Anda di halaman 1dari 9

Analisa panjang fragmen gen aflR menggunakan restriksi PCR untuk diferensiasi dan deteksi Aspergillus flavus dan

Aspergillus parasiticus pada jagung D. Somashekar, E.R. Rati, A. Chandrashekar*


Food Microbiology Department, Central Food Technological Research Institute, Mysore-570 013, Karnataka, India Diterima 19 May 2003; diterima dalam bentuk direvisi 21 October 2003; diterima 23 October 2003

Abstrak Kontaminasi makanan dan bahan pakan oleh Aspergillus spesies dan hasil metabolismenya yang bersifat racun adalah masalah serius karena memiliki efek buruk pada kesehatan manusia dan hewan. Oleh karena itu, pemantauan kontaminasi makanan merupakan hal yang penting karena dapat memberikan informasi tentang tingkat dan jenis kontaminasi. Sebuah metode berbasis PCR untuk deteksi Aspergillus spesies dikembangkan dengan menggunakan tepung jagung yang steril sebagai sampelnya. Primer spesifik dirancang untuk aflR gen dan RFLP dari produk PCR dilakukan untuk membedakan Aspergillus flavus dan Aspergillus parasiticus. Tepung jagung yang steril diinokulasi secara terpisah dengan A. flavus dan A. parasiticus, masing-masing diinokulasi di beberapa konsentrasi spora. Hasil positif diperoleh setelah inkubasi 12 jam dalam media yang diperkaya, dengan ekstrak jagung diinokulasi dengan A. flavus (101 spora / g) dan A. parasiticus (104 spora / g). Produk PCR dianalisa menggunakan enzim restriksi endonuklease (HincII dan PvuII) untuk melihat RFLPs. Pola PCR-RFLP yang diperoleh dengan kedua enzim tersebut menunjukkan perbedaan yang cukup untuk membedakan A. flavus dan A.parasiticus. Metode ini dapat digunakan untuk membedakan kedua spesies karena lebih sederhana, lebih murah, dan lebih cepat daripada konvensional sekuensing produk PCR. Kata Kunci : Aspergillus flavus; Aspergillus parasiticus; Maize; PCR; RFLP; aflR 1. Pendahuluan Aflatoksin adalah senyawa metabolit sekunder yang beracun yang diproduksi terutama oleh Aspergillus flavus dan Aspergillus parasiticus (Bennett dan Papa, 1988). Makanan dan bahan pakan rentan terhadap invasi oleh aflatoxigenic yang dihasilkan dari Aspergillus spesies selama pra-panen, pengolahan, pengangkutan atau penyimpanan. Aflatoksin yang mengontaminasi bahan pakan juga dikaitkan dengan tingginya insiden kanker hati pada manusia (Berry, 1988; Stark, 1980). Tingkat serangan jamur dan identifikasi spesies masih penting karena bisa memberikan indikasi kualitas bahan serta potensi kehadiran mikotoksin (Shapira et al., 1996). Metode konvensional untuk mengidentifikasi dan

mendeteksi jamur ini dalam makanan yang hanya mengandalkan metode mikroskopis atau pengkulturan memakan waktu dan tenaga. Pengembangan metode yang cepat dan sensitif untuk deteksi dan diferensiasi spesies aflatoxigenic di makanan diperlukan untuk memperkirakan potensi resiko kesehatan dari makanan. Dalam hal ini, deteksi berbasis DNA seperti PCR lebih sensitif, spesifik, dan sudah sering dilakukan untuk deteksi jamur aflatoxigenic (Shapira et al, 1996;. Farber et al, 1997;. Sweeney et al, 2000;. Chen et al, 2002). A. flavus, A. parasiticus, A. oryzae dan A. Sojae termasuk dalam kelompok Aspergillus telah menunjukkan memiliki koresponden cDNA yang tinggi (69 100%) dan ukuran genom yang sama (Kurtzman et al., 1986). Dua jamur penting ini, A. flavus dan A. Parasiticus yang bertanggung jawab dalam pembusukan makanan dibedakan dengan identifikasi taksonomi pada tingkat morfologi dimana membutuhkan keahlian mikologi dan memakan waktu. Media yang umum digunakan untuk membedakan Aspergillus tidak bisa membedakan kedua

spesies ini (Pitt et al., 1983). Beberapa gen dan enzim yang terlibat dalam aflatoksin biosintesis telah diidentifikasi, dikloning dan dimurnikan; termasuk regulasi gen lokus aflR dari A. flavus dan A. parasiticus (Chang et al, 1993;.. Payne et al, 1993; Bennett et al, 1994).. Produk aflR dikenal untuk mengatur gen struktural secara positif pada tingkat transkripsi (Woloshuk dan Prieto, 1998). Metode berbasis PCR untuk identifikasi Aspergillus spesies berfokus pada amplifikasi daerah yang conserved dari DNA dan mensekuensing gen untuk membedakan Aspergillus spesies (Chang et al, 1995;. Shapira et al, 1996;. Farber et al, 1997; Criseo et al, 2001). Variasi dalam urutan DNA dapat dideteksi dengan RFLP analisis. Tujuan dari penelitian ini adalah untuk mengetahui tingkat deteksi spora A. flavus dan A. parasiticus dalam sampel jagung dengan PCR dan menggunakan amplifikasi PCR untuk daerah yang terpilih dari aflR gen diikuti dengan analisa situs restriksi dari fragmen-fragmen DNA yang diamplifikasi untuk membedakan kedua spesies.

2. Bahan dan metode 2.1. Organisme dan media Sebuah penjelasan rinci dari strain jamur yang digunakan dalam penelitian ini diberikan pada Tabel 1. Semua strain disimpan sebagai budaya miring menggunakan media potato dextrose agar pada suhu 40 C. 2.2. Deteksi spora jamur dalam tepung jagung Untuk menguji kemampuan PCR untuk mendeteksi aflatoxigenic jamur dalam makanan, disterilkan jagung tanah (masing-masing 1 gr) yang diinokulasi secara terpisah dengan 101-106 spora / g. Jagung tersebut kemudian disuspensi dalam 5 ml media Czapekdox-casein yang berisi (g / l) NaNO3 3.0, K2HPO4 1.0, KCl 0.5, MgSO4 0.5, FeSO4.7H2O 0.01, Kasein hidrolisat 3.5 (Hi Media, Mumbai, India) dan sukrosa 30.0, pH 5.0 dan diinkubasi dalam uji steril. Tabung disimpan di bawah kondisi stasioner pada suhu 300 C. Untuk control, dipakai sample jagung steril tanpa inokulasi. Setelah inkubasi selama periode waktu tertentu, dari masing-masing campuran suspensi yang telah diperkaya, diambil 2 ml bagian dan DNA diekstraksi untuk PCR. 2.3. Isolasi DNA jamur Isolasi DNA dari strain jamur dilakukan sesuai dengan metode Farber dkk. (1997) dengan sedikit modifikasi. Campuran jamur yang telah diperkaya dari sampel jagung pada interval waktu yang berbeda diambil dalam mortar dan tanah dengan manik-manik kaca steril. Setelah itu disuspensikan dalam buffer lisis (50 mM EDTA, 0.2% SDS, pH 8.0) dan dipanaskan sampai 680Cselama 30 menit,

kemudian disentrifugasi selama 15 menit pada 15.000 x gr. Setelah disentrifugasi, supernatan dibawa ke tabung microfuge baru dan ditambahkan 0.3 ml dari 4 M natrium asetat. Setelah itu ditempatkan di atas es selama 1 jam dan disentrifugasi selama 15 menit pada 15.000 x gr. Ekstraksi double fenol-kloroform dilakukan dengan isopropanol presipitasi dan resuspensi dalam 30 l dari TE buffer (10 mM Tris-HCl, 1.0 mM EDTA, pH 8.0). 2.4. Polymerase chain reaction PCR digunakan untuk memperkuat dua fragmen target di A. flavus dan A. parasiticus. Urutan primer untuk aflatoksin gen regulasi (aflR) dirancang menggunakan program software 'Primer-3' (Rozen dan Skaletsky, 1996-1997). Sintesa primer diperoleh dari Sigma, USA. Urutan dari primer yang digunakan sebagai berikut: aflR-1, 5ACCGCATCCACAATCTCAT- 3; aflR-2,5AGTGCAGTTCGCTCAGAACA3 untuk memperkuat fragmen dari 796 bp; nested primer aflR-1a, 5GCACCCTGTCTTCCCTAACA- 3 ; aflR-2b, 5ACGACCATGCTCAGCAAGTA3 untuk memperkuat fragmen 398 bp. Amplifikasi DNA jamur dilakukan dalam total volume reaksi 25 l, yang berisi 1 l DNA yang diekstraksi dari sampel jagung berduri. Campuran reaksi terdiri dari 1 x PCR buffer (10 mM Tris-HCl pH 9.0, 1.5 mM MgCl2, 50 mM KCl dan 0,01% gelatin), 200 M dari setiap deoxynucleoside trifosfat, 4 pmol dari masing-masing primer dan 1,0 U dari Taq DNA Polymerase (Bangalore Genei, Bangalore, India). DNA Template awalnya 0 didenaturasi pada 94 C selama 5 menit. Selanjutnya, total dari 30 siklus amplifikasi dilakukan dalam pemrograman thermocycler (GeneAmp. PCR sistem

9700, Perkin- Elmer, USA). Setiap siklus terdiri dari denaturasi selama 0.3 menit pada 940 C, primer annealing untuk 1.25 menit pada 500 C dan perpanjangan 1.40 menit pada 720 C. Siklus terakhir diikuti oleh ekstensi akhir pada 720 C selama 10 menit. Nested PCR dilakukan dengan menggunakan primer aflR-1a dan-2b, menggunakan produk PCR dari aflR-1 dan aflR-2 sebagai template (setelah dilusi 1:1000) di bawah kondisi di atas. 2.5. Analisis Restriction Site produk PCR Proses produk PCR dengan HincII dan Pvu II (MBI Fermentas, Lithuania) dilakukan pada tabung terpisah dengan volume total 25.5 l. Produk PCR diencerkan tiga kali dengan air suling. Masing-masing reaksi restriksi mengandung 22.5 l produk PCR yang diencerkan (40 g DNA), 10 unit enzim pilihan dan 2 l dari 1 x digestion buffer seperti yang direkomendasikan oleh manufaktur. Campuran reaksi diinkubasi pada 370 C selama 4 jam. Kemudian sampel dibekukan dan diliofilisasi menggunakan Edwards lyophiliser, UK. Sampel kemudian dilarutkan kembali dalam 10 l T.E. dan hasil fragmen dipisahkan dengan elektroforesis pada 1.5% gel agarosa selama 1 jam 45 menit pada 100 V. Double digestion dari produk PCR dari A. flavus dan A. Parasiticus juga dilakukan secara individual. Kondisi untuk double digestion pada dasarnya sama kecuali bahwa 20 unit HincII dan 40 unit Pvu II digunakan dalam 2 x Y+ / Tango universal buffer. Ukuran dari fragmen DNA yang dihasilkan diperkirakan dibandingkan dengan komersial 100-bp DNA ladder (Bangalore Genei). 3. Metode Dalam rangka memeriksa sensitivitas PCR untuk mendeteksi spora Aspergillus dalam sampel jagung berduri, pengayaan dilakukan dengan cara

menggunakan media Czapek-dox, lalu aliquot diambil pada interval waktu yang berbeda yang ditujukan untuk proses ekstraksi DNA. Pasangan primer yang digunakan untuk amplifikasi gen aflR diuji pada aliquot sampel dari kultur yang telah diperbanyak setelah 12 dan 24 jam inkubasi dengan konsentrasi spora 101-106 dari A. flavus serta A.parasiticus. Hasil

positif diperoleh dengan cara PCR setelah 12 jam perbanyakan koloni A. flavus pada konsentrasi 101-106 . Spora A. Parasiticus dibiarkan berkecambah untuk menghasilkan sel-sel misel dalam medium Czapekdox selama 12 jam. Sampel yang telah diperbanyak dibentuk dari produk PCR 796 bp dengan menggunakan primer aFlR pada konsentrasi spora 104-106 , tetapi tidak pada konsentrasi 101-102. PCR prduk tidak terdapat pada sample jagung yang tidak terinokulasi, yang ditampilkan sebagai kontrol (Fig. 2). Sampel yang diambil pada waktu 0 hingga 6 jam tidak terdapat amplikon, sedangkan sampel yang diambil pada waktu 36 jam dapat menunjukan hasil amplifikasi dari gene aFlR pada kedua kultur. Peningkatan konstan dari intensitas amplikon juga diikuti dengan peningkatan jumlah sel. Untuk A. Flavus dan A.parasiticus, amplicon 796 bp telah dikonfirmasi kembali keberadaannya dengan menggunakan amplicon tersebut sebagai template dalam nested PCR. Primer-primer dari nested PCR telah

dibentuk dan diperkirakan memiliki ukuran amplikon sebesar 398 bp. DNA dari A.oryzae dan A.sojae juga ditujukan untuk PCR yang menggunakan primer aFlR, tetapi tidak terlihat adanya amplikon.

dan PvuII) yang dapat digunakan untuk membandingkan spesies yang telah disebutkan (Fig. 3). Menurut analisa sekuens yang didapat, terdapat 2 situs restriksi untuk PvuII dalam sekuens A. Parasiticus yang seharusnya dapat membagi produk PCR menjadi 3 fragmen 413,239, dan 144 bp. Namun, hanya terdapat 1 situs restriksi untuk enzim ini pada sekuens A. Flavus, yang dapat membagi sekuens tersebut menjadi 2 fragmen 652 dan 144 bp (tabel 1, dan Fig. 4).

Variasi dalam sekuens DNA dapat dideteksi dengan menggunakan RFLPPCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction). Oleh karena itu, untuk membedakan antara A. Flavus serta A. Parasiticus, dapat dilakukan metode RFLP-PCR. Dengan perbandingan yang lebih rinci dari peta restriksi produk PCR dari fragmen gen aflR ( Nomor akses genbank dari A. Flavus : AY197608, dan A. Parasiticus AF110766), dapat dilakukan identifikasi terhadap minimal 2 macam enzim endonuclease restriction (HincII

Enzim restriksi HincII dapat memotong produk PCR dari A.flavus pada 2 situs restriksi, sehingga dihasilkan 3 fragmen 385, 250, dan 161 bp. Tetapi, hanya terdapat 1 situs restriksi pada

sekuens A.parasiticus yang menghasilkan 2 fragmen 546 dan 250 bp (tabel 1 dan Fig. 5). Dengan melakukan RFLP-PCR ini, seseorang dapat membedakan 2 fungi yang hampir serupa ini dalam makanan yang terkontaminasi, mengembangbiakkan fungi-fungi tersebut dan mengidentifikasi fungi-fungi tersebut dengan tidak menggunakan prosedur yang panjang dari metode klasifikasi taksonomi. Pencernaan ganda oleh produk PCR dari A.flavus dan A. Parasiticus tidak menunjukkan perbedaan pada pola RFLP (data tidak ditunjukkan). Sebagian besar kerja yang dikutip dari literatur melibatkan monomeric PCR atau multiplex PCR, yang dapat mendeteksi rantai-rantai aflatoksigenik dari A.flavus dan A.parasiticus, tetapi hal ini tidak selalu mentoleransi perbedaan antar kedua spesies tersebut dan strain non-aflatoksigenik (Criseo et al., 2001). Oleh karena itu, kami mempelajari bahwa RFLP-PCR dapat membedakan antara strain aflatoksigenik dan strain nonaflatoksigenik pada A.flavus. Kedua spesies ini ditujukan untuk analisa restriksi dengan menggunakan enzim HincII dan PvuII, tetapi tidak terdapat perbedaan pada panjang fragmen dari kultur aflatoksigenik dan kultur non-aflatoksigenik. 4. Diskusi Metode konvensional dari deteksi spesies Aspergillus memerlukan waktu kurang lebih selama 44 48 jam, tetapi hal tersebut tidak dapat membedakan antara A. flavus dan A. parasiticus, dimana keduanya diketahui memproduksi aflatoksin. Teknik PCR (polymerase chain reaction) untuk kultur murni sedikit lebih mudah untuk dilakukan, bila di bandingkan dengan pendektesian

organisme terkait dalam sampel makanan yang ada. Diketahui bahwa komponen makanan yang terganggu oleh enzim Taq Polymerase akan memberikan hasil negative yang salah (Rossen dkk. 1992). Farber dkk. (1997) mendeteksi produksi aflatoksin oleh strain A. flavus pada buah ara yang terkontaminasi dengan teknik PCR monomerik. Chen dkk. (2002) dapat mendeteksi Aspergillus dengan teknik mulipleks PCR setelah mempengaruhi dan menginkubasi kacang kacangan setelah 7 hari. Shapira dkk. (1996) dengan menggunakan beberapa primer seperti omt-1 dan ver-1 dimana primer primer tersebut mampu untuk mendeteksi spesies Aspergillus pada tepung jagung setelah penginkubasian selama 24 jam pada media yang telah diperkaya. Pada laporan yang diatas nitrogen cair digunakan untuk proses ekstraksi DNA dan deteksi dari spesies Aspergillus memakan waktu lebih lama lagi (>24jam). Metode yang di gunakan pada pembelajaran ini sangatlah mudah dan tidak melibatkan penggunaan nitrogen cair pada proses ekstraksi DNA. Kami mampu mendeteksi A. flavus dan A. parasiticus di waktu yang jauh lebih singkat, yakni pada 12 jam dan pada level 101 untuk A. flavus dan 104 untuk A. parasiticus. Perbedaan tingkat deteksi mungkin lebih dikarenakan oleh kerapuhan sel dinding untuk dilakukan pada teknik ekstraksi DNA. Dinding sel dari A. flavus mungkin lebih rapuh jika dibandingkan dengan A. parasiticus untuk lisis sel dan sangat mungkin bila muncul amplikon dibawah konsentrasi jamur 104 pada A. parasiticus tidak dapat dideteksi dengan gel agarosa. Protocol PCR telah di rancang untuk system kultur murni, tetapi untuk deteksi dari makanan yang sama (sampel yang sama) sangatlah terbatas. Lebih lanjut, jamur dapat ditemui pada makanan

kering dan yang biasanya sangat sering dijumpai adalah spora aseksual atau mycelia yang telah mengering dimana mengandung sebagian kecil dari DNA dan bersifat resisten kepada gangguan saat ekstraksi DNA (Shapira dkk., 1996). Primer yang spesifik untuk fragmen gen aflR dan ukuran amplikon berhubungan dengan ukuran yang diharapkan dan tidak ada band tambahan atau band non-spesifik yang diamati. Nested PCR digunakan terutama untuk mengkonfirmasi keaslian dari PCR primer. Batas deteksi dan waktu inkubasi untuk mendeteksi A. flavus dan A. parasiticus dalam studi kami telah kurang dari yang dilaporkan oleh pekerja lainnya. Tidak ada amplifikasi yang diamati pada A. oryzae dan A. sojae yang telah diuji, kemungkinan karena kurangnya primer yang komplemen dengan daerah penempelan. Sampel tepung jagung yang belum diinokulasi gagal memberikan hasil amplifikasi, memberi indikasi bahwa produk PCR adalah hasil dari sampel buah ara yang terinfeksi Aspergillus. Diferensiasi A. flavus dari A. parasiticus sangat penting karena deferensiasi dalam produksi metabolit. A. parasiticus membuat toksin tipe B dan G, dimana A.flavus hanya membuat toksin tipe B. Secara taksonomi, A. flavus yang telah diselimuti konidia kasar dan sering diproduksi dari bantalan kepala baik metulae dan phialides, sementara itu konidia dari A. parasiticus biasanya terlihat kasar dan sebagian besar kepala beruang phialides saja (Pitt dan Hocking, 1985). Hasil dari RFLPs spesifik berbeda pada sekuens DNA, dimana ukuran fragmen ditentukan oleh aktifitas endonuklease tipe II. RFLPs yang memiliki korelasi dengan beberapa karakter morfologi dan biokimia mungkin

dapat diindentifikasi dan digunakan sebagai sidikjari individual (Michelmore dan Hulbert, 1987). Dalam studi ini, didasari oleh PCR-RFLP, dari dua spesies A. flavus dan A. parasiticus dapat dibedakan. Pola dari PCR-RFLP di tambahkan dengan HincII dan PvuII menunjukkan perbedaan yang cukup untuk membedakan kedua spesies. Hal ini tergantung pada kemiripan ukuran restriksi produk seperti hasil dari situs restriksi serupa (Gambar 3). Sejak kami tidak mendapatkan beberapa strain dari A. parasiticus pada sampel makanan yang diamati jamur aflatoksigeniknya (data tidak ditampilkan), studi yang ada telah memisahkan kepada pembagian dari strain tunggal A. parasiticus dari beberapa strain A. flavus. Bagaimanapun itu, metode ini dapat dibangun untuk membedakan strain lain dari A. parasiticus. Kehadiran studi tidak langsung mendiskriminasikan antara aflaktoksikgenik dan strain non aflaktoksigenik. Hal ini menunjukkan bahwa hanya keberadaan gen yang bertanggung jawab untuk biosintesis aflatoksin tidak perlu menganugerahkan status aflatoxigenicity di spesies Aspergillus. Itu selalu merupakan pengaruh lingkungan yang menentukan apakah gen untuk mengekspresikan atau tetap non-fungsional setiap saat. Oleh karena itu, kehadiran atau kurangnya mRNA dapat memungkinkan diferensiasi langsung antara aflatoxigenic dan strain non-aflatoxigenic. PCR-RFLP, untuk membedakan A. flavus dan A. parasiticus yang digunakan dalam penelitian ini, lebih sederhana, hemat biaya dan lebih cepat daripada sekuensing konvensional PCR produk diikuti oleh perbandingan individu urutan. Terlepas dari beberapa metode yang dijelaskan dalam sastra, metode meyakinkan membedakan antara anggota

yang tergabung dalam grup A. flavus masih kurang. Oleh karena itu ada banyak ruang lingkup untuk mengembangkan secara sederhana dan cepat, metode untuk membedakan spesies milik kelompok A. Flavi. Ucapan Terima Kasih Penulis DS berterima kasih kepada Dr V. Prakash, Direktur, CFTRI Mysore dan CSIR, New Delhi untuk pemberian kesempatan bekerja sebagai seorang Scientist Fellow. Referensi Bennett, J.W., Papa, K.E., 1988. The aflatoxigenic Aspergillus spp. Adv. Plant Pathol. 6, 263 280. Bennett, J.W., Bhatnagar, D., Chang, P.K., 1994. The molecular genetics of aflatoxin biosynthesis. In: Powell, K.A., Renwick, A., Peberdy, J.F. (Eds.), The Genus Aspergillus. Plenum, New York, pp. 51 58. Berry, C., 1988. The pathology of mycotoxins. J. Pathol. 154, 301 311. Chang, P.K., Cary, W.J., Bhatnagar, D., Cleveland, T.E., Bennett, J.W., Linz, J.E., Woloshuk, C.P., Payne, G.A., 1993. Cloning of the Aspergillus apa-2 gene associated with regulation of aflatoxin biosynthesis. Appl. Environ. Microbiol. 59, 3273 3279. Chang, P.K., Bhatnagar, D., Cleveland, T.E., Bennett, J.W., 1995. Sequence variability in homologs of the aflatoxin pathway gene aflR distinguish species in the Aspergillus section Flavi. Appl. Environ. Microbiol. 61, 40 43.

Chen, R.S., Tsay, J.G., Huang, Y.F., Chiou, R.Y.Y., 2002. Polymerase chain reaction mediated characterization of molds belongingto the Aspergillus flavus group and detection of A. parasiticus in peanut kernels by multiplex polymerase chain reaction. J. Food Prot. 65, 840844. Criseo, G., Bagnara, A., Bisignano, G., 2001. Differentiation of aflatoxin producing and non-producing strains of Aspergillus flavus group. Lett. Appl. Microbiol. 33, 291 295. Farber, P., Geisen, R., Holzapfel, W.H., 1997. Detection of aflatoxigenic fungi in figs by a PCR reaction. Int. J. Food Microbiol. 36, 215 220. Kurtzman, C.P., Smiley, M.J., Robnett, C.J., Wicklow, D.T., 1986. DNA relatedness among wild and domesticated species in the Aspergillus flavus group. Mycologia 78, 955959. Michelmore, R.M., Hulbert, S.H., 1987. Molecular markers for genetic analysis of phytopathogenic fungi. Annu. Rev. Phytopathol. 25, 383 404. Payne, G.A., Nystrom, G.J., Bhatnagar, D., Cleaveland, T.E., Woloshuk, C.P., 1993. Cloning of the aflR-2 gene involved in aflatoxin biosynthesis from Aspergillus flavus. Appl. Environ. Microbiol. 59, 156 162. Pitt, J.I., Hocking, A.D., 1985. Fungi and Food spoilage. Academic Press, Australia, pp. 259311. Pitt, J.I., Hocking, A.D., Glenn, D.R., 1983. An improved medium 106 D. Somashekar et al. / International Journal of Food Microbiology 93 (2004) 101107 for the detection of Aspergillus flavus and Aspergillus parasiticus. J. Appl. Bacteriol. 54, 109 114.

Rossen, L., Nosrskov, P., Holmstrom, K., Rasmussen, O.F., 1992. Inhibition of PCR by components of food samples, microbial diagnostic assays and DNA extraction solutions. Int. J. Food Microbiol. 17, 37 45. Rozen, E., Skaletsky, H.J., 1996 1997. Primer 3, http://wwwgenome. wi.mit.edu/genomesoftware/other/primer3.html. Shapira, R., Paster, N., Eyal, O., Menasherov, M., Mett, A., Salomon, R., 1996. Detection of aflatoxigenic molds in grains by PCR. Appl. Environ. Microbiol. 62, 3270 3273. Stark, A.A., 1980. Mutagenecity and carcinogenicity of mycotoxins: DNA binding as possible mode of action. Annu. Rev. Microbiol. 34, 235 262. Sweeney, M.J., Pamies, P., Dobson, A.D.W., 2000. The use of reverse transcription polymerase chain reaction (RT-PCR) for monitoring aflatoxin production in Aspergillus parasiticus 439. Int. J. Food Microbiol. 56, 97103. Woloshuk, C.P., Prieto, R., 1998. Genetic organization and function of the aflatoxin B1. FEMS Microbiol. Lett. 160, 169 176