemukan bayi lahir dengan cukup
bulan mengalami mikropenis dan bilateral kriptorkismus, 2 jam setelah dilahirkan
diperiksa kadar gula darahnya rendah, hormon testosteronnya rendah, defisiensi
dehidrotestosteron, GH defisiensi sehingga diagnosisnya panhipopituitarisme. Di samping
itu dapat diperkirakan penyebab mikropenis : 30% oleh karena hipopituitarisme, 25% oleh
karena hipogonad primer dan 45% idiopatik. Mikropenis dengan hypoglikemia
menjelaskan congenital hipopituitarism (Cervantes dkk.,

2006). Pada hipogonad dan

infertilitas ditemukan maksimum 40% prolaktinoma dari 60%

adenoma hipofise dan

menyebabkan terjadinya hipogonad (Gillam dkk., 2006). Adapun beberapa faktor risiko
kriptorkismus adalah bayi berat lahir rendah, kelainan malformasi (hipospadia, kelainan
epididimis dan hernia inguinalis) (Thonneau dkk, 2003).
2.7.4. Klasifikasi kriptorkismus
Undescended testis (UDT) diklasifikasikan menjadi: testis teraba dan testis tidak
teraba, testis teraba terdiri dari testis retraktil, testis ektopik dan murni UDT sedangkan
testis tidak teraba diklasifikasikan menjadi testis intraabdominal dan canaliculer ( di dalam
canalis inguinalis) . UDT umumnya kebanyakan inguinal (63%) diikuti preskrotal (24%),
ektopik (12%) dan intraabdominal (8%). Perlu dibedakan antara murni kriptorkismus,
testis retraktil dan testis ektopik untuk penanganan dan implikasi prognosis (Bajpai &
Menon., 2008).
Testis ektopik merupakan penyimpangan turunnya testis dari saluran yang normal,
tidak melalui cincin inguinalis ekterna dan tidak berhubungan dengan kerusakan testis atau
transformasi keganasan. Umumnya yang menjadi tempat dari testis ektopik adalah: bagian

52

luar dari kantong inguinal, pada perineum, kanalis femoralis, daerah suprapubik dan
kontralateral dari skrotum. Testis ektopik bisa dibedakan dengan kriptorkismus oleh
adanya pertumbuhan skrotum yang normal dan tidak adanya hernia inguinalis. Testis
retraktil merupakan bentuk lain dari penurunan testis ke dalam skrotum dimana aktipnya
reflek otot kremaster menyebabkan testis tertarik ke pangkal paha. Testis retraktil biasanya
bilateral dan sering ditemukan pada anak usia 2-6 tahun, kejadiannya 20% dari anak lakilaki yang normal dimana testis masih dapat dimanipulasi samapi ke bagian bawah skrotum.
Dengan membesarnya volume testis pada pase pubertas kejadian ini akan menjadi normal.
Kejadian ini perlu dibedakan dengan kriptorkismus karena pertumbuhan skrotum normal
dan tesis bisa turun ke skrotum (Bajpai & Menon., 2008).
Maksimum 20% kriptorkismus testisnya tidak teraba pada pemeriksaan klinis, testis
kebanyakan berada disebelah kiri. Dari testis yang tidak teraba 50%-60% kasus testisnya
masih utuh dan berada pada posisi intraabdominal atau inguinal dan yang sungguhsungguh tidak ada sekitar 20% dari kasus. Testis yang naik atau kriptorkismus yang
didapat sering ditemukan pada anak yang sebelumnya testis sudah turun di skrotum. Pada
anak laki-laki yang testisnya sudah turun saat dilahirkan, tetapi selama masa anak-anak
sering antara usia 4-10 tahun testis tidak masih ada di skrotum ( Bajpai & Menon., 2008).
Menurut Kaufer (2004) kriptorkismus dapat diklasifikasikan berdasarkan etiopatogenesis,
lokasi testisnya atau gambaran histopatologik. Dalam klinik yang sering digunakan
berdasarkan lokasinya :

53

2.7.4.1 Klasifikasi berdasarkan etiopatogenesis :


1. Mekanis / anatomik ( perlekatan-perlekatan, kelainan kanalis inguinalis)
2. Endokrin/hormonal (kelainan axis hipotalamus-hipofisis-testis)
3. Disgenetik (Kelainan interseks multipel)
4. Herediter/ genetik
2.7.4.2 Klasifikasi berdasarkan lokasi
1. Skrotal tinggi (supraskrotal) : 40%
2. Intrakanalikular (inguinal)

: 20%

3. Intraabdominal (abdominal )

: 10%

4. Terobstruksi

: 30%

2.7.4.3 Klasifikasi berdasarkan gambaran histopatologik


1. Tipe I : Kelainan minimal
2. Tipe II : Hipoplasia germinal berat dan hipoplasia tubular ringan sampai berat,
sel sertoli normal
3. Tipe III : Hipoplasia germinal dan tubular berat, hipoplasia sel sertoli
4. Tipe IV : Hipoplasia germinal dan tubular, hyperplasia sel sertoli
Selanjutnya diuraikan tabel perbandingan UDT, testis ektopik dan testis retraktil sebagai berikut:

54

Tabel 2.2
Perbandingan Undescended testis, testis ektopik dan testis retraktil, dipetik dari ( Bajpai &
Menon, 2008)
Gambaran

Uudescended testis

Testis ektopik

Testis retraktil

Abnormalitas

Testis tidak turun

Deviasi dari normal

Reflek kremaster
meningkat

Histologi testis

Testis disgenesis

Testis normal

Testis normal

Skrotum

Perkembangan kurang
baik

Perkembangan normal Perkembangan normal

Spermatic cord

Panjang

Panjang

Normal

Hernia

Sering

Jarang

Tidak ada

Komplikasi

Keganasan, infertilitas Trauma

Jarang

2.7.5 Komplikasi kriptorkismus


2.7.5.1 Infertilitas
Insiden azoospermia lebih tinggi pada klompok kriptorkismus bilateral dari pada
unilateral dan keadaan semen lebih baik pada yang unilateral (Moretti dkk., 2007).
Menurut Moldenhauer dkk (2003) pada UDT unilateral / bilateral ditemukan infertilitas
30%-80%. Sampai usia satu tahun, secara histologi testis yang belum turun ke skrotum
masih normal, termasuk masih normalnya populasi sel interstitial dan sel germinal. Pada
usia 18 bulan kedua sel tadi dengan mikroskop elektron mengalami perubahan histologi
berupa kerusakan populasi sel germinal. Keadaan yang sama juga terjadi pada usia 2
tahun pada testis kontralateral yang tidak turun. Secara klinis pada kriptorkismus terjadi
penurunan fertilitas, Setelah orchidopeksi, penurunan fertilitas terjadi 50 sampai 70 %
pada kriptorkismus unilateral dan 75% pada kriptorkismus bilateral (Kaefer, 2004).

55

Menurut Bajpai & Menon (2008) secara histology sel germinal sudah mengalami
kerusakan pada UDT mulai anak usia 6-12 bulan bila testis tidak masuk ke dalam
skrotum. Kerusakan yang terjadi berupa lambatnya maturasi sel germinal, menurunnya
jumlah sel germinal, tubulus seminiferus mengalami hialinisasi dan menurunnya jamlah
sel leydig yang khusus.
2.7.5.2 Keganasan
Pada Negara industri dalam 10 tahun terakhir terjadi peningkatan insiden ca testis
yang bersamaan dengan peningkatan insiden kriptorkismus (Thonneau dkk., 2003).
Individu yang lahir dengan UDT mempunyai insiden keganasan maksimum 40 kali
dibandingkan dengan yang lahir testisnya ada diskrotum (Kaefer, 2004), sedangkan
Bajpai & Menon (2008) mengatakan risiko keganasan pada UDT adalah 4-10 kali lebih
tinggi dibandingkan pada populasi normal dan maksimum 1 dari 80 UDT unilateral dan 1
dari 40 UDT bilateral. Sedangkan usia terjadinya keganasan adalah 15-40 tahun.
Maksimum 10% dari testis yang berkembang menjadi tumor testis mempunyai
riwayat UDT. Insiden keganasan testis meningkat dengan tingginya lokasi UDT testis
dan tumor testis enam kali lebih banyak pada testis abdominal dibandingkan dengan testis
inguinal. Kira-kira dari 14% testis intraabdominal, berkembang 50% nya menjadi tumor
testis . Pada pengamatan 10-20% tumor testis yang ditemukan pada pasien kriptorkismus
yang mengalami penurunan normal ditemukan mempunyai kelainan intrinsic (Kaefer,
2004). Keganasan yang sering terjadi pada testis kriptorkid ialah tumor sel germinal dan
yang terbanyak ialah seminoma (43%).

56

2.7.5.3 Hernia inguinalis


Maksimum 90% dari UDT disertai menetapnya prosesus vaginalis. Hernia
inguinalis tidak langsung ditemukan banyak pada kasus penurunan testis yang minimal
dan dengan epididimis yang abnormal. Testis ektopik insiden hernia inguinalisnya
rendah. Walaupun menetapnya prosesus vaginalis sering kecil pada operasi hernia
sebaiknya digabungkan dengan orkidopeksi (Kaefer, 2004).
2.7.5.4 Torsi testis
Torsi testis merupakan komplikasi kriptorkismus yang juga penting. Kejadian ini
bahkan dapat terjadi sebelum lahir. Diperkirakan bahwa insidennya mungkin lebih tinggi
dibandingkan testis scrotal normal. Torsi testis yang berhubungan dengan kriptorkismus
biasanya torsi intravaginal, yang mungkin diinduksi banyaknya kelainan pada
persambungan epididimis-testis, maupun karena kemungkinan terkena trauma pada testis
inguinal lebih tinggi dibandingkan testis skrotal. Torsi funikulus spermatikus juga dapat
terjadi sekunder terhadap suatu tumor pada testis kriptorkid (Kaefer, 2004).

57

2.7.5.5 Masalah psikologis


Pada penderita kriptorkismus sering terdapat masalah psikologis sejak masa anakanak, dan bertambah pada pubertas. Hal itu dapat terjadi bila anak itu membandingkan
bentuk tubuhnya dengan anak yang lain. Masalah psikologis sudah dapat mulai timbul
pada usia 4 tahun (Kaefer, 2004).
2.7.6 Terapi pada kriptorkismus
2.7.6.1 Terapi hormonal pada kriptorkismus
Bila kemungkinan turunnya testis masih diragukan pada kriptorkismus dan
kasusnya diperkirakan disebabkan oleh kekurangan gonadotropin sentral, kasus tersebut
dapat diberikan suntikan hCG 500 unit secara intra muskuler dua kali seminggu selama 5
minggu pada usia 1-6 tahun, dan 1000 unit dua kali seminggu pada anak yang lebih besar.
Bila hasilnya tidak memuaskan, bisa dilanjutkan dengan pembedahan (Wales dkk., 2003;
Kaefer, 2004). Pemberian rekombinan human FSH (r-hFSH) merangsang pertumbuhan
prepubertal testis dan peningkatan kadar inhibin B dalam sirkulasi. Hal ini terjadi karena
rangsangan imatur kepada sel sertoli. Pubertas berhasil dengan rangsangan hCG dan r-h
FSH. Inhibin B digunakan untuk memonitor aktivitas spermatogenesis pada bayi laki-laki
yang diobati dengan hCG ( Raivio dkk., 2007).
2.7.6.1.1 Human chorionic gonadotropic hormone (hCG)
Human chorionic gonadotropin (hCG) telah digunakan untuk pengobatan
kriptorkismus sejak lama. hCG ini mempunyai cara kerja seperti LH melalui
perangsangan terhadap sel Leydig untuk memproduksi testosteron yang kemudian secara

58

sendiri atau melalui Dehidro-testosteron (DHT) akan menginduksi turunnya testis.


Keberasilan pengobatan dengan menggunakan hCG ini sangat bervariasi, berkisar antara
20-55%. Keberasilan terapi dengan hCG ini banyak ditentukan oleh posisi testis sebelum
terapi. Hasil yang lebih baik didapatkan pada testis letak tinggi di inguinal dan testis yang
retraktil, sedangkan pada testis yang terdapat di rongga abdomen hasilnya kurang
memuaskan (Wales dkk., 2003).
2.7.6.1.2 Luteinizing hormon-releasing hormon (LHRH)
LHRH diberikan pada penderita kriptorkismus dengan maksud terjadinya
perangsangan terhadap hipotalamus untuk menghasilkan LH dan FSH yang kemudian
akan merangsang sel Leydig untuk menghasilkan testosteron yang berfungsi dalam
proses penurunan testis. LHRH diberikan secara nasal spray dosis 1,2 mg perhari. Nasal
spray ini diberikan 200 g perkali semprotan tiap lubang hidung sebanyak 3 kali sehari.
Hasil pengobatan dengan LHRH ini sangat bervariasi. Pada penelitian yangdilakukan
Bertelsen dkk dengan menggunakan dosis 1,2 mg LHRH perhari selama 4 minggu
didapatkan penurunan testis pada 24% kasus (Wales dkk., 2003).
2.7.6.1.3 Kombinasi LHRH dengan hCG
Beberapa peneliti melakukan pengobatan kombinasi antara LHRH dengan hCG.
Pada permulaan diberikan LHRH nasal spray kemudian dilanjutkan dengan hCG. Mereka
mendapatkan hasil yang lebih baik. Terapi kombinasi ini dilakukan untuk mengurangi
terjadinya relaps pada pengobatan dengan LHRH saja (Wales., 2003).
2.7.6.2 Terapi bedah pada kriptorkismus

59

Kadar testosteron pada anak-anak anorchid tidak meningkat terhadap stimulasi


hCG, sedangkan dengan testis normal selalu memberi respon pada umur berapapun.
Dengan adanya respon testosteron negatif terhadap stimulasi hCG dan meningkatnya
kadar gonadotropin basal, test hormone ini membuktikan adanya anorchidism congenital.
Bentuk pembedahan secara orkidopeksi yang biasanya dikerjakan pada pasien
kriptorkismus yang tidak mungkin turun, waktu yang baik untuk orkidopeksi adalah usia
2 sampai 3 tahun (Wales dkk., 2003; Kaefer, 2004). Tujuan operasi bedah adalah untuk
mobilisasi testis dan arteri spermatika yang adekuat, operasi hernia yang menyertainya
dan fiksasi testis adekuat di dalam skrotum. Banyak macam insisi dan tehnik fiksasi telah
dideskripsikan. Kebanyakan adalah insisi inguinal dengan diseksi testis dan cord
ekstraperitoneal. Laparoskopi dapat dilakukan untuk menemukan testis intraabdominal
secara akurat dan melihat vas spermatika dan vas deferens memasuki annulus inguinalis
interna. Laparoskopi juga dapat menemukan arteri spermatika yang buntu atau pembuluh
darah di dalam abdomen. Pettersson dkk (2007) melakukan penelitian kohort pada anakanak kriptorkismus yang dilakukan orchidopeksi antara tahun 1964-1999 di Swedia
menemukan bahwa pengobatan UDT sebelum masa pubertas dapat menurunkan risiko ca
testis. Selanjutnya diuraikan gambar diagnosis dan terapi pada UDT sebagai berikut:

60

UDT
Perabaan testis
Testis teraba
Perkembangan
skrotum

Tistis tidak teraba


tes hCG

Normal
Testis retraktil
atau ektopik

Tidak ada
UDT

Coba dg hCG
Tidak diobati

Testis turun
diawasi

Positip
UDT

Negatip
Anorchia

Laparoscopy
Tidak ada respon
Orkhidopeksi

Operasi

Gambar 2.19 Diagnosis dan terapi pada UDT, dipetik dari Bajpai & Menon, 2008

2.8 Teknik Enzyme-linked Immune-sorbent Assai (ELISA) untuk Asai Hormon


Prinsip pemeriksaan hormon dengan ELISA menggunakan tabung kecil yang
standar disebut mikroplate biasanya isinya 96 lubang atau 96 sumuran. Pada mikroplate
tertulis mereknya: Tissue Culture Test Plate, gama sterilred non pyrogenus disposible.
Pada tes ELISA ada 2 metoda:
2.8.1

Teknik kepcher laesa atau teknik zandwit laesa ( hormon Estradiol )

2.8.2

Teknik kompetitive laesa ( hormon INSL3)

61

2.8.1 Teknik kepcher laesa:


Antibodi yang berhubungan dengan zat yang kita cari misalnya hormon
estradiol, ditempelkan di sumuran (lubang mikroplate) dengan cloting buffer didiamkan
selama 24 jam kemudian antibodi nempel pada sumuran selanjutnya mikroplate dicuci
bersih namun antibodi yang sudah terlanjur nempel tidak bisa dicuci, sehingga bila
ditambah plasma, hormon estradiolnya ditangkap oleh antibodi. Bila hormon estradiol
konsentrasinya banyak maka yang diikat juga banyak, bila sedikit yang diikat sedikit.
Kemudian mikroplate dicuci bersih, estradiol yang sudah diikat

dilacak dengan

penambahan antibodi yang kedua yang sudah dilabel dengan enzim, kemudian
ditambahkan substrat dan antibodi yang kedua jadi berikatan dengan estradiol. Bila
hormon estradiol banyak maka antibodi kedua yang diikat banyak, enzim yang diikat
banyak dan substrat yang diikat juga banyak sehingga warnanya makin pekat. Antibodi
pertama biasanya monoclonal hanya satu

yang diikat. Tinggi rendahnya warna

tergantung keperluan. Kadarnya ditentukan dengan membuat standar dengan kelipatan 2,


biasanya memakai 7/8, konsentrasinya 100, 50, 25, 12,5,

6,75 . kepekatan

warna dibaca dengan spiktrofotometer, angka diset dai 0 sampai 3, konsentrasinya 0,1
sampai 3,0. Caranya standar dibuat di kertas grafik untuk menilai konsentrasi. Misalnya:
konsentrasi 100% dengan OD 2,5, konsentrasi 50 % dengan OD 2,0, konsentrasi 25%,
dengan OD 1,7, selanjutnya OD 0,2 . Supaya antibodi tidak lengket perlu ditambahkan
blocking buffer (susu atau albumin), jadi sampel tidak berikatan dengan dinding
mikroplate tapi berikatan dengan antibodi ( Astawa, 2010 ).

62

2.8.2 Teknik kompetitif : bisa dilakukan dengan 2 cara:


2.8.2.1 Teknik kompetitif 1:
Pada teknik ini yang titempel pertama pada mikroplate pertama adalah antigen
standar (estradiol atau INSL3). Selanjutnya pada mikroplate kedua ( di luar) setiap
sampel ditambahkan antibodi standar yang sudah disiapkan oleh kit, kemudian setelah
bereaksi diluar baru ditambahkan pada mikroplate yang sudah berisi antigen standar.
Pembacaannya terbalik yang konsentrasi tinggi angkanya rendah karena antibodi yang
terisi sedikit, dan yang konsentrasi rendah angkanya tinggi karena antibodi yang
berikatan banyak ( Asatawa, 2010; Anonim, 2010 ).
2.8.2.2 Teknik kompetitif 2:
Plat pertama titempelkan antibodi yang spesifik, kemudian ditambahkan sampel
darah sama dengan kepcher Laesa, kemudian dicuci, selanjutnya ditambahkan antigen
yang dilabel dengan biotin ditambah avidin yang dilabel dengan enzim HRP kemudian
ditambahkan substrat, avidin akan berikatan dengan biotin dan warna akan pekat.
sampel negatip warna pekat, 2 sampel rendah warna sedikit kurang pekat, 3 sampel
sedang warna sedang, 10 sampel tinggi warna bening atau mendekati 0. Untuk
menghitung konsentrasi dibuat label, misalnya konsentrasi 100, OD 0,1, yang sedang
OD 2,3,

paling tinggi OD 3. Antara teknik kepcher Laesa dan Kompetitif Laesa yang

membedakan kemampuan deteksi, biasanya teknik Kepcher Laesa paling sensitif.


INSL3 memakai teknik kompetitif strategi b, dan INSL3 diencerkan 1000 ( INSL3
assay Phoenix). INSL3: Imunoplate yang sudah diisi imuno antibodi akan berikatan
dengan antigen yang sudah dilabel dengan biotin + antigen standar yang disatukan

63

dengan kitnya atau dengan antigen yang ada di sampel dideteksi. Dipakai avidin ( bidsa
dari putih telor atau dari streptokokus) , disini digunakan avidin dari streptokokus
disebut streptosidin dan label dengan enzim Horse Radice Peroxidase (HRP) ( Astawa,
2010; Anonim, 2010).
2.9 Polymerase Chain Reaction (PCR)
Komponen yang diperlukan pada pemeriksaan PCR adalah: DNA templet, Premer,
dNTP, dan tag polimerase. Premer digunakan untuk membatasi daerah pada DNA yang mau
diamplifikasi, kemudian DNA yang double strain di denaturasi (dilonggarkan) pada suhu
950C, kemudian dilakukan annealing (menempelkan premer ke templet DNA) pada suhu 55650C atau tergantung melting tempratur premer dimana suhu annealing sedikit di bawah
suhu melting tempratur premer, setelah nempel dilakukan polimerasi dengan menambahkan
dNTP dan diektensi ( dipanjangkan ) pada suhu 720C sehingga didapatkan 2 double strain
pada satu siklus PCR . PCR diulang 30 silkus . adapun total amplifikasi DNA adalah 2n .
Pada saat PCR kita melihat DNA bening selanjutnya dicampur dengan loading dye untuk
pemurnian, fungsinya memberatkan DNA dan sejauh mana dia sudah bergerak dalam gel.
DNA bermuatan (-) pada saat ranning dijalankan dipakai etidium bromide yang berikatan
dengan DNA supaya DNA dapat dilihat berwarna putih di bawah sinar ultraviolet kemudian
di foto (Setianingsih, 2010).

64

BAB III KERANGKA BERPIKIR, KONSEP, DAN HIPOTESIS PENELITIAN

3.1 Kerangka Berpikir

Dari landasan teori di atas dapat dibuat kerangka berpikir sebagai berikut :
Gen :
sry
sf1
wt1
sox9
gata4
hoxa10
insl3

Hormon:
GnRH
FSH
LH
hCG

T.Intra abdominal
CSL

GFN &
CGRP

Testis di
Abdominal

AMH

Sel Sertoli
Sel Leydig

Hormon :
INSL3
Testosteron

Usia Kehamilan ibu


Estradiol

Gambar 3.1

Gubernakulum

Gen lgr8

Testis di
Inguinal

Reseptor LGR8
Testis di
Skrotum

Kerangka berpikir

64

65

3.2

Konsep Penelitian
Berdasarkan kajian pustaka dan permasalahan yang dihadapi, maka disusun
suatu kerangka konsep penelitian seperti gambar di bawah ini: polimorfisme gen lnsl3,
polimorfisme gen lgr8, kadar hormon INSL3 plasma yang rendah dan kadar hormon
estradiol plasma yang tinggi merupakan faktor risiko terjadinya kriptorkismus. Variabel
yang pengaruhnya dianggap sama pada kelompok kontrol dan kasus adalah: Kadar
hormon

testosteron,

AMH

dan

tekanan

intraabdominal.

Hormon

testosteron

menyebabkan regresi gubernakulum, kadarnya dianggap normal dan sama antara kasus
dan kontrol karena kelainan penis ( hipospadia, kordae, mikropenis) di ekslusi.

Populasi : anak laki-laki


usia 0-18 th

Usia

Pertumbuhan
gubernakulum

Polimorfisme gen lgr8

Polimorfisme gen insl3

Regresi
gubernakulum

T.intra abd
AMH

Kriptorkismus

Reseptor LGR8

Hormon INSL3

Hormon estradiol

Hormon testosteron,
GFN & CGRP

Gambar 3.2 Konsep penelitian


Keterangan:
Diperiksa : polimorfisme(exon 1,exon 2)gen insl3,polimorfisme(exon 8,exon 12,exon 13)
( )
gen lgr8, hormon INSL3, hormon estradiol, kriptorkismus, dan usia.
Tidak diperiksa: reseptor LGR8, pertumbuhan gubernakulum, regresi gubernakulum,
(----)
hormon testosteron, AMH, GFN &CGRP, dan tekanan intraabdominal

66

3.3

Hipotesis Penelitian
1. Adanya frekuensi polimorfisme ( exon 1, exon 2 ) gen insl3, frekuensi
polimorfisme ( exon 8, exon 12, exon 13 ) gen lgr8 pada anak laki-laki yang
kriptorkismus.
2. Polimorfisme ( exon 1, exon 2 ) gen insl3 merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki.
3. Polimorfisme ( exon 8, exon 12, exon 13 ) gen lgr8 merupakan faktor risiko
kejadian kriptorkismus pada anak laki-laki.
4. Kadar hormon INSL3 plasma yang rendah merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki.
5. Kadar hormon estradiol plasma yang tinggi merupakan faktor risiko kejadian
kriptorkismus pada anak laki-laki.

67

BAB IV METODE PENELITIAN

Penelitian ini merupakan penelitian observasional dengan case control study.


4.1

Rancangan Penelitian Observasional dengan Case Control Study

Retrospektif

Kasus

Populasi

FR +

FR FR +

FR -

Kontrol

Gambar 4.1 Bagan rancangan penelitian observasional dengan case control study
Catatan :
Populasi: anak laki-laki usia 0-18 tahun.
Kasus : anak laki-laki dengan Kriptorkismus positip (testis tidak ada di skrotum).
Kontrol : anak laki-laki dengan Kriptorkismus negatip ( testis ada di skrotum ).
FR + : polimorfisme (exon 1, exon 2) gen insl3, polimorfisme (exon 8, exon 12, exon 13)
gen lgr8, hormon INSL3 plasma rendah, hormon estradiol plasma tinggi.
FR - : gen insl3 normal, gen lgr8 normal, hormon INSL3 plasma normal,
hormon estradiol plasma normal.

67

68

4.2 Lokasi dan Waktu Penelitian


Penelitian dilakukan di Poliklinik anak RSUD Wangaya, RSUP Sanglah dan RB
Permata Hati Denpasar, mulai bulan September Desember 2010. Pemeriksaan hormonal
dan sequenzing PCR bulan Januari Maret 2011.
4.3 Penentuan Sumber Data
4.3.1 Populasi target
Anak laki-laki usia 0- 18 tahun.
4.3.2 Populasi terjangkau
Anak laki-laki usia 0-18 tahun di Poliklinik anak RSUP Sanglah, RSUD Wangaya,
RB Permata Hati sejak bulan September sampai bulan Desember 2010.
4.3.3 Sampel
Sampel dipilih secara konsekutif (non probability sampling ) dari populasi terjangkau.
4.3.4 Kriteria inklusi , eksklusi dan intended study subject
4.3.4.1 Kriteria inklusi
1. Anak laki-laki usia 0-18 tahun dengan kriptorkismus.
4.3.4.2 Kriteria eksklusi
1. Anak laki-laki usia 0-18 tahun dengan hipospadia.
2. Anak laki-laki usia 0-18 tahun dengan kordae (lipatan kulit).
3. Anak laki-laki usia 0-18 tahun dengan mikropenis
4.3.4.3 Intended study subject
Adalah sampel yang memenuhi ketentuan kriteria inklusi dan kriteria ekslusi serta
bersedia ikut serta dalam penelitian setelah menandatangani informed concent

69

4.3.5 Besar sampel penelitian

2(Z + Z ) P ( 1 P )
= -------------------------------(P0 Pt)

Keterangan :
n

= Jumlah sampel masing-masing kelompok

Z = 1,96 ( = 0,05 )
Z = 1,28 ( = 0,1 kekuatan = 90% )
P0 = 0,024 ( Proporsi efek possitif pada kelompok kontrol )
Pt = 0,03 ( Proporsi efek positif pada kelompok kasus )
R0 = 1,25
P = ( Po + P1 ) /2
P = Prevalensi kriptorkismus
(1-p) = Prevalensi non kriptorkismus
Dari perhitungan rumus di atas didapatkan besar sampel masing-masing kelompok adalah
28,37

dibulatkan menjadi

29.

Total sampel adalah

58

yang terdiri dari 29 anak laki-

laki dengan kriptorkismus dan 29 anak laki-laki sehat. Drop out biasanya kecil karena
Case Control Study tapi tetap diperhitungkan 5-10%, jadi kasus setelah diperhitungkan drop
out jadinya 31 anak laki-laki kriptorkismus dan 31 anak laki-laki sehat.
4.3.6 Cara pemilihan sampel
Dari populasi terjangkau penelitian ini diambil sampel kasus secara consecutive
sampling dari catatan rekam medis anak laki-laki usia 0-18 tahun yang menderita
kriptorkismus, kemudian diperiksa ulang oleh dokter spesialis anak konsultan endokrin

70

sesuai kriteria inklusi dan ekslusi setelah menandatangani informed consent jadilah kasus
(sebanyak 31 kasus), kemudian masing-masing kasus dicarikan kontrol pada anak sehat
yang tidak menderita kriptorkismus setelah diperiksa oleh dokter spesialis anak konsultan
endokrin di Poliklinik anak RSUD Wangaya, RSUP Sanglah, RB Permata Hati yang di
matching pada usia anak dalam tahun dan usia kehamilan (lahir kurang bulan atau cukup
bulan), kontrol diambil sebanyak 31 orang. Pada kasus dan kontrol diambil masing-masing
contoh darah vena sebanyak 6 ml.
4.4

Variabel Penelitian

4.4.1 Klasifikasi variabel


Dari bagan kerangka konsep di atas dapat diklasifikasikan variabel-variabel
penelitian sebagai berikut.
4.4.1.1 Variabel utama
a. Variabel bebas

: polimorfisme (exon 1, exon 2) gen insl3, polimorfisme (exon 8,


exon 12, exon 13) gen lgr8, hormon INSL3, hormon estradiol

b. Variabel antara

: reseptor LGR8, gubernakulum

c. Varibel tergantung: kriptorkismus


4.4.1.2 Variabel rambang ( random variable)
a. Kadar hormon testosteron, GFN, CGRP
b. Kadar AMH
c. Tekanan intraabdominal
4.4.1.3 Variabel kendali (Controlled variable)
a. Usia anak laki-laki (dalam tahun)
b. Usia kehamilan (kurang bulan atau cukup bulan)

71

4.4.2 Definisi operasional variabel


Untuk menghindari kesalahan dalam pengumpulan data maka variabel penelitian ini
perlu didefinisikan seperti di bawah ini:
1. Usia : ialah usia anak laki-laki dalam tahun dan usia kehamilan (lahir kurang bulan
dan lahir cukup bulan )
2. Bayi lahir kurang bulan: ialah bayi yang lahir dengan usia kehamilan lebih kecil
dari 37 minggu.
3. Bayi lahir cukup bulan: ialah bayi yang lahir dengan usia kehamilan lebih besar
atau sama dengan 37 minggu.
4 . Kriptorkismus: ialah testis terletak pada salah satu tempat sepanjang jalur
desensus yang normal, tetapi tidak mencapai tempat kedudukannya yang normal
di dalam skrotum ( Styne, 2002), yang diperiksa dengan perabaan (anak dalam posisi
tidur terlentang lutut ditekuk untuk pemeriksaan kemudian pemeriksa berada di
sebelah kanan kaki anak, kemudian tangan kanan pemeriksa meraba testis di
skrotum kanan dan kiri, bila tidak ketemu dilanjutkan meraba testis pada daerah
inguinal secara milking ), bila ketemu tangan kanan memegang testis dan tangan kiri
memegang orchidometer dan dibandingkan volumenya dalam ml. Volume testis yang
diukur letaknya di skrotum, preskrotal dan inguinal.
5. Testis di skrotum: ialah kedua testis dapat ditemukan di skrotum, yang diperiksa
dengan perabaan secara milking.
6. Hipospadia: ialah tidak sempurnanya penutupan uretra pada ventral penis yang
disebabkan berhentinya perkembangan spongiosum uretra dan bagian ventral penis
(Hughes, 2009).

72

7. Kordae: ialah lipatan kulit yang terbentang antara ventral penis dengan skrotum
(Hughes, 2009).
8. Mikropenis: ialah panjang penis (dari pangkal ke ujung gland) dengan ditarik lebih
besar dari 2,5 standar deviasi (SD) di bawah panjang rata-rata sesuai usia atau 1,9 cm
ke bawah pada neonatus sampai bayi usia 5 bulan atau panjang penis maksimal 2,5
cm dengan ditarik (Hughes, 2009)
9. Kadar hormon estradiol plasma yang tinggi: ialah kadar hormon estradiol serum
diukur secara ELISA dengan satuan ng/ml, lebih besar dari nilai optimum kurva ROC
10.Kadar hormon INSL3 plasma yang rendah: ialah kadar hormon INSL3 serum yang
diukur secara ELISA dengan satuan ng/ml lebih kecil dari nilai optimum kurva ROC.
11. Polymerase chain reaction (PCR) : ialah merupakan teknik amplifikasi DNA
spesifik secara invitro yang terdiri dari 3 tahap: denaturasi, anneling, polimerasi.
12. Sequenzing: ialah proses pemisahan template DNA menggunakan DNA polymerase
primer, dNTP, dan ddNTP untuk menemukan mutasi atau polimorfisme gen.
13. Polimorfisme: merupakan variasi genetik dari lokus (lokasi gen pada kromosom)
baik dalam ukuran besar maupun dalam jumlah allel yang dipunyai atau variasi
dalam urutan basa pada DNA dan berulang lebih dari 1% pada populasi. Variasi
ini bisa dalam bentuk SNPs, mikrosatelit, minisatelit maupun delesi, duplikasi dan
insersi pada lokus yang tidak diulang (Kingston, 1997; Jorde dkk, 2006; Hartwell
dkk, 2008).

73

4.5. Bahan Penelitian


Bahan untuk pemeriksaan gen insl3 dan gen lgr8 adalah darah vena 3ml yang berisi
EDTA, disimpan dalam bentuk DNA pada suhu -80oC. Sedangkan bahan untuk
pemeriksaan hormon INSL3 dan hormon estradiol adalah darah vena 3 ml tanpa
antikoagulan dicentrifuge pada suhu 4oC dan disimpan dalam bentuk serum yang dibagi
dalam 4-6 tabung kecil, serum untuk pemeriksaan hormon INSL3 dan hormon estradiol
disimpan pada suhu -80oC .
4.6. Intrumen Penelitian
4.6.1 Cara pengumpulan data
1. Wawancara: dilakukan kepada ibu atau ayah dari anak tersebut untuk mendapatkan
data identitas, riwayat kehamilan dan riwayat persalinan.
2. Pemeriksaan fisik: termasuk pemeriksaan fisik secara umum dan status genitalia
3. Perabaan secara milking: ialah pemeriksaan untuk memeriksa lokasi testis dengan cara
mengurut dari proximal.
4. Pemeriksaan laboratorium: untuk mendapatkan kadar hormon estradiol plasma
dan kadar hormon INSL3 plasma, menemukan polimorfisme gen insl3, lgr8.
4.6.2 Alat pengumpulan data
1. Kuesioner terstruktur: adalah alat untuk mendapatkan data identitas, riwayat
Kehamilan, riwayat persalinan.
2. Orkidometer: adalah alat yang terbuat dari kayu ukuran bulat lonjong dengan
diameter mulai dari 1 ml sampai 20 ml untuk mengukur volume testis dengan
membandingkan dengan alat tersebut.
3. Spatel kayu : ialah alat untuk mengukur panjang penis.

74

4. ELISA: ialah metode yang digunakan untuk mengukur kadar hormon estradiol dan kadar
hormon INSL3 dalam serum.
5. Primer: ialah susunan nukleotida yang dipakai untuk membatasi bagian yang mau di
amplifikasikan atau mau dibaca.

4.7 Prosedur Penelitian


4.7.1 Persiapan
Sebelum penelitian ini dilaksanakan terlebih dahulu proposal dikirim ke Komisi
Etik Penelitian, Unit penelitian dan pengembangan FK.UNUD/RSUP Sanglah untuk
mendapatkan keterangan kelayakan Etik, kemudian dimintakan ijin untuk pelaksanaan
penelitian kepada Direktur RSUD Wangaya, Direktur RSUP Sanglah, Direktur RB
Permatahati dan Kepala SMF Anak RSUD Wangaya, kepala Bagian/SMF Anak FK
UNUD/RSUP Sanglah. Selanjutnya setelah mendapatkan ijin, penelitian dilanjutkan dan
sebelumnya orang tuanya menandatangani surat persetujuan.

4.7.2 Alur penelitian


Dari populasi target yaitu anak laki-laki usia 0-18 tahun, kemudian dipilih
populasi terjangkaunya di Poliklinik anak RSUD wangaya, RSUP Sanglah dan RB
Permata Hati (multicenter), kemudian dibuatkan protokol pemeriksaan klinis dan
protokol pengambilan sampel dengan menggunakan alat standar. Pemeriksaan klinis
dilakukan oleh petugas yang terlatih dan dikonfirmasi oleh dokter spesialis anak
konsultan endokrin, sedangkan pengambilan sampel darah dilakukan oleh petugas
laboratorium prodia yang sudah terlatih, untuk mengurangi measurement bias atau recall

75

bias

petugas tetap diobservasi oleh peneliti. Dari populasi terjangkau selanjutnya

dilakukan kriteria inklusi dan kriteria eksklusi, kemudian diberikan informed concent
didapatlah kasus anak yang kriptorkismus, kumudian dicarikan kontrol anak sehat yang
diambilkan dari rumah sakit yang menjadi sampel (lihat bagan alur penelitian), untuk
mengurangi selection bias atau confounding bias antara kasus dan kontrol dilakukan
matching pada dua variabel yaitu usia anak dalam tahun dan usia kehamilan ( lahir
kurang bulan dan lahir cukup bulan) antara kasus dan kontrol perbandingannya 1:1.
Untuk lebih jelasnya bisa dilihat pada bagan alur penelitian sebagai berikut:

76

Populasi target

*Anak laki-laki 0-18 th


*Anak laki-laki 0-18 th di
*Poli Anak: RSUW, RSUP,

Populasi terjangkau

*RB.Permata Hati
K.Inklusi
*Kriptorkismus
*Berpartisipasi

K.Eksklusi
*Hipospadia
*Kordae
*Mikropenis

Intended sample
Informed consent
Matching
*Usia anak laki-laki
*Usia kehamilan

Kasus
Anak laki-laki
kriptorkismus

Kontrol
Anak laki-laki sehat

Pemeriksaan hormon estradiol dan


hormon INSL3 plasma dg ELISA

Pemeriksaan hormon estradiol dan


hormon INSL3 plasma dg ELISA

PCR & Squencing gen Insl3 dan gen Llg8

PCR & Squencing gen Insl3 dan gen Lgr8

Analisis hasil penelitian/statistik

Laporan

Gambar 4.2 Bagan alur penelitian

77

4.7.3 Tata cara pengambilan sampel darah


Pada anak laki-laki dengan kriptorkismus yang terpilih sebagai kasus dilakukan
informed concent selanjutnya petugas prodia yang terlatih mengambil darah venanya
sebanyak 6 ml, kemudian dibagi dua, 3ml dimasukkan ke dalam botol yang sudah berisi
EDTA dan 3 ml lagi dimasukkan ke dalam botol yang tidak berisi antikoagulan. Kemudian
darah yang berisi EDTA dan yang tidak berisi EDTA dibawa oleh petugas prodia tadi pada
suhu 40C ke Laboratorium Biomolekuler FK UNUD dan diserahkan kepada petugas
Laboratorium Biomolekuler FK UNUD yang sudah terlatih dan ditunjuk membantu
pemelitian ini. Darah yang tanpa antikoagulan di laboratorium Biomolekuler FK UNUD
oleh petugas yang ditunjuk langsung di sentrifuge pada suhu 4oC untuk mendapatkan
serum, kemudian serumnya dibagi dua dimasukkan ke botol masing-masing, serum untuk
pemeriksaan hormon INSL3 dan hormon estradiol disimpan pada suhu -80oC. Di
Laboratorium darah yang dengan EDTA langsung diproses oleh petugas yang sudah
terlatih dan ditunjuk untuk mendapatkan DNA kemudian DNA disimpan pada suhu -80oC
(Freezer). Setelah mendapat kasus dicarikan kontrolnya yang di matching pada usia anak
dalam tahun dan usia kehamilan, kemudian dilakukan informed concent

selanjutnya

diambil darah vena sebanyak 6 ml oleh petugas Laboratorium Prodia yang sudah terlatih
dan kemudian sampel darah diperlakukan sama seperti sampel darah kasus. Proses ini
dilakukan sama pada semua kasus dan kontrol sampai jumlahnya cukup.

78

4.7,4 Proses pengambilan DNA dari darah


Darah 3 ml + EDTA yang disimpan pada suhu 40 C, kemudian ditambahkan
larutan hipotonik Nacl 0,5% menyebabkan cairan hipotonik masuk ke dalam sel darah
merah dan sel darah merah pecah, selanjutnya disentrifuge untuk mengendapkan sel yang
berinti atau sel leukosit berupa pellet yang mengendap di bawah, cairan sel darah merah
dibuang. Leukosit ada membran yang menyelubungi dan intinya berada di dalam sel,
kemudian membran yang menyelubungi leukosit dirusak dengan ditambah deterjen atau
ammonium asetat (senyawa yang bisa mengikat lemak, air dan bisa merusak protein )
selanjutnya disentrifuge lagi karena DNA ringan dan lemak dan sisa leukosit berat
sehingga DNA mengambang dan lemak beserta sisa leukosit jadi pellet mengendap
dibawah, kemudian cairan yang berisi DNA yang mengambang diambil dan dipindahkan
ke tabung lain yang baru. Pada tabung yang baru ditambahkan isopropanol untuk menarik
air dari DNA, pada saat ditambah isopropanol kita bisa melihat DNA berupa benangbenang putih, selanjutnya disentufuge kemudian airnya dibuang dan dicuci dengan etanol
70% kemudian disentrifuge, etanol dibuang dan pellet dikeringkan kemudian pellet
dilarutkan lagi dengan Tris-EDTA PH 8.0. Kemudian ukur kandungan dan kemurnian
DNA dengan spektrofotometer dan dicek dengan panjang gelombang 260 nano meter,
kemudian DNA disimpan pada suhu -800C (freezer) (Setianingsih, 2010).
4.7.5 Cara penyimpanan sampel
Sampel darah untuk pemeriksaan hormon INSL3 dan hormon estradiol disimpan
di laboratorium Biomolekuler FK UNUD dalam bentuk serum pada suhu -800C.
Sedangkan sampel darah untuk pemeriksaan gen insl3 dan gen lgr8 disimpan di
Laboratorium Biomolekuler FK UNUD dalam bentuk DNA pada suhu - 800C . Setelah

79

sampel dianggap cukup sampel DNA diamplifikasi untuk memperbanyak dengan PCR
yang sudah ditambahkan primer untuk exon masing-masing, setelah itu masing-masing
exon 1, exon 2 gen insl3 dipurifikasi, begitu juga exon 8, exon 12 dan exon 13 gen lgr8
dipurifikasi, kemudian hasil purifikasi baru dikirim.
4.7.6 Cara pengiriman sampel
Sampel exon 1, exon 2 gen insl3 dan sampel exon 8, exon 12, exon 13 gen lgr8
yang sudah dipurifikasi di Laboratorium Biomolekuler FK UNUD bila jumlahnya sudah
cukup dimasukkan ke dalam box plastik kemudian dikirim ( dibawa langsung oleh petugas
laboratorium yang ditunjuk) ke Lembaga Eijkman Jakarta pada suhu 40C untuk dilakukan
pemeriksaan sequenzing . Sedangkan sampel serum yang sudah disimpan pada suhu -800C
dan dibagi-bagi ke dalam tube, yang dimasukkan dalam plastik setelah jumlah sampel
cukup dikirim ke Laboratorium Kedokteran Hewan UNUD untuk pemeriksaan hormon
INSL3 dan hormon estradiol secara ELISA.

4.7.7 Skema pengambilan darah


3 ml + EDTA

DNA

simpan

kirim ke Eijkman

sequenzing

-800C

6 ml darah vena

3 ml

sentrifuge 40C

serum

gen insl3, lgr8


INSL3

simpan
-800C

(tanpa antikoagulan)
estradiol

simpan
-80 0C

Gambar 4.3 Skema pengambilan darah

periksa
hormon INSL3
periksa
hormon estradiol

80

4.7.8 Pemeriksaan hormon INSL3 secara ELISA


Pemeriksaan hormon INSL3 menggunakan teknik kompetitif: Microplate yang
sudah dilapisi antiantibodi atau antibodi sekunder ditambahkan antibodi terhadap hormon
INSL3, selanjutnya ditambahkan serum dari sampel dan ditambahkan sampel setandar
selanjutnya ditambahkan INSL3 biotin (untuk melacak) yang dilacak jumlah biotinnya,
Standar yang disiapkan adalah standar biasa (biotinilated) terhadap INSL3, biotin berikatan
dengan tempat avidin yang sudah dilabel enzim HRP selanjutnya bila warnanya pekat
konsentrasinya rendah. Standar ini diencerkan

dengan konsentrasi 1000 ngram/ ml

kemudian diencerkan lagi menjadi 100nano gram/ml dilanjutkan 10 nanogram/ ml


dilanjutkan 1 nano gram/ ml dilanjutkan 0,1 nanogram/ml dan dilanjutkan menjadi 0,01
nanogram/ml. Proses ini memakai 5 seri selanjutnya diduplo pada 43 sampel. Substrat
yang dipakai Tio Metil Benzidine (TMB), Substrat akan berwarna bening, bila ada enzim
HRP

akan

berwarna

biru

pekat.

Tingkat

kepekatan

warna

dibaca

dengan

spectrophotometer. dipakai EIA Kit (Enzym immune antibody) dan memakai enzim kinetik
Y merupakan kemampuan enzim untuk mengubah senyawa tertentu dalam kurun waktu
tertentu. Enzim ditambah substrat dibaca dengan spectrophotometer setiap 30 detik selama
5 menit OD awal dan akhir ditentukan 1 sampai 0,4 seperti SGOT,SGPT disebut metode
kinetic. EIA Kit yang dipakai 405 sedangkan untuk enzim pakai 340(Astawa, 2010;
Phoenix Pharmaceuticals, 2010).

81

4.7.9 Pemeriksaan hormon estradiol secara ELISA:


Untuk pemeriksaan hormon estradiol digunakan teknik kompetitif: micropalate
ELISA yang sudah dilapisi dengan antibodi terhadap estradiol (sudah mampu menangkap
estradiol dalam sampel) ditambahkan sampel dari serum kemudian ditambahkan lagi
estradiol trizer (estradiol pelacak yang akan merubah warna). Makin banyak trizer yang
melekat makin pekat warnanya, jumlah trizer yang melekat berbanding terbalik dengan
kadar estradiol (karena kompetitif estradiol serum dan estradiol trizer sama-sama melekat
dengan antibodi). Trizer adalah estradiol yang dilabel dengan enzim choline esterase.
Estradiol standar adalah estradiol yang konsentrasinya sudah diketahui dan nanti akan
diencerkan dengan konsentrasi awal 40 nanogram /ml kemudian diencerkan sebanyak 10
kali dan pengencerannya 90 mikroliter, pengenceran itu akan dipakai buat grafik.
Disarankan di duplo (1 sampel untuk 2 lubang) warna dibuat dengan standar , paling ujung
pekat sekali. Kalau ada perbedaan dibuat rata-ratanya dan digunakan rumus untuk
mengetahui konsentrasinya. Kalau ada Orticle Density (OD) sampel dan OD standar,
dimasukkan komputer keluar grafik. Software 3 atau 4 PL (parameter logistic) pakai
regresi

logistic,

kalau

pakai

linier

logistic

yang

sering

dipakai

(memperhitungkan kemiringan), 4 (lebih akurat), 5 paling akurat (jarang dipakai) (Astawa,


2010; Anonim, 2008)

82

4.7.10 Pemeriksaan gen insl3 dan gen lgr8


4.7.10.1 Polymerase chain reaction (PCR) exon 1 gen insl3, exon 2 gen insl3, exon 8 gen
lgr8, exon 12, 13 gen lgr8
Masing masing DNA pada kasus dan kontrol dilakukan PCR untuk exon 1 gen
insl3 digunakan primer forward (1F): tgggagaaaggctctggcac dan primer reverse (1R) :
ctgggcacatgcatgcaaac, untuk exon 2 gen insl3 digunakan

primer forward (2F):

tgcatgcatgagtgtttggtggg dan primer reverse (2R) : gtgagcacccatcccaggaggtaatc, untuk exon 8


gen lgr8 digunakan primer forward (8F): acacaaaggagtaggccagg dan primer reverse (8R) :
ctagtgctagatgtcattgc, untuk exon 12, 13 gen lgr8 digunakan primer forward (12-13F):
ggatgatgataattgtgagg dan primer reverse (12-13R): ctgaaatgcatgctcctgtg dan semua ini
dikerjakan di Laboratorium Biomolekuler FK UNUD oleh petugas terlatih yang ditunjuk.
Komponen yang diperlukan adalah: DNA template

+ Primer (Forward dan reverse)

masing-masing secara bergantian untuk exon 1 gen insl3, exon 2 gen insl3, exon 8 gen lgr8,
exon 12,13 gen lgr8 + dNTP + tag polymerase, kemudian DNA yang double strain di
denaturasi (dilonggarkan) pada suhu 950C, kemudian dilakukan annealing (menempelkan
primer ke template DNA) pada suhu 55-650C atau tergantung melting tempratur primer,
setelah menempel dilakukan polimerasi dengan menambahkan dNTP dan diektensi
(dipanjangkan ) pada suhu 720C sehingga didapatkan 2 double strain pada satu siklus PCR .
PCR diulang 30 silkus .

kemudian dicampur loading dye untuk pemurnian, kemudian

dilakukan running dan ditambahkan etidium bromide yang berikatan dengan DNA dan DNA
digerakkan pada gel algarose di bawah sinar ultraviolet kemudian di foto, DNA kelihatan

83

seperti bayangan putih, kemudian hasil PCR dipurifikasi (dimurnikan) kemudian baru
dikirim ke Lembaga Eijkman Jakarta untuk dilakukan sequenzing.
4.7.10.2.Skuenzing exon 1 gen insl3, exon 2 gen insl3, exon 8 gen lgr8, exon 12,13 gen lgr8
Secara bergantian kedalam mesin skuenzing masing-masing sampel dari purifikasi
hasil PCR xon 1 gen insl3, exon 2 gen insl3, exon 8 gen lgr8, exon 12,13 gen lgr8 pada
masing-masing kasus dan kontrol + DNA polymerase + primer untuk exon 1 gen insl3,
exon 2 gen insl3, exon 8 gen lgr8, exon 12,13 gen lgr8 secara bergantian + dNTP + ddNTP
kemudian keluar berupa grafik susunan nukletida selanjutnya dibandingkan dengan susunan
nukleotida bentuk normal dari exon 1 gen insl3, exon 2 gen insl3, exon 8 gen lgr8, exon 12
dan exon 13 gen lgr8, kemudian dianalisis adanya polimorfisme atau adanya mutasi.

84

4.8 Analisis Statistik


Data karakteristik demografi dianalisis secara deskriptif, dimana untuk data
numerik dianalisis dengan rerata standar deviasi (SD) dan frekuensi dengan prosentase.
Normalitas data diuji dengan Kolmogorov Smirnov / Shapiro Wilk, dan bila data
berdistribusi normal analisis parametrik yang dipakai adalah t test dan bila data tidak
berdistribusi normal digunakan analisis nonparametrik atau transformasi data logaritmik
kemudian dilakukan uji normalitas bila normal dilakukan uji parametrik. Bila ada variasi
data dilakukan uji homogenitas dengan Levene test. Pada data yang bivariat berpasangan
digunakan tabel 2 x 2 untuk odds ratio berpasangan dengan 95% convident interval (CI)
dan digunakan simple log rergresi untuk odds ratio 95% CI. Pada data yang multivariat
dianalisis dengan multiple log regresi untuk odds ratio 95% CI. Untuk uji statistik beda
kadar hormon pada kasus dan kontrol (match paired) dilakukan uji statistik paired student t
test. Odds ratio berpasangan (paired) dengan formula b/c. Untuk menghitung tabel 2x2
dilakukan dengan komputer, untuk menghitung odds ratio berpasangan dilakukan dengan
komputer. Hipotesis ini dianalisis dengan tingkat kepercayaan ( ) diterima bila p < 0,05
Hipotesis statistik
Variabel bebas : polimorfisme (exon 1, exon 2) gen insl3
Polimorfisme (exon 8, exon 12, exon 13) gen lgr8
Hormon INSL3 plasma , Hormon estradiol plasma
Variabel tergantung : Kriptorkismus
Hipotesis satu sisi

H0 : 1

2 ,

Ha : 1

>

1 = Polimorfisme (exon 1, exon 2) gen insl3, polimorfisme (exon 8, exon 12, exon 13)
gen lgr8, hormon INSL3 plasma rendah, hormon estradiol plasma tinggi.

85

2 = gen insl3 normal, gen lgr8 normal, hormon INSL3 plasma normal,
hormon estradiol plasma rendah

4.9 Keterangan Kelaikan Etik ( Ethical Clearance ) dan Ijin Penelitian


Penelitian ini telah mendapatkan keterangan kelaikan Etik ( Ethical Clearence)
dari Unit Penelitian dan Pengembangan serta dari Komisi Etik Penelitian Fakultas
Kedokteran Universitas Udayana dengan No surat: 289/ Skrt / v/ 2010. Penelitian ini juga
telah mendapatkan ijin dengan permohonan ijin penelitian dari Program Studi Doktor Ilmu
Kedokteran Program Pasca Sarjana Unud dengan no surat: 362/ H14.4.10/PL/2010 Untuk
Kepala Rumah Bersalin Permata Hati, no surat: 363/ H14.4.10/PL/2010 untuk Direktur
RSUD Wangaya, no surat: 364/H14.4.10/Pl/2010 untuk Direktur Utama RSUP Sanglah
Denpasar.

86

BAB V HASIL PENELITIAN


5.1. Karakteristik Sampel Penelitian
Penelitian ini menggunakan sampel 62 anak laki-laki yang terdiri dari 31 anak laki-laki
yang menderita kriptorkismus sebagai

kasus dan dicarikan 31 anak laki-laki yang normal

sebagai kontrol, setiap kasus dan kontrol dimatching berdasarkan usianya dalam tahun.
Tabel 5.1
Karakteristik Subyek Penelitian Kelompok Kasus dan Kelompok Kontrol
Karakteristik

Usia (tahun)
Berat badan lahir (gram)
Panjang badan lahir (cm)
Umur kehamilan cukup umur
Cara persalinan:
- Spontan
- Secsio sercario
- Vakum ekstraksi
Panjang penis (cm)
Volume testis kanan (ml)
Volume testis kiri (ml)

Kelompok kasus
( n = 31 )
RerataSB/Frekuensi
43
3142,90 619,90
49,52 2,20
31

Kelompok kontrol
( n = 31 )
Rerata SB/Frekuensi
43
3206,45 331,60
50,13 1,28
31

15
15
1
4,23 0,56
2,08 0,67
1,80 0,49

19
12
0
4,65 0,76
2,35 0,61
2,37 0,61

Nilai-p

0,92
0,62
0,19

0,02
0,12
0,001

Tabel 5.2
Jenis dan Lokasi Kriptorkismus pada Kelompok Kasus
Jenis Kriptorkismus
Bilateral
Kanan
Lokasi kriptorkismus
Intraabdominal
Inguinal
Preskrotal
Total

3
1
1
5 (16,13%)

4
4
2
10 (32,26%)

86

Kiri

Total

6
8
2
16 (51,61%)

13 (41,94%)
13 (41,94%)
5 (16,12%)
31 (100%)

87

Semua sampel yang digunakan baik pada kasus maupun pada kontrol tidak menderita
sindrom dan tidak mengalami mikropenis, bentuk penis normal tidak ada kordae dan hipospadia
dan pada penelitian ini anak kriptorkismus yang dipakai kasus usianya 6 bulan ke atas.
Tabel 5.3
Frekuensi Polimorfisme Gen insl3, Gen lgr8 pada Kelompok Kasus dan Kontrol
Gen

Exon

Polimorfisme

Kasus (%)
(n=31)

Kontrol (%)
(n=31)

insl3

Exon 1

M1M
A9A
L42L
L42P
V43M
T60T
T60A

1(3,23%)
6(19,36%)
1(3,23%)
1(3,23%)
1(3,23%)
16(51,61%)
8(25,81%)

0(0%)
2(6,45%)
0(0%)
0(0%)
0(0%)
5(16,13%)
15(48,39%)

Exon 2

R73R
C115W
C116C
Kdn stp140kdn stp
G144G
E146E
Q157Q
A166D

1(3,23%)
1(3,23%)
1(3,23%)
1(3,23%)
1(3,23%)
3(9,68%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0(0%)
0(0%)
0(0%)
0(0%)
0(0%)
0(0%)

Exon 8

Kdn stp223M

1(3,23%)

0(0%)

Exon 12

N315N
E319E
L331L

2(6,45%)
31(100%)
15(48,39%)

0(0%)
23(74,19%)
6(19,36%)

Exon 13

S337A
P340P
L344L
H345P
K346K
Q348Q
Q354K
Q356P
S357S
S357C

17(54,84%)
13(41,94%)
1(3,23%)
19(61,29%)
28(90,32%)
1(3,23%)
5(16,13%)
9(29,03%)
15(48,39%)
1(3,23%)

0(0%)
8(25,81%)
0(0%)
9(29,03%)
21(67,74%)
0(0%)
0(0%)
0(0%)
0(0%)
0(0%)

lgr8

88

5.2. Polimorfisme Gen insl3


5.2.1. Polimorfisme exon 1 gen insl3
Untuk menemukan polimorfisme pada exon 1 gen insl3 dilakukan sequencing pada hasil
PCR menggunakan primer forward (1F): tgggagaaaggctctggcac dan primer reverse (1R) :
ctgggcacatgcatgcaaac dan ukuran basa yang teramplifikasi dari proses PCR adalah 451 pasang
basa. Adapun program PCR untuk exon 1 gen insl3 adalah pre denaturasi dengan suhu 950C
selama 5 menit hanya 1 siklus, dilanjutkan dengan ( denaturasi dengan suhu 940C selama 1
menit, annealing dengan suhu 600C selama 1 menit, ekstensi dengan suhu 720C selama 1 menit )
sebanyak 35 siklus dan terakhir final ekstensi dengan suhu 720C selama 7 menit dan 1 siklus.
Adapun campuran yang digunakan adalah master mix PCR 15l, H2O 9l, primer exon 1F
1,8l, primer exon 1R 1,8l, DNA template 2,4l dan jumlah keseluruhan 30l. Sedangkan
untuk proses sequencing hanya menggunakan primer forward (1F): tgggagaaaggctctggcac .

451 bp

Gambar 5.1 Hasil PCR exon 1 gen insl3

89

Wild type
280

Wild type

290

300

AGGAGGCCTGCGACCGGAGGCGAC

Polimorfime T60T A G G A G G C C T G C G N C C G G A G G C G A C
Polimorfisme ACCNCC
Gambar 5.2 Sequenzing exon 1 gen insl3 wild type dan polimorfisme T60T (ACCNCC)
Dari hasil sequencing ditemukan polimorfisme exon 1 pada: ATGNTG (M1M) pada
kasus no 14, GCGGCN/GCA (A9A) pada kasus no: 2, 3, 7, 8, 9, 20, dan juga ditemukan pada
kontrol no: 2, 17, CTACTN (L42L) pada kasus no: 19, CTACNN (L42P) pada kasus no: 29,
GTGNNG (V43M) pada kasus no: 29. Polimorfisme ACCNCC (T60T) pada kasus no: 3, 4,
5, 6, 9, 13, 15, 16, 19, 20, 21, 22, 23, 25, 28, 30 dan juga ditemukan pada kontrol no: 20, 21, 23,
25, 28. Polimorfisme ACCGCC (T60A) pada kasus no: 2, 7, 8, 10, 11, 12, 17, 24, dan juga
ditemukan pada kontrol no: 1, 2, 4, 7, 12, 13, 14, 15, 16, 17, 18, 19, 24, 26, 27. Hubungan
polimorfisme exon 1 dengan kriptorkismus dapat dilihat pada tabel 5.4, gambar 5.3.

90

Tabel 5.4
Hubungan antara Frekuensi Polimorfisme Exon 1 Gen insl3 dan Kejadian Kriptorkismus
pada Anak Laki-laki
Polim Exon 1

Kasus
(n=31)
Positip

ATGNTG
(M1M)

Kontrol

GCGGCN/GCA
(A9A)

Kontrol

CTACTN
(L42L)

Kontrol

CTACNN
(L42P)

Kontrol

GTGNNG
(V43M)

Kontrol

ACCNCC
(T60T)

Kontrol

ACCGCC
(T60A)

Kontrol

(n=31)
Total

(n=31)
Total

(n=31)
Total

(n=31)
Total

(n=31)
Total

(n=31)
Total

(n=31)
Total

Total

Statistik

Negatip

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

1(3,23%)
5(16,13%)
6(19,36%)

1(3,23%)
0(0%)
1

2(6,45%)
5
7

Nilai-p: 0,22
Odds ratio: 5,0
95%CI: 0,56 - 236,45

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

5(16,13%)
11(35,48%)
16(51,61%)

0(0%)
0(0%0
0

5(16,13%)
11
16

Nilai-p: 0,001
Odds ratio: infinity
95%CI: 2,51 - infinity

Positip
Negatip

5(16,13%0
3(9,68%)
8(25,81%)

10(32,26%)
0
10

15(48,39%)
3
18

Nilai-p: 0,09
Odds ratio: 0,30
95%CI: 0,05 - 1,17

Dari tabel 5.4. polimorfisme M1M, L42L, L42P, V43M pada exon 1 tidak bisa dianalisis
secara statistik karena jumlahnya sangat sedikit tetapi polimorfisme ini hanya ditemukan pada
kasus. Frekuensi polimorfisme A9A (GCGGCN/GCA) exon 1 gen insl3 ditemukan lebih
banyak pada kelompok kasus dibandingkan kontrol (19,36% vs 6,45%) tetapi tidak berbeda
bermakna dengan nilai-p =0,22 (p>0,05) dan asam aminonya tidak berubah. Polimorfisme T60A
(ACCGCC) exon 1 ditemukan frekuensinya lebih banyak pada kelompok anak sehat (25,81%
vs 48,39%) tetapi tidak berbeda secara bermakna dengan nilai-p=0,09 (p > 0,05) dan asam amino

91

no 60 berubah dari treonin menjadi alanin. Frekuensi polimorfisme T60T (ACCNCC) exon 1
gen insl3 lebih banyak ditemukan pada kasus dibanding kontrol (51,61% vs 16,13% ) dan
berbeda bermakna (nilai-p= 0,001(p< 0,05) , Odds ratio= tak terhingga,

95% Convident

interval= 2,51-tak terhingga) tetapi asam amino no 60 tetap treonin.

Gambar 5.3 Frekuensi Polimorfisme Exon 1 Gen insl3


T60T: Nilai-p= 0,001; Odds ratio= tak terhingga; 95% Convident interval= 2,51 - tak terhingga

5.2.2. Polimorfisme exon 2 gen insl3


Untuk menemukan polimorfisme pada exon 2 gen insl3 dilakukan sequencing pada hasil
PCR menggunakan primer forward (2F): tgcatgcatgagtgtttggtggg dan primer reverse (2R) :
gtgagcacccatcccaggaggtaatc dan ukuran basa yang teramplifikasi dari proses PCR adalah 455
pasang basa. Adapun program PCR untuk exon 2 gen insl3 adalah pre denaturasi dengan suhu
950C selama 5 menit hanya 1 siklus, dilanjutkan dengan ( denaturasi dengan suhu 940C selama 1
menit , annealing dengan suhu 540C selama 1 menit, ekstensi dengan suhu 720C selama 1 menit )

92

sebanyak 30 siklus dan terakhir final ekstensi dengan suhu 720C selama 7 menit dan 1 siklus.
Adapun campuran yang digunakan adalah master mix PCR 15l, H2O 9,6l, primer exon 2F
1,8l, primer exon 2R 1,8l, DNA template 1,8l dan jumlah keseluruhan 30l. Sedangkan
untuk proses sequencing menggunakan primer forward (2F): tgcatgcatgagtgtttggtggg, karena
exon 2 gen insl3 panjang ada beberapa hasil sequencing yang kurang baik dan diulang dengan
menggunakan primer reverse (2R): gtgagcacccatcccaggaggtaatc.

455bp

Gambar 5.4 Hasil PCR exon 2 gen insl3


Wild type
330

340

Wild type

GGCCCAGAGGGTCTGGTC

Polimorfisme E146E

GGCCCANAGGGTCTGGTC
Polimorfisme GAGNAG

Gambar 5.5 Sequenzing exon 2 gen insl3 wild type dan polimorfisme E146E(GAGNAG)

93

Dari hasil sequencing ditemukan polimorfisme exon 2 pada: CGACNA (R73R) pada
kasus no: 13, TGCTGG (C115W) dan TGCTNGC (C116C) pada kasus no: 16,
AGAANA (kodon stop140kodon stop), GGCNGC (G144G) pada kasus no: 31,
GAGNAG (E146E) pada kasus no: 26, 29, 31, CAGCAN(Q157Q) kasus no: 29 dan
GCCGCA (A166D) pada kasus no: 14.
Tabel 5.5
Hubungan antara Frekuensi Polimorfisme Exon 2 Gen insl3 dan Kejadian Kriptorkismus
pada Anak Laki-laki
Polimorfisme exon 2

Kasus (n=31)

Kontrol (n=31)

Statistik

CGACNA(R73R)

1 (3,23%)

Tidak dianalisis

TGCTGG(C115W)

1 (3,23%)

Tidak dianalisis

TGCTNGC(C116C)

1 (3,23%)

Tidak dianalisis

AGAANA(kdstp140kdstp)

1 (3,23%)

Tidak dianalisis

GGCNGC(G144G)

1 (3,23%)

Tidak dianalisis

GAGNAG(E146E)

3 (9,68%)

Tidak dianalisis

CAGCAN(Q157Q)

1 (3,23%)

Tidak dianalisis

GCCGAC(A166D)

1 (3,23%)

Tidak dianalisis

Dari tabel 5.5 polimorfisme R73R, C115W, C116C, kodon stop140kodon stop, G144G,
E146E, Q157Q, A166D dari exon 2 gen insl3 tidak bisa dianalisis secara statistik karena
jumlahnya sangat sedikit, tetapi polimorfisme ini hanya ditemukan pada kasus sedangkan pada
kontrol tidak ditemukan polimorfisme. Dari polimorfisme ini ada 2 perubahan asam amino
C115W ( sistein no 115 menjadi triptopan) dan A166D (alanin no 166 menjadi aspartat).

94

5.3. Polimorfisme Gen lgr8


5.3.1. Polimorfisme exon 8 gen lgr8
Untuk menemukan polimorfisme pada exon 8 gen lgr8 dilakukan sequencing pada hasil
PCR menggunakan primer forward (8F): acacaaaggagtaggccagg dan primer reverse (8R) :
ctagtgctagatgtcattgc dan ukuran basa yang teramplifikasi dari proses PCR adalah 229 pasang
basa. Adapun program PCR untuk exon 8 gen lgr8 adalah pre denaturasi dengan suhu 950C
selama 1 menit hanya 1 siklus, dilanjutkan dengan (denaturasi dengan suhu 940C selama 1 menit,
annealing dengan suhu 540C selama 1 menit, ekstensi dengan suhu 680C selama 1 menit)
sebanyak 35 siklus dan terakhir final ekstensi dengan suhu 680C selama 5 menit dan 1 siklus.
Adapun campuran yang digunakan adalah master mix PCR 15l, H2O 9,6l, primer exon 8F
1,8l, primer exon 8R 1,8l, DNA template 1,8l dan jumlah keseluruhan 30l. sedangkan
untuk proses sequencing hanya menggunakan primer forward (8F):acacaaaggagtaggccagg.

229bp

Gambar 5. 6 Hasil PCR exon 8 gen lgr8

95

Wild type
70

80

90

Wild type

AATCCAATAACCAGAATTTCACAG

Polimorfisme

AATCCAATAACCANAATTTCACAG

kdstp223M

Polimorfisme AGAANA

Gambar 5.7Sequenzing exon 8 gen lgr8 wild type dan polimorfisme kdstp223M(AGAANA)

Dari hasil sequencing ditemukan hanya 1 polimorfisme AGAANA (kdn stp223M)


pada kasus no: 13 dan tidak bisa dianalisis secara statistik karena jumlahnya sangat sedikit,
terjadi perubahan asam amino no 223 dari kodon stop ke metionin, tetapi polimorfisme ini hanya
ditemukan pada anak laki-laki dengan kriptorkismus sedangkan pada anak yang sehat tidak
ditemukan polimorfisme.
5.3.2. Polimorfisme exon 12 gen lgr8
Untuk menemukan polimorfisme pada exon 12 gen lgr8 dilakukan sequencing pada hasil
PCR menggunakan primer forward (12-13F): ggatgatgataattgtgagg dan primer reverse (12-13R)
: ctgaaatgcatgctcctgtg dan ukuran basa yang teramplifikasi dari proses PCR adalah 439 pasang
basa. Adapun program PCR untuk exon 12-13 gen lgr8 adalah pre denaturasi dengan suhu 950C
selama 1 menit hanya 1 siklus, dilanjutkan dengan ( denaturasi dengan suhu 950C selama 1 menit
, annealing dengan suhu 520C selama 1 menit, ekstensi dengan suhu 720C selama 1 menit )
sebanyak 35 siklus dan terakhir final ekstensi dengan suhu 720C selama 5 menit dan 1 siklus.
Campuran yang digunakan adalah master mix PCR 15l, H2O 9,6l, primer exon 12-13F 1,8l,
primer exon 12-13R 1,8l, DNA template 1,8l dan jumlah keseluruhan 30l. sedangkan untuk
proses sequencing menggunakan primer forward (12-13F): ggatgatgataattgtgagg, untuk hasil

96

sequencing yang exon 13 rusak atau tidak bisa untuk dibaca sequencing diulang dengan
menggunakan primer reverse (12-13R): ctgaaatgcatgctcctgtg.

439bp

Gambar 5.8 Hasil PCR exon 12-13 gen lgr8

Wild type
70

80

Wild type

TAACGGAACTATCA

Polimorfisme E319E

TAACGGAGCTATCA
Polimorfisme GAAGAG
Wild type
100

Wild type

110

AAGCTTCTACAAAA

Polimorfisme L331L

AAGCTTCTGCAAAA
Polimorfisme CTACTG

Gambar 5.9 Sequenzing exon 12 gen lgr8 wild type dan polimorfisme
E319E(GAAGAG); L331L(CTACTG)

97

Dari hasil sequencing ditemukan polimorfisme exon 12 pada: ATTANT (N315N)


ditemukan pada kasus no: 10, 13, GAAGAN/GAG (E319E) ditemukan pada kasus no: 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
dan juga ditemukan pada kontrol no: 1, 3, 4, 5, 7, 8, 9, 10, 12, 13, 15, 17, 18, 19, 20, 21, 22, 23,
25, 27, 28, 30, 31. Jadi polimorfisme E319E ditemukan pada semua kasus kriptorkismus dan
pada 23 kontrol. Sedangkan polimorfisme CTACTN/CTG (L331L) ditemukan pada kasus no:
2, 6, 7, 11, 14, 16, 19, 20, 21, 23, 24, 25, 26, 28, 31 juga pada kontrol no: 2, 5, 19, 21, 23, 31.
Hubungan polimorfisme exon 12 dengan kriptorkismus dilihat pada tabel 5.6, gambar 5.10
Tabel 5.6
Hubungan antara Frekuensi Polimorfisme Exon12 Gen lgr8 dan Kejadian Kriptorkismus
pada Anak Laki-laki
Polim Exon 12

ATTANT
(N315N)
GAAGAN/
GAG (E319E)
CTACTN/
CTG (L331L)

Kasus
(n=31)

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Total

Statistik

Positip

Negatip

Positip
Negatip

0(0%)
2(6,45%)
2(6,45%)

0(0%)
0(0%)
0

0(0%)
2
2

Nilai-p: 0,50
Odds ratio: infinity
95%CI: 0,19-infinity

Positip
Negatip

23(74,19%)
8(25,81%)
31(100%)

0(0%)
0(0%)
0

23(74,19%)
8
31

Nilai-p: 0,008
Odds ratio: infinity
95%CI: 1,71-infinity

Positip
Negatip

5(16,13%)
10(32,26%)
15(48,39%)

1(3,23%)
0(0%0
1

6(19,36%)
10
16

Nilai-p: 0,012
Odds ratio: 10,0
95%CI: 1,43-433,98

Dari tabel 5.6 polimorfisme N315N (ATTANT) hanya ditemukan pada kasus tetapi
tidak berbeda bermakna nilai-p=0,50 (p>0,05) karena sangat sedikit.

Polimorfisme E319E

(GAAGAN/GAG) frekuensinya lebih banyak pada kasus (100% vs 74,19%) dengan nilai-p=
0,008 (p<0,05), Odds ratio= tak terhingga,

95% Convident interval: 1,71- tak terhingga.

98

Frekuensi polimorfisme L331L (CTACTN/CTG) lebih banyak ditemukan pada kasus


dibandingkan kontrol (48,39% vs 19,36%) dengan nilai-p=0,012(p<0,05). Polimorfisme L331L
berisiko 10,0 kali lebih besar untuk menimbulkan kriptorkismus dibandingkan dengan yang wild
type (Odds ratio=10,0; 95% Convident interval= 1,43 433,98). Polimorfisme N315N, E319E
dan L331L tidak merubah susunan asam amino hanya merubah susunan kodon dalam asam
amino asparagin no 315, asam amino glutamate no 319 dan asam amino leusin no 331.

Gambar 5.10 Frekuensi Polimorfisme Exon 12 Gen lgr8 (E319E, L331L)


E319E : Nilai-p= 0,008; Odds ratio= tidak terhingga; 95% Convident interval= 1,71 tidak terhingga
L331L: Nilai-p= 0,012; Odds ratio= 10,0; 95% Convident interval= 1,43 433,98

5.3.3. Polimorfisme exon 13 gen lgr8


Untuk menemukan polimorfisme pada exon 13 gen lgr8 dibaca dari hasil sequencing
exon 12-13 yang menggunakan primer forward (12-13F) atau primer reverse (12-13R), jadi hasil
sequencing yang dibaca untuk exon 13 sama dengan untuk exon 12 hanya untuk melihat

99

polimorfisme exon 12 dibaca bagian exon 12 dan untuk melihat polimorfisme exon 13 dibaca
bagian exon 13.
Dari hasil sequencing ditemukan polimorfisme exon 13 pada: TCAGCA (S337A)
ditemukan pada kasus no: 2, 3, 4, 5, 6, 8, 9, 10, 13, 16, 18, 20, 21, 22, 24, 25, 29, dan pada
kontrol tidak ditemukan. Polimorfisme CCTCCN/CCC (P340P) ditemukan pada kasus no: 3,
4, 7, 8, 9, 10, 14, 16, 18, 19, 26, 29, 31 dan juga ditemukan pada kontrol no: 1, 4, 6, 17, 18, 19,
23, 31 . Polimorfisme CTTCTN (L344L) ditemukan pada kasus no: 1. Polimorfisme
CACCCC (H345P) ditemukan pada kasus no: 2, 3, 4, 5, 6, 8, 9, 10, 13, 14, 16, 18, 20, 21, 22,
24, 25, 29, 31 dan juga ditemukan pada kontrol no: 1, 2, 3, 8, 9, 12, 20, 27, 30. Polimorfisme
AAGAAN/AAA (K346K) ditemukan pada kasus no: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31 dan juga ditemukan pada kontrol no: 1, 2, 3,
4, 6, 7, 8, 9, 10, 12, 13, 17, 18, 19, 20, 22, 23, 27, 28, 30, 31. Polimorfisme CAGCAN
(Q348Q) hanya ditemukan pada kasus

no: 1, CAAAAA (Q354K) ditemukan pada kasus no:

7, 14, 19, 26, 31. Polimorfisme CAGCCG (Q356P) ditemukan pada kasus no: 4, 10, 13, 16,
18, 20, 22, 24, 25. Sedangkan polimorfisme TCTTCC (S357S) ditemukan pada kasus no: 2, 3,
4,6, 8, 9, 10, 13, 18, 20, 21, 22, 24, 25, 29 dan polimorfisme TCTTNT (S357C) ditemukan
pada kasus no: 11 .Hubungan polimorfisme exon 13 dengan kriptorkismus dapat dilihat pada
tabel 5.7 dan gambar 5.11
Dari tabel 5.7

polimorfisme L344L(CTTCTN), Q348Q (CAGCAN), S357C

(TCTTNT) exon 13 gen Lgr8 tidak bisa dilakukan analisis statistik karena jumlahnya sangat
sedikit, tetapi polimorfisme ini hanya ditemukan pada kelompok kasus dan tidak ditemukan pada
kontrol. Polimorfisme S357C terjadi perubahan asam amino no 357 dari serin menjadi sistein.
Polimorfisme P340P(CCTCCN/CCC)

lebih banyak ditemukan pada kasus dibandingkan

100

dengan kontrol tetapi tidak berbeda secara bermakna dengan nilai-p =0,27 (p > 0,05) dan asam
amino no 340 tetap prolin. Polimorfisme S337A (TCAGCA),

polimorfisme Q354K

(CAAAAA), polimorfisme Q356P (CAGCCG), polimorfisme S357S (TCTTCC) hanya


ditemukan pada kelompok kasus. Polimorfisme S337A (TCAGCA) terjadi perubahan asam
amino no 337 dari serin menjadi alanin dan frekuensinya berbeda bermakna dengan nilai-p:
<0,001(p<0,05), Odds ratio: tidak terhingga, 95% Convident interval: 4,13-tidak terhingga.
Polimorfisme Q354K (CAAAAA) terjadi perubahan asam amino no 354 dari glutamin
menjadi lisin namun tidak berbeda bermakna antara kasus dan kontrol dengan nilai-p=
0,06(p>0,05). Polimorfisme Q356P (CAGCCG) terjadi perubahan asam amino no 356 dari
glutamin menjadi prolin

polimorfisme ini berbeda secara bermakna antara kasus dan kontrol

dengan nilai-p: 0,004(p<0,05), Odds ratio= tidak terhingga, 95% Convident interval= 1,97- tidak
terhingga. Polimorfisme S357S (TCTTCC) tidak terjadi perubahan asam amino no 357 asam
aminonya tetap serin hanya susunan kodon dari asam amino serin yang berubah dari
TCTTCC, tetapi polimorfisme ini berbeda secara bermakna antara kasus dan kontrol dengan
nilai-p= <0,001(p<0,05), Odds ratio= tidak terhingga, 95% Convident interval= 3,59- tidak
terhingga.
Pada tabel 5.7 frekuensi polimorfisme H345P (CACCCC) exon 13 gen lgr8 lebih
banyak ditemukan pada kasus dibandingkan kontrol (61,29% vs 29,03%) dengan nilai-p=
0,03(p<0,05), Odds ratio= 3,5 dan 95% Convident interval= 1,10 14,60. Frekuensi
polimorfisme K346K (AAGAAN/AAA) lebih banyak ditemukan pada kasus dibandingkan
dengan kontrol (90,32% vs 67,74%) dengan nilai-p = 0,07(p>0,05) dan polimorfisme ini asam
aminonya tetap lisin hanya berubah susunan kodon dari asam amino lisin (AAGAAN/AAA).
Wild type
230

Wild type

240

GAACCTGTCATCCAA

101

Polimorfisme S337A

GAACCTGGCATCCAA
Polimorfisme TCAGCA
Wild type
250

260

Wild type

TATGTATCTTCACAA

Polimorfisme H345P

TATGTATCTTCCCAA
Polimorfisme CACCCC

Gambar 5.11 Sequenzing exon 13 gen lgr8 wild type dan polimorfisme
S337A(TCAGCA); H345P(CACCCC)
Wild type
290

300

Wild type

ACTTCAGTCTCTGTA

Polimorfisme Q356P, S357S

ACTTCCGTCCCTGTA

Polimorfisme CAGCCG

Polimorfisme TCTTCC

Gambar 5.12 Sequenzing exon 13 gen lgr8 wild type dan polimorfisme
Q356P(CAGCCG); S357S(TCTTCC)

102

Tabel 5.7
Hubungan antara Frekuensi Polimorfisme Exon 13 Gen lgr8 dan Kejadian Kriptorkismus
pada Anak Laki-laki
Polim Exon 13

Kasus (n=31)

TCAGCA
(S337A)

Kontrol

CCTCCN/
CCC (P340P)

Kontrol

CTTCTN
(L344L)
CACCCC
(H345P)

(n=31)
Total

(n=31)
Total

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

AAGAAN/ Kontrol
AAA (K346K) (n=31)

CAAAAA
(Q354K)
CAGCCG
(Q356P)
TCTTCC
(S357S)
TCTTNT
(S357C)

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Kontrol
(n=31)
Total

Statistik

Positip

Negatip

Positip
Negatip

0(0%)
17(54,84%)
17(54,84%)

0(0%)
0(0%)
0

0(0%)
17
17

Nilai-p: <0,001
Odds ratio: infinity
95%CI: 4,13-infinity

Positip
Negatip

4(12,90%)
9(29,03%)
13(41,94%)

4(12,90%)
0(0%)
4

8(25,81%)
9
17

Nilai-p: 0,27
Odds ratio: 2,25
95%CI: 0,63-10,0

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

5(16,13%)
14(45,16%)
19(61,29%)

4(12,90%)
0(0%)
4

9(29,03%)
14
23

Nilai-p: 0,03
Odds ratio: 3,5
95%CI: 1,10-14,60

Positip
Negatip

19(61,29%)
9(29,03%)
28(90,32%0

2(6,45%)
0(0%)
2

21(67,74%0
9
30

Nilai-p: 0,07
Odds ratio: 4,5
95%CI: 0,93-42,80

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Positip
Negatip

0(0%)
5(16,13%)
5(16,13%)

0(0%)
0(0%)
0

0(0%)
5
5

Nilai-p: 0,06
Odds ratio: infinity
95%CI: 0,92-infinity

Positip
Negatip

0(0%)
9(29,03%)
9(29,03%)

0(0%)
0(0%)
0

0(0%)
9
9

Nilai-P: 0,004
Odds ratio: infinity
95%CI: 1,97-infinity

Positip
Negatip

0(0%)
15(48,39%
15(48,39%)

0(o%)
0(0%)
0

0(0%)
15
15

Nilai-p: < 0,001


Odds ratio: infinity
95%CI: 3,59-infinity

Positip
Negatip

0(0%)
1(3,23%)
1(3,23%)

0(0%)
0(0%)
0

0(0%)
1
1

Tidak dianalisis

Total

CAGCAN
(Q348Q)

Total

103

Gambar 5.13 Frekuensi Polimorfisme Exon 13 Gen lgr8 (S337A, H345P, Q356P, S357S)
S337A: Nilai-p=< 0,001; Odds ratio= tidak terhingga; 95% Convident interval=4,13 - tidak terhingga
H345P: Nilai-p=0,03; Odds ratio= 3,5; 95% Convident interval= 1,10 14,6
Q356P: Nilai-p= 0,004; Odds ratio= tidak terhingga; 95% Convident interval= 1,97 tidak terhingga
S357S: Nilai-p= <0,001; Odds ratio= tidak terhingga; 95% Convident interval: 3,59 tidak terhingga

Jadi polimorfisme exon 13 gen lgr8 yang diwakili oleh polimorfisme S337A, H345P,
Q356P berbeda secara bermakna dan terjadi perubahan asam amino. Polimorfisme S357S tidak
terjadi perubahan asam amino hanya perubahan basa dalam kodon asam amino serin.

104

5.4. Kadar Hormon INSL3


Tabel 5.8.1
Beda Kadar Hormon INSL3 Plasma antara Kasus dan Kontrol pada Anak Laki-laki

Rerata SB Kadar hormon


INSL3 plasma (ng/ml

Kasus
(n=31)

Kontrol
(n=31)

Nilai-p

95% convident interval


(beda rerata)

0,40 0,24

0,91 0,46

< 0,001

-0,72 s/d -0,31

Dari tabel 5.8.1 ditemukan rerata kadar hormon INSL3 plasma pada kasus 0,40 0,24
ng/ml dan pada kontrol 0,91 0,46 ng/ml. Jadi rerata kadar hormon INSL3 plasma lebih rendah
bermakna pada kasus dibandingkan dengan kontrol (Nilai-p = <0,001 ( p < 0,05); 95%
Convident interval= -0,72 - 0.31).
Tabel 5.8.2
Beda Frekuensi Kadar Hormon INSL3 Plasma yang Rendah antara Kasus dan Kontrol pada Anak
Laki-laki

Kadar Hormon INSL3

Sampel

Nilai-p

Kasus(%)
(n=31)

Kontrol(%)
(n=31)

Rendah

18(58,06%)

3(9,68%)

Normal

13(41,94%)

28(90,32%)

Odds

95%CI

ratio

<0,001

12,92

3,23 51,78

Nilai batas optimum untuk diagnosis kriptorkismus (< 0,42 ng/ml, kurva ROC ) kadar
hormon INSL3 plasma yang rendah lebih banyak ditemukan pada kasus dibandingkan dengan
kontrol (58,06% vs 9,68%) dengan nilai-p= <0,001. Kadar hormon INSL3 plasma yang rendah
berisiko 12,92

kali lebih besar untuk terjadinya kriptorkismus dibandingkan dengan yang

normal (Odds ratio= 12,92; 95% Convident interval= 3,23 51,78).

105

ROC Curve
1.0

Sensitivity

0.8

0.6

0.4

0.2

0.0
0.0

0.2

0.4

0.6

0.8

1.0

1 - Specificity
Diagonal segments are produced by ties.

Gambar 5.14 Kurva ROC Kadar Hormon INSL3 Plasma


5.5. Kadar Hormon Estradiol
Tabel 5.9.1
Beda Kadar Hormon Estradiol Plasma antara Kasus dan Kontrol pada Anak Laki-laki

Rerata SB Kadar hormon


Estradiol plasma (ng/ml

Kasus
(n=31)

Kontrol
(n=31)

Nilai-p

95% convident interval


(beda rerata)

17,08
16,05

9,55
4,92

0,02

1,16 s/d 13,90

Dari tabel 5.9.1 rerata kadar hormon estradiol plasma pada kasus 17,08 16,05 ng/ml
dan rerata kadar hormon estradiol plasma pada kontrol 9,55 4,92 ng/ml. Jadi rerata kadar
hormon estradiol plasma pada kasus lebih tinggi bermakna dibandingkan dengan kontrol (Nilai-p
= 0,02 ( p < 0,05); 95% Convident interval= 1,16 13,90).

106

Tabel 5.9.2
Beda Frekuensi Kadar Hormon Estradiol Plasma yang Tinggi antara Kasus dan Kontrol pada
Anak Laki-laki

Kadar Hormon Estradiol

Sampel

Nilai-p

Kasus(%)
(n=31)

Kontrol(%)
(n=31)

Tinggi

25(80,64%)

9(29,03%)

Normal

6(19,36%)

22(70,97%)

Odds

95%CI

Ratio

<0,001

10,19

3,13 33,19

Nilai batas optimum untuk diagnosis kriptorkismus ( > 10,22 ng/ml, Kurva ROC ) kadar
hormon estradiol plasma yang tinggi lebih banyak ditemukan pada kasus dibandingkan kontrol
(80,64% vs 29,03%) dengan nilai-p= <0,001.

Kadar hormon estradiol plasma yang tinggi

berisiko 10,19 kali lebih besar menimbulkan kriptorkismus.

ROC Curve
1.0

Sensitivity

0.8

0.6

0.4

0.2

0.0
0.0

0.2

0.4

0.6

0.8

1.0

1 - Specificity
Diagonal segments are produced by ties.

Gambar 5.15 Kurva ROC Kadar Hormon Estradiol Plasma

107

BAB VI PEMBAHASAN
Kriptorkismus merupakan kondisi patologi berupa kegagalan testis turun ke dalam
skrotum, kadang-kadang karena kriptorkismus terjadi atropi tubulus semineferus dan lokasi testis
pada kriptorkismus dapat berada di canalis inguinalis, daerah preskrotal atau daerah abdomen
(Moretti dkk., 2007; Hutson, 2007). Menurunnya testis terjadi selama kehidupan fetus, maka
insiden dari kriptorkismus tergantung dari usia kehamilan dari bayi tersebut, bayi laki-laki yang
prematur yang mempunyai testis yang tidak turun dapat mencapai 30% dan insiden ini menurun
menjadi 3 sampai 5% pada bayi yang lahir cukup bulan. Penurunan testis akan terus berlangsung
pada beberapa pasien selama satu tahun kehidupannya, yang mana pada usia satu tahun insiden
kriptorkismus adalah 0,8%. Penurunan testis pada bayi setelah lahir kebanyakan terjadi karena
pengaruh hormon testosteron neonatus dalam usia 3 bulan pertama. Walaupun sebelumnya testis
dapat turun sampai usia satu tahun setelah lahir, kebanyakan testis akan turun secara spontan
dalam 3 bulan pertama kelahiran (Kaefer, 2004). Sampai usia satu tahun, secara histologi testis
yang belum turun ke skrotum masih normal, termasuk masih normalnya populasi sel interstitial
dan sel germinal. Pada usia 18 bulan kedua sel tadi dengan mikroskop elektron mengalami
perubahan histologi berupa kerusakan populasi sel germinal. Keadaan yang sama juga terjadi
pada usia 2 tahun pada testis kontralateral yang tidak turun. Secara klinis pada kriptorkismus
terjadi penurunan fertilitas, setelah orkidopeksi penurunan fertilitas terjadi 50 sampai 70 % pada
kriptorkismus unilateral dan 75% pada kriptorkismus bilateral (Kaefer, 2004). Menurut Bajpai &
Menon (2008) secara histologi sel germinal sudah mengalami kerusakan pada kriptorkismus
mulai anak usia 6-12 bulan bila testis tidak masuk ke dalam skrotum. Kerusakan yang terjadi
berupa lambatnya maturasi sel germinal, menurunnya jumlah sel germinal, tubulus seminiferus
mengalami hialinisasi dan menurunnya jamlah sel Leydig yang khusus. Main dkk (2006-b)

107

108

mengatakan pada kasus kriptorkismus volume testis akan mengecil, kadar semen dan inhibin B
yang rendah. Hormon testosteron dihasilkan oleh sel leydig testis mulai usia 9 minggu kehamilan
dan gangguan pada produksi maupun aktivitas hormon testosteron baik pada bayi dalam
kandungan setelah trimester pertama maupun pada masa bayi dan anak akan menyebabkan
ukuran penis kecil (Hughes, 2009). Penelitian ini

menemukan rerata panjang penis pada

kelompok kriptorkismus lebih pendek dibandingkan kelompok anak yang sehat (4,23 0,56 cm
vs 4,65 0,76 cm) dan berbeda secara bermakna dengan nilai-p= 0,02 (p< 0,05). Rerata volume
testis kiri juga lebih kecil secara bermakna pada kelompok anak dengan kriptorkismus
dibandingkan dengan anak yang sehat (1,80 0,49 ml vs 2,37 0,61 ml ) dengan nilai-p= 0,001
(p<0,050). Hal ini mungkin disebabkan pada anak yang mengalami kriptorkismus sudah ada
sedikit kerusakan sehingga produksi hormon testosteron lebih rendah. Volume testis kiri lebih
kecil bermakna pada kriptorkismus kemungkinan karena 51,61% kriptorkismus kiri sedangkan
kriptorkismus kanan hanya 32,26%, karena yang kanan mungkin banyak turun spontan.
Pada penelitan ini prosentase kriptorkismus intraabdominal dan kriptorkismus inguinal
sama yaitu masing-masing 41,94%, prosentase kriptorkismus kanan lebih kecil dari
kriptorkismus kiri (32,26% vs 51,61%) dan kriptorkismus bilateral hanya 16,13%. Hasil ini
berbeda dengan yang ditemukan Kaefer (2004) bahwa kriptorkismus unilateral dua kali lebih
banyak dari kriptorkismus bilateral dan kriptorkismus kanan dua kali lebih banyak dari
kriptorkismus kiri. Bajpai & Menon (2008) menemukan bahwa 20% testis tidak teraba dan
kebanyakan letaknya di kiri. Pada penelitian ini anak kriptorkismus yang dipakai kasus berusia 6
bulan ke atas sedangkan 2/3 anak kriptorkismus bijinya akan turun spontan sebelum usia 6 bulan,
karena itu kemungkinan kriptorkismus inguinal kiri yang tinggi

sebelumnya adalah

intraabdominal kiri dan kriptorkismus inguinal kanan saat lahir setelah usia 6 bulan kebanyakan

109

sudah turun sehingga prosentase kriptorkismus intraabdominal dan inguinal sama yaitu 41,94%,
dan inguinal kiri lebih besar dari inguinal kanan. Terjadinya kriptorkismus intraabdominal
disebabkan karena adanya gangguan pada produksi maupun sifat dari hormon INSL3, diketahui
pada fase penurunan testis transabdominal terjadi pertumbuhan gubernakulum yang dipengaruhi
oleh hormon INSL3 dan terjadi juga regresi CSL yang dipengaruhi oleh hormon testosteron.
Pada kekurangan hormon INSL3 yang komplit menyebabkan gubernakulum tidak tumbuh dan
testis tetap berada di dalam perut, terjadilah kriptorkismus intraabdominal. Fase kedua dari
turunnya testis, testis turun dari cincin inguinalis interna dan langsung masuk ke skrotum.
Penurunan testis transinguinal ini disebabkan karena terjadinya regresi dari gubernakulum yang
sebelumnya gubernakulum sudah tumbuh sampai di dasar skrotum, regresi gubernakulum pada
fase ini dipengaruhi oleh hormon testosteron dan gerakan ritmik gubernakulum dari cincin
inguinalis interna ke dasar skrotum dipengaruhi oleh GFN dan CGRP. Selain hal diatas
penurunan testis juga dipengaruhi oleh adanya tekanan intraabdominal dan

hormon AMH

terutama penurunan testis transabdominal. Pada anak laki-laki kriptorkismus intraabdominal


disebabkan rendahnya kadar hormon INSL3 yang merangsang pertumbuhan gubernakulum, atau
adanya resistensi dari reseptor

hormon INSL3 ( LGR8).

Kriptorkismus inguinal dan

kriptorkismus presktrotal terjadi karena rendahnya kadar hormon INSL3 bersifat parsial sehingga
gubernakulum tumbuh tetapi pertumbuhan gubernakulum tidak optimal atau petumbuhan
gubernakulum tidak mencapai dasar skrotum atau rendahnya kadar hormon testosteron plasma
sehingga meskipun gubernakulum sudah tumbuh sampai dasar skrotum tapi regresi dan gerakan
ritmik testis tidak optimal sehingga testis berada dalam inguinal atau maksimal bisa mencapai
preskrotal tapi tetap tidak mencapai dasar skrotum.

110

6.1. Frekuensi Polimorfisme


Polimorfisme SNPs merupakan salah satu bentuk polimorfisme yang bersifat sederhana,
prevalensinya banyak dan umumnya merupakan bagian dari polimorfisme DNA yang tumbuh
dari substansi pasang basa tunggal. SNPs dapat diidentifikasi dengan melakukan sequenzing pada
region yang sama dari genum pada beberapa individu , walaupun SNPs sudah mempunyai kode
sequenzing, namun SNPs masih berhubungan dengan gene yang berhubungan langsung dengan
fenotip, dan sebagian besar polimorfisme SNPs ditemukan lokusnya anonym. Beberapa kelainan
pada pada gen yang lain berhubungan dengan perubahan fenotip secara signifikan merupakan
marker DNA (Hartwell dkk., 2008). Polimorfisme SNPs merupakan marker biologi untuk
terjadinya penyakit pada genum manusia tertentu, sebab polimorfisme SNPs biasanya terletak
dekat dengan gen yang menyebabkan penyakit dan ada kalanya polimorfisme SNPs secara actual
menyebabkan penyakit, dan selanjutnya dapat digunakan dan diteliti sebagai penyakit yang
disebabkan oleh gen. Pada penelitian ini ditemukan polimorfisme exon 1 gen insl3 ( ditemukan
pada anak dengan kriptorkismus dan anak yang sehat), polimorfisme exon 2 gen insl3 ( hanya
ditemukan pada anak dengan kriptorkismus ), polimorfisme exon 8 gen lgr8 (hanya ditemukan
pada anak dengan kriptorkismus), polimorfisme exon 12 gen lgr8 (ditemukan pada anak dengan
kriptorkismus dan anak yang sehat), polimorfisme exon 13 gen lgr8 (ditemukan pada anak
dengan kriptorkismus dan anak yang sehat). Frekuensi polimorfisme exon 1 gen insl3 pada
anak laki-laki yang kriptorkismus ( A9A = 19,36%;

T60T= 51,61%;

T60A= 25,81%).

Polimorfisme A9A dan polimorfisme T60T tidak terjadi perubahan asam amino, hanya terjadi
perubahan susunan basa, sedangkan polimorfisme T60A terjadi perubahan asam amino no 60
dari treonin menjadi alanin dan ditemukan lebih banyak pada anak yang sehat namun tidak
berbeda bermakna.

Frekuensi polimorfisme exon 2 gen insl3 pada anak laki-laki yang

111

kriptorkismus ( E146E= 9,68%) polimorfisme ini tidak mengubah asam amino. Frekuensi
polimorfisme exon 8 gen lgr8 pada anak laki-laki yang kriptorkismus ( kodon stop223M=
3,23%), polimorfisme ini meskipun ditemukan hanya 3,23% tapi hanya ditemukan pada anak
kriptorkismus sedangkan pada anak sehat tidak ditemukan dan terjadi perubahan asam amino no
223 dari kodon stop menjadi metionin atau kodon start. Dalam proses replikasi DNA peranan
kodon start dan kodon stop sangat penting yang mana kodon start tugasnya memulai suatu
replikasi DNA dan kodon stop memberhentikan proses replikasi DNA. Perubahan kodon stop
menjadi kodon start asam amino no 223 pada exon 8 gen lgr8 akan mempengaruhi sifat reseptor
RGR8 terhadap hormon INSL3 dan selanjutnya berpengaruh pada pertumbuhan gubernakulum,
dan kita ketahui pertumbuhan gubernakulum yang normal dan optimal sangat diperlukan untuk
penurunan testis.

Frekuensi polimorfisme exon 12 gen lgr8 pada anak laki-laki yang

kriptorkismus ( E319E= 100%; L331L= 48,39%), kedua polimorfisme ini juga ditemukan pada
anak yang sehat tapi jumlahnya pada anak kriptorkismus lebih banyak secara bermakna,
polimorfisme E319E dan L331L asam aminonya no 319 tetap glutamate dan asam amino no 331
tetap leusin hanya terjadi perubahan susunan basa pada kodon asam amino glutamat dari
GAAGAN/GAG, begitu juga dengan susunan basa asam amino lisin berubah darai
CTACTN/CTG. Frekuensi polimorfisme exon 13 gen lgr8 pada anak laki-laki yang
kriptorkismus ( S337A= 54,84%; P340P= 41,94%;

H345P= 61,29%; K346K= 90,32%;

Q354K= 16,13%; Q356P= 29,03%; S357S= 48,39%), polimorfisme S357S asam amino no 357
tetap serine hanya terjadi perubahan susunan basa pada asam amino serine no 357 dari
TCTTCC, polimorfisme P340P asam amino no 340 tetap prolin hanya susunan basa asam
amino prolin saja yang berubah dari CCTCCN/CCC, polimorfisme K346K asam amino no
346 tetap lisin hanya susunan basa dari asam amino lisin berubah dari AAGAAN/AAA.

112

Polimorfisme S337A terjadi perubahan asam amino no 337 dari serin menjadi alanin,
polimorfisme H345P terjadi perubahan asam amino no 345 dari histidin menjadi prolin,
polimorfisme Q354K terjadi perubahan asam amino no 354 dari glutamin menjadi lisin,
polimorfisme Q356P terjadi perubahan asam amino no 356 dari glutamat menjadi prolin.
Semua polimorfisme yang ditemukan berbentuk polimorfisme SNPs, hanya polimorfisme C116C
(TGCTNGC) pada exon 2 berbentuk substitusi atau indel.
6.2. Polimorfisme Exon 1, Exon 2 Gen insl3 dan Kriptorkismus
Gubernakulum perannya sangat menentukan pada mekanisme yang komplek dari
turunnya testis dan tertutupnya hernia inguinalis (Hutson dkk., 2004), perubahan pada gen Insl3
menyebabkan kegagalan testis secara normal masuk ke skrotum selama perkembangan
embriyo (Ferline dkk.,2003). Kekacauan genetik dari gen insl3 pada tikus percobaan
menyebabkan tingginya kriptorkismus intraabdominal. Analisis mutasi gen insl3 dengan SNPs
pada pasien kriptorkismus belum jelas (The Endocine society, 2005).
Penelitian ini menemukan adanya polimorfisme exon 1 dan exon 2 gen insl3,
polimorfisme exon 1 ditemukan berupa M1M (ATGNTG) asam amino no 1 tetap metionin,
A9A (GCGGCN/GCA) asam aminonya tetap alanin, L42L (CTACTN) asam amino tetap
leusin, L42P (CTACNN) asam amino berubah dari leusin menjadi prolin, V43M
(GTGNNG) asam amino valin menjadi metionin, T60T (ACCNCC) asam amino tetap
treonin, T60A (ACCGCC) asam amino berubah dari treonin menjadi alanin. Sedangkan
peneliti lain yang menemukan polimorfisme exon 1 gen insl3 adalah Lim dkk (2001)
menemukan polimorfisme pada exon 1 berupa A41A (GCGGCA) asam aminonya tetap
alanin, polimorfisme ini tidak ditemukan pada penelitian ini. Ferlin dkk (2003) menemukan

113

polimorfisme exon 1 berupa A9A (GCGGCA) asam aminonya tetap alanin, L42L
(CTACTG) asam aminonya tetap leusin, T60A (ACCGCC) asam amino berubah dari
treonin menjadi alanin, polimorfisme ini ditemukan juga pada penelitian ini. Foresta dkk (2008)
menemukan polimorfisme berupa V18M (GTGATG) asam amino berubah dari valin menjadi
metionin, P49S (CCCTCC) asam amino berubah dari prolin menjadi serin, polimorfisme ini
tidak ditemukan pada penelitian ini. Polimorfisme T60A ditemukan lebih banyak pada anak yang
sehat dibandingkan anak dengan kriptorkismus meskipun tidak berbeda secara bermakna
kemungkinan polimorfisme T60A merupakan faktor protektip untuk terjadinya kriptorkismus
pada anak. Polimorfisme T60A dan polimorfisme T60T ditemukan dalam jumlah yang banyak
baik pada anak dengan kriptorkismus maupun pada anak yang sehat hal ini kemungkinan exon 1
gen insl3 perannya kecil terhadap produksi hormon INSL3 oleh sel Leydig.
Pada penelitian ini polimorfisme exon 2 ditemukan berupa R73R (CGACNA) asam
aminonya tetap arginin, C115W (TGCTGG) asam amino berubah dari sistein menjadi
triptopan, C116C (TGCTNGC) asam amino tetap sistein, kodon stop140kodon stop
(AGAANA), G144G (GGCNGC) asam amino tetap glisin, E146E (GAGNAG) asam
amino tetap glutamate, Q157Q (CAGCAN) asam amino tetap glutamin, A166D
(GCCGAC) asam amino berubah dari alanin menjadi aspartat. Pada exon 2 meskipun
jumlahnya kecil polimorfisme hanya ditemukan pada kelompok anak dengan kriptorkismus dan
ada beberapa polimorfisme yang asam aminonya berubah. Polimorfisme exon 2 gen insl3 yang
ditemukan hanya pada anak dengan kriptorkismus dan tidak ditemukan pada anak yang sehat
menandakan exon 2 gen insl3 sangat berperan dalam memproduksi hormon INSL3 dan
pertumbuhan gubernakulum.

Peneliti lain yang menemukan polimorfisme pada exon 2 gen

insl3 adalah Lim dkk (2001) berupa L85L (CTCCTG) asam aminonya tetap leusin, V141L

114

(GTGCTG) asam aminonya berubah dari valin menjadi leusin, (140A, 140G, 160T berupa
dilesi atau polimorfisme indel), A152V (GCTGTT) asam aminonya berubah dari alanin
menjadi valin, polimorfirme ini tidak ditemukan pada penelitian ini. Canto dkk (2003)
menemukan polimorfisme berupa N86K (AACAAG) asam aminonya berubah dari asparagin
menjadi lisin, polimorfisme ini tidak ditemukan pada penelitian ini. Ferlin dkk (2003)
menemukan polimorfisme berupa P93L (CCCCTC) asam aminonya berubah dari prolin
menjadi leusin, R102H (CGCCAC) asam aminonya berubah dari arginin menjadi histidin,
R102C (CGCTGC) asam aminonya berubah dari arginin menjadi sistein, polimorfisme ini
tidak ditemukan pada penelitian ini. Pada penelitian ini polimorfisme exon 1 M1M, L42L,
L42P, V43M jumlahnya masing-masing 1 dan hanya ditemukan pada anak dengan
kriptorkismus. Polimorfisme A9A, T60T, T60A ditemukan pada anak dengan kriptorkismus dan
anak sehat. Frekuensi polimorfisme T60T ditemukan lebih banyak secara bermakna pada
kelompok anak dengan kriptorkismus dibandingkan anak normal (51,61% vs 16,13%) ,
polimorfisme T60T berisiko tidak terhingga menyebabkan kejadian kriptorkismus dibandingkan
dengan yang wild type, tetapi polimorfisme ini tidak merubah asam amino no 60 hanya merubah
susunan basa dari kodon asam amino treonin ( ACCNCC). Pada polimorfisme T60A ada
perubahan asam amino no 60 dari treonin menjadi alanin dan bersifat protektip untuk terjadinya
kasus kriptorkismus pada anak karena frekuensinya lebih banyak pada anak yang sehat ( 25,81%
vs 48,39%) tetapi tidak berbeda bermakna secara statistik. Dari hasil penelitian ini ditemukan
polimorfisme exon 1 yang diwakili polimorfisme T60T berkaitan dengan marker baru
kriptorkismus pada anak laki-laki karena lebih banyak secara bermakna pada kasus tetapi secara
biologi asam aminonya tetap treonin (hanya susunan basa saja pada asam amino treonin yang
berubah).

115

6.3. Polimorfisme Exon 8, Exon 12, Exon 13 Gen lgr8 dan Kriptorkismus
Reseptor LGR8 merupakan reseptor dari hormon INSL3 (Ferlin dkk., 2003; Nuti dkk.,
2007). Hormon INSL3 dan reseptor LGR8 memainkan peran penting pada penurunan testis fase
transabdominal (Kumagai dkk., 2002a,b). Reseptor LGR8 tersebar di testis, ligament
gubernakulum dan pada epididymis (Anand-Ivell dkk., 2006). Gen lgr8 terdiri dari 18 exon dan
terletak pada kromosom 13 yaitu 13q13.1 yang mempunyai panjang 63.330 pasang basa (dari 5001
68331. Analisis mutasi gen lgr8 dideteksi dengan SNPs, pada tikus percobaan perubahan
susunan basa gen lgr8 menyebabkan tingginya kasus kriptorkismus intraabdominal (Ferlin dkk.,
2003).
Penelitian ini juga menemukan polimorfisme exon 8 gen Lgr8 berupa (kodon stop223M)
asam amino berubah dari kodon stop menjadi metionin, sedangkan peneliti lain menemukan
polimorfisme exon 8 gen lgr8 berupa T222P (ACCCCC) asam amino berubah dari treonin
menjadi prolin oleh (Garlov dkk 2002, Ferlin dkk 2003, Vinci dkk 2004, Nuti dkk 2007).
Polimorfisme exon 8 pada penelitian ini hanya ditemukan pada anak dengan kriptorkismus
(kodon stop223M) dan peneliti lain juga menemukan pada anak dengan kriptorkismus ( T222P )
meskipun jumlahnya tidak banyak kemungkinan exon 8 gen lgr8 banyak mempengaruhi fungsi
reseptor LGR8. Polimorfisme exon 12 gen lgr8 berupa (N315N, E319E, L331L) asam aminonya
tetap asparagin, glutamat, leusin. Polimorfisme E319E dan L331L juga ditemukan oleh peneliti
lain Ferlin dkk (2003) dan Nuti dkk (2007). Pada penelitian ini polimorfisme E319E dan
polimorfisme L331L berbeda bermakna antara kelompok anak dengan kriptorkismus dan anak
sehat. Polimorfisme E319E dan L331L merupakan polimorfisme yang umum ditemukan oleh
peneliti lain namun pada penelitian ini ditemukan perbedaan bermakna, perbedaan frekuensi ini
kemungkinan disebabkan oleh faktor ras dan kemungkinan exon 12 gen lgr8 perannya terhadap

116

fungsi reseptor LGR8 tidak banyak. Polimorfisme exon 13 gen lgr8 berupa (S337A asam
aminonya berubah dari serin menjadi alanin, P340P asam aminonya tetap prolin, L344L asam
aminonya tetap leusin, H345P asam aminonya berubah dari histidin menjadi prolin, K346K asam
aminonya tetap lisin, Q348Q asam aminonya tetap glutamin, Q354K asam aminonya berubah
dari glutamin menjadi lisin, Q356P asam aminonya berubah dari glutamin menjadi prolin, S357S
asam aminonya tetap serin, S357C asam aminonya berubah dari serin menjadi sistein), peneliti
lain belum menemukan polimorfisme pada exon 13 gen lgr8, sehingga polimorfisme pada exon
13 gen lgr8 ini merupakan temuan baru dari penelitian ini. Polimorfisme pada exon 13 gen lgr8
banyak ditemukan adanya perubahan asam amino dan banyak ditemukan juga polimorfisme
hanya pada anak dengan kriptorkismus hal ini kemungkinan peran exon 13 dalam mempengaruhi
fungsi reseptor lgr8 sangatlah besar. Polimorfisme (kodon stop223M) exon 8, (N315N) exon 12,
(S337A, L344L, Q348Q, Q354K, Q356P, S357S, S357C) exon 13 hanya ditemukan pada
kelompok anak dengan kriptorkismus. Polimorfisme E319E dan L331L exon 12 ditemukan pada
kelompok anak dengan kriptorkismus dan anak sehat, namun jumlahnya lebih banyak pada
kelompok anak dengan kriptorkismus dan berbeda secara bermakna. Polimorfisme E319E dan
L331L exon 12 gen lgr8 berisiko tidak terhingga untuk E319E dan 10,0 kali lebih besar untuk
L331L menimbulkan kejadian kriptorkismus dibandingkan dengan yang wild type. Polimorfisme
exon 12 yang diwakili polimorfisme

E319E, L331L berkaitan dengan marker kejadian

kriptorkismus pada anak laki-laki karena berbeda secara bermakna, tetapi asam amino tetap
hanya terjadi perubahan susunan basa dari asam amino glutamat dan asam amino lisin.
Polimorfisme exon 13 yang diwakili oleh S337A, H345P, Q356P berkaitan dengan
meningkatnya risiko kejadian kriptorkismus pada anak laki-laki karena berbeda secara bermakna
dan secara biologi terjadi perubahan asam amino, sedangkan polimorfisme S357S berkaitan

117

dengan marker baru kejadian kriptorkismus pada anak laki-laki karena yang berubah hanya
susunan basa dari asam amino serin.
6.4. Kadar Hormon INSL3, Hormon Estradiol dan kriptorkismus
Gubernakulum tumbuh dengan cepat pada fetus laki-laki, namun pada fetus perempuan
pertumbuhan gubernakulum tidak sempurna, faktor yang berperan pada pertumbuhan
gubernakulum adalah hormon INSL3, tidak sempurnanya pertumbuhan gubernakulum
berhubungan dengan aktivitas mitosis dari bulbus gubernakulum dari fetus laki-laki dan fetus
perempuan (Emmen dkk., 2000). Gubernakulum perannya sangat menentukan pada mekanisme
yang komplek dari turunnya testis dan tertutupnya hernia inguinalis (Hutson dkk., 2004). Pada
laki-laki yang normal dan pada tikus percobaan yang organ seksualnya sudah matur hormon
INSL3 konsentrasinya di sirkulasi dapat terdeteksi maksimum 1 ng/ml, sedangkan konsentrasi
hormon INSL3 dalam vena spermatika alalah > 14 ng/ml, karena hormon Insl3 merupakan
hormon autokrin-parakrin ( Anand-Ivell dkk., 2006 ). Hormon INSL3 merupakan marker penting
untuk mengetahui fungsi sel leydig dan status difrensiasinya, ekpresi hormon INSL3 meningkat
pada masa fetus, menurun setelah bayi lahir dan kemudian ekspresi INSL3 meningkat lagi saat
remaja. Kekurangan hormon INSL3 sangat penting sebagai tanda dari adanya hipogonad
(Foresta dkk., 2008 ). Penelitian ini menemukan rerata kadar hormon INSL3 plasma pada
kelompok anak dengan kriptorkismus adalah 0,40 0,24 ng/ml, pada kelompok anak yang sehat
adalah 0,91 0,46 ng/ml, pada anak dengan kriptorkismus rerata kadar hormon INSL3 plasma
lebih rendah secara bermakna.
Nilai batas optimum kadar hormon INSL3 plasma untuk diagnosis kriptorkismus (< 0,42
ng/ml, kurva ROC), frekuensi kadar hormon INSL3 plasma yang rendah lebih banyak secara

118

bermakna pada anak kriptorkismus dibandingkan anak yang normal (58,06 % vs 9,68 % ) dan
kadar hormon INSL3 plasma yang rendah berisiko 12,92 kali lebih besar untuk terjadinya
kriptorkismus dibandingkan dengan anak yang normal.

Kadar hormon INSL3 plasma yang

rendah dengan nilai batas optimum <0,42 ng/ml berkaitan dengan meningkatnya risiko
kriptorkismus pada anak laki-laki.
Penelitian ini menemukan dari 31 anak laki-laki kriptorkismus 13 orang ( 41,94 % )
mengalami kriptorkismus intraabdominal, 13 orang ( 41,94 % ) mengalami kriptorkismus
inguinal dan 5 orang ( 16, 12 % ) mengalami kriptorkismus preskrotal. Setelah dibandingkan
kadar hormon INSL3 plasma yang rendah dengan nilai optimum < 0,42 ng/ml kurva ROC antara
anak laki-laki dengan kriptorkismus intraabdominal dan kriptorkismus inguinal tidak ditemukan
perbedaan ( 53,85% vs 53,85% ). Sementara diketahui hormon INSL3 plasma berperan dalam
pertumbuhan gubernakulum dan pada penurunan testis transabdominal, sehingga diharapkan
kadar hormon INSL3 plasma yang rendah ditemukan frekuensinya lebih banyak pada anak lakilaki dengan kriptorkismus intraabdominal namun pada penelitian ini frekuensi kadar hormon
INSL3 yang rendah antara kriptorkismus intraabdominal dengan kriptorkismus preskrotal tidak
ada perbedaan. Sedangkan kadar hormon INSL3 plasma yang rendah ditemukan lebih banyak
pada anak kriptorkismus dibandingkan anak yang normal ( 58,06 % vs 9,68 % ). Kadar hormon
INSL3 plasma pada anak yang kriptorkismus dipengaruhi oleh testis lainnya yang masih normal
dan dipengaruhi juga oleh berat ringannya kerusakan testis anak yang kriptorkismus. Adanya
resistensi pada reseptor LGR8 yang diakibatkan oleh banyaknya polimorfisme pada gen lgr8
mempengaruhi kadar hormon INSL3 karena bila ada resistensi pada reseptor dari hormon akan
memacu pengeluaran hormon sebagai kompensasi.

119

Penurunan testis dihambat oleh hormon estradiol, pengaruh hormon estradiol


diperkirakan sebagai mediasi penekanan perkembangan sel leydig pasien dan menyebabkan
menurunnya produksi hormon testosteron dan hormon INSL3 (The endocrine society, 2005).
Pada tikus yang diobati dengan diethylstilbesterol saat hamil kasus kriptorkismus ditemukan
meningkat, diperkirakan estrogen dalam fetus dapat menimbulkan penekanan ekspresi Insl3 dan
feedbac inhibisi terhadap axis hipothalamus hipofise gonad sehingga terjadi hipoandrogenisme
(Ivell & Hartung., 2003). Penelitian ini menemukan rerata kadar hormon estradiol plasma pada
kelompok anak dengan kriptorkismus adalah 17,08 16,05 ng/ml , pada kelompok anak yang
sehat adalah 9,55 4,92 ng/ml, pada anak dengan kriptorkismus rerata kadar hormon estradiol
plasma lebih tinggi secara bermakna.
Nilai batas optimum kadar hormon estradiol plasma untuk diagnosis kriptorkismus
(>10,22 ng/ml, kurva ROC), kadar hormon estradiol plasma yang tinggi lebih banyak secara
bermakna pada anak kriptorkismus dibandingkan dengan anak yang normal dan kadar hormon
estradiol plasma yang tinggi berisiko 10,19 kali lebih besar menimbulkan kriptorkismus
dibandingkan anak yang normal. Kadar hormon estradiol plasma yang tinggi dengan nilai batas
optimum > 10,22 ng/ml berkaitan dengan meningkatnya risiko kriptorkismus pada anak laki-laki.
Kadar hormon estradiol plasma yang tinggi pada anak laki-laki bisa berasal dari perubahan
hormon testosteron menjadi hormon entradiol melalui proses aromatisasi dengan enzim
aromatase, gangguan pada proses aromatisasi menyebabkan kadar hormon estradiol plasma
meningkat. Kadar hormon estradiol plasma pada anak laki-laki juga bisa berasal dari kadar
hormon estradiol ibu saat bayi dalam kandungan dan bisa juga berasal dari makanan setelah bayi
lahir ( anak makan makanan yang banyak mengandung estradiol). Kadar estradiol plasma yang

120

tinggi dalam plasma akan menekan produksi hormon INSL3 dan produksi hormon testosteron
sehingga terjadi kriptorkismus.
6.5. Hubungan Polimorfisme Gen insl3, Kadar Hormon Estradiol Plasma yang Tinggi,
Kadar Hormon INSL3 Plasma yang Rendah dan Adanya Polimorfisme Gen lgr8
dengan Kejadian Kriptorkismus
Gubernakulum berhubungan dengan ujung bawah testis-epididimis terletak pada bagian
kranial kanalis inguinalis di diperlukan untuk perkembangan normal prosesus vaginalis.
Mekanisme terputusnya bagian distal gubernakulum merupakan hasil dari berkurangnya
perkembangan prosesus vaginalis. Regresi ligamen suspensory kranial dan penebalan
gubernakulum menghasilkan migrasi testis transabdominal, keadaan ini membawa testis ke
cincin inguinalis interna pada usia tiga bulan kehamilan, selama bulan ke empat sampai ke lima
kehamilan, kantong luar peritoneum berkembang sepanjang bagian kaudal dari gubernakulum
meluas lewat kanalis inguinalis ke dalam skrotum (Kaefer, 2004., Achermann, 2005).
Gubernakulum sangat berperan pada fase turunnya testis dari intraabdominal ke dasar sekrotum,
pada fase pertama akan terjadi pertumbuahan gubernakulum sampai di dasar sekrotum, hal ini
akan menyebabkan turunnya testsis dari intraabdominal dan masuk cincin inguinalis interna
(penurunan testis transabdominal). Hormon yang mempengaruhi pertumbuhan gubernakulum
adalah hormon INSL3, bila terjadi gangguan dalam produksi atau sifat dari hormon INSL3 atau
resistensi akibat gangguan reseptor hormon INSL3 (gangguan reseptor LGR8) di gubernakulum,
menyebabkan gangguan pertumbuhan gubernakulum atau gubernakulum tidak tumbuh (testis
tetap di intraabdominal atau kriptorkismus intraabdominal) atau gubernakulum masih tumbuh
tapi tidak optimal sampai di dasar sekrotum menyebabkan testis tidak bisa turun optimal sampai
di dasar skrotum (kriptorkismus inguinal atau kriptorkismus presekrotal) hal ini karena pada saat

121

regresi gubernakulum pada fase penurunan testis traninguinal yang dipengaruhi hormon
testosteron tetap tidak bisa menyebabkan penurunan testis sampai dasar sekrotum karena
gubernakulum belum pernah turun sampai kantong sekrotum. Kita ketahui setelah bayi lahir
sampai usia 1 tahun 2/3nya akan terjadi penurunan testis spontan karena terjadi peningkatan
produksi hormon testosteron asal pertumbuhan gubernakulum sebelumnya sudah optimal sampai
di dasar sekrotum.
Pada penelitian ini ditemukan rerata kadar hormon INSL3 plasma pada anak yang
kriptorkismus lebih rendah secara bermakna dibadingkan dengan rerata kadar hormon INSL3
plasma pada anak yang normal, dengan asumsi peneliti kadar hormon INSL3 juga rendah pada
saat bayi dalam kandungan saat terjadi pertumbuhan gubernakulum dan gubernakulum tidak
tumbuh pada anak dengan kriptorkismus intraabdominal atau pertumbuhan gubernakulum tidak
optimal pada kriptorkismus inguinal dan kriptorkismus presekrotal. Rendahnya kadar hormon
INSL3 dipengaruhi oleh faktor genetik berupa adanya polimorfisme pada exon 1 dan exon 2 gen
insl3 yang ditemukan pada anak kriptorkismus dan dipengaruhi oleh faktor lingkungan berupa
tingginya kadar hormon estradiol yang menekan produksi hormon INSL3 dan produksi hormon
testosteron. Pada penelitian ini polimorfisme T60T ditemukan lebih banyak secara bermakna
pada anak kriptorkismus dibandingkan anak yang normal, meskipun polimorfisme T60T tidak
merubah asam amino treonin no 60 pada exon 1 gen insl3 tapi merubah basa dalam kodon asam
amino treonin maka polimorfisme T60T bisa merupakan marker baru kriptorkismus. Pada
penelitian ini rerata kadar hormon estradiol lebih tinggi secara bermakna pada anak
kriptorkismus dibandingkan dengan anak yang normal, hormon estradiol yang tinggi merupakan
faktor lingkungan yang menekan produksi hormon INSL3. Jadi adanya polimorfisme T60T yang
merupakan marker baru kriptorkismus dikombinasikan dengan kadar hormon estradiol plasma

122

yang tinggi akan menyebabkan produksi hormon INSL3 berkurang dan kadar hormon INSL3
plasma menjadi rendah. Kadar hormon INSL3 yang rendah mempengaruhi pertumbuhan
gubernakulum dan pertumbuhan gubernakulum tidak optimal sehingga testis tidak turun atau
turun tidak optimal. Pada penelitian ini ditemukan polimorfisme exon 12 gen lgr8 (E319E,
L331L) meskipun tidak merubah asam amino karena jumlahnya pada anak kriptorkismus lebih
banyak secara bermakna sehingga merupakan marker kriptorkismus. Pada penelitian ini juga
ditemukan polimorfisme exon 13 gen lgr8 (S337A, H345P, Q356P, S357S) ditemukan lebih
banyak secara bermakna pada anak kriptorkismus dibandingkan anak yang normal, polimorfisme
S357S merupakan marker kriptorkismus karena tidak merubah asam amino, tetapi polimorfisme
S337A, H345P, Q356P merupakan faktor risiko kriptorkismus karena asam aminonya berubah.
Polimorfisme exon 12 (E319E, L331L) exon 13 (S337A, H345P, Q356P,S357S) gen lgr8
mempengaruhi kepekaan atau terjadinya resistensi reseptor LGR8 terhadap hormon INSL3,
sehingga peran hormon INSL3 dalam merangsang pertumbuhan gubernakulum berkurang dan
testis tidak turun optimal. Produksi hormon INSL3 yang rendah diperberat lagi oleh adanya
resistensi hormon INSL3 akibat gangguan pada reseptor LGR8 (reseptor dari hormon INSL3) di
gubernakulum karena adanya polimorfisme

exon 12, exon 13 gen lgr8 pada anak yang

kriptorkismus. Sehingga kadar hormon INSL3 yang rendah disertai kemampuan yang kurang
dalam merangsang pertumbuhan gubernakulum menyebabkan gubernakulum tumbuh tidak
optimal dan terjadilah kriptorkismus dengan lokasi yang bervariasi ( intraabdominal, inguinal,
presekrotal).
Reseptor LGR8 merupakan reseptor dari hormon INSL3, reseptor LGR8 melekat pada
permukaan gubernakulum, hubungan antara hormon INSL3 dengan reseptor LGR8
menyebabkan terjadinya pertumbuhan gubernakulum dan adanya gangguan pada kadar hormon

123

INSL3 atau gangguan pada reseptor LGR8 menyebabkan pertumbuhan gubernakulum terganggu
atau pertumbuhan gubernakulum tidak optimal. Reseptor LGR8 dipengaruhi oleh gen lgr8,
adanya polimorfisme pada gen lgr8 akan mempengaruhi fungsi reseptor LGR8. Pada penelitian
ini dari 18 exon gen lgr8 diperiksa 3 exon yang predominan menimbulkan kelainan yaitu exon
8, exon 12 dan exon 13, exon 12 dan exon 13 karena berdekatan primer forward dan primer
reversenya sama yaitu primer forward (12-13F): ggatgatgataattgtgagg dan primer reverse (1213R) : ctgaaatgcatgctcctgtg dan ukuran basa yang teramplifikasi dari proses PCR adalah 439
pasang basa. Exon 13 gen lgr8 banyak ditemukan polimorfisme, dan polimorfisme yang terjadi
pada exon 13 merupakan faktor risiko atau marker kriptorkismus Polimorfisme pada exon 13
gen lgr8 menyebabkan resistensi reseptor LGR8 terhadap hormon INSL3, kalau produksi
hormon INSL3 normal reseistensi reseptor LGR8 akan mengakibatkan produksi hormon INSL3
meningkat karena ada rangsangan untuk memproduksi hormon INSL3 yang lebih banyak.
Adanya polimorfisme pada exon 13 gen lgr8 menyebabkan ikatan hormon INSL3 dengan
reseptor LGR8 terganggu dan pertumbuhan gubernakulum juga terganggu sehingga terjadi
hambatan dalam penurunan gubernakulum dan terjadilah kriptorkismus.
Pada penelitian ini polimorfisme paling banyak ditemukan pada exon 13 gen lgr8 dan ada
yang merubah susunan asam amino (S337A, Q356P) merubah susunan asam amino dari serin
menjadi alanin dan dari glutamin menjadi prolin merupakan faktor risiko baru kejadian
kriptorkismus pada anak laki-laki (hanya ditemukan pada anak yang kriptorkismus).
Polimorfisme exon 13 gen lgr8 (H345P) merubah susunan asam amino dari histidin menjadi
prolin tapi ditemukan juga pada anak yang sehat meskipun jumlahnya lebih sedikit secara
bermakna sehingga merupakan faktor risiko atau marker baru kejadian kriptorkismus pada anak
laki-laki. Polimorfisme exon 13 gen lgr8 (S357S) asam aminonya tetap tapi hanya ditemukan
pada anak laki-laki yang kriptorkismus merupakan marker baru kejadian kriptorkismus pada
anak laki-laki. Susunan asam amino yang disandi oleh exon 13 gen lgr8 adalah: Asn(335)Leu(336)-Ser(337)-Ser(338)-Asn(339)-Pro(340)-Leu(341)-Met(342)-Tyr(343)-Leu(344)-

124

His(345)-Lys(346)-Asn(347)-Gln(348)-Phe(349)-Glu(250)-Ser(351)-Leu(352)-Lys(353)Gln(354)-Leu(355)-Gln(356)-Ser(357)-Leu(358). Pada exon 12 gen lgr8 ditemukan 2


polimorfisme (E319E, L331L) asam aminonya tetap glutamate dan leusin merupakan marker
kejadian kriptorkismus pada anak laki-laki. Susunan asam amino yang disandi oleh exon 12 gen
lgr8 adalah:

Asp(311)-Leu(312)-Ser(313)-Ser(314)-Asn(315)-Thr(316)-Met(317)-Thr(318)-

Glu(319)-Leu(320)-Ser(321)-Pro(322)-His(323)-Leu(324)-Phe(325)-Lys(326)-Asp(327)Leu(328)-Lys(329)-Leu(330)-Leu(331)-Gln(332)-Lys(333)-Leu(334). Polimorfisme exon 1 gen


insl3 (T60T) asam aminonya tetap treonin. Exon 1 gen insl3 menyandi susunan asam amino
hormon INSL3 berupa:

Met(1)-Asp(2)-Pro(3)Arg(4)-Leu(5)-Pro(6)-Ala(7)-Trp(8)-Ala(9)-

Leu(10)- Val(11)-Leu(12)-Leu(13)-Gly(14)-Pro(15)-Ala(16)-Leu(17)-Val(18)-Phe(19)-Ala(20)Leu(21)-Glt(22)-pro(23)-Ala(24)-Pro(25)-

Thr(26)-Pro(27)-Glu(28)-Met(29)-Arg(30)-Glu(31)-

Lys(32)-Leu(33)-Cys(34)-Gly(35)-His(36)-His(37)-Phe(38)-Val(39)-Arg(40)-Ala(41)-Leu(42)Val(43)-Arg(44)-Val(45)-Cys(46)-Gly(47)-Gly(48)-Pro(49) Arg(50)-Trp(51)-Ser (52)-Thr(53)Glu(54)-Ala(55)-Arg(56)-Arg(57)-pro(58)-Ala(59)-Thr(60)-Gly(61)-Gly(62)-Asp(63).


Polimorfisme yang ditemukan pada penelitian ini menyandi asam amino yang sama, hanya
terjadi perubahan susunan nukleotida saja ( T60T), (E319E, L331L), (S357S) dan ada yang
menyandi asam amino berbeda (S337A, H345P, Q356P).
Kadar hormon INSL3 plasma yang rendah (< 0,42 ng/ml), kadar hormon estradiol plasma
yang tinggi ( >10,22 ng/ml), polimorfisme exon 13 gen lgr8 ( S337A, H345P, Q356P, S357S )
secara bersama-sama atau secara sendiri-sendiri berkaitan dengan meningkatnya risiko
kriptorkismus pada anak laki-laki (nilai-p total: < 0,001, nilai-p hormon INSL3 rendah < 0,001,
nilai-p hormon estradiol tinggi < 0,001, nilai-p polimorfisme exon13 gen lgr8 : 0,005). Dengan
analisis regresi linier ditemukan 54,8 % kriptorkismus pada anak laki-laki dipengruhi oleh kadar
hormon INSL3 plasma yang rendah, kadar hormon estradiol plasma yang tinggi dan adanya
polimorfisme exon 13 gen lgr8 secara bersama-sama dan sisanya oleh sebab-sebab lain
(R= 0, 740., RSquare = 0, 548., Adjusted R square : 0, 524 ).

125

6.6. Kebaharuan Penelitian ( Novelty )


1. Faktor risiko kriptorkismus adalah:
a. Polimorfisme S337A exon 13 gen lgr8
b. Polimorfisme H345P exon 13 gen lgr8
c. Polimorfisme Q356P exon 13 gen lgr8
d. Kadar hormon INSL3 plasma yang rendah < 0,42 ng/ml
e. Kadar hormon estradiol plasma yang tinggi > 10,22 ng/ml
2. Marker kriptorkismus adalah:
a. Polimorfisme T60T exon 1 gen insl3
b. Polimorfisme E319E exon 12 gen lgr8
c. Polimorfisme L331L exon 12 gen lgr8
d. Polimorfisme S357S exon 13 lgr8
3. Polimorfisme baru anak kriptorkismus adalah:
a. Polimorfisme T60T exon 1 gen insl3
b. Polimorfisme S337A exon 13 gen lgr8
c. Polimorfisme H345P exon 13 gen lgr8
d. Polimorfisme Q356P exon 13 gen lgr8
e. Polimorfisme S357S exon 13 gen lgr8

126

6.7.Keterbatasan Penelitian
Keterbatasan penelitian ini adalah tidak semua exon gen lgr8 diperiksa, dari 18 exon
hanya exon yang predominan memiliki kelainan saja yang diperiksa yaitu exon 8, exon 12 dan
exon 13. Tidak diperiksanya kadar hormon testosteron plasma untuk mengurangi kelemahan ini
dilakukan kriteria eksklusi pada kelainan klinis karena rendahnya hormon testosteron
(mikropenis, hipospadia, adanya kordae). Dari beberapa gen yang mempengaruhi kriptorkismus
yang diperiksa hanya gen yang berhubungan dengan pertumbuhan gubernakulum yaitu gen insl3
dan gen lgr8. Adanya keterbatasan dengan studi kasus kontrol berupa tidak dapat memberikan
angka insiden, tidak dapat dipakai menentukan lebih dari satu variabel tergantung.

127

BAB VII SIMPULAN DAN SARAN


7.1. Simpulan
Dari hasil-hasil yang ditemukan dari penelitian ini dan pembahasannya diajukan simpulan
sebagai berikut:
1. Frekuensi polimorfisme exon 1 gen insl3 pada anak laki-laki yang kriptorkismus
adalah (A9A= 19,36%; T60T= 51,61%; T60A= 25,81%), exon 2 adalah
9,68%).

(E146E=

Frekuensi polimorfisme exon 8 gen lgr8 pada anak laki-laki yang

kriptorkismus adalah (kdn stp223M= 3,23%), exon 12 adalah (E319E= 100%;


L331L= 48,39%), exon 13 adalah (S337A= 54,84%; P340P= 41,94%; H345P=
61,29%; K346K= 90,32%; Q354K= 16,13%; Q356P= 29,03%; S357S= 48,39%).
2. Polimorfisme exon 1 gen insl3 (T60T) berkaitan dengan marker baru kriptorkismus
pada anak laki-laki.
3. Polimorfisme

exon 12 gen lgr8 (E319E, L331L) berkaitan dengan marker

kriptorkismus pada anak laki-laki. Polimorfisme exon 13 (S357S) berkaitan dengan


marker baru kriptorkismus pada anak laki-laki. Polimorfisme

exon 13 (S337A,

Q356P) berkaitan dengan meningkatnya risiko kriptorkismus pada anak laki-laki.


Polimorfisme exon 13 (H345P) berkaitan dengan meningkatnya risiko atau marker
baru kriptorkismus pada anak laki-laki.
4. Kadar hormon INSL3 plasma yang rendah dengan nilai batas optimum <0,42 ng/ml
berkaitan dengan meningkatnya risiko kriptorkismus pada anak laki-laki.
5. Kadar hormon estradiol plasma yang tinggi dengan nilai batas optimum > 10,22
ng/ml berkaitan dengan meningkatnya risiko kriptorkismus pada anak laki-laki.

127

128

7.2. Saran
Dari hasil-hasil penelitian ini dapat diajukan beberapa saran, sebagai berikut:
1. Pada anak laki-laki yang mengalami kriptorkismus bisa ditentukan langkah terapi dan
prognosis selanjutnya (bila kadar hormon INSL3 normal dan tidak ada polimorfisme
gen Insl3 dan gen Lgr8 untuk menurunkan testis bisa terapi dengan hormon hCG dan
bila ada polimorfisme pada gen insl3 dan gen lgr8 bisa langsung terapi pembedahan
berupa orkidektomi, prognosis kurang baik bila kadar hormon INSL3 rendah (< 0,42
ng/ml). Untuk mendapatkan pemeriksaan yang lebih efisien bisa dengan melakukan
PCR

pada salah satu: S337A, H345P, Q356P exon 13 gen lgr8 dengan enzim

restriksi.
2. Perlu penelitian lebih lanjut kemungkinan penggunaan hormon Insl3 sintetik dan obat
yang mempengaruhi kepekaan reseptor LGR8 terhadap hormon INSL3 pada anak
kriptorkismus.

129

DAFTAR PUSTAKA
Acerini,C.L., Miles,H.L., Dunger,D.B., Ong,K.K., Hughes,I.A. 2009. Abstract: The descriptipe
epidemiology of congenital and acquired cryptorchidism in a UK infant cohort. Arch Dis
Child, jun 18. (Epub ahead of print) PubMed PMID: 19542061.
Achermann,J.C. 2005. Development of the reproductive systems. in: Brook,C.G.D.,
Clayton,P.E., Brown,R.S., editors. Clinical Pediatric Endocrinology. 5th . Ed. London:
Blackwell. p. 153-170.
Amann,R.P., Veeramachaneni,D.N.R. 2007. Review: Cryptorchidism in common eutherian
mammals. Society for Reproduction and Fertility, 133: 541-561.
Amory,J.K., Page,S.T., Anawalt,B.D., Coviello,A.D., Matsumoto,A.M., Bremner,W.J. 2007.
Elevated End-of-treatment serum INSL3 is associated with failure to completely suppress
spermatogenesis in men receiving male hormonal contraception. Journal of Andrology,
28(4): 548-554.
Anand-Ivell,R.J.K., Relan, V., Balvers,M., Coiffec-Dorval, I., Fritsch, M., Bathgate, R.A.D.,
Ivell, R. 2006. Expression of the Insulin-Like Peptide 3 ( INSL3) Hormone-Receptor
(LGR8 ) system in the Testis. Biology of Reproduction, 74: 945 953.
Anonim. 2008. Immulite 1000 estradiol. Pilke 2-14.
Anonim. 2010. Teknik ELISA untuk Asai hormon. Denpasar: Prodia.
Arya. 2007. Kuliah Biomolekuler. Denpasar: S3 Ilmu Kedokteran FK UNUD.
Astawa, N.M. 2010. Kuliah mata kuliah penunjang disertasi ( MKPD ), pemeriksaan hormon
dengan teknik Elisa dan praktek. Denpasar: S3 Ilmu Kedokteran FK UNUD.
Bajpai,A., Menon,P.S.N. 2008. Undescended Testis. in: Desai,M.P., Menon,P.s.N., Bhatia,V.,
editors. Pediatric Endocrine Disorders. 2nd. Ed. India: Orient Longman Private, p.432-441.
Bogatcheva,N.V., Truong,A., Feng,S., Engel,W., Adham,I.M & Agoulnik, A.I. 2003. Great /
LGR8 is the only Receptor Insulin-like peptide. Molecular Endocrinoilogy,17(12): 26392646
Bott,R.C., BVSc,E.K.G. 2006. Descent of scrotal testis and temperature regulation. BS 640 Fall.
Canto,P., Escudero,I., Soderlund,D., Nishimura,E., Carranza,S., Lira., Gutierrez,J., Nova, A.,
Mendez, J. P. 2003. Original article: A novel mutation of the insulin-like 3 gene in patients
with cryptorchidism. J Hum Genet, 48:86-90

129

130

Cederroth,C.R., Schood,O., Descombes,P., Chambon,P., Vassalli,J.P., Nef,S. 2007. Estrogen


Receptor alfa Is a Major Contributor to Estrogen-mediated Fetal Testis Dysgenesis and
Cryptorchidism. Endocrinology, 148(11): 5507-5519.
Cervantes,L.F., Altman,N.R., Medina,L.S. 2006. Pituitary aplasia. Radiology, 241(3), December:
936-938.
Delbes,G., Levacher,C., Duquene,C., Racine,C., Pakarinen,P and Habert,R. 2005. Endogenous
Estrogens inhibit Mouse Fetal Leydig cell development via Estrogen Receptor .
Endocrinology, 146(5): 2454-2461.
Delbes, G., Levacher,C and Habert,R. 2006. Review: Estrogen effects on fetal and neonatal
testicular development. Society for Reproduction and Fertility, 132: 527-538.
Departemen of Health & Human Services. 2010. Homo sapiens insulin-like 3 ( Leydig cell )
(INSL3) on chromosome 19, available at: http//www.ncbi.nlm.nih.gov/nuccore
/NG012092.1? ordinalpos=9&itooi eutrezsyst.
Emmen,J.M.A., Mc Luskey,A., Adham,I.M., Engel,W., Grootegold,J.A., Brinkmann,a.O. 2000.
Hormonal control of Gubernaculum development during Testis descent: Gubernaculum
outgrowth invitro requires both insulin-like factor and Androgen. Endocrinology, 141(12):
4720-4727.
Estradiol 17-beta-dehydrogenase, (NCBI), Available at: http:www.NCBI.nlm.nih.gov/ protein/
AAB16941.1 (Access: 2010, May 17)
Ferlin,A., Simonoto,M., Bartoloni,L., Rizzo,G., Bettella,A., Dottorini,T., Dallapiccola, B.,
Foresta, C. 2003. The INSL3- LGR8/Great Ligand-Receptor Pair in Human
Cryptorchidism. The Jaurnal of Clinical Endocrinology & Metabolism, 88(9): 4273-4279.
Foresta,C., Zuccarello,D., Garolla,A., Ferlin,A. 2008. Role of Hormonal, Genes, and
Environment in Human Cryptorchidism. Endocrine Reviews by The Endocrine Society,
29(5): 560-580.
Galan,J.J., Guarducci,E., Nuti,F., Gonzalez,A., Ruiz,M., Ruiz,A., Krausz, C. 2007. Molecular
analysis of estrogen receptor alpha gene AGATA haplotype and SNP12 in European
Populations: Potential protective effect for cryptorchidism and lack of association with
male infertility. Human reproduction, 2 : 444-449.
Gallagher,M.P., Oberfield,S.E. 2004. Disorders of sexual differentiation. in: Pescovitz,O.H.,
Eugster,E.A. editors. Pediatric Endocrinology, Mechanisms, Manifestations, and
Management. Philadelphia: Lippincott Williams & Wilkins. p. 243-254.

131

Garlov,I.P., Kamat,A., Bogatcheva,N.V., Jones,E., Lamb,D.J., Truong,A., Bishop, C. E.,


McElreavey, K., Agoulnik, A. I. 2002. Mutation of the Great gene cause cryptorchidism.
Human Molecular Genetics, 11 (9): 2309-2318.
Gillam,M.P., Molitch,M.E., Lombardi,G., Calau,A. 2006. Advances in the Treatment of
Prolactinomas. Endocrine Reviews, 27(5) Agust: 485-534.
Hartwell,L.H., Hood,L., Goldberg,M.L., Reynolds,A.E., Silver,L.M., Veres,R.C. 2008. The
direct detection of genotype distinguishes individual genomes. in: Hartwell,L.H., Hood,L.,
Goldberg,M.L., Reynolds,A.E., Silver,L.M., Veres,R.C., editors. Genetics from Genes to
Genomes. 3rd. Ed. Boston Burr Ridge: Mc Graw Hill. p. 391- 436.
Hickey,G.I., Fletcher,H.L., Winter,P. 2007. Genetic Screening. in: Owen,E., Lyons,K.,editors.
Genetics. 3rd. Ed. Francis: Taylor. p. 321-324.
Homo sapiens insulin-like 3 (Leydig cell) (Insl3) on chromosome 19. 2010, Apr 20-last update,
(NCBI), Available at: http://www.ncbi.nlm.nih.gov/nuccore/NG_012092./?&from=
5000&to=9998&repart=genbank (Accessed: 2010, May 9).
Homo sapiens relaxin/insulin-like family peptide receptor 2 (RXFP2) on chromosome 13. 2010,
Mar 5-last update, (NCBI), Available at: http://www.ncbi.nlm.nih.gov/NG_015819./?&
from=5000&to=683308&repart=genbank (Accessed : 2010, May 9).
Honour,J.W., Savage,M.O. 2003. Endocrine Function of the Testis. in: Ranke,M.B., editor.
Diagnostics of Endocrine function in Children and Adolescents. 3rd. Ed. London: Karger.
p.339-355.
Hughes,I.A. 2009. Evaluation and Management of Disorders of Sex Development. in: Brook, C.,
Clayton, P., Brown, R., editors. Brook!s Clinical Pediatric Endocrinology. 6th. Ed.
Hongkong: Wiley-Blackwell. p. 192-212.
Hutson,J.M. 2007. Cryptorchidism and Hypospadias. Australia: Endotext.com.
Hutson,J.M., Sasaki,Y., Huynh,J., Yong,E., Ting,A. 2004. Suplement: The Gubernaculum in
Testicular descent and Cryptorchidism. The Turkish Journal of Pediatrics, 46: 3-6.
Insulin-like 3 precursor (homo sapiens). 2010, Apr 19-last update, (NCBI), Available at:
http://www.ncbi.nlm.nih.gov/protein/38327535 (Accessed: 2010, May 9).
Ivell,R and Bathgate,R.A.D. 2002. Minireview: Reproductive Biology of the Relaxin-like faktor
(RLF/INSL3). Biology of Reproduction, 67: 699-705.
Ivell,R., Hartung,S. 2003. The molecular basis of crypthorchidism. Molecular Human
Reproduction, 9 (4): 175-181.

132

Jing,R., knox,M.R., Lee,J.M., Vershinin,A.V., ambrose,M., Ellis,T.H.N., Flavell, A. J. 2005.


Insertional Polymorphism and antiquity of PDRI Retrotransposon Insertions in Pisum
Species. Genetics, 171: 741-752.
Jorde,L.B., Carey,J.C., Bamshad,M.J., White,R.L. 2006. Genetic Variation: Its Origin and
Detection. in: Jorde,L.B., Carey,J.C., Bamshad,M.J., White,R.L.editors. Medical Genetics.
3rd. Ed. U.S.A: Mosby. p.29-56.
Kaefer,M. 2004. Diagnosis and Treatment of the Undescended Testicle. in: Pescovitz,O.H.,
Eugster,E.A., editors. Pediatric Endocrinology, Mechanisms, Manifestations, and
Management. Philadelphia: Lippincott Williams & Wilkins. p. 255-274.
Kaleva, M., Toppari,J. 2003. Review: Genetics and hormones in testicular descent. Hormones,
2(4): 211-216.
Klonisch,T., Steger,K., Kehlen,A., Allen,W.R., Froehlich,C., Kauffold,J., Bergmann, M.,
Hombach-Klonisch, S. 2003. INSL3 Ligand-Receptor System in the Equine Testis. Biology
of Reproduction, 68: 1975-1981.
Kopp, P.A. 2009. Genetics and Genomics. in: Brook, C., Clayton, P., Brown, R., editors. Brook!s
Clinical Pediatric Endocrinology. 6th. Ed. Hongkong: Wiley-Blackwell. p. 1- 23.
Krausz,C., Murci,L.Q., Fellous,M., Siffroi, J.P., Mc Elreavey, K. 2000. Absense of mutations
involving the INSL-3 gene in human idiopathic cryptorchidism. Molecular Human
Reproduction, 6(4) : 298-302.
Kumagai,J., Hsu,S. Y., Matsumi,H. Roh,J,S., Fu,P., Wade,J.D., Bathgate, R. A. D., Hsueh, A. J.
W. 2002-a. INSL3/Leydig insulin-like peptide activates the LGR8 receptor important in
testis descent. JBC Papers in Press, p.1-13.
Kumagai,J., Hsu,S. Y., Matsumi,H., Roh,J,S., Fu,P., Wade,J.D., Bathgates, R. A. D., Hsuch, A.
J. W. 2002-b. INSL3/Leydig insulin-like peptide activates the LGR8 receptor important in
testis descent. The Journal of Biological Chemistry , 277(35): 31283- 31286.
Lim,H.L., Rajpert-De Meyts,E., Skakkebaek,N.E., Hawkins,J.R & Hughes,L.A. 2001. Clinical
study: Genetic analysis of the INSL3 gene in patients with maldecent of the testis.
European Journal of Endocrinology, 144: 129-137.
Main,K.M.,Toppari,J., Skakkebalk,N.E. 2006-a. Gonadal development and reproductive
hormones in infant boys. European Journal of Endocrinology, 155: 51-57.
Main,K.M., Toppari,J., Suomi,A.M., Kaleva,M., Chellakooty,M., Schnidt,I.M., Virtanen, H. E.,
Boisen, K. A., Kai, C. M., Damgaard, I. N., Skakkebaek, N. E. 2006-b. Large Testes and
Higher Inhibin B levels in Finnish than in Danies Newborn boys. The Journal of Clinical
Endocrinology & Metabolism, 91(7): 2732-2737.

133

McGlynn, K.A., Graubard,B.I., Nam,J.M., Stanczyk,Z., Longuecker,M.P., Klebanoff,M.A. 2005.


Maternal Hormone Levels and Risk of Cryptorchism among Populations at high and low
Risk of Testicular germ cell Tumors. Cancer Epidemiology, Biomarkkers & Prevention,
14(7) July : 1732-1737.
Microsatellite. 2010, May 6-last update, (WIKIPEDIA), Available at : http://en.Wipedia.org/
Wiki/microsatelit (Accessed: 2010, May 17)
Minisatellite. 2010, May 2-last update, (WIKIPEDIA), Available at: http://en.Wikipedia.org/
Wiki/minisatellite (Accessed: 2010,May 17)
Indel. 2010, May 16-last update, (WIKIPEDIA), Available at: http://en.Wikipedia.org/
Wiki/Indel (Accessed: 2010 May 17)
Moldenhauer,J.S., Ostermeier,G.C., Johuson,A., Diamond,M.P., Krawetz,S.A. 2003. Review:
Diagnosing male factor infertility using microarrays. Journal of Andrology, 24 (6)
Nopember/Desember : 783-789.
Moretti, E., Cairano,G, D., Copitani, S., Scapigliati, G., Baccetti, B., Collodel, G. 2007.
Cryptorchidism and Semen Quality: A tem and molecular Study. Journal of Andrology,
28(1) January/February: 194-199.
Muller,J. 2003. Gonadotropins, Gonadotropin-Releasing Hormone Tests, and the Ovary. in:
Ranke,M.B., editor. Diagnostics of Endocrine function in Children and Adolescents. 3rd.
Ed. Copenhagen: Karger. p. 356-371.
Nuti,F., Marinari,E., Erdei,E., El-hamshari,M., Echavarria,M.G., Ars,E., Balercia, G., Merksz,
M., Giachini, C., Shaeer, K. Z. M., Forti, G., Ruiz-Castane, E., Krausz, C. 2007. The
Leucine-Rich Repeat-Containing G Protein-coupled Receptor 8 Gene T222P mutation
does not couse Cryptorchidism. J Clin endocrinol Metab, 93(3): 1072-1076.
Nuver,J., Smit,A.J., Wolffenbuttel,B.H.R., Shuiter,W.J., Hoekstra,H.J., Sleijfer,D.T. 2005. The
Metabolic Syndrome and Disturbances in Hormone levels in Long-Term Survivors of
Disseminated Testicular Cancer. Journal of Clinical Oncology, 23: 3718-3725.
Pentikainen,V., Dunkel, L., Erkkila, K. 2003. Male Germ Cell Apoptosis. in: Soder,O., editor.
The Developing Testis Physiology and Pathophysiology. vol 5. London: Karger. p. 56-80.
Pettersson,A., Richiardi,L., Nordenskjold,A., Kaijser,M., Arke,O. 2007. Age at Surgery for
Undescended Testis and risk of Testicular Cancer. The New England Journal of Medicine,
356: 1835-1841.
Phoenix Pharmaceuticals. 2010, Protocol for catalog # EK-035-27 INSL3 (human ) EIA Kit
(range: 0 100ng/ml), Available at: http://prodia.co.id/webapps/webmail/src/read_body.
php?mailbox=INBOX&passed_id=1 (Accessed : 2010, February 10).

134

Raivio,T., Wikstrom,A.M., Dunkel, L. 2007. Treatment of Gonadotropin deficient boy with


Recombinant human FSH: Lonh-term observation and Out come. European Journal of
Endokrinology, 156: 105-111.
Relaxin receptor 2 isoform1 (homo sapiens). 2010, Mar 4-last update, (NCBI), Available at:
http://www.ncbi.nlm.nih.gov/protein/18677729 (Accessed : 2010, May 9).
Setianingsih, I. 2010. Kuliah deteksi polimorfisme gen Insl3 dan gen LGR8. Jakarta: Lembaga
Biologi Molekuler Eijkman.
Sijstermans,K., Hack,W.W., Meijer,R.W., Van der Voort-Doedens,L.M. 2008. Abstract: The
frequency of undescended testis from birth to adulthood: a review. Int J Androl, 31(1):
1-11.
Single-nucleotide polymorphism: Variation on a theme. 2007, Sep 20-last update, (NCBI),
Available at: http://www.ncbi.nlm.nih.gov/about/primer/Snps.html (Accessed: 2010, May
13)
Single-nucleotide polymorphism: (Wikipedia), Available at: http://en.Wikipedia.org/ Singlenucleotide polymorphism #use_and_infortan_of_Snps (Accessed : 2010, May 13)
Styne,D.M. 2002. The Testes, Disorders of Sexual Differentiation and Puberty in the Male. in:
Sperling,M.A., editor. Pediatric Endocrinology. 2nd. Ed. U.S.A: Saunders. p. 565-628.
Suomi,A.M., Main,K.M., Kaleva,M., Schmidt,I.M., Chellakooty,M., Virtanen,H.E., Boisen, K.
A., Damgaard, I.N., Kai, C. M., Skakkebaek, N. E., Toppari, J. 2006. Hormonal changes in
3-month-old Cryptorchid Boys. The Journal of Clinical Endocrinology & Metabolism,
91(3): 953-958.
The Endocrine Society. 2005. Editorial: Cryptorchidism- An Estrogen Spoil. The Journal of
Clinical Endocrinology & Metabolism, 90(8) : 4975-4977.
Thonneau,P.F., Caudia,P., Mieusset,R. 2003. Review: Cryptorchidism Incidence, Risk Factors,
and potential role of environment an update. Journal of Andrology, 24(2): p.155-162.
Toppari,J. 2009. Management of Cryptorchidism. in: Meet the Expert Sessions Handout.
LWPES/ESPE 8th joint meeting, September 9-12, 2009. New York.
Toppari,J.2003. Physiology and Disorders of Testicular Descent. in: Soder,O., editor. The
Developing Testis Physiology and Pathophysiology, vol 5. London: Karger. p. 104-109.
Toppari,J., Kaleva, M and Virtamen, H.E. 2001. Trends in the incidence of cryptorchidism and
hypospadias and methodological limitations of registry-based date. Human Reproduction
Update, 7(3): 282-286

135

Vinci,G., Anjot,M.N., Trivin,C., Lottmann,H; Branner,R and McElrlaves,K. 2004. An Analysis


of the Genetic factors Involved in testicular Descent in a Cohort of 14 male Patients with
Anorchia. The Journal of Clinical Endocrinology & Metabolism, 89(12): 6282- 6285.
Virtanen, H.E., Toppari, J. 2008. Epidemiology and pathogenesis of cryptorchidism. Human
Reproduction Update, 14 (1): 49-58
Wales,J.K.H., Wit,J.M., Rogol,A.D. 2003. Pediatric Endocrinology and Growth. 2nd. Ed.
Edinburgh: Saunders. p.173-174.
Watanabe,M., Yoshida,R., Ueoka,K., Aoki,K., Sosagama,I., Hasegawan,T., Sueoka, K.,
Kamatani, N., Yoshimura, Y., Ogata, T. 2007. Haplotype analysis of the estrogen receptor
1 gene in male genital and reproductive abnormalities. Human Reproduction. 22(5) :
1279-1284.
Wohlfahrt-Veje,C., Boisen,K.A., Boas,M., damgaard,I.N., Kai,C.M., Schmidt,I.M., Chellakooty,
M., Suomi, A. M., Toppari, J., Skakkebaek, N. E., Main, K.M . 2009. Abstract: Acquired
cryptorchidism is frequent in infancy and childhood. Int J Androl, Jan 6. (Epub ahead of
print) PubMed PMID: 19515170.
Yuwono,T. 2005. Organisasi Genom. in: Safitri,A., editor. Biologi Molekuler. Jakarta: Erlangga.
hal. 75-92.

ANALISIS STATISTIK

Exon 1 gen insl3


Ca se P rocessing Sum ma ry

Ex on-1 A9A * Sam pel


Ex on-1 T60T * Sam pel
Ex on-1 T60A * Sam pel

Valid
N
Percent
62
100,0%
62
100,0%
62
100,0%

Cases
Mi ssing
Percent
0
,0%
0
,0%
0
,0%

Total
N
62
62
62

Percent
100,0%
100,0%
100,0%

Exon-1 A9A * Sampel


Cr osstab
Count

Ex on-1
A9A

A9A
Normal

Total

Sampel
Kasus
Kontrol
6
2
25
29
31
31

Total
8
54
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As soci ation
N of Valid Cases

Value
2,296 b
1,292
2,390

1
1
1

As ymp. Sig.
(2-sided)
,130
,256
,122

,133

df

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,255
2,259
62

a. Computed only for a 2x2 table


b. 2 cells (50,0%) have expected count less than 5. The mi nimum expected count is
4,00.

Risk Estimate

Value
Odds Ratio for Exon-1
A9A (A9A / Norm al)
For cohort Sam pel =
Kasus
For cohort Sam pel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

3,480

,644

18,810

1,620

,990

2,651

,466

,137

1,586

62

Exon-1 T60T * Sampel


Crosstab
Count

Ex on-1
T60T
Total

T60T
Normal

Sampel
Kontrol
Kasus
16
5
15
26
31
31

Total
21
41
62

,128

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As soci ation
N of Valid Cases

Value
8,713b
7,201
9,047

1
1
1

As ymp. Sig.
(2-sided)
,003
,007
,003

,003

df

Exact Sig.
(1-sided)

Exact Sig.
(2-sided)

,007
8,573
62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The m inim um expected count is
10,50.

Risk Estimate
95% Confidence
Interval
Lower
Upper

Value
Odds Ratio for Exon-1
T60T (T60T / Normal)
For cohort Sam pel =
Kasus
For cohort Sam pel =
Kontrol
N of Valid Cases

5,547

1,690

18,203

2,083

1,303

3,327

,375

,169

,835

62

Exon-1 T60A * Sampel


Crosstab
Count

Ex on-1
T60A

T60A
Normal

Total

Sampel
Kasus
Kontrol
8
15
23
16
31
31

Total
23
39
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
3,387b
2,488
3,428

df
1
1
1

3,332

As ymp. Sig.
(2-sided)
,066
,115
,064

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,114

,057

,068

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The m inim um expected count is
11,50.

Risk Estimate

Value
Odds Ratio for Exon-1
T60A (T60A / Normal)
For cohort Sam pel =
Kasus
For cohort Sam pel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

,371

,127

1,081

,590

,318

1,094

1,590

,983

2,570

62

,003

Exon 12 gen lgr8


Ca se P rocessing Sum ma ry

E12_N315N * S ampel
E12_E 319E * S ampel
E12_L331L * S ampel

Cases
Missing
Percent
N
0
,0%
0
,0%
0
,0%

Valid
N
Percent
62
100,0%
62
100,0%
62
100,0%

Total
N
62
62
62

Percent
100,0%
100,0%
100,0%

E12_N315N * Sampel
Crosstab
Count

E12_
N315N

N315N
Normal

Total

Sampel
Kontrol
Kasus
0
2
31
29
31
31

Total
2
60
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

1
1
1

As ymp. Sig.
(2-sided)
,151
,472
,092

,154

df

Value
2,067b
,517
2,839

2,033

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,492

,246

62

a. Computed only for a 2x2 table


b. 2 cells (50,0%) have expected count less than 5. The minimum expected count is
1,00.
Ri sk Estim ate

Value
For cohort
Sampel = Kas us
N of V alid Cas es

95% Confidenc e
Int erval
Lower
Upper

2,069

1,593

2,688

62

E12_E319E * Sampel
Crosstab
Count

E12_
E319E
Total

E319E
Normal

Sampel
Kasus
Kontrol
31
23
0
8
31
31

Total
54
8
62

Chi-Square Tests
Value
9,185b
7,032
12,280

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

df
1
1
1

9,037

As ymp. Sig.
(2-sided)
,002
,008
,000

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,005

,002

,003

62

a. Computed only for a 2x2 table


b. 2 cells (50,0%) have expected count less than 5. The minimum expected count is
4,00.

Ri sk Estim ate
95% Confidenc e
Int erval
Lower
Upper

Value
For cohort
Sampel = Kontrol
N of Valid Cas es

,426

,313

,581

62

E12_L331L * Sampel
Crosstab
Count

E12_
L331L

L331L
Normal

Total

Sampel
Kasus
Kontrol
15
6
16
25
31
31

Total
21
41
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
5,833b
4,609
5,977

5,739

1
1
1

As ymp. Sig.
(2-sided)
,016
,032
,014

,017

df

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,031

,015

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The m inim um expected count is
10,50.

Risk Estimate

Value
Odds Ratio for E12_
L331L (L331L / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

3,906

1,255

12,163

1,830

1,146

2,924

,469

,228

,962

62

Exon 13 gen lgr8


Ca se P rocessi ng S um mary

Ex on-13
Ex on-13
Ex on-13
Ex on-13
Ex on-13
Ex on-13
Ex on-13

S 337A
P 340P
H345P
K 346K
Q354K
Q356P
S 357S

Cases
Missing
Percent
N
0
,0%
,0%
0
,0%
0
,0%
0
0
,0%
,0%
0
,0%
0

Valid
Percent
N
100,0%
62
100,0%
62
100,0%
62
100,0%
62
100,0%
62
100,0%
62
100,0%
62

* S ampel
* S ampel
* S ampel
* S ampel
* S ampel
* S ampel
* S ampel

Total
N
62
62
62
62
62
62
62

Exon-13 S337A * Sampel


Crosstab
Count

Ex on-13
S337A

S337A
Normal

Total

Sampel
Kasus
Kontrol
17
0
14
31
31
31

Total
17
45
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

df

Value
23,422 b
20,748
30,151

1
1
1

23,044

As ymp. Sig.
(2-sided)
,000
,000
,000

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,000

,000

,000

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The m inim um expected count is
8,50.

Ri sk Estim ate

Value
For cohort
Sampel = Kas us
N of V alid Cas es

3,214

95% Confidenc e
Int erval
Lower
Upper
2,081

4,965

62

Exon-13 P340P * Sampel


Crosstab
Count

Ex on-13
P340P
Total

P340P
Normal

Sampel
Kasus
Kontrol
13
8
18
23
31
31

Total
21
41
62

Percent
100,0%
100,0%
100,0%
100,0%
100,0%
100,0%
100,0%

Chi-Square Tests
Value
1,800b
1,152
1,813

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

As ymp. Sig.
(2-sided)
,180
,283
,178

df
1
1
1

1,771

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,283

,142

,183

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The minimum expected count is
10,50.
Risk Estimate
95% Confidence
Interval
Lower
Upper

Value
Odds Ratio for Exon-13
P340P (P340P / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

2,076

,709

6,085

1,410

,871

2,283

,679

,369

1,248

62

Exon-13 H345P * Sampel


Crosstab
Count

Ex on-13
H345P

Sampel
Kasus
Kontrol
19
9
12
22
31
31

H345P
Normal

Total

Total
28
34
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
6,513b
5,275
6,637

df
1
1
1

6,408

As ymp. Sig.
(2-sided)
,011
,022
,010

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,021

,010

,011

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The minimum expected count is
14,00.

Risk Estimate

Value
Odds Ratio for Exon-13
H345P (H345P / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

3,870

1,341

11,172

1,923

1,141

3,239

,497

,275

,899

62

Exon-13 K346K * Sampel


Crosstab
Count

Ex on-13
K346K

Sampel
Kasus
Kontrol
28
21
3
10
31
31

K346K
Normal

Total

Total
49
13
62

Chi-Square Tests
Value
4,769b
3,504
4,980

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As soci ation
N of Valid Cases

1
1
1

As ymp. Sig.
(2-sided)
,029
,061
,026

,030

df

4,692

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,059

,029

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The m inim um expected count is
6,50.
Risk Estimate
95% Confidence
Interval
Lower
Upper

Value
Odds Ratio for Exon-13
K346K (K346K / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

4,444

1,086

18,183

2,476

,891

6,878

,557

,359

,865

62

Exon-13 Q354K * Sampel


Crosstab
Count

Ex on-13
Q354K

Sampel
Kasus
Kontrol
5
0
26
31
31
31

Q354K
Normal

Total

Total
5
57
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
5,439b
3,481
7,371

1
1
1

As ymp. Sig.
(2-sided)
,020
,062
,007

,021

df

5,351

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,053

,026

62

a. Computed only for a 2x2 table


b. 2 cells (50,0%) have expected count less than 5. The minimum expected count is
2,50.

Ri sk Estim ate

Value
For cohort
Sampel = Kas us
N of V alid Cas es

2,192
62

95% Confidenc e
Int erval
Lower
Upper
1,651

2,911

Exon-13 Q356P * Sampel


Crosstab
Count

Ex on-13
Q356P

Sampel
Kasus
Kontrol
9
0
22
31
31
31

Q356P
Normal

Total

Total
9
53
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As soci ation
N of Valid Cases

1
1
1

As ymp. Sig.
(2-sided)
,001
,004
,000

,001

df

Value
10,528 b
8,319
14,012

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,002
10,358

,001

62

a. Computed only for a 2x2 table


b. 2 cells (50,0%) have expected count less than 5. The mi nimum expected count is
4,50.

Ri sk Estim ate
95% Confidenc e
Int erval
Lower
Upper

Value
For cohort
Sampel = Kas us
N of V alid Cas es

2,409

1,750

3,316

62

Exon-13 S357S * Sampel


Crosstab
Count

Exon-13
S357S

S357S
Normal

Total

Sampel
Kasus
Kontrol
15
0
16
31
31
31

Total
15
47
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
19,787 b
17,237
25,666

1
1
1

As ymp. Sig.
(2-sided)
,000
,000
,000

,000

df

19,468

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,000

,000

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The minimum expected count is
7,50.

Ri sk Estim ate

Value
For cohort
Sampel = Kas us
N of Valid Cas es

2,938
62

95% Confidenc e
Int erval
Lower
Upper
1,973

4,373

Kadar hormon INSL3 pada kasus dan kontrol

T-Test
Paired Samples Statistics
Mean
.3964
.9120

h_insl3_kasus
h_insl3_kontrol

Pair
1

Std. Deviation
.24379
.45683

31
31

Std. Error
Mean
.04379
.08205

Paired Samples Test


Paired Differences

Mean
Pair
1

h_insl3_kasus h_insl3_kontrol

-.51564

Std. Deviation

Std. Error
Mean

.56908

.10221

95% Confidence
Interval of the
Difference
Lower
Upper
-.72439

-.30690

df

-5.045

Sig. (2-tailed)
30

.000

Kadar hormon estradiol pada kasus dan kontrol

T-Test
Paired Samples Statistics

Pair
1

h_estradiol_kas us
h_estradiol_kontrol

Mean
17.0788
9.5456

N
31
31

Std. Deviation
16.05380
4.91833

Std. Error
Mean
2.88335
.88336

Paired Samples Test


Paired Differences

Mean
Pair
1

h_estradiol_kas us h_estradiol_kontrol

7.53325

Std. Deviation

Std. Error
Mean

17.36546

3.11893

95% Confidence
Interval of the
Difference
Lower
Upper

1.16355

2.415

13.90296

df

Sig. (2-tailed)
30

.022

Kadar Hormon INSL3 Plasma


ROC Curve
Case Processing Summary
Valid N
(lis twis e)
31
31

Sampel
Positivea
Negative

Larger values of the test result variable(s) indicate


stronger evidence for a positive actual state.
a. The positive actual s tate is Kasus .

ROC Curve
1.0

Sensitivity

0.8

0.6

0.4

0.2

0.0
0.0

0.2

0.4

0.6

0.8

1.0

1 - Specificity
Diagonal segments are produced by ties.

Area Unde r the Curve


Test Result Variable(s): Kadar Hormon INSL3 Plasma

Area
,138

Std. Error
,046

Asymptotic
b
Sig.
,000

Asymptotic 95% Confidence


Interval
Lower Bound Upper Bound
,048
,229

The test result variable(s): Kadar Hormon INSL3 Plasma has at least
one tie between the positive actual state group and the negative actual
state group. Statistics may be biased.
a. Under the nonparametric assumption
b. Null hypothesis: true area = 0.5

Coordinates of the Curve


Test Resul t Variable(s): Kadar Hormon INSL3 Plas ma
Positive if
Greater Than
a
or Equal To
-,899099600
,102586550
,110687100
,130656050
,152507250
,175046350
,189847300
,201751050
,235802250
,265840250
,277447150
,282594950
,296351350
,319246050
,351554000
,387488580
,401195530
,410578400
,421262300
,455496150
,494938800
,506584050
,516833350
,523770400
,530867700
,543528350
,574199000
,607942150
,622602850
,631211750
,672831450
,738645150
,835745750
,942012200
1,017144050
1,070465450
1,128543450
1,175157000
1,193082400
1,211164500
1,244081050
1,344682650
1,584973150
1,811390550
1,991949150
3,114116000

Sensiti vity
1,000
,968
,935
,903
,871
,806
,774
,742
,710
,677
,645
,613
,581
,548
,516
,484
,484
,452
,419
,387
,355
,355
,323
,290
,258
,194
,161
,129
,097
,065
,065
,065
,032
,032
,032
,032
,032
,032
,032
,032
,032
,000
,000
,000
,000
,000

1 - Specificity
1,000
1,000
1,000
1,000
1,000
1,000
1,000
1,000
1,000
1,000
,968
,968
,968
,968
,968
,968
,935
,935
,903
,903
,871
,839
,806
,806
,774
,742
,710
,677
,613
,581
,548
,516
,484
,452
,419
,387
,323
,290
,226
,194
,161
,129
,097
,065
,032
,000

The tes t res ult variable(s ): Kadar Horm on INSL3 Plasm a


has at leas t one tie between the positive actual state group
and the negative actual s tate group.
a. The sm allest cutoff value is the m inim um
observed test value minus 1, and the largest cutoff
value is the maximum observed test value plus 1.
All the other cutoff values are the averages of two
consecutive ordered obs erved test values .

Kadar Hormon Estradiol Plasma


ROC Curve
Case Processing Summary
Sampel
Positivea
Negative

Valid N
(lis twis e)
31
31

Larger values of the test result variable(s) indicate


stronger evidence for a positive actual state.
a. The positive actual s tate is Kasus .

ROC Curve
1.0

Sensitivity

0.8

0.6

0.4

0.2

0.0
0.0

0.2

0.4

0.6

0.8

1.0

1 - Specificity
Diagonal segments are produced by ties.

Area Unde r the Curve


Test Result Variable(s): Kadar Hormon E stradiol Plas ma

Area
,765

St d. E rror
,061

As ymptotic
b
Sig.
,000

As ymptotic 95% Confidenc e


Int erval
Lower Bound Upper Bound
,885
,645

The tes t result variable(s): K adar Hormon Es tradiol P lasma has at least
one tie bet ween the pos itive act ual s tate group and the negat ive actual
state group. St atist ics may be biased.
a. Under the nonparametric as sumption
b. Null hy pothesis : true area = 0.5

Coordinate s of the Curve


Te st R esul t Var iable (s): Kad ar Ho rmo n Es trad iol Plasm a
Po sitive if
Gr eate r Tha n
a
or Equ al To
-,9 9988 750 0
,00 011 7450
,00 013 5950
3,5 460 9535 0
7,1 089 3435 0
7,1 769 0595 0
7,2 451 4425 0
7,2 709 0925 0
7,5 364 9735 0
7,8 117 4235 0
7,8 391 6195 0
7,8 574 9475 0
7,8 758 6305 0
8,0 156 3925 0
8,2 615 1370 0
8,4 151 2265 0
8,4 729 7495 0
8,5 121 1910 0
8,5 514 1325 0
8,7 823 8465 0
9,0 127 3820 0
9,1 794 7235 0
9,3 538 1985 0
9,3 962 9795 0
9,5 742 7255 0
9,8 919 9410 0
10 ,104 0865 00
10 ,217 7120 00
10 ,286 2700 00
10 ,484 3620 00
10 ,754 3775 00
10 ,977 8655 00
11 ,197 3585 00
11 ,314 0635 00
11 ,451 8290 00
12 ,118 2730 00
12 ,711 6670 00
12 ,780 4010 00
13 ,003 3655 00
13 ,199 1655 00
13 ,241 6940 00
13 ,471 6085 00
13 ,716 9960 00
13 ,968 6345 00
14 ,404 9035 00
14 ,648 8355 00
14 ,820 3145 00
14 ,992 0990 00
15 ,477 1375 00
16 ,029 7890 00
16 ,541 1690 00
17 ,864 2525 00
19 ,266 0015 00
20 ,240 1385 00
22 ,039 7370 00
23 ,721 0060 00
29 ,524 5395 00
36 ,080 2565 00
66 ,213 1595 00
96 ,244 7480 00

Se nsiti vity
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
1,0 00
,96 8
,90 3
,87 1
,87 1
,87 1
,83 9
,83 9
,83 9
,83 9
,83 9
,83 9
,83 9
,80 6
,80 6
,80 6
,77 4
,74 2
,74 2
,71 0
,67 7
,64 5
,64 5
,61 3
,58 1
,54 8
,48 4
,45 2
,41 9
,38 7
,35 5
,35 5
,32 3
,32 3
,29 0
,25 8
,25 8
,25 8
,22 6
,19 4
,19 4
,16 1
,12 9
,12 9
,09 7
,06 5
,03 2
,00 0

1 - Spe cificity
1,0 00
,96 8
,93 5
,90 3
,87 1
,83 9
,80 6
,77 4
,74 2
,71 0
,67 7
,64 5
,61 3
,61 3
,61 3
,61 3
,58 1
,54 8
,54 8
,51 6
,48 4
,45 2
,41 9
,38 7
,35 5
,35 5
,32 3
,29 0
,29 0
,29 0
,25 8
,25 8
,25 8
,25 8
,22 6
,22 6
,22 6
,22 6
,22 6
,22 6
,19 4
,19 4
,19 4
,16 1
,16 1
,12 9
,12 9
,12 9
,09 7
,06 5
,06 5
,06 5
,03 2
,03 2
,03 2
,00 0
,00 0
,00 0
,00 0
,00 0

Th e tes t res ult varia ble(s ): Ka dar Horm on Estr adio l


Pla sm a ha s at leas t one tie b etw een the p ositive a ctua l
sta te g roup and the nega tive actu al state g rou p.
a. Th e sm alle st cu toff value is the m inim um
ob served te st va lue minu s 1 , and the larg est cutoff
va lue is the ma ximu m ob ser ved test value plu s 1.
All the othe r cutoff va lues are the aver ages of two
co nsecutive ord ered obs erve d te st va lues .

KADAR HORMON INSL3 PLASMA RENDAH < 0,42 ng/ml KURVA ROC, SENSITIVITAS: 41,9% dan
SPESIFITAS: 9,75

Crosstabs
Case Processing Summary
Cases
Mis sing
N
Percent

Valid
N
Kadar hormon INSL3
plasma * Sampel

Percent
62

100,0%

Total
Percent

,0%

62

Ka dar hormon INSL3 pla sma * S am pel Crossta bula tion


Count

Kadar hormon
INSL3 plas ma

Sampel
Kasus
Kontrol
18
3
13
28
31
31

Rendah
Normal

Total

Total
21
41
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

Value
16,202 b
14,114
17,505

1
1
1

As ymp. Sig.
(2-sided)
,000
,000
,000

,000

df

15,941

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,000

,000

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The minimum expected count is
10,50.

Risk Estimate

Value
Odds Ratio for Kadar
hormon INSL3 plas ma
(Rendah / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

12,923

3,225

51,781

2,703

1,669

4,377

,209

,072

,609

62

100,0%

KADAR HORMON ESTRADIOL PLASMA TINGGI >1 0,22 ng/ml KURVA ROC, SENSITIVITAS: 80,6% dan
SPESIFITAS: 71%

Crosstabs
Case Processing Summary
Cases
Mis sing
N
Percent

Valid
N
Kadar hormon Estradiol
plasma * Sampel

Percent
62

100,0%

Total
N

,0%

Percent
62

100,0%

Ka dar hormon Estradiol plasma * Sa mpel Crosstabulation


Count

Kadar hormon Estradiol


plasma

Sampel
Kasus
Kontrol
25
9
6
22
31
31

Tinggi
Normal

Total

Total
34
28
62

Chi-Square Tests

Pearson Chi-Square
Continuity Correction a
Likelihood Ratio
Fis her's Exact Test
Linear-by-Linear
As sociation
N of Valid Cases

1
1
1

As ymp. Sig.
(2-sided)
,000
,000
,000

,000

df

Value
16,672 b
14,653
17,555

16,403

Exact Sig.
(2-sided)

Exact Sig.
(1-sided)

,000

,000

62

a. Computed only for a 2x2 table


b. 0 cells (,0%) have expected count less than 5. The minimum expected count is
14,00.

Risk Estimate

Value
Odds Ratio for Kadar
hormon Es tradiol plasma
(Tinggi / Normal)
For cohort Sampel =
Kasus
For cohort Sampel =
Kontrol
N of Valid Cases

95% Confidence
Interval
Lower
Upper

10,185

3,126

33,188

3,431

1,641

7,173

,337

,186

,609

62

Regresi Hormon INSL3 Rendah, Hormon Estradiol Tinggi, Polimorfisme Exon13


b
Va riab les Entere d/Re mo ved

Model
1

Variables
Entered
Polimorfis
me ex on
13 gen
lgr8, K adar
hormon
es tradiol
plasm a,
Kadar
hormon
Ins l3
a
Pl asm a

Variables
Removed

Method

Enter

a. Al l reques ted variables ent ered.


b. Dependent Variabl e: s ampel

Model Summ ary


Model
1

R
,740a

R Square
,548

Adjust ed
R Square
,524

St d. E rror of
the Es timate
,348

a. Predic tors: (Constant), Polimorfisme ex on 13 gen lgr8,


Kadar hormon estradiol plasma, Kadar hormon Insl3
Plasma

ANOVA b
Model
1

Regression
Residual
Total

Sum of
Squares
8,490
7,010
15,500

df
3
58
61

Mean Square
2,830
,121

F
23,415

Sig.
,000a

a. Predictors: (Constant), Polimorfisme exon 13 gen lgr8, Kadar hormon estradiol


plasma, Kadar hormon Insl3 Plasma
b. Dependent Variable: sampel

Coefficients a

Model
1

(Constant)
Kadar hormon
Insl3 Plasma
Kadar hormon
estradiol plasma
Polimorfisme
exon 13 gen lgr8

Unstandardized
Coefficients
B
Std. Error
-,346
,230

a. Dependent Variable: sampel

Standardized
Coefficients
Beta

t
-1,506

Sig.
,138

,462

,094

,437

4,901

,000

,465

,089

,463

5,216

,000

,260

,089

,259

2,918

,005

DATA ANALISIS POLIMORFISME SECARA BERPASANGAN


1. Polimorfisme A9A exon 1 gen insl3
Paired observations, dichotomous variable [module A] (A9A)
DATA:
A yes, B yes: 1 pairs
A yes, B no: 5 pairs
A no, B yes: 1 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.109

0.219

Mid-P:

0.063

0.125

McNemar test:

0.051

0.102

with cont.corr.

0.110

0.221

Wald test, modif

0.033

0.065

Odds ratio (odds A : odds B) = 5.000


Fisher's confidence intervals:
90% confidence interval = 0.719 to 116.475
95% confidence interval = 0.559 to 236.488
99% confidence interval = 0.340 to 1196.498

2. Polimorfisme T60T exon 1 gen insl3


Paired observations, dichotomous variable [module A] (T60T)
DATA:
A yes, B yes: 5 pairs
A yes, B no: 11 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.000 [ 4.9E-0004 ]

0.001 [ 9.8E-0004 ]

Mid-P:

0.000 [ 2.4E-0004 ]

0.000 [ 4.9E-0004 ]

McNemar test:

0.000 [ 4.6E-0004 ] 0.001 [ 9.1E-0004 ]

with cont.corr. 0.001 [ 1.2E-0003 ]

0.003 [ 2.6E-0003 ]

Wald test, modif 0.000 [ 8.9E-0008 ] 0.000 [ 1.8E-0007 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 3.195 to infinity
95% confidence interval = 2.510 to infinity
99% confidence interval = 1.616 to infinity

3. Polimorfisme T60A exon 1 gen insl3


Paired observations, dichotomous variable [module A] (T60A)
DATA:
A yes, B yes: 5 pairs
A yes, B no: 3 pairs
A no, B yes: 10 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

Fisher's P:
Mid-P:

0.046

two-tailed P
0.092

0.029

0.057

McNemar test:

0.026

0.052

with cont.corr.

0.048

0.096

Wald test, modif 0.019

0.037

Odds ratio (odds A : odds B) = 0.300


Fisher's confidence intervals:
90% confidence interval = 0.071 to 0.979
95% confidence interval = 0.053 to 1.165
99% confidence interval = 0.029 to 1.636

4. Polimorfisme N315N exon 12 gen lgr8


Paired observations, dichotomous variable [module A] (N315N)
DATA:
A yes, B yes: 2 pairs
A yes, B no: 2 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

Fisher's P:

0.250

0.500

Mid-P:

0.125

0.250

McNemar test:

0.079

0.157

with cont.corr.

0.240

0.480

Wald test, modif

0.079

two-tailed P

0.157

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 0.288 to infinity
95% confidence interval = 0.188 to infinity
99% confidence interval = 0.076 to infinity

5. Polimorfisme E319E exon 12 Gen lgr8


Paired observations, dichotomous variable [module A] (E319E)
DATA:
A yes, B yes: 23 pairs
A yes, B no: 8 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.004 [ 3.9E-0003 ]

0.008 [ 7.8E-0003 ]

Mid-P:

0.002 [ 2.0E-0003 ]

0.004 [ 3.9E-0003 ]

McNemar test:

0.002 [ 2.3E-0003 ]

0.005 [ 4.7E-0003 ]

with cont.corr.

0.007 [ 6.7E-0003 ]

0.013

Wald test, modif 0.001 [ 1.1E-0003 ]

0.002 [ 2.4E-0003 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 2.202 to infinity
95% confidence interval = 1.707 to infinity
99% confidence interval = 1.065 to infinity

6. Polimorfisme L331L exon 12 gen lgr8


Paired observations, dichotomous variable [module A] (L331L)
DATA:
A yes, B yes: 5 pairs
A yes, B no: 10 pairs
A no, B yes: 1 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.006 [ 5.9E-0003 ]

0.012

Mid-P:

0.003 [ 3.2E-0003 ]

0.006 [ 6.3E-0003 ]

0.003 [ 3.3E-0003 ]

0.007 [ 6.7E-0003 ]

McNemar test:
with cont.corr.

0.008 [ 7.9E-0003 ]

0.016

Wald test, modif

0.000 [ 3.2E-0004 ]

0.001 [ 6.3E-0004 ]

Odds ratio (odds A : odds B) = 10.000


Fisher's confidence intervals:
90% confidence interval = 1.745 to 213.953
95% confidence interval = 1.423 to 433.977
99% confidence interval = 0.966 to 2193.995

7. Polimorfisme S337A exon 13 gen lgr8


Paired observations, dichotomous variable [module A]
DATA:
A yes, B yes: 17 pairs
A yes, B no: 17 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.000 [ 7.6E-0006 ]

0.000 [ 1.5E-0005 ]

Mid-P:

0.000 [ 3.8E-0006 ]

0.000 [ 7.6E-0006 ]

McNemar test:

0.000 [ 1.9E-0005 ]

0.000 [ 3.7E-0005 ]

with cont.corr.

0.000 [ 5.2E-0005 ]

0.000 [ 1.0E-0004 ]

Wald test, modif

0.000 [ 1.7E-0008 ]

0.000 [ 3.5E-0008 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 5.189 to infinity
95% confidence interval = 4.127 to infinity
99% confidence interval = 2.734 to infinity

8. Polimorfisme P340P exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (P340P)
DATA:
A yes, B yes: 4 pairs
A yes, B no: 9 pairs
A no, B yes: 4 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.133

0.267

Mid-P:

0.090

0.180

McNemar test:

0.083

0.166

with cont.corr.

0.134

0.267

Wald test, modif

0.079

0.158

Odds ratio (odds A : odds B) = 2.250


Fisher's confidence intervals:
90% confidence interval = 0.746 to 7.876
95% confidence interval = 0.628 to 9.999
99% confidence interval = 0.447 to 16.521

9. Polimorfisme H345P exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (H345P)
DATA:
A yes, B yes: 5 pairs
A yes, B no: 14 pairs
A no, B yes: 4 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.015

0.031

Mid-P:

0.010 [ 9.6E-0003 ]

0.019

McNemar test:

0.009 [ 9.2E-0003 ]

0.018

with cont.corr.

0.017

0.034

Wald test, modif

0.004 [ 4.5E-0003 ]

0.009 [ 9.0E-0003 ]

Odds ratio (odds A : odds B) = 3.500


Fisher's confidence intervals:
90% confidence interval = 1.279 to 11.548
95% confidence interval = 1.099 to 14.603
99% confidence interval = 0.821 to 23.985

10. Polimorfisme K346K exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (K346K)
DATA:
A yes, B yes: 19 pairs
A yes, B no: 9 pairs
A no, B yes: 2 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.033

0.065

Mid-P:

0.019

0.039

McNemar test:

0.017

0.035

with cont.corr.

0.035

0.070

Wald test, modif

0.015

0.030

Odds ratio (odds A : odds B) = 4.500


Fisher's confidence intervals:
90% confidence interval = 1.127 to 29.013
95% confidence interval = 0.931 to 42.800
99% confidence interval = 0.643 to 100.836

11. Polimorfisme Q354K exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (Q354K)
DATA:
A yes, B yes: 5 pairs
A yes, B no: 5 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.031

0.063

Mid-P:

0.016

0.031

McNemar test:

0.013

0.025

with cont.corr.

0.037

0.074

Wald test, modif

0.004 [ 3.8E-0003 ]

0.008 [ 7.5E-0003 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 1.219 to infinity
95% confidence interval = 0.916 to infinity
99% confidence interval = 0.530 to infinity

12. Polimorfisme Q356P exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (Q356P)
DATA:
A yes, B yes: 9 pairs
A yes, B no: 9 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

two-tailed P

Fisher's P:

0.002 [ 2.0E-0003 ]

0.004 [ 3.9E-0003 ]

Mid-P:

0.001 [ 9.8E-0004 ]

0.002 [ 2.0E-0003 ]

McNemar test:

0.001 [ 1.3E-0003 ]

0.003 [ 2.7E-0003 ]

with cont.corr.

0.004 [ 3.8E-0003 ]

0.008 [ 7.7E-0003 ]

Wald test, modif

0.000 [ 6.2E-0005 ]

0.000 [ 1.2E-0004 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 2.532 to infinity
95% confidence interval = 1.974 to infinity
99% confidence interval = 1.247 to infinity

13. Polimorfisme S357S exon 13 gen lgr8


Paired observations, dichotomous variable [module A] (S357S
DATA:
A yes, B yes: 15 pairs
A yes, B no: 15 pairs
A no, B yes: 0 pairs
A no, B no: 0 pairs
RESULTS:
If inverse sampling was used,
see results at end of output.
TESTS AND MEASURES OF DIFFERENCE:
Exact tests:

one-tailed P

Fisher's P:

0.000 [ 3.1E-0005 ]

0.000 [ 6.1E-0005 ]

Mid-P:

0.000 [ 1.5E-0005 ]

0.000 [ 3.1E-0005 ]

McNemar test:

0.000 [ 5.4E-0005 ]

0.000 [ 1.0E-0004 ]

with cont.corr.

0.000 [ 1.5E-0004 ]

0.000 [ 3.0E-0004 ]

Wald test, modif

0.000 [ 1.3E-0007 ]

0.000 [ 2.7E-0007 ]

Odds ratio (odds A : odds B) = infinity


Fisher's confidence intervals:
90% confidence interval = 4.524 to infinity
95% confidence interval = 3.587 to infinity
99% confidence interval = 2.360 to infinity

two-tailed P

PANJANG BADAN LAHIR

Group Statistics

Panjang Badan
Lahir (cm)

Sampel
Kasus
Kontrol

Mean
49,52
50,13

31
31

Std. Error
Mean
,396
,231

Std. Deviation
2,204
1,284

Independent Samples Test


Levene's Test for
Equality of Variances

F
Panjang Badan
Lahir (cm)

Equal variances
as sumed
Equal variances
not ass umed

t-test for Equality of Means

Sig.

5,148

,027

df

Sig. (2-tailed)

Mean
Difference

Std. Error
Difference

95% Confidence
Interval of the
Difference
Lower
Upper

-1,338

60

,186

-,613

,458

-1,529

,304

-1,338

48,266

,187

-,613

,458

-1,534

,308

BERAT BADAN LAHIR


Group Statistics

Berat Badan Lahir (gram)

Mean
3142,90
3206,45

Sampel
Kasus
Kontrol

31
31

Std. Deviation
619,904
331,598

Std. Error
Mean
111,338
59,557

Independent Samples Test


Levene's Test for
Equality of Variances

F
Berat Badan Lahir (gram)

Equal variances
assumed
Equal variances
not assumed

9,498

Sig.
,003

t-test for Equality of Means

df

Sig. (2-tailed)

Mean
Difference

Std. Error
Difference

95% Confidence
Interval of the
Difference
Lower
Upper

-,503

60

,617

-63,548

126,266

-316,119

189,022

-,503

45,869

,617

-63,548

126,266

-317,729

190,632

PANJANG PENIS
Group Statistics

Panjang Penis (cm)

31
31

Std. Error
Mean
,09993
,13590

Std. Deviation
,55641
,75668

Mean
4,2323
4,6452

Sampel
kasus
Kontrol

Independent Samples Test


Levene's Test for
Equality of Variances

F
Panjang Penis (cm)

Equal variances
as sumed
Equal variances
not ass umed

t-test for Equality of Means

Sig.

,005

,945

df

Sig. (2-tailed)

Mean
Difference

Std. Error
Difference

95% Confidence
Interval of the
Difference
Lower
Upper

-2,448

60

,017

-,41290

,16869

-,75033

-,07547

-2,448

55,103

,018

-,41290

,16869

-,75095

-,07485

VOLUME TESTIS
Group Sta tisti cs
N

Sampel
Volume Testis Kanan
Kasus
(ml)
Kontrol
Volume Testis Kiri (ml) Kasus
Kontrol

Mean
2,075
2,348
1,796
2,365

24
31
23
31

St d. Deviat ion
,6726
,6131
,4922
,6102

St d. E rror
Mean
,1373
,1101
,1026
,1096

Independent Samples Test


Levene's Test for
Equality of Variances

F
Volume Tes tis Kanan
(ml)

Volume Tes tis Kiri (ml)

Equal variances
as sumed
Equal variances
not ass umed
Equal variances
as sumed
Equal variances
not ass umed

1,079

,028

Sig.
,304

,868

t-test for Equality of Means

df

Sig. (2-tailed)

Mean
Difference

Std. Error
Difference

95% Confidence
Interval of the
Difference
Lower
Upper

-1,572

53

,122

-,2734

,1739

-,6222

,0754

-1,553

47,151

,127

-,2734

,1760

-,6274

,0806

-3,670

52

,001

-,5689

,1550

-,8799

-,2578

-3,789

51,589

,000

-,5689

,1501

-,8702

-,2675

USIA
Group Statistics

Us ia ( tahun )

Sampel
Kasus
Kontrol

N
31
31

Mean
3,67077
3,59168

Std. Deviati on
3,024875
2,888453

Std. Error
Mean
,543284
,518781

Independent Samples Test


Levene's Test for
Equality of Variances

F
Us ia ( tahun )

Equal variances
as sumed
Equal variances
not ass umed

Sig.

,029

,864

t-test for Equality of Means

df

Sig. (2-tailed)

Mean
Difference

Std. Error
Difference

95% Confidence
Interval of the
Difference
Lower
Upper

,105

60

,916

,079097

,751193

-1,423513

1,581707

,105

59,873

,916

,079097

,751193

-1,423579

1,581773

KRIPTORKISMUS
Case Processing Summary

Valid
N
Lokasi Kriptorkismus
* Jenis Kriptorkismus

Percent
31

96,9%

Cases
Missing
N
Percent
1

Total
N

3,1%

Percent
32

Lokasi Kri ptorkism us * Je nis Kriptorkism us Crosstabulation


Count

Lokasi
Kriptorkismus
Total

Int rabadominal
Inguinal
Preskrotal

Jenis K ript orkis mus


Bilateral
Kanan
Kiri
3
4
6
1
4
8
1
2
2
5
10
16

Total
13
13
5
31

100,0%

Chi-Square Te sts

Pearson Chi-S quare


Lik elihood Ratio
Linear-by-Linear
As soc iation
N of V alid Cases

Value
1,574a
1,656
,077

4
4

As ymp. Sig.
(2-sided)
,813
,799

,781

df

31

a. 7 c ells (77,8%) have ex pec ted c ount les s than 5. The


minimum expected count is ,81.

DATA KARAKTERISTIK SUBYEK PENELITIAN


NO

UMUR

DX

vol Ka

vol Ki

P penis

BBL

UK

PBL

1a
1b

1 th, 5 bln
1 th, 7 bln

K Inguinal ki
Sehat

2
2

2
2

3.6 3550 Aterm


4.5 3100 Aterm

52
51

2a
2b

1 th, 8 bln
1 th, 8 bln

K Inguinal ki
Sehat

1.5
1.5

1.5
1.5

4.2 2200 Aterm


4.2 2600 Aterm

48
49

3a
3b

1 th, 9 bln
1 th, 11 bln

K Intraabdominal ki
Sehat

2
2

3.5 2900 Aterm


3.7 3900 Aterm

49
53

4a
4b

1 th, 2 bln
10 bln

K Preskrotal ki
Sehat

1.5
2

1.5
2

4 2450 Aterm
4 3100 Aterm

45
50

5a
5b

7 th, 2 bln, 23 hr
6 th, 8 bln

K Inguinal Bilateral
Sehat

2
2.5

1
2.5

4.5 3700 Aterm


4.5 3200 Aterm

51
52

6a
6b

1 th, 5 bln, 16 hr
1 th, 5 bln, 3 hr

K Inguinal ki
Sehat

2.5
2

2
2

4 3300 Aterm
4.3 2850 Aterm

52
49

7a
7b

1 th,
7 hr
1 th, 2 bln, 21 hr

K Inguinal ka
Sehat

1.5
2.5

1.5
2.5

4 3030 Aterm
4.7 2900 Aterm

49
51

8a
8b

3 th, 1 bln, 3 hr
3 th, 1 bln, 10 hr

K Inguinal ki
Sehat

2.5
3

1
3

5 3800 Aterm
4.8 3500 Aterm

52
51

9a
9b

1 th, 3 bln, 14 hr
1 th, 4 bln, 25 hr

K Preskrotal ka
Sehat

1.5
2.5

2
2.5

3.8 3400 Aterm


4.2 3550 Aterm

51
52

3.9 3350 Aterm

53

2.5

2.5

5 3350 Aterm

49

2
2

4.9 3900 Aterm


4.4 2950 Aterm

50
48

4.2 3500 Aterm


4.5 3200 Aterm

50
50

4 4090 Aterm

50

10a
10b hr

9 bln, 2 hr
10 bln, 1

K Inguinal ki
Sehat

11a 1 th,
13 hr
11b 1 th, 1 bln, 23 hr

K Inguinal ka
Sehat

2
2

12a 4 th, 3 bln, 13 hr


12b 4 th, 3 bln, 27 hr

K Intraabdominal ki
Sehat

3
2

13a

K Intraabdominal

11 bln

Bilateral
13b hr

7 bln, 25

14a 1 th, 10 bln, 7 hr


14b 1 th, 6 bln, 8 hr

15a hr
15b

11 bln, 10
8 bln

Sehat

3.7 3400 Aterm

52

K Inguinal ki
Sehat

1
2

1
2

3.7 2800 Aterm


4.2 3200 Aterm

50
50

K Intraabdominal ki
Sehat

2
3

3.7 3150 Aterm


4 3900 Aterm

49
51

3.5 1950 Aterm


5 2700 Aterm

47
49

16a 1 th, 3 bln, 2 hr


16b 1 th, 7 bln, 10 hr

K Intraabdominal
Bilateral
Sehat

17a
17b

K Preskrotal ki
Sehat

3
1.8

2
1.8

3.7 3870 Aterm


4 3200 Aterm

52
51

18a 4 th, 1 bln, 15 hr


18b 4 th, 3 bln, 26 hr

K Bilateral
Sehat

2.5

2
2.5

5.3 3200 Aterm


5 2800 Aterm

50
51

19a 5 th, 9 bln, 19 hr


19b 5 th, 9 bln, 19 hr

K Intraabdominal ka
Sehat

2
2.5

5 1900 Aterm
5 2900 Aterm

43
50

20a 4 th, 10 bln, 3 hr


20b 4 th, 9 bln, 13 hr

K Inguinal ki
Sehat

3
2.5

1.8
2.5

4 3550 Aterm
5 3200 Aterm

51
50

21a 8 th, 9 bln, 13 hr


21b 8 th, 9 bln, 9 hr

K Preskrotal ka
Sehat

2.5
2.5

2
2.5

5 3250 Aterm
5 3200 Aterm

50
48

22a 5 th, 1 bln, 2 hr


22b 5 th, 7 bln

K Intraabdominal ka
Sehat

2.5

2
2.5

4 2900 Aterm
4.2 3500 Aterm

48
48

23a 12 th, 5 bln, 2 hr


23b 11 th, 7 bln

K Preskrotal Bilateral
Sehat

3
5

2.5
5

5 3000 Aterm
8 3200 Aterm

50
50

4 th, 11 bln, 14
24a hr
24b 4 th, 6 bln, 29 hr

K Inguinal ka
Sehat

2
2

2
2

5 3050 Aterm
4.5 3500 Aterm

48
50

25a 7 th, 7 bln, 22 hr


25b 7 th, 6 bln, 6 hr

K Inguinal ki
Sehat

1.8
2.5

1
2.5

5 3800 Aterm
5 3100 Aterm

52
50

6 bln, 6 hr
9 bln, 27 hr

26a

6 th, 8 bln, 30 hr
5 th, 10 bln, 21
26b hr

K Inguinal ka

2.5

4.2 4100 Aterm

50

Sehat

5 3000 Aterm

51

27a 3 th, 1 bln, 6 hr


27b 2 th, 5 bln, 18 hr

K Intraabdominal ki
Sehat

0.5
2

3.4 1900 Aterm


4.6 3300 Aterm

46
48

8 th, 11 bln, 26
28a hr
28b 8 th, 8 bln, 28 hr

K Intraabdominal ki
Sehat

3
3

4.5 3300 Aterm


5 2800 Aterm

51
50

29a 5 th, 5 bln, 11 hr


29b 5 th, 8 bln, 11 hr

K Intraabdominal ka
Sehat

2.5

2
2.5

4.7 2500 Aterm


5 3800 Aterm

48
51

30a 2 th, 6 bln, 8 hr


30b 2 th, 5 bln

K Intraabdominal ki
Sehat

1.5
2.5

2.5

4 2700 Aterm
5 3000 Aterm

49
50

31a 1 th, 7 bln, 28 hr


31b 1 th, 9 bln, 3 hr

K Intraabdominal ka
Sehat

1.5
2

3.9 3340 Aterm


4 3500 Aterm

49
49

DATA POLIMORFISME EXON 1, 2 GEN insl3, EXON 8, 12, 13 GEN lgr8


NO

Exon 1 gen
Insl3

Exon 2 gen Insl3

Exon8 gen
Lgr8

Exon 12 gen Lgr8

1a

normal

normal

normal

gaa-->gag*(E319E)

1b

acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

normal

gaa->gan*(E319E)

2a

2b

3a

gcg-->gca (A9A)
acc->gcc*(T60A)

normal

gcg-->gca (A9A)
acc->gcc*(T60A)

normal

gcg-->gcn (A9A)
acc->ncc*(T60T)

cta-->ctn (L 331L)

normal

normal

cta-->ctn (L 331L)

normal

gaa-->gag*(E319E)

3b

normal

normal

normal

gaa->gan*(E319E)

4a

acc--

normal

normal

gaa-->gag*(E319E)

Exon 13 gen
Lgr8
ctt-->ctn (L 344 L)
aag->aaa*(K346K)
cag-->can(Q 348
Q)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357
S)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357
S)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tca-->gca (S 337

>ncc*(T60T)

4b

acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

5a

acc->ncc*(T60T)

normal

normal

gaa-->gag*(E319E)

5b

normal

normal

normal

gaa-->gag*(E319E)
cta-->ctg (L331L)

6a

acc->ncc*(T60T)

normal

normal

gaa-->gag*(E319E)
cta-->ctg (L331L)

6b

normal

normal

normal

normal

7a

gcg-->gcn (A9A)
acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

7b

acc->gcc*(T60A)

cta-->ctg (L331L)

normal

normal

gaa-->gag*(E319E)

A)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg (Q 356
P)
tct-->tcc (S 357 S
)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
normal

tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357
S)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
caa-->aaa (Q
354K)
aag->aaa*(K346K)

8a

gcg-->gcn (A9A )
acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

8b

normal

normal

normal

gaa-->gag*(E319E)

9a

gcg-->gcn (A9A )
acc->ncc*(T60T)

normal

normal

gaa-->gag*(E319E)

9b

normal

normal

normal

gaa-->gag*(E319E)

10a

acc->gcc*(T60A)

normal

normal

aat-->ant (N315N)

11a

acc->gcc*(T60A)

normal

normal

normal

normal

tca-->gca (S 337
A)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357
S)
cac-->ccc (H 345
P)
aag->aaa*(K346K)

gaa->gan*(E319E)

tca-->gca (S 337
A)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg(Q 356
P)
tct-->tcc (S 357 S)
aag->aaa*(K346K)

gaa-->gag*(E319E)

tct-->tnt (S 357
C)

gaa-->gag*(E319E)

10b normal

tca-->gca (S 337
A)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357 S)
cac-->ccc (H 345
P)
aag->aaa*(K346K)

11b normal
acc->gcc*(T60A)
acc-12b >gcc*(T60A)
12a

13a

acc->ncc*(T60T)

normal

normal

cta-->ctg (L331L)
normal

normal

normal

gaa-->gag*(E319E)

normal

normal

gaa-->gag*(E319E)

cga-->cna(R73R)

aga-->ana

aat-->ant (N315N)

(n 223 g-->t )

gaa-->gag*(E319E)

aga=kdn stp
ata=Met
acc-13b >gcc*(T60A)

14a

atg-->ntg
(M1M)

normal

normal

gaa-->gag*(E319E)

gcc->gac(A166D)

normal

gaa-->gag*(E319E)
cta-->ctg (L331L)

acc-14b >gcc*(T60A)
acc->ncc*(T60T)
acc-15b >gcc*(T60A)
15a

16a

acc->ncc*(T60T)

normal

normal
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg (Q 356
P)
tct-->tcc (S 357 S)
aag->aaa*(K346K)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
caa-->aaa(Q 354
K)

normal

normal

normal

normal

normal

normal

gaa--gag*(E319E)

aag->aaa*(K346K)

normal

normal

gaa--gag*(E319E)

normal

normal

gaa-->gag*(E319E)

tgc->tgg(C115W)
tgc->tngc(C116C)

cta-->ctg (L331L)

tca-->ncc (S 337
A)
cct-->ccn (P 340
P)
cac-->ccc (H 345
P)
aag--

>aan*(K346K)
cag-->cng(Q 356
P)

acc-16b >gcc*(T60A)

normal

normal

normal

acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

17b gcg-->gca (A9A)


acc->gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

18a

normal

normal

normal

gaa-->gag*(E319E)

acc-18b >gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

17a

19a

cta-->ctn (L42L)
acc->ncc*(T60T)

acc-19b >ncc*(T60A)

normal

normal

gaa-->gag*(E319E)
cta-->ctn (L331L)

normal

normal

gaa-->gag*(E319E)
cta-->ctn (L331L)

20a

gcg-->gcn (A9A)
acc->ncc*(T60T)

normal

normal

gaa->gan*(E319E)
cta-->ctn (L331L)

normal
aag->aaa*(K346K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
tca-->gcc (S 337
A)
cct-->ccn (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg (Q 356
P)
tct-->tcc (S 357 S)

cct-->ccc (P 340
P)
aag->aaa*(K346K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
caa-->aaa(Q 354
K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)

acc-20b >ncc*(T60T)

21a

acc->ncc*(T60T)

normal

normal

normal

normal

gaa-->gag*(E319E)

gaa-->gag*(E319E)
cta-->ctn (L331L)

acc-21b >ncc*(T60T)

22a

acc->ncc*(T60T)

normal

normal

gaa-->gag*(E319E)
cta-->ctg (L331L)

normal

normal

gaa-->gag*(E319E)

normal

normal

gaa-->gag*(E319E)

acc->ncc*(T60T)

normal

normal

acc-23b >ncc*(T60T)

gaa-->gag*(E319E)
cta-->ctg (L331L)

normal

normal

gaa-->gag*(E319E)

22b normal

23a

cta-->ctn (L331L)

24a

acc->gcc*(T60A)

normal

normal

gaa->gan*(E319E)
cta-->ctn (L331L)

aag->aaa*(K346K)
cag-->ccg (Q 356
P)
tct-->tcn (S 357
S)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357 S)
normal

tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg(Q 356
P)
tct-->tcc (S 357 S)
aag->aan*(K346K)
aag->aan*(K346K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)
tca-->gca (S 337
A)
cac-->ccc (H 345
P)

acc-24b >gcc*(T60A)

25a

acc->ncc*(T60T)

aag-->aaa
(K346K)
cag-->ccg(Q 356
P)
tct-->tcc (S 357 S)
normal

normal

normal

normal

normal

normal

gaa->gan*(E319E)

tca-->gca (S 337
A)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
cag-->ccg (Q 356
P)
tct-->tcc (S 357
S)

cta-->ctn (L331L)

acc-25b >ncc*(T60T)

normal

26a

gag->nag(E146E)

normal

normal

normal

gaa-->gag*(E319)

gaa-->gag*(E319E)
cta-->ctn (L331L)

acc-26b >ncc*(T60A)

normal

normal

normal

normal

normal

normal

normal

acc-27b >gcc*(T60A)

normal

normal

gaa-->gag*(E319E)

acc->ncc*(T60T)

normal

normal

gaa-->gag*(E319E)
cta-->ctg (L331L)

28a

cct-->ccc (P 340
P)
aag->aaa*(K346K)
caa-->aaa
(Q354K)

normal

gaa->gan*(E319E)

27a

normal

cac-->ccc (H 345
P)
aag->aaa*(K346K)
aag->aan*(K346K)

acc-28b >ncc*(T60T)

normal

normal

gaa-->gag*(E319E)

aag->aan*(K346K)

29a

gag--

normal

gaa-->gag*(E319)

tca-->gca (S 337

cta-->cnn (L

42P)
gtg->nnG(V43M)

29b normal

30a

acc->ncc*(T60T)

30b normal

31a

normal

31b normal

>nag(E146E)
cag->can(Q157Q)

normal

normal

normal

normal

normal

gaa-->gag*(E319E)

normal

normal

gaa-->gag*(E319E)

normal

gaa-->gag*(E319E)

aga>ana(st140st)
ggc->ngc(G144G)
gag->nag(E146E)

normal

cta-->ctn (L331L)

normal

gaa-->gag*(E319E)
cta-->ctn (L331L)

A)
cct-->ccn (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
tct-->tcc (S 357 S)
normal
aag->aan*(K346K)
cac-->ccc (H 345
P)
aag->aaa*(k346K)
cct-->ccc (P 340
P)
cac-->ccc (H 345
P)
aag->aaa*(K346K)
caa-->aaa(Q 354
K)
cct-->ccc (P 340
P)
aag->aaa*(K346K)

KADAR HORMON INSL3 PLASMA, HORMON ESTRADIOL PLASMA PADA


SAMPEL
NO
Sampel

1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31

H. INSL3
KASUS
(ng/ml)
0.1904058
0.5362109
0.4012646
0.3292573
0.281722
0.5975522
0.1442106
0.1608039
0.1042727
0.4198922
0.3738507
0.2731723
0.4226324
0.5220163
0.6268736
1.2724178
0.1608039
0.5116504
0.1892888
0.5508458
0.6183321
0.5362109
0.7671773
0.2834679
0.1009004
0.1171015
0.2130963
0.2585082
0.3092348
0.5255245
0.4883599

H.INSL3
KONTROL
(ng/ml)
1.4169475
0.9043142
0.40112646
0.6355499
1.086353
0.5975522
2.114116
1.086353
0.6183321
0.4198922
0.5015177
0.2731723
1.7529988
1.0545779
0.6268736
1.2724178
0.710113
0.5116504
1.1707339
0.5508458
0.6183321
0.5362109
0.7671773
1.1795801
1.2065847
1.1795801
1.8697823
0.9797102
1.2157443
0.5255245
0.4883599

H.ESTRADIOL
KASUS
(ng/ml)
34.978942
11.11795
13.213316
8.5317286
8.1462224
12.821716
16.96918
8.376805
14.176422
9.7364492
8.1462224
13.270072
10.837781
11.276767
16.113158
24.070137
12.739086
14.664286
10.29775
11.552298
10.27479
13.673145
14.976343
20.707599
7.8850561
12.684248
37.181571
95.244748
12.821716
13.185015
19.772678

H.ESTRADIOL
KONTROL
(ng/ml)
0.0001224
7.7934803
7.2623041
10.047539
10.670974
18.759325
9.4120959
13.760847
9.3271397
7.0920412
14.633385
11.35136
8.9936714
8.4534403
10.160634
15.007855
0.0001125
9.031805
7.8483195
8.4925096
7.1258275
15.94642
23.371875
7.8300044
0.0001495
7.2795144
8.5710979
7.2279844
9.3805
7.86667
13.213316

TIME TABLE PENELITIAN


Jenis
kegiatan

Th 2009

Seminar
praproposal

26
Nopember

Ujian
Kwalifikasi
Kuliah
MKPD

Mengurus
ethical
clearance
Seminar
kelayakan
proposal
Ujian
proposal
Pelaksanaan
penelitian
Seminar
kelayakan
naskah
Disertasi

Th
2010

Th
Th
Th
Th
Th
Th
2010 2010 2010 2010 2010 2010

Th
2011

Th
2011

12
Maret
6
April
- 18
juni
25
Mei
-9
Juni
7
Juli
2
Sep
Sep

Des

Maret
18
Mei

Ujian
tertutup

16
Juni

Ujian
terbuka

4
Agus

KUISIONER PENELITIAN

Identitas sampel:
Nama sampel :
Tanggal lahir

Umur

No CM

Cara persalinan :
Berat badan lahir :
Umur kehamilan :
Panjang badan lahir :
Tempat penelitian :
Penyakit yang pernah diderita oleh sampel :
Nama ayah

Riwayat ayah testisnya tidak turun : 1. Ya, 2. Tidak


Bila ya testisnya tidak turun : 1. Kanan, 2. Kiri, 3. Keduanya kanan dan kiri
Riwayat saudara laki-laki ayah testis tidak turun : 1. Ya, 2. Tidak
Bila ya testisnya yang tidak turun: 1. Kanan, 2. Kiri, 3. Keduanya kanan dan kiri
Nama ibu

Alamat

No. Telpon :

Riwayat ibu minum obat yang mengandung estrogen saat hamil :


Riwayat ibu minum obat yang mengandung estrogen saat menyusui:
Riwayat saudara laki-laki dari ibu testis tidak turun : 1. Ya, 2. Tidak
Bila ya testisnya yang tidak turun : 1. Kanan, 2. Kiri, 3. Keduanya kanan dan kiri

Nama kakek dari ayah :


Riwayat kakek dari ayah testisnya tidak turun: 1. Ya, 2. Tidak
Bila ya testisnya tidak turun: 1. Kanan,

2. Kiri, 3. Keduanya kanan dan kiri

Nama kakek dari ibu :


Riwayat kakek dari ibu testisnya tidak turun : 1. Ya, 2. Tidak
Bila ya testisnya yang tidak turun: 1. Kanan, 2. Kiri, 3. Keduanya kanan dan kiri
Riwayat saudara laki-laki dari sampel yang testis tidak turun: 1. Ya, 2. Tidak
Bila ya testis yang tidak turun: 1.kanan, 2.kiri, 3.keduanya kanan dan kiri
Hasil pemeriksaan fisik sampel:
Adanya sindroma : 1. Ya, 2. Tidak, Bila ya sindroma apa :
Testis teraba keduanya : 1. Ya. 2. Tidak teraba
Bila ya lokasinya : 1.inguinal , 2. Preskrotal, 3. Retraktil, 4. Skrotum
Volume testis yang teraba : 1 kanan =

ml ,

2, kiri =

Testis teraba satu : 1. Ya. 2. Tidak


Bila ya lokasinya : 1. Kanan, atau 2. kiri
Bila ya lokasinya : 1. Inguinal, 2.Preskrotal, 3. Retraktil, 4. Skrotum
Volume testis yang teraba:

ml

Bentuk penis : 1. Normal, 2 tidak normal , panjang penis : .cm


Kordae : 1. Ada, 2. Tidak ada,

Hipospadia : 1. Ada, 2. Tidak ada

Hasil pemeriksaan laboratorium


Hormon estradiol :
Hormon Insl3

Gen Insl3

Gen LGR-8

ml.

INFORMASI dan PERSETUJUAN IKUT PENELITIAN (Inform Concent)


INFORMASI MENGENAI PENELITIAN KEPADA ORANG TUA RESPONDEN

Judul Penelitian :
Polimorfisme gen Insl3 dan LGR8, Kadar hormon INSL3 dan estradiol
sebagai faktor risiko kriptorkismus pada anak.

Latar Belakang: Kriptorkismus merupakan tidak sempurnanya penurunan testis kedalam


skrotum dan testis dapat berada pada saluran yang normal diantara ginjal dan bagian dalam
skrotum. Adapun insiden kriptorkismus adalah sampai 30 % pada bayi prematur, sedangkan
pada bayi cukup bulan insidennya 3-5% , pada saat bayi berumur 3 bulan insiden masih 1-3%
dan pada usia 1 tahun insiden kriptorkismus tinggal 0,8%. Komplikasi kriptorkismus berupa:
infertilitas, keganasan (ca testis), hernia inguinalis, torsi testis, dan masalah psikologis.
Kriptorkismus disebabkan oleh multifaktorial, sedangkan peranan polimorfisme gen INSL-3,
polimorfisme gen LGR-8 dan kadar hormon estradiol sampai saat ini masih belum jelas.
Tujuan Penelitian: Mengetahui faktor-faktor yang berkaitan dengan peningkatan risiko
terjadinya kriptorkismus pada anak.
Manfaat Penelitian: Bila terbukti polimorfisme gen Insl3, gen LGR8 dan kadar estradiol
berkaitan dengan peningkatan risiko terjadinya kriptorkismus pada anak. Akan menambah
kasanah teoritis dan merupakan sumbangan pengetahuan praktis dalam pengelolaan
kriptorkismus pada anak.
Cara Penelitian: Penelitian dilakukan dengan wawancara kepada orang tua sampel,
pemeriksaan fisik sampel dan pengambilan contoh darah vena sampel untuk pemeriksaan
kadar hormon INSL3 plasma, hormon estradiol plasma, polimorfisme gen Insl3 dan Gen LGR8 di
Lembaga Eijkman Jakarta.
Risiko dan Kerahasian anak: Tidak ada risiko yang diterima dengan ikut serta dalam penelitian
ini. Informasi mengenai data pasien akan dirahasiakan secara hukum.

INFORMASI dan PERSETUJUAN IKUT PENELITIAN (Inform Concent)


PERNYATAAN KESEDIAN MENJADI RESPONDEN

Saya yang bertanda tangan di bawah ini:


Nama

Umur

Jenis Kelamin

Orang tua / Wali

Bersedia dengan sukarela anak saya diikutkan menjadi subjek penelitian dengan judul :
Polimorfisme gen Insl3 dan LGR8, Kadar hormon Insl3 dan estradiol sebagai faktor risiko
kriptorkismus pada anak, setelah mendengar penjelasan mengenai latar belakang, manfaat,
risiko dan cara kerja dalam penelitian ini.
Demikian pernyataan ini saya buat dengan sebenarnya tanpa ada tekanan dari pihak manapun.

Denpasar,
Peneliti

( I Wayan Bikin Suryawan )

Yang membuat pernyataan

(.)
Tanda tangan, nama terang

S.O.P PENGAMBILAN SAMPEL DARAH

1. Kasus anak kriptorkismus yang diambil secara consecutive sampling dari rekam medis
dianamnesis dan diperiksa ulang oleh peneliti atau oleh dokter spesialis anak konsultan
endokrin, kemudian dicarikan kontrol di poliklinik anak RSUD wangaya, RSUP Sanglah,
RB permata hati yang di matching pada usia dalam tahun dan usia kehamilan.
2. Sampel yang sudah memenuhi syarat sebagai kasus maupun kontrol diberikan penjelasan
oleh peneliti mengenai prosedur ,tujuan, manfaat dan efek samping penelitian ini, setelah
orang tua sampel bersedia sebagai sampel disarankan untuk menandatangai informed
concent.
3. Kasus maupun kontrol yang sudah menandatangai informed concent disiapkan untuk
diambil contoh darahnya.
4. Disiapkan alat-alat untuk mengambil contoh darah ( wing needle no 25, spuit 10ml,
alkohol swab untuk desinfeksi, betadin 60 ml, plester, hanchun, botol steril yang berisi
EDTA dan yang tidak berisi EDTA, termos es untuk menyimpan sampel, karet untuk
membendung aliran vena)
5. Pengambilan sampel darah dilakukan oleh petugas Laboratorium Prodia yang terlatih dan
ditunjuk membantu penelitian ini. Sebelum mengambil contoh darah petugas
menggunakan hanchun, kemudian dilakukan pembenungan pada lengan atas dengan karet
dan melakukan desinfeksi pada daerah cubiti dengan betadin dan alkohol swab 70%.
6. Setelah dilakukan desinfeksi petugas mengambil darah vena pada bagian volar articulus
cubiti dengan menggunakan wing needle no 25 yang disambung dengan spuit 10 ml,
selanjutnya darah vena diambil sebanyak 6 ml, setelah dapat darah sebanyak 6 ml,
kemudian 3 ml dimasukkan ke dalam botol yang sudah berisi EDTA dan 3 ml
dimasukkan ke dalam botol yang tidak berisi EDTA.
7. Botol dengan darah EDTA dan tanpa EDTA diberikan etiket identitas sampel kemudian
dimasukkan ke dalam termos es.
8. Bila sampel yang mau diambil darahnya sudah habis petugas laboratorium prodia yang
membantu penelitian ini membawa sampel darah ke Laboratorium Biomolekuler FK
UNUD yang selanjutnya diserahkan kepada petugas laboratorium biomolekuler yang
ditunjuk membantu penelitian ini (pengambilan sampel darah dilakukan pada hari senin
sampai hari jumat).

9. Darah yang berisi EDTA langsung diperoses di Laboratorium Biomolekuler FK UNUD


untuk mendapatkan DNA oleh petugas laboratorium yang ditunjuk membantu penelitian
ini kemudian disimpan pada lemari pendingin pada suhu -800C
10. Darah yang tidak berisi EDTA langsung disentrifuge pada suhu 40C untuk mendapatkan
serum, selanjutnya serum dimasukkan ke dalam tube kecil-kecil dan disimpan pada suhu
-800C untuk persiapan pemeriksaan hormon INSL3 dan hormon estradiol.
11. Setelah sampel darah jumlahnya cukup serum dikirim ke laboratorium Poliklinik Hewan
FKH UNUD oleh petugas laboratorium bersama peneliti, dan di laboratorium poliklinik
hewan diperiksa kadar hormon INSL3 dan kadar hormon estradiol dengan metoda ELISA
oleh peneliti bersama petugas laboratorium.
12. Sampel DNA sebelum dikirim dilakukan PCR dulu dan hasil PCR dipurifikasi setelah itu
hasil purifikasi PCR baru diantar oleh petugas laboratorium Biomolekuler ke Lembaga
Biologimolekuler Eijkman Jakarta untuk diperiksa skuenzing exon 1, exon 2 gen Insl3
dan exon 8, exon 12,13 gen Lgr8.

S.O.P Pemeriksaan DNA

1. Urutan pemeriksaan DNA: Extraks DNA yang sudah disimpan pada suhu -200C diambil
untuk dilakukan PCR, selanjutnya hasil PCR di purifikasi, hasil purifikasi atau hasil PCR
dikirim ke Lembaga Eijkman Jakarta, untuk dilakukan cycle Sequencing, kemudian
dilakuan presipitasi,
kemudian hasil presipitasi yang berupa pure dried DNA
ditambahkan Hidi Formamide dan masukkan kedalam mesin sequencer untuk melakukan
sequencing electrophoresis, hasilnya berupa electro pherogram yang kemudian dianalisis
menggunakan Bioedit Soft Ware.
2. PCR: menggunakan mesin PCR biasa 9700 atau 9600, bahannya adalah: dNTP, tag
polimerase, MgCl (buffer), Primer Forward, Primer Reverse, d H2O yang steril, DNA
hasil extraksi.
3. Cycle Sequencing : menggunakan mesin PCR biasa 9700 atau 9600, bahannya adalah:
dNTP, ddNTP, tag polimerase, buffer, menggunakan salah satu primer Forward atau
primer Reverse, DNA hasil purifikasi, dH2O steril ( free RNAse),
4. Presipitasi : menggunakan mesin Thermo Scientific Centrifuge, bahannya adalah: EDTA,
sodium asetat, etanol absorbent, etanol 70 %, DNA hasil cycle sequencing, hasilnya
berupa: pure dried DNA
5. Sequencing electrophoresis: menggunakan mesin Applied Biosystem (ABI) Genetic
Analyzer 3130 atau 3130XL, bahannya pure dried DNA dan Hidi Formamide, hasilnya
berupa electro pherogram.

DAFTAR PENELITIAN
NO
1

JUDUL / JURNAL / PENELITI

METODOLOGI

HASIL PENELITIAN

KESIMPULAN

Genetic analysis of INSL-3 gene in

Case control study: 3 klp kasus dan 3 klp kontrol

SSCP/HA dapat ditemukan 8 variasi mutasi,

Mutasi dan polimorfisme gen INSL-3

patients with maldescent of the

klp kasus: tistis tidak turun n=28, Gangguan maskulini

5 squen urutan protein berubah (A-16, V19L, P25S,

tidak menjadi penyebab mayor tidak

testis, Clinical study

sasi dan gonad abdominal n=24, gonad inguinal n=33

A36T, R78H) dan 3 perubahan pada asam amino

turunnya testis dg atau tanpa gangguan

European Journal of Endocrinology

Kontrol: laki-laki normal n=15, laki-laki gangguan

(A-1G, V19L, R78H) Polimorfisme aa, A36T

maskulinisasi

(2001) 144: 129-139, Lim HN dkk

maskulinisasi n=29, prempuan n=82

ditemukan pada kedua klp pasien dan kontrol


dengan frekwensi yang serupa.

Absence of mutations involving the

31 kasus dg kriptorkismus idiopatik bilateral dan

Pada exon 1 terjadi polimorfisme Alan-->Thr, ada

Mutasi pada gen INSL-3 tidak umum

INSL-3 gene in human idiopathic

unilateral di Eropah dan semua kasus mengalami

16 polimorfisme dg 2 silent polimorfisme pd

menyebabkan kriptorkismus pada

cryptorchidism. Molecular Human

infertilitas 9 kontrol laki-laki infertilitas dan tidak

exon 1 keduanya ada pada kriptorkismus maupun

anak laki-laki. Polimorfisme tidak

Reproductation (2000) vol 6, no 4,

ada riwayat kriptorkismus. Analisis molekuler,

yg normal, ditemukan tranversi G-->A pd posisi 27

berhubungan dg penotif

pp. 298-302, Krausz C dkk

squens pada exon 1 dan exon 2 gen INSL-3 dg primer

dan 126 pd 16 kriptorkismus laki-laki tranversi

F2/R1 atau F5/R5 untuk exon 1 dan F4/R4 untuk

G-->A pd posisi 178 kode C-peptida, dari 31 kasus

exon 2, sebelumnya dilakukan PCR

1 perubahan pd homozigot dan 15 pd heterozigot

A novel mutation of the insulin-like 3

Case control study,menggunakan 150 pasien dg

Ada 3 perubahan polimorfisme pada exon 1,

Penemuan ini memberikan fakta-fakta

gene in patients with cryptorchidism.

idiopatik kriptorkismus unilateral kiri 48, unilateral

G-->A pada nukleotida 1167 mengkode Alanin

baru mengenai INSL3 berperan pada

J Hum Genet (2003) 48: 86-90,

kanan 57, bilateral 45 atau ada riwayat kriptorkismus

perubahan tidak ada pada asam amino leusin

penurunan testis pada manusia

Canto P dkk

kontrol 50 laki-laki dari etnis Mexico dg faktor

G-->A pada nukleotida 1338 Alanin-->Threonin

walaupun mutasi pada gen ini tidak

keluarga tidak ada, lahir aterm, usia 2 bulan - 27 tahun

Mutasi pada exon 2 C-->G pd nukleotida 2560

banyak menyebabkan kriptorkismus

Genom DNA diisolasi dari lekosit darah pasien,

Asparagin-->Lysin pada codon 86

didapat dari PCR dan primer kedua exon ditentukan.

Ibu dg heterozigot menjadi karier dari C-->G pd

Analisa mutasi atau variasi squen dikonfirmasi dg 3

nukleotida 2560

amplifikasi PCR indevendent dan squens dianalisa

Perubahan seperti ini juga ditemukan pada kontrol

Mutations of the Great gene cause

61 kasus kriptorkismus idiopatik bilateral atau

Variasi nukleotida pada Great cDNA ditemukan

Mutasi missen pada gen Great menjadi

cryptorchidism. Human Molecular

unilateral, 20 orang prancis dan 41 orang campuran

pada kasus dan kontrol, secara khusus ada mutasi

penyebab beberapa kasus

Genetic (2002), vol 11, no 19,

kontrol 193 dg fertil dan testis di skrotum 62 francis

missen (T222P) pada ectodomain reseptor Great

pp.2309-2318, Garlov I P dkk

100 orang Jerman dan 31 orang USA mutasi DHPCL

pada satu pasien, mutasi pada reseptor Great

dianalisa dg squen. Genom diisolasi pada exon 12-16

menyebabkan kegagalan merespon stimulasi

kriptorkismus pada manusia

dari gene Great squen dg premer K/o derivat dari


vector bacbone, vector 53527 dan inser-reverse
dan sisipan kebalikannya
5

The INSL3-LGR8/GREAT Ligand-Recep

87 pasien kriptorkismus usia 24-45th dg 36 kriptorkis

18 pasien normosperma, 16 pasien oligosperma

Kriptorkismus banyak berhubungan

tor pair in Human Cryptorchidism.

mus bilateral, 46 kriptorkismus unilateral, usia

dan 53 azosperma ditemukan 3 polimorfisme

dg mutasi pada INSL-3 dan reseptornya

The Journal of Clinical Endocrinology


& Metabolism (2003) 88(9): 42734279

orchidopeksi 1-27th, 5 kasus testis turun sendiri usia

L9L (27G-->A) 3% kriptorkismus, 5 % kontrol


A60T (178G-->A), 42,5% kriptorkismus, 47%
kontrol

LGR8/GREAT. Gen ini punya peran

Ferlin A dkk

1 tahun, kontrol 80 kasus di Italia. Genom DNA

penting pada penurunan testis tanpa

diambil dari darah perifer, digunakan LGR8 cDNA

L42L (126--> A) 57% kriptorkismus, 58% kontrol

berpengaruh pada spermatogenesis

untuk squen kromosum 13 dan didesain 17 pasangan

Ditemukan 3 mutasi INSL-3 pada 4 pasien dan

dan komponen endokrin testis

premer untuk 18LGL8 hasil PCR dicek polimorfisme

1 mutasi INSL-3 pada 4 pasien.

Great/LGR-8 is the only Receptor for

Seluruh lengan wild-type INSL-3 cDNA diamplifikasi

INSL-3 pada defisiensi GREAT tidak terjadi

Reseptor GREAT/LGR8 hanya satu-satu

Insulin-like 3 pepteda. Molecular


Endocrinology(2003)17 (12)26392646

RT-PCR dan RNA testis manusia dg primer

difrensiasi gubernakulum dan pada perempuan

nya reseptor INSL-3 in vivo. Interaksi

5!-(CCCAAGCTT)C-CACCATGGACCCCCGT-3! Dan

overekpresi INSL-3 dan dilesi GREAT terjadi

INSL-3 dan LGR-8 dapat dipahami pada

Bogatcheva NV dkk

5!-(CCCAGATCT)GTAGG-GACAGAGGGCAGCA-3!

ovarium letak tinggi di abdomen. Rekombinan

desensus testis dan kriptorkismus

dianalisa mutasi dari wild type INSL-3 cDNA dan

INSL-3 mampu meningkatkan cAMP pada GREAT.

Mutasi P49S pada INSL-3 dapat diiden

dilakukan aktivasi dari reseptor LGR7 dan GREAT dg

INSL-3 merupakan aktivator spesifik pada GREAT

tifikasi pada pasien kriptorkismus

INSL-4 dan INSL-6

INSL-4,INSL-6 tidak mengaktivasi LGR7 atau GREAT

INSL-3 Ligand-Receptor system in the

Jaringan testis kuda diambil dari 9 tempat untuk

Peptida LGR-8 testis kuda dapat ditunjukkan dg

Telah diidentifikasi testis kuda dan

Equine Testis.Biologyof Reproduction

testis dewasa: testis normal n=9, gangguan spermato

identifikasi LGR-8 manusia 94,8%, dg LGR-8 tikus

target jaringan dari INSL3.Diperkirakan

(2003) 68: 1975-1981, Klonisch T dkk

genesis n=7, kriptorkismus inguinal n= 3. Pada kuda

80,5%, tapi hanya dapat 55,3% berhubungan dg

fungsi intratestikular INSL3-LGR8

prepubertas diambil dari 8 tempat: kriptorkismus

LGR7 manusia. Pada desensus testis kuda dewasa

secara hormonal berhubungan di

kontralateral n= 3, kriptorkismus inguinal n= 5

eINSL3 spesifik dapat dideteksi secara imunologis

dalam testis kuda

dilanjutkan pemeriksaan PCR pada jaringan testis

pada sel Leydig. Pada kriptorkismus abdominal,

diperiksa imunohistokimianya dan dg Werten Blot

inguinal dan prepubertas testis kuda juga

Analisis aktivitas INSL-3 dan LGR-8 testis kuda dg

menunjukkan imunopositif eINSL3.

INSL3,LGR8 testis manusia dan tikus

Dengan Water Blot Analisis adanya penurunan


secara signifikan imunoreaaktif eINSL3 pada
ekstrak protein kriptorkismus dan prepubertas

Hormonal control of Gubernaculum

Tikus dewasa dianalisa imunohistokimia dari

Analisa histologi dari fetus tikus pada E17 dan E19

INSL-3 dan androgen punya peran

Development during Testis descent:

gubernakulum . Prolifirasi sel pada gubernakulum

menstimulasi perkembangan seksual dismorfik

penting pd pentumbuhan keluar

Gubernaculum Outgrowth in vitro

invivo diawasi dengan 5-bromo deoxyuridine

pada bulbus gubernakulum jaringan testis yang

gubernakulum pada penurunan testis

Requires both Insulin-like factor and

Dipakai DNA gubernakulum tikus fetus dan 5-bromo

berisi R 1881, androgen sintetis menstimulasi

gubernakulum invivo dan invitro

Androgen. Endocrinology (2000)

deoksyuridin dan dipakai DNA gubernakulum tikus

pertumbuhan gubernakulum.

berhubungan dengan regulasi ekspresi

141: 4720-4727, Emmen JMA dkk

fetus diaktivasi dari E17 fetus di cek juga : INSL-3,

gen INSL-3 pada penurunan testis .

AMH dan androgen.

Sebagian besar penelitian selanjutnya


memiliki gen yang berpengaruh terhadap aktivasi INSL-3 pada perkembangan
gubernakulum.

An analysis of the Genetic factor

Penelitian kohort pada 14 anak laki-laki dengan

Mutasi gen INSL-3 dan T222P pada gen LGR-8

Mutasi pada gen INSL-3 dan T222P dari

involved in testicular descent in

bilateral anorchia usia (1,3-15,8) tahun antara tahun

diketahui menyebabkan kriptorkismus. Konfirma

gen LGR-8 semata mata berhubungan

a cohort of 14 male patients with

1981-tahun 2003. Dilakukan pembedahan, kemudian

si dengan hasil mutasi pada gen SRY tidak berhu

dengan desensus testis dan tidak

Anorchia. The Journal of Clinical

analisa hormonal (testosteron, AMH, FSH,LH) dan

bungan dengan anorchia. Walapun umumnya

berhubungan dengan anorchia, data

Endocrinology & Metabolism(2004)

analisa DNA pada ( Gen SRY, gen INSL-3, T222P pada

polimorfisme gen INSL-3 telah teridentifikasi

ini menunjukkan kemungkinan ada

89(21): 6282-6285, Vinci G dkk

gen LGR-8) dianalisa mutasi pada gen tersebut.

pada kasus ini namun pada observasi tidak dite

faktor genetik lain juga yang berperan

Dilakukan juga modifikasi untuk menciptakan primer

mukan adanya mutasi dan pengulangan mutasi

pada desensus testis seperti HOXA 10

yang menditeksi tempat restriksi baru untuk polimor

T222P dari gen LGR-8 tidak dijumpai.

fisme

10

INSL-3 /Leydig insulin -like peptide


activites the LGR-8 receptor
infortant

Ada 293 jaringan testis manusia diperiksa INSL-3 dan

Dikatakan ikatan INSL-3 dan LGR-8 sangatlah baik

Penurunan testis sangat tergantung


pada

LGR-8 kemudian dianalisa pengaruhnya pada

ikatan ini sangat berguna untuk pertumbuhan

gen INSL-3 dan gen LGR-8 ikatan ini

in testis descent. The American

gubernakulum

gubernakulum

menentukan pertumbuhan gubernaku

Society for Biochemistry and molecu

lum . Pada perempuan INSL-3 berhu

lar Biologi (2002) 1-13, Kumagai J dkk

bungan dg sel corpul luteum dan


gangguan INSL-3 menyebabkan ovarium
letak tinggi

11

The Leucine-Rich Repeat-Containing

Jumlah sampel 822 dg 359 riwayat kriptorkismus dan

Analisa mutasi exon 8 dari gen LGR-8 dari 822 pasi

Mutasi T222P pada gen LGR-8 tidak

G Protein-Coupled Receptor 8 gene

463 sebagai kontrol dari negara: Italia n=159, spanyol

en, mutasi T222P pada pasien dan kontro.

dapat dipertimbangkan sebagai penye

T222P mutation does not cause

n=77, Hungaria n= 70 dan Egypt n= 53 mutasi pada

Pasien: 3,6% dari 359 dan pada kontrol 1,7% dari

bab atau faktor risiko kriptorkismus

Cryptorchidism. J Clin Endocrine

gen T222P dari LGR-8 dg squens langsung dg premer

463 tidak berbeda signifikan. Mutasi pada pasien:

namun pada penelitian ini banyak

Metab (2007) 93 (3): 1072-1076,

exon 8 yang berisi mutasi T222P. 5 Polimorfisme

Egypt = 5,66%, Italia = 5,03%, Hungaria = 2,86%

ditemukan polimorfisme gen LGR-8

Nuti F dkk

dianalisa pada 19 karier dari mutasi T222P

Spanyol 0%, Pada Kontrol mutasi: Spanyol =4,17%


Italia = 1,82%, Hungaria = 0,71%.
Analisa polimorfisme 5 exon dan intron dari 19
kasus ditemukan mayoritas pada pasien dibanding
kan dg kontrol

12

Impaired Estrogen Production by

Menggunakan 16 babi yang kriptorkismus dan yang

Diukur berat testis dari 16 babi dan terjadi pengu

Testis di skrotum dari kriptorkismus

Leydig cells of Naturally Retained

normal diobservasi di universitas Swine Reseach

rangan berat pada kriptorkismus abdominal.

unilateral pada binatang percobaan

Testis in unilaterally Cryptorchid

senter selama usia 3-4 bulan, pada usia 4 bulan testis

Produksi estrone meningkat oleh sel Leydig pada

menekan aliran produksi estrogen dari

Boars and Stallions. J Androl (1986)

yang di skrotum dari 4 kriptorkismus unilateral dan

testis skrotal. Terjadi hambatan sekresi estron

testis abdominal. Testis di skrotum

7: 100-104, Ryan PL dkk

1 yang normal dioprasi dan dipindahkan ke abdomen

pada testis abdominal. Pada kriptorkismus

berfungsi sebagai regulasi aliran yang

melalui kanalis inguinalis. Kemudian testis dibawa

produksi estrogen dapat terdeteksi. Produksi

berlebihan dari aktivitas aromatisasi

ke laboratorium selama 5 menit untuk pemeriksaan

androgen tidak berbeda antara testis skrotal

testis abdominal. Aliran estrogen ini

sel Leydig. Kemudian pemeriksaan radioimunoassy

dengan testis tranlokasi ke abdominal.

nilainya normal 2 bulan setelah

dengan menggunakan estrone sulfat dan estrone

orchidopeksi

Analisa statistik dengan student! T test


13

Estrogen Receptor is a major contri

13 anjing yang hamil diberi suntikan 0,2 ml dimethyl

Terjadi kriptorkismus pada binatang yang ibunya

Xenoestrogen menghambat fungsi

butor to Estrogen-mediated fetal

sulfaxide (DMSO) atau ditambah 6 mg 17-E2

terpapar E2 pada kadar 18,5. Pada uterus yang

endokrin sel Leydig fetus, berhubungan

testis dysgenesis and cryptorchidism

sebelumnya. Untuk paparan DES anjing hamil menda

terpapar estrogen 6 gen dari 55 gen testis menga

dengan mekanisme langsung estrogen

endocrinology (2007) 148 (11) : 5507-

pat paparan 10 g/d--> anjing hamil dibunuh dengan

lami regulasi menurun yaitu gen: INSL-3, Star,

reseptor . Sebab ekspresi INSL-3 dan

5519, Cederroth CR dkk

E18,5 dan testis anak anjing dikeluarkan . Diekstraksi

Cyp17a!, Ren!, FMO2, dan lefty.A. Sementara 31

produksi androgen sel leydig dibutuh

RNAnya dengan RT-PCR , dengan primer disquens.

gen mengalami regulasi yang meningkat. Pada

kan dalam keadaan normal untuk defe

Total RNAs dari wild-type atau mutasi Er testis yang

inaktivasi Er tidak berpengaruh. Terjadi toxicoge

rensiasi laki-laki dan fungsi testis.

terekspresi dengan DMSO atau 17 E2 diektraksi

nik pada mutasi Er pada paparan xenoestrogen.

Obat-obat estrogen akan menyebabkan

tersendiri. Analisa statistik perbedaan nilai mean

Pada real-time RT PCR validasi ekspresi gen pada

teratogenik dalam fase maskulinisasi

antara klinis dg genotif dg unpaired t test. One-way

E2 atau DES yang terpapar terjadi blokade Er

dan pertumbuhan saluran urogenital

anova membedakan kedua group atau lebih

pada testis. Pada paparan minimal terjadi desen

dan fertilitas.

sus testis.
14

Endogenous Estrogens inhibit Mouse

Tikus rumah dikontrol dengan lampu 0800-2000h

Ex vivo produksi testosteron basal berhubungan

Er menjadi mediasi in vivo pengham

fetal Leydig cell Development via

dan disediakan air secukupnya. Umumnya tikus homo

dengan kandungan testosteron intra seluler. Pada

batan pengaruh estrogen endogen pada

Estrogen Receptor . Endocrinology


(2005)146(5): 2454-2461, Delbes G
dkk

zigot untuk Er. Kemudian yang heterozigot dikum

testosteron basal dan stimulasi LH. Produksi

perkembangan steriodogenesis testis

pulkan pada malam hari. Tikus yang hamil dibius pada

testosteron meningkata untuk homozigote tapi

selama masa fetus dan perkembangan

kehamilan 13,5 hari dengan injeksi 4 mg/100g

tidak untuk heterozigot. Er aktivasi gen selama

neonatal pada tikus. Hal ini mendukung

15

sodium pentobarbital. Neonatus laki-laki dibunuh

2 hari dibanding binatang wild type. Plasma FSH

hipotesis fetus dan neonatus yang

dengan leher dipotong pada usia 2-3 hari dilakukan

dan LH 2 hari setelah lahir tidak ada beda antara

terpapar xenoestrogen dapat mengala

PCR pada testis, total sel leydig diukur digenakan

Er -/- dengan wild type. Peningkatan kadar

mi gangguan maskulinisasi traktus

Real Time PCR untuk gen steriodogenik (StAR, P450Scc,

biosintesa androgen pada Er -/- dan endrolin

urogenital dan fertilisasi pada dewasa

dan P450C17 pada testis, Testosteron dg RIA . FSH,LH

pada b ayi tak sesuai dengan perubahan pada bayi

dg imunoflorometrik assay. Dianalisa dg student!

tak sesuai. Peningkatan kadar biosintesa androgen

unpaired t tes dan one-way ANOVA.

tidak sesuai untuk India. Peningkatan biosintesa.

Haplotype analysis of the estrogen

Dilakukan analisa haplotype dari estrogen reseptor

LD Block pada kelompok pasien dan kontrol diban

Mendukung hipotesis homozigot untuk

receptor 1 gene in male genital and

(ESR1) pada 328 subjek orang jepang dengan 70 pasien

dingkan. Frekuensi homozigot dengan AGATA

estrogen reseptor (ESR1) spesifik

and reproductive abnormalities.

mikropenis (MP), 43 pasien hipospadia (HS), 80 pasien

haplotype spesifik hasilnya paling tinggi pada

AGATA haplotype, bisa meningkatkan

Human Reproduktion (2007) 22 (5):

kegagalan sperma (SF) dan 135 kontrol. Genotyping dg

pasien HS(p=0,0000033), OR = 11,26) sedikit tinggi

kepekaan berkembangnya kelainan

1279 - 1284. Watanabe M dkk

5! Nuclease assay.

pada pasien MP(p=0,034, OR= 3,64) dibandingkan

alat genitalia laki-laki sebagai respon

dengan kontrol dan AGATA haplotype sangat kuat


hubungannya dg HS (p= 0,0000022, OR = 11,26)
dan
lemah dengan MP (p=040 dan OR = 3,64) pada
type

estrogenik dari terputusnya lingkungan

resesip. Tidak ada perbedaan bermakna antara

endokrin (EEDs)

pasien SF dengan kontrol. Analisa SNPs frekwensi


genotif 8-15 peningkatan AA pada SNP 10
(p=0,023)
dan SNP 12 (p=0,03) pada HS.
16

Molecular analysis of estrogen


receptor alpha gene ABATA
haplotype

Dua kelompok besar yaitu kasus 335 orang dan kontrol

SNP12 merupakan representatip SNP untuk AGATA

567 orang pada dua populasi kulit putih kemudian

haplotype juga pada kulit putih. Kita ketahui berla

dari observasi didapatkan efek yang


berlawanan dg kriptorkismus
dianjurkan

and SNP12 in European populations:

dianalisa SNP12 yg merupakan representasi SNP1-15

wanan dengan populasi di Jepang didapatkan

adanya penelitian lain selanjutnya

potential protective effect for


Cryptorchidism and lack of
association

dan AGATA haplotype ( estrogen reseptor ) untuk

pada kasus independent dan kontrol

membuktikan apakah variasi genetik ini dan yang

ESR1 SNP12 mempunyai efek protektip terhadap


terjadinya kriptorkismus pada polpulasi Italia.
Tidak

dari etnis berbeda dan daerah yang ber

ditunjukkan oleh SNP berhubungan dengan kriptorkis

ada hubungan antara SNP12 dengan gangguan

beda. Pada bagian lain terjadi hal yang

mus atau gangguan spermatogenesis yang berat.

spermatogenesis yang berat. Frekwensi allel dan

with male infertility. Human Repro


duction (2007), vol 22, no 2,pp.444449
Galan JJ dkk

Kontrol Italia = 168 laki-laki, AGATA karyotive 109

SNP12 pada orang italia dan spanyol adalah

berlawanan pada polimorfisme ESR1,


SNP12. polimorfisme tidak
berhubungan

dari 168 laki-laki, dan di serum SNP12

13,4% dan 9,3% (p=0,04, OR = 1,51) dan

dengan faktor infertilitas laki-laki

C1 95-1,02 . Dan kasus =13,4 , kontrol = 7,2


17

Morphometric study of the Guberma

Speasmen diambil dari tikus usia 21-25 minggu yg

Pada sayatan sagital ada perbedaan bermakna

Paparan estrogen tidak jelas perannya

culum in male Estrogen Receptor

dibiakkan dari reseptor estrogen tikus yg dimatikan

ketiga grup.Pada wide type semua testis turun

pada perkembangan gubernakulum.

mutant mice . Journal of Andrology

ditunjukkan genotif estrogen reseptor ketiganya.

kecuali 1 atropi intraabdominal. ERKO heterozigot

Estrogen lewat penekanan testosteron

(1996) 17: 91-95, Donalson Km dkk

jaringan difiksasi dg formalin 10% kemudian

3 dari 8 turun dan 5 retraktil. ERKO homozigot

dan aktivasi MIS berpengaruh pada

sampel dibagi 3 kelompok: 4 wide type, 4 ER heterozi

1 turun dan 6 dari 8 retraktil.Kantong kremaster

perkembangan gubernakulum. Estrogen

got dan 4 ER homozigot yang mutasi. Kemudian dipe

membesar dan meleber pada wide type (p<0,05)

exogen menyebabkan atropi perkem

riksa genotif dan morfologi jaringan. Hasil PCR diperik

penurunan testis lebih dibawah pada wide type

bangan gubernakulum normal dan blok

sa hasilnya: 239 base pair untuk yang normal dan 449


base pare untuk yang terganggu. Morfologi otot
kremas
ter diperiksa, dianalisa dg mean, SD dan student!s t
test

Otot kremaster lebihbesar dan teratur pada wide

pada estrogen gubernakulum tumbuh


cepat (tidak ditemukan pd penelitian
ini)
Ditemukan perkembangan otot
kremaster
diperkirakan berhubungan dg
gubernakulum
Kelainan spermatogenesis pd
homozigot

type (p<0,02) dg heterozigot dan (p<0,05) dg


homozigot. Potongan sagital (p< 0,01)

18

Hormonal changes in 3-month-old

Penelitian secara prospeftif longitudinal dengan

Anak laki-laki Finlandia yg kriptorkismus FSH tinggi

Hasil penelitian ini mendukung hipotesa

Cryptorchid Boys. The Journal of

basis populasi. Dilakukan pada dua pusat pelayanan

1.59(0,50-3,53) dengan 1,30 (0,49-2,92) IU/L,

kriptorkismus berhubungan dengan

Clinical Endocrinology&Metabolism

primer obstetri, adapun sampel sebanyak 386 anak

p<0,0001, inhibin B rendah =426 (254-770) dg 459

kerusakan testis primer, yang mana

(2006) 91(3): 953-958, Suomi AM dkk

laki-laki Finlandia 88 dengan kriptorkismus, 433 anak

(216-742) pg/ml, p< 0,015, median (2,5th-97,5th

menyebabkan kriptorkismus .

laki-laki Denmark 34 dengan kriptorkismus. Pemerik

persentil. Di Denmark kriptorkismus FSH tinggi

Gangguan fungsi ini dapat ditunjukkan

saan klinis dilakukan pada usia 0 bulan dan 3 bulan,

1,47 (0,54-3,89) dg 1,18 (0,41-3,64) iu/L p=0.018

oleh produksi inhibin yang rendah

sedangkan pemeriksaan sampel darah usia 3 bulan.

Inhibin B lebih rendah pada Denmark lebih rendah


380 (233- 637) pg/ml p<0,000 dan tidak turun
pada

pada penelitian kohort di Finlandia

Hasil utama yang diukur adalah posisi testis dan


kadar hormon reproduksi.

kriptorkismus di Denmark 392 (236-672) pg/ml


p: 0,851. Perubahan kadar hormon sangat kuat
pada

dan peningkatan kadar gonadotropin


pada penelitian di Finlandia dan
Denmark.

anak dengan kriptorkismus berat dan persisten.


tetapi juga terdeteksi pada kriptorkismus ringan
dan sementarsa. Pengaruhnya pada sel Leydig
sedikit dengan peningkatan LH Finlandia
tapi tidak pada Denmark, LH= 1,97 (0,77-5,91) dg
1,75 (0,58-4,o4), p<0,021, tetapi testosteron masih
normal.
19

Maternal hormone levels and Risk of

Penelitian kohort prospektif ibu hamil dg anak krip

Tidak ada perbedaan signifikan testosteron ,

Peningkatan estrogen ibu tidak berhu

Cryptorchidism among population at

torkismus dan kontrol, diteliti ibu kulit hitam resiko

-fetoprotein, sex hormon- binding-globulin, atau

pada Hight low risk of testicular germ

ca testis rendah dan ibu amerika kulit putih resiko

ratio estrogen dengan androgen. Total estradiol

bungan dengan meningkatnya risiko


kriptorkismus dan mungkin
berhubungan

cell tumor. Cancer Epidemiologi ,

ca testis tinggi. Diambil 200 kasus dan 200 sampel

lebih rendah bermakna pada kasus (p=0,03)

dengan menurunnya kriptorkismus.

biomarker & prevention (2005) 14(7)

secara nested. Hipotesis estrogen ibu meningkatkan

diantara seluruh ibu dan sebagian ibu kulit putih

Risiko rendahnya estrogen pada kasus

1732-1737, Mc Glynn KA dkk.

kriptorkismus dan ca testis, androgen ibu mencegah

(p=0,05), estriol juga lebih rendah bermakna

mengindikasikan defek plasenta

Diambil serum ibu: estradiol (total,bebas, bioavilable)

pada kasus (p=0,05) diantara semua kasus dan

meningkatkan risiko kriptorkismus dan

estriol,testosteron (total,bebas,bioavilable), sex-

diantara kulit putih.

kemungkinan ca testis. Penelitian

hormon binding globulin, -fetoprotein, rasio

selanjutnya disarankan meneliti

estradiol : testosteron pada kasus dan kontrol

cairan amnion, darah umbilikal, atau


sampel darah bayi

20

Elevated End-of-Treatment serum

Analisa retrospektif kadar serum INSL-3 pada laki-laki

Usia subjek dari 3 penelitian 328 tahun, rerata

Kadar serum INSL-3 berhubungan

INSL-3 is associated with failure to


completely suppress
spermatogenesis

yang diobati dengan kontrasepsi hormonal testosteron

bermakna dengan persisten spermato

plus fungsi progestogen : Diukur kadar serum INSL-3

berat badan: 83 15 kg. Pada akhir pengobatan


63 laki-laki (59%) azoosperma dan 44 laki-laki
(41%)

in men receiving male hormonal

dengan RIA pada 107 laki-laki dari 3 penelitian

ada sperma. Data awal INSL-3 tidak ada korelasi

pada pencegahan komplit penekanan

contraception. Journal of Andrology

yang baru mendapat kontrasepsi hormonal. Nilai

dengan konsentrasi sperma dan akhir pengobatan

spermatogenesis pada laki-laki dengan

(2007) 28(4): 548-554, Amory JK dkk.

genesis. INSL-3 memegang peranan

normal INSL-3: 291-1132 pg/ml, batas bawah yang

serum INSL-3 lebih tinggi bermakna pada nonazo

penggunaan kontrasepsi hormonal.

masih terukur: 16 pg/ml, FSH dan LH juga diukur

sperma dibanding azosperma median 95 (73-127)

Selanjutnya INSL-3 menjadi target

dengan RIA. Azoosperma tidak ada sperma, oligosper

pg/ml berbanding 80 (67-101)pg/ml dengan nilai

potensial untuk pengembangan

ma sperma 1millien sperma/ml ejakulat. Data

p = 0,03. Selanjutnya serum INSL-3 punya korelasi

kontrasepsi laki-laki.

dianalisa dengan: nonparametrik, Wilcoxon-rank-sum

positip dengan konsentrasi sperma (r = 0,25,

test, analisa univariat dan bivariat logistik regresi

p=0,009). Pada akhir pengobatan INSL-3 punya

dengan kemaknaan < 0,05.

hubungan bermakna dengan nonazosperma oleh


multipariat logistik regresi (p=0,03). Setelah 6 bulan
pengobatan tingginya konsentrasi serum INSL-3
berhubungan dengan produksi sperma yang
persisten.