Anda di halaman 1dari 25

LATAR BELAKANG PCR ..?

1953 Watson and Crick: model the structure of DNA Sanger, Maxam and Gilbert: publish DNA sequencing methods Karry Mullis: invents the concept of PCR

1977 1986

DNA: deoxyribonucleic acid RNA: ribonucleic acid

Fungsi DNA sebagai materi genetik


DNA RNA Protein
Inti Sel genome Sitoplasma

DNA

RNA

mRNA

Protein

Translation Transcription
Watson and Crick (1953): model the structure of DNA

Meniru situasi in vivo Memanfaatkan sifat kimiawi DNA untai DNA pecah pada
suhu tinggi

Pelipatgandaan molekul secara eksponensial 2n Pendeteksian dan visualisasi hasil amplifikasi DNA bukti
Kary B. Mullis At Present Day .

pemeriksaan

Beberapa Point Penting


Reaksi in vitro yang memanfaatkan sifat komplementasi DNA dengan bantuan enzim DNA polimerase. Persyaratan reaksi : DNA templat, enzim DNA polimerase, konstituen nukleotida (dNTPs), bufer yang optimum, Mg2+, primer

Catatan : templat DNA harus sudah diketahui terlebih dahulu

Komplementasi DNA
DNA berkomplemen satu pita dengan pita pasangannya Ujung 5 -> 3 pita atas berpasangan dengan ujung 3 > 5 pita bawah Pemisahan pita terjadi secara kimiawi dan fisika

Prinsip dasar PCR


1. Denaturing DNA ( )
94oC 20 detik

2. Annealing Primer (

)
62oC 20 detik

3. Extend with Polymerase (

)
72oC 30 detik

TAHAPAN PENGERJAAN
1. 2. 3. 4. Ekstraksi DNA/RNA Amplifikasi DNA Electrophoresis UV-trans & Photo

552 bp

M123

FAKTOR KEBERHASILAN DALAM PCR


1. Hindari kontaminasi Ruang dan alat laboratorium: pipet Kontaminasi silang antar sampel Hasil dari hasil amplifikasi sebelumnya 2. Fasilitas laboratorium (ruang yang diperlukan) Persiapan template sebelum PCR Pencampuran bahan amplifikasi Analisa PCR
Mikrotube yang bebas (DNase & RNase) Mikropipet yang hanya digunakan untuk PCR Gunakan ruang khusus (UV) yang dilengkapi mikrosentrifuge & sarung tangan untuk membuat larutan PCR (MMS)

FAKTOR KEBERHASILAN DALAM PCR


3. Penanganan sampel Aseptis, selalu pakai sarung tangan Gunakan selalu alat (gelas/plastik) yang baru atau steril begitu juga pipet

Bahan kimia untuk PCR tidak boleh digunakan untuk yang lain (Lakukan Aliquotasi untuk menghindari kontaminasi)
Ketika melakukan pemipetan, hindari pembentukan udara dalam pipet (dapat mengkontamnasi yang lain) Dalam amplifikasi selalu harus menyertakan sampel Negative (tanpa DNA) dan Postive control (Yg sudah benar teruji positif)

AMPLIFIKASI DNA

Komponen dalam PCR Mix: 1. Primer spesifik 2. dNTP 3. Enzyme Polymerase 4. MgCl 5. Buffer 6. ddH2O

PRIMER SPESIFIK

Forward
Reverse

Bagaimana mendapatkan primer? 1. Beli detection kits: Primer & kontrol positif Lengkap: DNA extraction kits, primer, kontrol pos 2. Beli primer: Supplier tahu sequence primer? 3. Buat sendiri .?

1 51 101 151 201 251 301 351 401 451 501 551 601 651 701 751 801 851

GAATTCCTGGCACTGACCATTTTCATACTGTCTTTTCCCTTTGTT GACAGAGATATGCACGCCAAGTGGGTGCGCAACAAAATAAACCCT AGTAACTGATGATGAAGATTTGGTAGATTCTGGTATTAGGACTAA AATACTCTTCTAAAATTTTTGGTAAAGGATTCAATCCGAGACCTC TCCCTCGACTATCAAGAGAGGATTAAGATATTAAAGTCTCATTTT GAGGACGGGTAATTTCTTTGCTCGAGGCCACTTGGCTCCGGCTGG TTTTCCTCGCTTCAGAGAGATGGGCAACTTTTGCTCTAGAGAATG CCTCAAATACAGAACCATAACAATGGTGAATGGAAAGATATTGAA TGCAAGAACTACGCCAGGTGCCGCGTGGGCTGAGACTGGACCAAT ACCAACACAAGAAGAAGGAATATCTAGACAAGAAGAAGAAGTACA ATCCCTCATGCCCTCTACAAGATTGTGTACGACAAGAATAACAAG GTTCCGTGTACAGCGTGATATGTCTTGGAAATAAAATACATAATT ATTTATATTGTTTTATTTTGTCATTTATTTGATACATTTGTTGTA TAAAGACAATACAGATAATTTTCCTCCATGACGAAACACTGGTGA CTGGAGCTCTGATGAATGTCTTGCCAGATGCCATCCTAGTTTTTC GGGAAGGTGACGTCCGTTTGAGAGAGGGTTCGCTGGGTTTCAACT CAAGAAAATATCCCTTTGTCCAGTGACGGTAAATTGTGTACCGTT GTGTGATGACATTATCCCTCTCTGATTGTTTCAAAGCTT

dNTP deoxyribonucleotide triphosphate


P P P

OCH5 H
OH

Basa

H H

- dATP - dGTP - dCTP - dTTP

Enzyme polymerase
Katalisator reaksi Taq diisolasi dari bakteri Thermus aquaticus enzim tahan panas stabil: tanpa perlu penambahan sampai reaksi selesai

Analisa hasil PCR


1. Elektroforesis - memisahkan zat b/ berat molekul - DNA bergerak ke arah kutub + 2. Pewarnaan DNA Et Br - Et Br berikatan dg DNA - Et Br berpendar dlm sinar UV - Karsinogenik hati-hati (sarung tangan) 3. Visualisasi dg UV-trans - hati-hati merusak mata 4. Dokumentasi hasil bukti hasil pemeriksaan

PEMBACAAN HASIL PCR PADA TRANSILUMINATOR

430 bp. M 1 2 3 4 5 6 7 8 9 10 1 12

Et Br + UV = berpendar

Parameter berpengaruh dalam reaksi PCR :


Kualitas dan kuantitas templat DNA Disain primer dan konsentrasi primer Enzim dan konsentrasi enzim Konsentrasi dNTP Konsentrasi Mg+2 Thermocycler Temperatur annealing dan jumlah siklus Penambahan aditif dan pelarut

Prinsip dasar Elektroforesis


Teknik yg digunakan untuk melihat atau

memisahkan molekul DNA, RNA atau protein menggunakan arus listrik Biasanya menggunakan gel : agarosa atau polyacrylamide Digunakan utk keperluan analisis atau preparasi sampel untuk metode molekular lain, a.l. PCR, kloning, sekuensing DNA, dll.

Elektroforesis DNA digunakan utk memisahkan

fragmen DNA berdasarkan ukuran Ukuran DNA : base pair (bp) atau pasangan basa. Gel yang sering digunakan adalah : - Agarosa : untuk molekul DNA yg relatif besar - Polyacrylamide : untuk DNA yang berukuran pendek, atau yang membutuhkan resolusi tinggi. Seringkali berupa submarine electrophoresis, karena gel tersebut tenggelam dalam buffer. Buffer yang sering digunakan : - TBE (Tris Borate EDTA) atau - TAE (Tris Acetate EDTA

DNA bergerak sesuai dengan ukurannya : fragmen yang

lebih kecil/pendek akan bergerak lebih cepat dibandingkan dengan fragmen yang berukuran lebih besar/panjang. Untuk visualisasi pita/fragmen DNA, gel di warnai dengan pewarna yang berikatan dengan DNA, a.l. EtBr (Ethidium Bromide), Perak nitrat, dll. Untuk EtBr, bisa dilihat dengan bantuan UV illuminator

Factors that have important effects on the mobility of DNA fragments in agarose gels
Agarose Concentration :
[agarose ] Small DNAs fragment sizes separation

Voltage :
move faster

voltage, larger fragments

Electrophoresis Buffer: establish a pH, conductivity


bp Effects of Ethidium Bromide: alters DNA1000 mass ,

rigidity, and mobility.

Ultraviolet transiluminator

Penyinaran hasil elektroforesis DNA di bawah sinar UV