Gabungan Paper Prosto

PENGARUH DENTURE ADHESIVE TERHADAP
PERTUMBUHAN DAN PERUBAHAN

MORFOLOGI Candida albicans
Disadur dari: T. Nomura, et al., Effects of denture adhesives on growth and
morphological transformation of Candida albicans, J Prosthodont Res 2019,
560, 1-7
Dosen Pembimbing: Penyaji:
Putri Welda Utami Ritonga, drg., MDSc, Kristin Halim (190631029)

Sp.Pros(K) Miftah Maharani (190631037)
NIP. 198708182009122005
DEPARTEMEN PROSTODONSIA
FAKULTAS KEDOKTERAN GIGI
UNIVERSITAS SUMATERA UTARA
MEDAN 2020
1
Pengaruh Denture Adhesive Terhadap Pertumbuhan dan

Perubahan Morfologi Candida albicans
ABSTRAK
Tujuan dari penelitian ini adalah untuk melihat pengaruh denture adhesive
(kelompok sediaan krim (Cr), bubuk (Po), dan cushion (Cu)) terhadap pertumbuhan
dan perubahan morfologi Candida albicans yang berhubungan dengan adhesive.
Pada penelitian ini, diperiksa jumlah C. albicans yang melekat, ekspresi gen hifa
spesifik dan gambaran SEM. Metode: resin akrilik dibuat dalam bentuk balok dan
berperan sebagai kontrol (Co). Denture adhesive dalam masing-masing sediaan
dioles pada permukaan balok resin akrilik. Suspensi C. albicans ditanam pada
spesimen dan diinkubasi pada suhu 40C selama 2 jam. Jumlah C. albicans yang
melekat pada setiap spesimen dalam setiap masa inkubasi (1 jam, 2 jam, 3 jam, 6
jam, 12 jam, dan 24 jam) diukur dengan RT-PCR. Kemudian, ekspresi gen hifa
spesifik juga diukur. Permukaan masing-masing spesimen diobservasi di bawah
SEM untuk mendeteksi perubahan menjadi bentuk hifa. Hasil: Laju adhesi inisial
untuk ketiga kelompok tidak mempunyai perbedaan yang signifikan secara statistik.
Jumlah C. albicans yang melekat meningkat seiring bertambahnya waktu untuk
ketiga kelompok, dan jika dibandingkan dengan kelompok kontrol, ketiga
kelompok mempunyai jumlah C. albicans yang lebih banyak secara signifikan.
Pada kelompok Cr dan Po, ekspresi gen hifa spesifik lebih tinggi setelah inkubasi
selama 6 jam. Perubahan menjadi bentuk hifa dapat diamati pada kelompok Cr dan
Po setelah inkubasi selama 6 jam dan 12 jam. Kesimpulan: Pada studi ini, denture
adhesive yang digunakan dapat meningkatkan pertumbuhan C. albicans. Selain itu,
dapat dijumpai adanya perubahan awal menjadi bentuk hifa pada kelompok Cr dan
Po, sehingga penggunaan adhesive jenis krim dan bubuk sebaiknya diawasi.
1. Pendahuluan tiruan menggunakan denture

5,6
Gigi tiruan lepasan dapat adhesive . Denture adhesive
meningkatkan kemampuan mastikasi1, terdapat dalam tipe glue dan liner.
quality of life yang berhubungan Denture adhesive tipe glue
dengan rongga mulut 2,3
, dan diklasifikasikan dalam sediaan krim,
kesehatan secara umum 4
. Pasien bubuk dan lembaran. Banyak produk
dengan resorpsi linggir sisa yang denture adhesive dalam sediaan
parah dan perluasan distal akan tersebut dijual di pasaran. Kegunaan
mengalami retensi dan stabilisasi denture adhesive telah dilaporkan
yang buruk, sehingga dapat untuk meningkatkan kepuasan pasien,
digunakan denture adhesive yang retensi gigi tiruan dan kemampuan
dijual di pasaran. Telah dilaporkan mastikasi 7-10, namun tidak dilaporkan
bahwa sekitar 30% dari pengguna gigi adanya pengaruh lain.
2
Pada beberapa tahun yang lalu, adhesive tidak mempunyai pengaruh

23,24
American College of Prosthodontists . Candida albicans (C. albicans),
11
dan American Dental Association 12 yang dilaporkan mempunyai
melaporkan bahwa penggunaan hubungan erat dengan denture
denture adhesive tipe glue dapat stomatitis, adalah golongan jamur
meningkatkan retensi dan stabilitas (fungi) yang dimorfik (mempunyai
gigi tiruan, dan memberikan quality dua bentuk, yaitu bentuk yeast atau
of life yang lebih baik. Penggunaan bentuk hifa). C. albicans dalam
denture adhesive tipe glue telah bentuk hifa mempunyai kemampuan
diakui dalam beberapa kasus 13-15. Di menginfiltrasi mukosa oral dan
25
samping itu, penggunaan denture bersifat patogenik . Studi
adhesive tipe liner yang tidak sesuai sebelumnya melaporkan bahwa C.
(sediaan cushion) dilaporkan dapat albicans bentuk hifa sering terdeteksi
menyebabkan resorpsi parah dari pada saliva dan palatum pasien
linggir sisa 16-17. dengan denture stomatitis 26. Namun,
Salah satu dampak negatif belum dijumpai laporan dari
dari denture adhesive adalah pengaruh denture adhesive terhadap
munculnya denture stomatitis. Plak perubahan morfologi dari C. albicans.
pada gigi tiruan, terutama oleh oral Pada penelitian ini, untuk
Candida spp., dilaporkan sebagai melihat dampak denture adhesive
penyebab utama denture stomatitis 18- terhadap pertumbuhan dan perubahan
20
. Oral Candida spp. terbukti dapat morfologi C. albicans, kami meneliti
21
melekat pada resin akrilik , tetapi aspek pertumbuhan C. albicans pada
hanya beberapa studi telah diterbitkan masa inkubasi yang berbeda untuk
yang berhubungan dengan laju adhesi denture adhesive. Pada penelitian ini,
dan pertumbuhan pada denture juga diperiksa ekspresi gen hifa
adhesive. Meskipun beberapa studi spesifik (efg1, cph1, hwp1, eap1, dan
telah menyatakan bahwa perlekatan als3) dan menunjukkan perubahan
pada denture adhesive dapat morfologi C. albicans menjadi bentuk
meningkatkan pertumbuhan hifa di bawah scanning electron
22
mikroorganisme oral , studi lain microscope (SEM), karena dengan
juga melaporkan penggunaan denture
3
alat ini dapat dideteksi struktur dipolish dengan kertas waterproof

mikroskopis hifa C. albicans. nomor 400 untuk menyesuaikan
kekasaran permukaan balok-balok
2. Bahan dan Cara tersebut dengan permukaan anatomis
27
2.1 Persiapan fungal strain dan gigi tiruan . Balok resin tersebut
fungal suspension disterilisasi dengan autoklaf pada
Strain dari C. albicans 1210C selama 15 menit. Permukaan
SC5314 dikultur dalam medium balok resin tersebut diobservasi
ekstrak yeast pepton-dekstrosa (YPD) terlebih dahulu apakah terdapat
(Difco Laboratories, Franklin Lakes, pengaruh dari autoklaf. Perbedaan
NJ) pada suhu 370C selama 24 jam tersebut tidak tampak di bawah SEM
dalam kondisi aerobik. Kemudian, (Gambar 1). Selain itu, kekasaran
sel-selnya dikumpulkan dengan permukaan balok resin diukur. Tidak
sentrifugasi (2400 xg, 10 menit, 40C) terdapat perbedaan yang signifikan
dan pelet diatur dengan rumus OD600 secara statistik antara kekasaran
= 2.0 (1.6 x 107 CFU/mL) permukaan sebelum autoklaf (0.782 ±
menggunakan saline buffer fosfat 0.018 µm) dan setelah autoklaf (0.776
steril (PBS) (Nacalai Tesque Inc., ± 0.040 µm).
Kyoto, Japan) untuk mempersiapkan
fungal suspension.
2.2 Persiapan bahan spesimen

Balok resin akrilik dibuat dari
Gambar 1. Gambaran SEM dari balok
resin akrilik polimerisasi panas resin sebelum (kiri) dan sesudah (kanan)
disterilisasi dengan autoklaf
(Acron (pin), GC Corp., Tokyo,
Japan). Mengikuti instruksi pabrik, Terdapat 3 sediaan denture
resin akrilik dituang ke cetakan yang adhesive yang digunakan dalam
terbuat dari plaster yang keras (New penelitian: krim (Cr), bubuk (Po) dan
Fujirock, GC Corp.), di heat-cure dan cushion (Cu) (Tabel 1). Setiap
dipotong menjadi balok dengan sediaan denture adhesive (0.011g)
ukuran 10x10x5mm. Bagian atas, diolesi pada permukaan balok resin
bawah dan samping dari balok resin setipis mungkin. Jumlah ini (0.011 g)
4
adalah jumlah minimum yang spesimen, diikuti preinkubasi pada

diperlukan untuk melapisi permukaan 40C selama 2 jam. Temperatur ini
balok resin dan sekaligus dapat ditentukan untuk mengukur
menunjang pertumbuhan C. albicans kemampuan adesif C. albicans dan
yang melekat pada denture adhesive juga mencegah pertumbuhannya.
kelompok Cr dan Po. Balok resin
tanpa diolesi denture adhesive 2.3.1 Pengumpulan C. albicans
berperan sebagai kelompok kontrol yang melekat pada spesimen
(Co). Setelah preinkubasi,
Tabel 1. Denture adhesive yang digunakan spesimen-spesimen dibersihkan
dalam penelitian
Tipe Krim Bubuk Cushion dengan 500 µL dari larutan saline
(Cr) (Po) (Cu)
Nama New Poligrip Toughgrip buffer fosfat untuk menyingkirkan C.
Poligrip Powder Pink A
Sa Fa albicans yang tidak melekat. Pada
Pabri GlaxoSmithKline Kobayashi saat tersebut, sediaan pada spesimen
k Consumer Phaemaceu
Healthcare Japan tical Co., kelompok Cr dan Po berubah menjadi
K.K (Tokyo, Japan) Ltd (Osaka,
Japan) gel. Spesimen kelompok tersebut
Komp Poly Poly Polyvinyl
osisi (methyl (methyl acetate dikumpulkan dengan cara scraping
vinyl vinyl resin,
ether-alt- ether-alt- Ammonio
dan divortex dengan 1.5 mL larutan
maleic maleic methacrylat saline buffer fosfat. Setelah
anhydrid anhydrid e
e) e) copolymer, disentrifugasi (2400 xg, 40C, 10
sodium / sodium / dehydrated
calcium calcium ethanol, menit), supernatannya dibuang dan
mixed mixed Food red
partial partial no. 3 presipitatnya direaksikan dengan 1.5
salt, salt, aluminum
Carboxy Carboxy lake,
mL 3M larutan NaCl untuk
methyl methyl Purified melarutkan gel tersebut dan dengan
cellulose cellulose water
, Paraffin (alcohol 50 U lyticase (Sigma-Aldrich) untuk
Liquid, containing)
Vaseline menghancurkan dinding sel C.
albicans pada suhu 500C selama 20
menit. Meskipun spesimen kelompok
2.3 Pertumbuhan dan perubahan Cu dan Co tidak berubah menjadi gel,
morfologi C. albicans prosedur yang sama dilakukan untuk
Fungal suspension (100 µL) mempertahankan kondisi yang
ditanamkan pada masing-masing seragam.
5
2.3.2 Perhitungan jumlah C. Tabel 2. Primer yang digunakan dalam

perhitungan RT-PCR
albicans dan laju adhesi inisial
Gen 5’ ke 3’ Panjang
Larutan NaCl dan lyticase produk
(bp)
yang mengandung C. albicans act1 tgctgaacgtatgcaaaagg 197
disentrifugasi (2400 xg, 4 C, 10 0 tgaacaatggatggaccaga
efg1 ccagggtggtgctgctaatag 241
menit), kemudian supernatannya gggtgaagggtgaactgaacc
cph1 aacccggcattagcagtagatg 71
dibuang. Kemudian, mRNA diisolasi cagagtgctaatggtggagaagaa
hwp1 cggaatctagtgctgtcgtctct 99
dari pelet menggunakan Rneasy Mini cgacacttgagtaattggcagatg
eap1 tgtgatggcggttcttgttc 66
Kit (Qiagen, Limburg, the
ggtagtgacggtgatgatagtgaca
Netherlands). Jumlah C. albicans als3 ctggaccaccaggaaacact 122
acctggaggagcagtgaaag
dihitung dengan metode RT-PCR, Laju adhesi inisial (%)
29
menargetkan protein act1 . dihitung dari proporsi jumlah C.
Perhitungan ini menggunakan sistem albicans yang ditanam pada awal
PCR SYBR Green (Real-time PCR penelitian (1.6 x 106 CFU/mL)
Thermal Cycler Dice, Takara Bio dengan jumlah yang melekat pada
Inc.). Larutan PCR tersebut masing-masing spesimen (setelah
mengandung 4 µL dari cDNA yang preinkubasi).
sudah dilarutkan, 12.5 µL dari SYBR
Premix Ex Taq (Perfect Real Time, 2.3.3 Jumlah C. albicans yang
Takara Bio Inc.), 0.5 µL dari masing- melekat pada setiap waktu
masing 10 µM primer (tabel 2), dan inkubasi
7.5 µL air destilasi steril (volume total Setelah preinkubasi,

spesimen-spesimen direndam dalam
25 µL). Keadaan reaksi ini
1.5 mL medium YPD dan diinkubasi
melibatkan denaturasi cDNA pada
pada suhu 370C selama 1, 2, 3, 6, 12,
suhu 950C selama 30 detik, diikuti
dan 24 jam dalam kondisi aerobik.
dengan 40 kali reaksi dua-langkah
Pada setiap masa inkubasi, jumlah C.
pada suhu 950C selama 5 detik dan
albicans yang melekat pada setiap
pada suhu 560C selama 30 detik.
spesimen dihitung dengan metode
Kurva kalibrasi dibuat dengan rumus
yang sama seperti yang dijelaskan
pengenceran OD600 = 2.0 (1.6 x 107
sebelumnya.
CFU/mL) dan mengukur nilai
ambang batas (Ct).
6
2.3.4 Ekspresi gen hifa spesifik 2.3.5 Observasi permukaan

pada setiap masa inkubasi spesimen dengan Scanning
cDNA yang diperoleh dari Electron Microscope (SEM)
spesimen-spesimen dimasukkan Spesimen dipersiapkan
dalam perhitungan RT-PCR, terlebih dahulu direndam dalam 2.5%
menggunakan gen hifa spesifik yaitu, glutaraldehid-0.1M buffer fosfat
enhanced filamentous growth protein (pada suhu 40C selama 2 jam),
30
1 (efg1) , Candida pseudohyphal kemudian direndam dalam 1%
31
regulator 1 (cph1) , hyphal wall osmium tetraoksida-0.1 M buffer
32
protein 1 (hwp1) , enhanced fosfat (pada suhu 40C selama 2 jam).
adherence to polystyrene protein 1 Kemudian spesimen dikeringkan
32
(eap1) , dan agglutinin-like dengan etanol dalam konsentrasi yang
32
sequence 3 (als3) sebagai target. semakin tinggi, diikuti pengeringan
Keadaan reaksinya berupa denaturasi dengan t-butanol (VFD-216, Vacuum
cDNA pada suhu 950C selama 30 Device, Ibaraki, Japan). Spesimen
detik, diikuti dengan 40 kali reaksi yang sudah kering dimasukkan ke
dua-langkah pada suhu 950C selama 5 dalam deposisi uap osmium
detik dan pada suhu 560C selama 30 (OPC60A, Filgen, Inc., Aichi, Japan),
detik. dan permukaan spesimen dapat
Pada tahap ini, ambang batas diamati di bawah SEM (SU8010,
ekspresi gen hifa spesifik Hitachi High Technologies Corp.,
memberikan hasil ketika 100 µL dari Tokyo, Japan) pada voltase 2 kV.
suspensi percobaan diinkubasi dalam
1.5 mL medium YPD dalam kondisi 2.4 Analisis statistik
yang sama. Karena C. albicans tidak Hasil yang didapat dari 10
terbentuk menjadi hifa, melainkan percobaan independen disajikan
bentuk yeast dalam medium YPD 25, dalam bentuk mean dan standar
sifat ini digunakan sebagai ambang deviasi, dan setelah perbandingan
batas untuk mendeteksi ekspresi gen menggunakan uji Kruskal-Wallis dan
hifa spesifik. analisis post-hoc dengan metode
Bonferroni. Software statistik yang
digunakan adalah JMP 13.2.1 (SAS
7
Institute Inc., Cary, NC, USA), 3.2 Laju adhesi inisial

dengan nilai p<0.05 tergolong Laju adhesi inisial dari C.
signifikan. albicans pada spesimen kelompok Cr,
Po, Cu dan Co adalah 3,15; 3,65; 3.02;
3. Hasil dan 3,45% secara berurutan.
3.1 Persiapan kurva kalibrasi Perbedaan statistik yang signifikan
antara densitas C. albicans tidak ditemukan (p>0,05) (Gambar 3).
dan Ct
Kurva kalibrasi metode RT-
PCR yang menargetkan gen act1
diproduksi dengan rumus
pengenceran OD600 = 2.0 (1.6 x 107
CFU/mL) dan mengukur nilai Ct.
Gambar 3. Laju adhesi inisial C. albicans
Gambar 2 menunjukkan kurva pada setiap spesimen. C. albicans
kalibrasi yang berkaitan dengan diinkubasi pada suhu 4o selama 2 jam.
Laju adhesi inisial dihitung dari rumus
densitas C. albicans dan Ct. Sebuah berikut. Laju adhesi inisial (%) =
(jumlah C.albicans yang melekat (1.6 106
hubungan invers yang linear dapat CFU) x 100.
diamati antara densitas C. albicans
3.3 Jumlah C. albicans yang
(1.6 x 102 – 1.6 x 106 CFU/mL) dan
melekat pada setiap waktu
Ct (R2 = 0.9999). Rumus yang
menggambarkan hubungan kedua inkubasi
Jumlah dari C. albicans yang
variabel adalah Ct = -1.479ln(x) +
melekat ke spesimen mengalami
40.556.
peningkatan seiring waktu pada
semua kelompok. Laju
pertumbuhannya tidak konstan,
terjadinya peningkatan pada 2 jam
pertama, kemudan laju pertumbuhan
yang menurun. Jumlah dari C.
Gambar 2. Kurva kalibrasi antara albicans yang melekat pada spesimen
densitas C.albicans dan Ct. Kurva
kalibrasi menunjukkan hubungan linear kelompok Cr, Po dan Cu adalah
yang baik dari range 1.6 x 102 – 1.6 x 106
CFU/mL. secara signifikan lebih tinggi
dibandingkan pada spesimen
8
kelompok Co saat diinkubasi pada dengan kelompok kaldu setelah

waktu yang sama (Gambar 4). diinkubasi selama 6 jam dan 12 jam.
Ekspresi gen cph1 dan eap1 adalah
lebih tinggi pada spesimen kelompok
Cr dan Po setelah diinkubasi selama 6
dan 12 jam, dan ekspresi gen als3 dan
hwp1 adalah lebih tinggi pada
spesimen kelompok Cr dan Po setelah
Gambar 4. Jumlah perlekatan C. albicans

diinkubasi selama 6 jam.
pada setiap waktu inkubasi
Jumlah C. albicans pada setiap waktu
inkubasi (1, 2, 3, 6, 12, dan 24 jam)
ditunjukkan:
(#) adanya perbedaan yang signifikan
secara statistik antara Cu dan Cr
(p<0,05).
($) adanya perbedaan yang signifikan
secara statistik antara Co dan Po
(p<0,05).
(+) adanya perbedaan yang signifikan
secara statistik antara Co dan Cu
(p<0,05).
3.4 Ekspresi gen hifa spesifik

Ekspresi gen hifa spesifik dari Gambar 5. Ekpresi gen hifa spesifik pada
setiap waktu inkubasi.
C. albicans yang melekat pada Ekspresi hifa gen spesifik dari C. albicans
yang melekat pada spesimen pada setiap
spesimen pada setiap waktu inkubasi waktu inkubasi (1, 2, 3, 6, 12, dan 24 jam)
lalu dibandingkan dengan C. albicans
yang ditunjukkan pada gambar 5. yang diinkubasi pada media YPD.
Ekspresi gen tersebut dibandingkan
dengan C. albicans yang diinkubasi 3.5 Identifikasi bentuk C.
pada media YPD (kaldu). Ekspresi albicans
gen efg1 pada spesimen kelompok Cr Gambar 6 menunjukkan
adalah lebih tinggi dibandingkan permukaan dari spesimen pada setiap
dengan kelompok kaldu setelah waktu inkubasi yang digambarkan
diinkubasi selama 6 jam. Ekspresi gen menggunakan SEM dengan
efg1 pada spesimen kelompok Po pembesaran 1000x. Kebanyakan
adalah lebih tinggi dibandingkan spesimen C. albicans ada dalam
9
bentuk yeast pada inkubasi selama 3 sedikit yang menunjukkan perubahan

jam pertama pada semua kelompok. morfologi menjadi bentuk hifa, yang
Selanjutnya, bentuk hifa diobservasi dapat berbahaya bagi mukosa oral.
setelah 6 jam inkubasi pada spesimen Oleh karena itu, pada penelitian ini,
Cr dan Po dan setelah 12 jam inkubasi peneliti berfokus terhadap ekspresi
pada semua kelompok. dari gen hifa spesifik dan perubahan
morfologi menjadi bentuk hifa dari C.
albicans dengan menggunakan
bantuan SEM serta melihat jumlah sel
yang melekat pada denture adhesive
pada setiap waktu inkubasi. Pada
penelitian ini, jumlah C. albicans
yang melekat pada setiap spesimen
dihitung menggunakan RT-PCR.
Karena kurva kalibrasi antara densitas
C. albicans dan Ct menunjukkan
Gambar 6. Identifikasi bentuk C.
albicans. adanya suatu hubungan invers linear
Pembesaran SEM 1000x pada setiap yang kuat (R2 = 0.9999), hal ini
spesimen yang diinkubasi selama 3, 6, dan
12 jam. dianggap dimana perhitungan gen
Lingkaran putih menunjukkan bentuk
yeast dan panah putih menunjukkan dapat dihasilkan dengan akurasi yang
bentuk hifa.
tinggi.
4. Diskusi Tidak terdapat perbedaan
Meskipun sudah ada beberapa signifikan yang ditemukan pada saat
penelitian mengenai perlekatan C. laju adesi inisial dari C. albicans
albicans ke permukaan resin akrilik antara spesimen kelompok Cr, Po, Cu,
dan bahan soft-lining akrilik 21, 27, 33

, dan Co, dimana semuanya terletak
hanya ada beberapa penelitian saja dalam rentang 3,02-3,75%. Untuk itu,
yang dilaporkan mengenai denture penelitian ini menyimpulkan bahwa
adhesive 22-24. Penelitian sebelumnya penggunaan denture adhesive tidak
mengenai denture adhesive dimana memiliki pengaruh pada adhesi inisial
fokus utamanya adalah terhadap dari C. albicans. Hasil penelitian ini
jumlah mikroorganisme, dan masih konsisten dengan hasil penelitian

10
yang dilakukan oleh Sampaio-Maia setelah pasien membersihkan gigi

dkk. 22 tiruan mereka secara mekanis,
Jumlah dari C. albicans yang dimana dalam penelitian in vitro pada
melekat pada spesimen meningkat penelitian ini, peneliti menghitung
seiring waktu pada semua kelompok. jumlah sel yang melekat tanpa
Laju pertumbuhannya tidak konstan, dilakukan pembersihan secara
karena diamati adanya peningkatan mekanis terlebih dahulu dengan
pada 2 jam pertama. Kecendrungan tujuan hanya untuk menginvestigasi
proliferasi dari C. albicans yang jumlah sel yang melekat, tidak
diamati pada penelitian ini adalah termasuk faktor-faktor lainnya.
22-24
konsisten seperti yang pernah Penelitian lainnya telah
dilaporkan sebelumnya 34. Penurunan melaporkan hasil penelitian yang
pada laju pertumbuhan dengan waktu berbeda dengan penelitian ini.
inkubasi yang diperpanjang mungkin Penelitian tersebut menghitung
disebabkan dari adanya defisiensi jumlah koloni yang terbentuk dengan
nutrisi pada medium YPD dan kadar menginkubasi ulang mikroorganisme
C. albicans yang terlalu jenuh dari yang telah diinkubasi. Namun, pada
pada permukaan balok resin. penelitian ini, kami menggunakan
Jumlah sel yang melekat pada perhitungan RT-PCR untuk
spesimen kelompok Cr, Po, dan Cu menghitung jumlah dari C. albicans.
adalah lebih besar secara signifikan Perbedaan metodologi ini mungkin
dibandingkan dengan yang melekat memberi kontribusi terhadap hasil
pada spesimen kelompok Co pada penelitian yang berbeda. Selanjutnya,
waktu inkubasi yang sama. Hasil faktor fisik dari denture adhesive,
penelitian ini tidak sama dengan seperti komponen, viskositas,
23
penelitian Ozkan dkk. , yang kemampua penyerapan air, dan
melaporkan tidak terdapat perbedaan tekstur permukaan, pada setiap
yang signifikan pada laju penelitian mungkin memberikan
pertumbuhan pada denture adhesive pengaruh terhadap hasil yang berbeda,
dan resin akrilik. Secara spesifik dimana perlu dilakukan penelitian
23
Ozkan dkk. , mengukur jumlah C. lebih lanjut.
albicans yang melekat secara in vivo
11
C. albicans diklasifikasikan pada kelompok Cr dan Po dengan

sebagai fungus dimorfik yang dapat menggunakan SEM. Hasil obervasi
ditemukan dalam bentuk yeast atau ini mengkonfirmasi hasil penelitian
hifa. Perubahan morfologi dari yeast tersebut.
menjadi bentuk hifa memberikan Di samping itu, ekpresi gen
pengaruh terhadap patogenitas dari C. hifa spesifik pada spesimen kelompok
albicans. C. albicans secara umum Co dan Cu adalah tidak lebih besar
sering dijumpai dalam bentuk yeast, secara signifikan dibandingkan
tapi perubahan morfologi menjadi dengan kelompok kaldu pada setiap
bentuk hifa yang terjadi dibawah waktu inkubasi. Hasil penelitian ini
kondisi defisiensi nutrisi. Bentuk hifa menunjukkan bahwa ekspresi gen
yang terbentuk pada keadaan tersebut hifa spesifik terjadi lebih awal pada
menginvasi mukosa oral untuk kelompok Cr dan Po dibandingkan
25
mendapatkan nutrisi. Mayer dkk. dengan kelompok Co dan Cu.
melaporkan bahwa mukosa oral akan Spesimen pada kelompok Cr dan Po
mengalami inflamasi saat hifa dari C. berubah menjadi bentuk gel dengan
albicans penetrasi ke mukosa. Oleh penyerapan kelembaban, dan hal ini
karena itu, pada penelitian ini, peneliti menjadi sulit untuk menyediakan
memeriksa ekspresi gen hifa spesifik suplai nutrisi dan oksigen ke dalam
(efg1, cph1, eap1, als3, dan hwp1) denture adhesive yang sudah
pada setiap waktu inkubasi. Ekspresi berbentuk gel. Sebagai hasilnya, C.
gen hifa spesifik diperiksa pada albicans yang sedang berkembang di
spesimen kelompok Cr dan Po dalam struktur gel berada pada
dimana hasilnya adalah signifikan keadaan nutrisi yang buruk, sehingga
lebih tinggi dibandingkan pada perubahan menjadi bentuk hifa akan
kelompok kaldu setelah diinkubasi terjadi lebih awal. Diasumsikan
selama 6 jam. Hasil ini menunjukkan dimana denture adhesive (sediaan Cr
bahwa perubahan morfologi menjadi dan Po) digunakan pada situasi klinis,
bentuk hifa dapat terjadi dalam kurun morfologi C. albicans dapat berubah
waktu inkubasi 6 jam pada kelompok menjadi bentuk hifa lebih awal.
Cr dan Po. Dengan tambahan, bentuk Sebagai tambahan, C.albicans dapat
hifa juga diamati saat 6 jam inkubasi berpenetrasi ke dalam mukosa dan
12
menyebabkan stomatitis oral setelah 5. Kesimpulan

perubahan morfologi menjadi bentuk Dengan adanya keterbatasan
35
hifa . Untuk itu, penggunaan pada penelitian ini, maka kesimpulan
denture adhesive (sediaan Cr dan Po) yang diperoleh adalah: C. albicans
dengan periode yang lama dapat dapat melekat pada denture adhesive
meningkatkan patogenitas dari C. sama halnya pada gigi tiruan basis
albicans dan meningkatkan pengaruh resin akrilik. Penggunaan denture
yang berbahaya pada mukosa oral. adhesive pada penelitian ini tidak
Penelitian ini mempunyai mempengaruhi laju adhesi inisial, tapi
batasan. Penelitian ini merupakan mempengaruhi proses percepatan
penelitian in vitro yang dilakukan pertumbuhan. Selain itu, adanya
dengan menggunakan satu spesies perubahan awal menjadi bentuk hifa
fungi, yang membuat hal ini berbeda dijumpai pada denture adhesive
dari keadaan rongga mulut dimana dalam sediaan Cr dan Po, dimana
dapat dijumpai berbagai spesies penggunaannya harus lebih berhati-
mikroorganisme lainnya. Selanjutnya, hati.
faktor-faktor seperti jumlah saliva
dan pengaruh antimikroba saliva, DAFTAR PUSTAKA
pengaruh self-cleansing oleh 1. Liedberg B, Spiechowicz E,
pergerakan jaringan lunak dan Owall B. Mastication with and
without removable partial
pembatasan suplai oksigen terhadap
dentures: an intraindividual
C. albicans yang terdapat pada study. Dysphagia
permukaan anatomis gigi tiruan tidak 1995;10:107–12.
dipertimbangkan. Namun, penelitian 2. Shigli K, Hebbal M.
Assessment of changes in oral
lebih lanjut mengenai isolasi Candida
health-related quality of life
dengan varietas yang lebih luas dari among patients with complete
spesies Candida di dalam suatu denture before and 1 month
post-insertion using Geriatric
biofilm yang terisolasi, dibandingkan
Oral Health AssessmentIndex.
dengan isolasi plantonik yang Gerodontology 2010;27:167–
digunakan dalam penelitian ini dapat 73.
3. Yamamoto S, Shiga H.
dilakukan untuk menguatkan bukti
Masticatory performance and
yang ada. oral health-related quality of
13
life before and after complete using denture adhesive: a pilot

denture treatment. J study. J Prosthodont
Prosthodont Res 2010;19:443–8.
2018;62:370–4. 11. Shigli K. Aftercare of the
4. Shimazaki Y, Soh I, Saito T, complete denture patient. J
Yamashita Y, Koga T, Prosthodont 2009;18:688–93.
Miyazaki H, et al. Influence of 12. Felton D, Cooper L, Duqum I,
dentition status on physical Minsley G, Guckes A, Haug S,
disability, mental impairment, et al. Evidence-based
and mortality in guidelines for the care and
institutionalized elderly maintenance of complete
people. J Dent Res dentures: a publication of the
2001;80:340–5. American College of
5. Coates AJ. Usage of denture Prosthodontists. J Prosthodont
adhesives. J Dent 2011;20:S1–12.
2000;28:137–40. 13. Munoz CA, Gendreau L,
6. Morizawa M, Hayakawa I. Shanga G, Magnuszewski T,
Survey of the use of denture Fernandez P, Durocher J. A
adhesives in complete denture clinical study to evaluate
wearers. J J Gerodont denture adhesive use in well-
2002;17:135–42 [in Japanese]. fitting dentures. J Prosthodont
7. Kapur KK. A clinical 2012;21:123–9.
evaluation of denture 14. de Oliveira Junior NM,
adhesives. J Prosthet Dent Rodriguez LS, Mendoza
1967;18:550–8. Marin DO, Paleari AG, Pero
8. Kelsey CC, Lang BR, Wang AC, Compagnoni MA.
RF. Examining patients’ Masticatory performance of
responses about the complete denture wearers
effectiveness of five denture after using two adhesives: a
adhesive pastes. J Am Dent crossover randomized clinical
Assoc 1997;128:1532– 8. trial. J Prosthet Dent
9. Ozcan M, Kulak Y, de Baat C, 2014;112:1182–7.
Arikan A, Ucankale M. The 15. Quiney D, Nishio Ayre W,
effect of a new denture Milward P. The effectiveness
adhesive on bite force until of adhesives on the retention
denture dislodgement. J of mandibular free end saddle
Prosthodont 2005;14:122– partial dentures: an in vitro
10. Nicolas E, Veyrune JL, study. J Dent 2017;62:64–71.
Lassauzay C. A six-month 16. Ellinger CW. Extensive
assessment of oral damage to the lower ridge
healthrelated quality of life of caused by use of home reliner
complete denture wearers
14
by a patient. Fortn Rev Chic 23. Ozkan YK, Uçankale M,

Dent Soc 1965;49:13–5. Ozcan M, Uner N. Effect of
17. Woelfel JB, Kreider JA. denture adhesive on the
Home reliner ruins dentures micro-organisms in vivo.
and causes shrinkage. J Gerodontology 2012;29:9–16.
Prosthet Dent 1968;20:319– 24. Rajaram A, Manoj SS.
25. Influence of 3 different forms
18. Webb BC, Thomas CJ, of a commercially available
Willcox MD, Harty DW, denture adhesive material on
Knox KW. Candida- the growth of Candida species:
associated denture stomatitis. an in vitro study. J Prosthet
Aetiology and management: a Dent 2017;118:379–85.
review. Part 2. Oral diseases 25. Mayer FL, Wilson D, Hube B.
caused by Candida species. Candida albicans
Aust Dent J 1998;43:160–6. pathogenicity mechanisms.
19. Ramage G, Tomsett K, Virulence 2013;4:119–28.
Wickes BL, López-Ribot JL, 26. Bilhan H, Sulun T, Erkose G,
Redding SW. Denture Kurt H, Erturan Z, Kutay O, et
stomatitis: a role for Candida al. The role of Candida
biofilms. Oral Surg Oral Med albicans hyphae and
Oral Pathol Oral Radiol Lactobacillus in denture-
Endod 2004;98:53–9. related stomatitis. Clin Oral
20. Koba C, Koga C, Cho T, Investig 2009;13:363–8.
Kusukawa J. Determination of 27. Yamauchi M, Yamamoto K,
Candida species nestled in Wakabayashi M, Kawano J. In
denture fissures. Biomed Rep vitro adherence of
2013;1:529–33. microorganisms to denture
21. Nevzatoglu EU, Ozcan M, base resin with different
Kulak-Ozkan Y, Kadir T. surface texture. Dent Mater J
Adherence of Candida 1990;9:19–24.
albicans to denture base 28. Scott JH, Schekman R.
acrylics and silicone-based Lyticase: endoglucanase and
resilient liner materials with protease activities that act
different surface finishes. Clin together in yeast cell lysis. J
Oral Investig 2007;11:231–6. Bacteriol 1980;142:414–23.
22. Sampaio-Maia B, Figueiral 29. Cavalcanti YW, Wilson M,
MH, Sousa-Rodrigues P, Lewis M, Williams D, Senna
Fernandes MH, Scully C. The PM, Del-Bel-Cury AA, et al.
effect of denture adhesives on Salivary pellicles equalise
Candida albicans growth in surfaces’ charges and
vitro. Gerodontology modulate the virulence of
2012;29:e348–56. Candida albicans biofilm.
15
Arch Oral Biol 2016;66:129– albicans to denture-base

40. materials with different
30. Toyoda M, Cho T, Kaminishi surface finishes. J Dent
H, Sudoh M, Chibana H. 1998;26:577–83.
Transcriptional profiling of 34. Baillie GS, Douglas LJ. Role
the early stages of germination of dimorphism in the
in Candida albicans by real- development of Candida
time RT-PCR. FEMS Yeast albicans biofilms. J Med
Res 2004;5:287–96. Microbiol 1999;48:671–9.
31. Bandara HM, Cheung BP, 35. Gow NA, Brown AJ, Odds FC.
Watt RM, Jin LJ, Fungal morphogenesis and
Samaranayake LP. Secretory host invasion. Curr Opin
products of Escherichia coli Microbiol 2002;5:366–71.
biofilm modulate Candida
biofilm formation and hyphal
development. J Investig Clin
Dent 2013;4:186–99.
32. Samaranayake YH, Cheung
BP, Yau JY, Yeung SK,
Samaranayake LP. Human
serum promotes Candida
albicans biofilm growth and
virulence gene expression on
silicone biomaterial. PLoS
One 2013;8:e62902.
33. Radford DR, Sweet SP,
Challacombe SJ, Walter JD.
Adherence of Candida
G Model
JPOR 560 No. of Pages 7
journal of prosthodontic research xxx (2019) xxx–xxx
Contents lists available at ScienceDirect
Journal of Prosthodontic Research

journal homepage: www.elsevier.com/locate/jpor
Original article
Effects of denture adhesives on growth and morphological

transformation of Candida albicans
Taro Nomuraa , Tomohiko Murakamia , Yu Shimoyamab , Takuya Kobayashia ,
Junichi Furuyac, Minoru Sasakib , Hisatomo Kondoa,*
a
Department of Prosthodontics and Oral Implantology, School of Dentistry, Iwate Medical University, Morioka, Japan
b
Division of Molecular Microbiology, Department of Microbiology, Iwate Medical University, Yahaba, Japan
c
Oral Health Sciences for Community Welfare, Graduate School of Medical and Dental Sciences, Tokyo Medical and Dental University, Tokyo, Japan
A R T I C L E I N F O A B S T R A C T
Article history: Purpose: We investigated the effects of denture adhesives (cream (Cr), powder (Po), and cushion (Cu)) on
Received 30 December 2018 growth and adhesive-related morphological transformation of Candida albicans. For this purpose, the
Received in revised form 28 February 2019 numbers of adherent C. albicans, hyphae-specific gene expressions, and the SEM images were examined.
Accepted 11 April 2019
Methods: Acrylic resin blocks were prepared as controls (Co). Cr, Po, and Cu were thinly spread on the
Available online xxx
surface of the resin block.C. albicans suspension was seeded on the specimens and incubated at 4 C for
2 h. The numbers of C. albicans adhering to each specimen at each incubation time period (1, 2, 3, 6, 12,
Keywords:
and 24 h) were quantified using real-time RT-PCR. The hyphae-specific genes expressions were
Denture adhesive materials
Candida albicans adhesion
examined. The surface of each specimen was observed under the SEM to detect the transformation to the
Hyphae-Specific gene expression hyphal form.
Results: The initial adhesion rates in all groups were not statistically significant. The numbers of C.
albicans adhering increased with time in all groups, and those adhering to the Cr, Po, and Cu were
significantly greater than that adhering to the Co. In the Cr and Po, the hyphal-specific genes expressions
were higher after incubation for 6 h. The transformation to the hyphal form was identified in the Cr and
Po after incubation for 6 and 12 h.
Conclusions: The denture adhesives used in this study accelerated the growth of C. albicans. Moreover, the
early transformation to the hyphal form on the Cr- and Po-type adhesives was observed, suggesting that
we should carefully use Cr- and Po-type adhesives.
© 2019 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
1. Introduction adhesives has been reported to improve patient satisfaction,

denture retention, and masticatory ability [7–10], while other
The use of removable dentures improves masticatory perfor- effects have not been reported sufficiently.
mance [1], oral health-related quality of life (QOL) [2,3], and In recent years, however, the American College of Prosthodont-
general health [4]. However, patients with poor retention and ists [11] and the American Dental Association [12] have expressed
stability of dentures due to factors such as severe residual ridge consensus on denture adhesives and have reported that the
resorption and distal extension missing may use commercially appropriate use of denture adhesives (especially glue types)
available denture adhesives based on their decision. Approximate- improves denture retention and stability, leading to a better QOL
ly 30% of denture wearers have an experience of applying denture [7–10]. Accordingly, the account of denture adhesives (especially
adhesives has been reported [5,6]. Denture adhesives include the glue types) was well recognized [13–15]. On the other hand,
glue and liner types. The glue-type denture adhesives can be improper usage of the liner-type denture adhesives (cushion type)
classified into the cream, powder, and sheet types. Many such has been reported to cause severe residual ridge resorption [16,17].
products have been developed and marketed. The use of denture One of the adverse effects of denture adhesives is the
occurrence of denture stomatitis. Denture plaque, especially by
oral Candida spp., has been reported as a major cause of denture
stomatitis [18–20]. Oral Candida spp. are well known to adhere to
* Corresponding author at: Department of Prosthodontics and Oral Implantology,
acrylic resin [21], but only a few studies have been published
School of Dentistry, Iwate Medical University, 19-1 Uchimaru, Morioka, Iwate, 020-
8505, Japan. regarding their adhesion and growth on denture adhesives.
E-mail address: hkondo@iwate-med.ac.jp (H. Kondo). Although several previous studies have stated that adherence to
https://doi.org/10.1016/j.jpor.2019.04.006
1883-1958/ © 2019 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: T. Nomura, et al., Effects of denture adhesives on growth and morphological transformation of Candida
albicans, J Prosthodont Res (2019), https://doi.org/10.1016/j.jpor.2019.04.006
G Model
2 T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx
denture adhesives may enhance the growth of oral microorgan- the surface roughness of resin blocks was measured. There were
isms [22], other studies reported no effect of denture adhesives no statistically significant differences between the surface
[23,24]. Candida albicans (C. albicans), which is considered to be roughness (Ra) before autoclaving (0.782 0.018 mm) and the
strongly associated with denture stomatitis, is a dimorphic fungus one after autoclaving (0.776 0.040 mm).
(i.e., it exists as either in yeast or hyphal form). C. albicans in its Three different types of commercially available denture
hyphal form has the ability to infiltrate the oral mucosa and adhesives were used for this study: cream (Cr), powder (Po),
become pathogenic [25]. The previous study has reported that the and cushion (Cu) (Table 1). Each type of denture adhesive (0.011 g)
hyphal form of C. albicans are frequently detected in saliva and was spread on the surface of the resin blocks as thinly as possible.
palate of the patients with denture stomatitis [26]. However, there This amount (0.011 g) was the minimum required to cover the top
have been no reports on the effect of denture adhesives on the surface of the resin blocks as well as to enable harvesting of C.
morphological transformation of C. albicans. albicans adhering to the Cr and Po denture adhesives. The resin
In this study, to reveal the impact of denture adhesives on blocks without adhesives were used as a control (Co).
growth and adhesive-related morphological transformation of C.
albicans, we investigated the growth aspect of C. albicans at 2.3. Growth and morphological transformation of C. albicans
different incubation time points on denture adhesives. We also
examined the expression of hyphae-specific genes (i.e., efg1, cph1, The fungal suspension (100 ml) was seeded onto each specimen,
hwp1, eap1, and als3), and demonstrated the morphological followed by preincubation at 4 C for 2 h. This temperature was
transformation of C. albicans into the hyphal form under the determined to measure only the adhesive ability of C. albicans by
scanning electron microscope (SEM). preventing growth.
2. Materials and methods 2.3.1. Harvesting of C. albicans adhering to each specimen

After preincubation, the samples were rinsed with 500 ml of
2.1. Fungal strain and preparation of fungal suspensions PBS (–) solution to remove the non-adherent C. albicans. At this
time point, the Cr and Po samples had turned into gels. The gelled
The strain of C. albicans SC5314 was cultured in yeast extract– denture adhesives (the Cr- and Po-types) were harvested by
peptone–dextrose (YPD) broth (Difco Laboratories, Franklin Lakes, scraping and vortexed with 1.5 ml of PBS (–) solution. After
NJ) for preculturing at 37 C for 24 h under aerobic conditions. centrifugation (2400 g, 4 C, 10 min), the supernatant was
Then, the cells were collected by centrifugation (2400 g, 10 min, discarded and the precipitate was reacted with 1.5 ml of 3 M NaCl
4 C), and the pellet was adjusted to OD600 = 2.0 (1.6 107 CFU/ml) solution to dissolve the gel and with 50 U of lyticase (Sigma–
using sterilized phosphate-buffered saline (PBS) (Nacalai Tesque Aldrich) to destroy the C. albicans cell walls [28] at 50 C for 20 min.
Inc., Kyoto, Japan) to prepare the fungal suspension. Although the Cu and Co specimens did not form gels, the same
procedure was performed to maintain the same harvest con-
2.2. Preparation of sample materials ditions.
Resin blocks were produced from heat-cured denture base 2.3.2. Quantification of C. albicans and calculation of the initial
acrylic resin (Acron (pink), GC Corp., Tokyo, Japan). Following the adhesion rate
manufacturer’s instructions, the resin was poured into molds The NaCl and lyticase solution containing C. albicans was
made from super-hard plaster (New Fujirock, GC Corp.), heat centrifuged (2400 g, 4 C, 10 min), and the supernatant was
cured, and then cut into 10 10 5 mm blocks. The top, bottom, discarded. Then, mRNA was isolated from the pellets using the
and side surfaces of the resin blocks were polished with #400 RNeasy Mini Kit (Qiagen, Limburg, the Netherlands). Subsequently,
waterproof paper to make the surface roughness of these blocks cDNA was reverse transcribed using the PrimeScrip RT Master Mix
equivalent to that of the mucosal surface of a denture adjusted by (Takara Bio Inc., Shiga, Japan). The numbers of C. albicans were
a carbide bur [27]. The resin blocks were sterilized by autoclaving quantified by quantitative real-time RT-PCR targeting actin 1 (act1,
at 121 C for 15 min. The surface profile of resin blocks was #C113700WA) [29]. A SYBR Green real-time PCR system (Real-time
observed to reveal the influence of autoclaving. The marked PCR Thermal Cycler Dice, Takara Bio Inc.) was used for this
differences of the surface profile between before and after quantification. The PCR solution contained 4 ml of the diluted cDNA
autoclaving were not observed under the SEM (Fig. 1). Moreover, as the template, 12.5 ml of SYBR Premix Ex Taq (Perfect Real Time,
Fig. 1. SEM images of resin blocks before and after autoclaving.

Marked differences of the surface profile between before and after autoclaving were not observed under the SEM (1000).
G Model
T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx 3
Table 1. Denture adhesives used in this study
Type Cream Powder Cushion

Name New Poligrip Sa Poligrip Powder Fa Toughgrip Pink A
Manufacturer GlaxoSmithKline Consumer Healthcare Japan K.K (Tokyo, Japan) Kobayashi Pharmaceutical Co., Ltd (Osaka, Japan)
Composition Poly (methyl vinyl ether-alt-maleic anhydride) Poly (methyl vinyl ether-alt-maleic Polyvinyl acetate resin, Ammonio methacrylate
sodium / calcium mixed partial salt, Carboxymethyl anhydride) sodium / calcium mixed copolymer, dehydrated ethanol, Food red no. 3
cellulose, Paraffin Liquid, Vaseline partial salt, Carboxymethyl cellulose aluminum lake, Purified water (alcohol containing)
Table 2. Primers used in quantitative real-time RT-PCR

tetroxide–0.1 M phosphate buffer (at 4 C for 2 h). They were then
Genes 5’ to 3’ Product length (bp) dehydrated in a series of ethanol in ascending concentrations,
act1 tgctgaacgtatgcaaaagg 197 followed by freeze-drying using t-butanol (VFD-216, Vacuum
tgaacaatggatggaccaga Device, Ibaraki, Japan). The freeze-dried specimens were subjected
efg1 ccagggtggtgctgctaatag 241 to osmium vapor deposition (OPC60A, Filgen, Inc., Aichi, Japan),
gggtgaagggtgaactgaacc and the surfaces were demonstrated using the SEM (SU8010,
cph1 aacccggcattagcagtagatg 71
cagagtgctaatggtggagaagaa
Hitachi High Technologies Corp., Tokyo, Japan) at an acceleration
hwp1 cggaatctagtgctgtcgtctct 99 voltage of 2 kV.
cgacacttgagtaattggcagatg
eap1 tgtgatggcggttcttgttc 66 2.4. Statistical analysis
ggtagtgacggtgatgatagtgaca
als3 ctggaccaccaggaaacact 122
acctggaggagcagtgaaag The results were obtained from 10 independent experiments,
expressed as means standard deviation, and, after multiple
comparison using the Kruskal–Wallis test, post-hoc analysis was
performed by the Bonferroni method. The statistical software used
Takara Bio Inc.), 0.5 ml of each of the 10 mM primers listed in was JMP 13.2.1 (SAS Institute Inc., Cary, NC, USA), with p < 0.05
Table 2, and 7.5 ml of sterile distilled water (total volume 25 ml). considered to be statistically significant.
The reaction conditions involved first heat-denaturing the cDNA at
95 C for 30 s, followed by 40 two-step cycle reactions at 95 C for 3. Results
5 s and then at 56 C for 30 s. The calibration curve was produced
by formulating a dilution series of OD600 = 2.0 (1.6 107 CFU/ml) 3.1. Preparing the calibration curve between the density of C. albicans
and measuring the threshold cycle (Ct) values. and Ct
The initial adhesion rate (%) was calculated from the proportion
of the number of C. albicans initially seeded (1.6 106 CFU) and that The calibration curve of real-time RT-PCR targeting the C.
adhering to each specimen (after preincubation). albicans act1 gene was produced by formulating a dilution series of
OD600 = 2.0 (1.6 107 CFU/ml) and measuring the Ct values. Figure
2.3.3. Adhering number of C. albicans at each incubation time 2 shows the calibration curve related to the density of C. albicans
After preincubation, the specimens were immersed in 1.5 ml of and Ct. A strong linear inverse relationship was noted between the
YPD medium and incubated at 37 C for 1, 2, 3, 6, 12, and 24 h under density of C. albicans (1.6 102–1.6 106 CFU/ml) and Ct
aerobic conditions. At each incubation time, the numbers of C. (R2 = 0.9999). The equation describing the relationship was
albicans adhering to each specimen were quantified by the same Ct = 1.479ln(x) + 40.556.
methods described in subsections 2.3.1. and 2.3.2.
2.3.4. Expression of hyphae-specific genes at each incubation time

cDNA acquired from the specimens was subjected to quantita-
tive real-time RT-PCR, as described in subsection 2.3.2., using
hyphae-specific genes: enhanced filamentous growth protein 1
(efg1, #Q59 67) [30], Candida pseudohyphal regulator 1 (cph1,
#Q59RL7) [31], hyphal wall protein 1 (hwp1, #KHC86638) [32],
enhanced adherence to polystyrene protein 1 (eap1, #G1UBC2)
[32], and agglutinin-like sequence 3 (als3, #Q59L12) [32] as the
targets. The reaction conditions consisted of first heat-denaturing
the cDNA at 95 C for 30 s, followed by 40 two-step cycle reactions
at 95 C for 5 s and then at 58 C for 30 s.
In this experimental procedure, the baseline for hyphae-specific
gene expression was defined as the result when 100 ml of the
experimental suspension was incubated in 1.5 ml of the YPD
medium under the same conditions. Since C. albicans did not exist
in the hyphal form, but rather in the yeast form in the YPD medium
[25], this property of C. albicans was used as the baseline to detect
the expression of hyphae-specific genes.
2.3.5. Observation of the surface of specimens by the scanning electron

microscopy (SEM) Fig. 2. The calibration curve between the density of C. albicans and Ct.
The specimens were prefixed in 2.5% glutaraldehyde–0.1 M The calibration curve showed good linearity in the range from 1.6 102–1.6 106
phosphate buffer (at 4 C for 2 h) and then post-fixed in 1% osmium CFU/ml.
G Model
3.2. Initial adhesion rate
The initial adhesion rates of C. albicans on the Cr, Po, Cu, and Co
specimens were 3.15, 3.75, 3.02, and 3.45%, respectively. Statisti-
cally significant differences were not found (p > 0.05) (Fig. 3).
3.3. Adhering number of C. albicans at each incubation time
The numbers of C. albicans adhering to the specimens increased

with time in all groups. The growth rate was not constant, with a
marked increase for the first 2 h, and a reduced growth rate
subsequently. The numbers of C. albicans adhering to the Cr, Po, and
Cu specimens were significantly higher than that to the Co Fig. 3. Initial adhesion rates of C. albicans on each specimen.
C. albicans was incubated at 4 C for 2 h. The initial adhesion rate was acquired from
specimen at the same incubation time (Fig. 4).
the following formula. Initial adhesion rate (%) = {number of C. albicans adhered /
number of C. albicans initially seeded (1.6 106 CFU)} 100.
3.4. Expression of hyphae-specific genes at each incubation time
The expressions of hyphae-specific genes of C. albicans adhering

to the specimens at each incubation time are shown in Fig. 5. The
expressions were compared with those of C. albicans incubated in
YPD medium (broth). The expression of efg1 on the Cr specimen
was higher than that in the broth after 6 h of incubation. The
expression of efg1 on the Po specimen was higher than that in the
broth after 6 and 12 h of incubation. The expressions of cph1 and
eap1 were higher on the Cr and Po specimens after incubation for 6
and 12 h, and the expressions of als3 and hwp1 were higher on the
Cr and Po specimens after incubation for 6 h.
3.5. Identification of the C. albicans form
Figure 6 shows the surface of the specimens at each incubation

time demonstrated using the SEM at 1000 magnification. Most C.
albicans specimens existed in the yeast form during the first 3 h of Fig. 4. Adhering number of C. albicans at each incubation time.
incubation in all groups. Then, the hyphal form was observed after The number of C. albicans at each incubation time (1, 2, 3, 6, 12, and 24 h) was shown.
6 h of incubation on the Cr and Po specimens and after 12 h of (#) : Indicates statistically significant differences between Co and Cr (p < 0.05).
($) : Indicates statistically significant differences between Co and Po (p < 0.05).
incubation in all groups.
(+) : Indicates statistically significant differences between Co and Cu (p < 0.05).
4. Discussion
the prolonged incubation time may have been caused by
Although there have been some studies on the adhesion of C. nutritional deficiency in the YPD medium and the oversaturation
albicans to acrylic resin and acrylic soft lining materials [21,27,33], of C. albicans on the surface of the resin block.
only a few studies have reported on denture adhesives [22–24]. The cell numbers adhering to the Cr, Po, and Cu specimens were
Previous studies on denture adhesives have focused mainly on the significantly greater than that adhering to the Co specimen at the
number of microorganisms, and very few have demonstrated the same incubation time. This result is inconsistent with that of Ozkan
morphological change to the hyphal form, which harms the oral et al. [23], who reported no significant difference in the growth
mucosa. Therefore, in this study, we focused on the expression of rates on denture adhesives and acrylic resin. Specifically, Ozkan
hyphae-specific genes and SEM demonstration of the morphologi- et al. [23] measured the adhering numbers of C. albicans in vivo
cal changes to the hyphal form of C. albicans in addition to the after patients had cleaned their dentures mechanically, whereas, in
number of cells adhering to denture adhesives at each incubation our in vitro study, we quantified the adhering cell numbers
time. In this study, the number of C. albicans adhering to each without mechanical cleaning to investigate solely the adhering
sample was quantified using quantitative real-time RT-PCR. Since number, excluding other factors. Some other studies [22–24] have
the calibration curve related to the density of C. albicans and Ct reported results different from ours. These studies enumerated the
showed a strong linear inverse relationship (R2 = 0.9999), it was number of colonies formed by re-incubating the harvested
considered that gene quantification could be performed with a microorganisms. However, in this study, we used quantitative
high accuracy. real-time RT-PCR to quantify the numbers of C. albicans. These
No significant differences were noted in the initial adhesion methodological differences may also have contributed to the
rates of C. albicans among the Cr, Po, Cu, and Co specimens, which differences in the results. Furthermore, the physical factors of
all fell in the range of 3.02–3.75%. Hence, this finding suggested denture adhesives, such as the components, viscosity, water
that the use of denture adhesives had no effect on the initial absorbability, and surface texture, in each study may also have
adhesion ability of C. albicans. This result is consistent with that of affected the differences in results, which warrants further detailed
Sampaio-Maia et al. [22]. investigation.
The numbers of C. albicans adhering to the specimens increased C. albicans is classified as a dimorphic fungus that exists in yeast
over time in all groups. The growth rate was, however, not or hyphal form. The morphological change from the yeast to the
constant, as it increased markedly for the first 2 h. The proliferation hyphal form affects the pathogenicity of C. albicans. C. albicans
tendency of C. albicans observed in this study was consistent with usually exists in the yeast form, but its morphological transforma-
that reported elsewhere [34]. The decline in the growth rate with tion to the hyphal form occurs under the condition of nutritional
G Model
Fig. 5. Hyphae-specific genes expression at each incubation time.

The expressions of hyphae-specific genes of C. albicans adhering to the specimens at each incubation time (1, 2, 3, 6, 12, and 24 h) were compared with that of C. albicans
incubated in YPD medium.
(*): Indicates statistically significant difference compared with the expression incubated in YPD medium (p < 0.05).
deficiency. The hyphae formed in such a scenario invade the oral encounter a poor nutrition condition, and the transformation to
mucosa to secure their nourishment. Mayer et al. [25] reported the hyphal form may occur earlier. Assuming that denture
that the oral mucosa becomes inflamed when the hyphae of C. adhesives (Cr- and Po-types) are used in the clinical situation, C.
albicans penetrate it. Therefore, in this study, we examined the albicans may change its morphology to the hyphal form relatively
expression of the hyphae-specific genes (i.e., efg1, cph1, eap1, als3, early. In addition, C. albicans can penetrate the mucosa and cause
and hwp1) at each incubation time. The expressions of all hyphae- oral stomatitis after morphological transformation into the hyphae
specific genes examined on the Cr and Po specimens were form [35]. Therefore, the application of denture adhesives (the Cr-
significantly higher than that in the broth after 6 h of incubation. and Po-types) for a long period might encourage high pathogenic-
These results suggest that the morphological transformation to the ity of C. albicans and increase its harmful effect on the oral mucosa.
hyphal form may have resulted at around 6 h of incubation on the This study had some limitations. This was an in vitro study
Cr and Po specimens. In addition, the hyphal form was observed at performed using a single fungal species, which made it different
6 h of incubation on the Cr and Po specimens under the SEM. This from the actual oral cavity in which various types of micro-
observation confirmed our aforementioned result. organisms exist. Furthermore, factors such as the amount and
On the other hand, the expressions of hyphae-specific genes on antimicrobial effects of saliva, self-purification effects by the
the Co and Cu specimens were not significantly higher than that in movement of soft tissues, and restriction of oxygen supply to the C.
the broth at every incubation time. These results suggest that the albicans that exists on the denture mucosal surface in real time
expression of hyphae-specific genes occurs earlier on the Cr and Po were not considered. However, more investigations with sessile
specimens than on the Co and Cu specimens. As the Cr and Po Candida isolates belonging to a wider variety of Candida species
specimens turn into a gel with moisture absorption, it becomes encased in a biofilm, as opposed to the planktonic isolates used in
difficult to supply nutrition and oxygen into gelled denture the current study, are warranted to further augment the current
adhesives. As a result, C. albicans growing within the gel may evidence.
G Model
Fig. 6. Identification of C. albicans form.

SEM images (1000) of each specimen incubated for 3, 6 and 12 h were shown.
Circle indicates yeast form, arrow heads indicate hyphal form.
5. Conclusion [3] Yamamoto S, Shiga H. Masticatory performance and oral health-related quality
of life before and after complete denture treatment. J Prosthodont Res
2018;62:370–4.
Within the limitations of this study, the following conclusions [4] Shimazaki Y, Soh I, Saito T, Yamashita Y, Koga T, Miyazaki H, et al. Influence of
were drawn: C. albicans could adhere to the denture adhesives in dentition status on physical disability, mental impairment, and mortality in
the same manner as that to acrylic denture base resin. The denture institutionalized elderly people. J Dent Res 2001;80:340–5.
[5] Coates AJ. Usage of denture adhesives. J Dent 2000;28:137–40.
adhesives used in this study did not affect the initial adhesion, but [6] Morizawa M, Hayakawa I. Survey of the use of denture adhesives in complete
affected the acceleration of growth. Moreover, the early transfor- denture wearers. J J Gerodont 2002;17:135–42 [in Japanese].
mation to the hyphal form on the Cr- and Po-type adhesives was [7] Kapur KK. A clinical evaluation of denture adhesives. J Prosthet Dent
1967;18:550–8.
observed, suggesting that we should carefully use Cr- and Po-type
[8] Kelsey CC, Lang BR, Wang RF. Examining patients’ responses about the
adhesives. effectiveness of five denture adhesive pastes. J Am Dent Assoc 1997;128:1532–
8.
[9] Ozcan M, Kulak Y, de Baat C, Arikan A, Ucankale M. The effect of a new denture
Acknowledgements
adhesive on bite force until denture dislodgement. J Prosthodont
2005;14:122–6.
We thank Mr. Kinji ISHIDA and Mr. Katsutoshi OGASAWARA of [10] Nicolas E, Veyrune JL, Lassauzay C. A six-month assessment of oral health-
Technical Support Center for Life Science Research (LSR) of Iwate related quality of life of complete denture wearers using denture adhesive: a
pilot study. J Prosthodont 2010;19:443–8.
Medical University, Iwate, Japan for their help with SEM [11] Shigli K. Aftercare of the complete denture patient. J Prosthodont
observations. This work was supported by JSPS Grant-in-Aid for 2009;18:688–93.
Young Scientists (B) Grant Number JP15K21318. [12] Felton D, Cooper L, Duqum I, Minsley G, Guckes A, Haug S, et al. Evidence-based
guidelines for the care and maintenance of complete dentures: a publication of
the American College of Prosthodontists. J Prosthodont 2011;20:S1–12.
References [13] Munoz CA, Gendreau L, Shanga G, Magnuszewski T, Fernandez P, Durocher J. A
clinical study to evaluate denture adhesive use in well-fitting dentures. J
[1] Liedberg B, Spiechowicz E, Owall B. Mastication with and without removable Prosthodont 2012;21:123–9.
partial dentures: an intraindividual study. Dysphagia 1995;10:107–12. [14] de Oliveira Junior NM, Rodriguez LS, Mendoza Marin DO, Paleari AG, Pero AC,
[2] Shigli K, Hebbal M. Assessment of changes in oral health-related quality of life Compagnoni MA. Masticatory performance of complete denture wearers after
among patients with complete denture before and 1 month post-insertion using two adhesives: a crossover randomized clinical trial. J Prosthet Dent
using Geriatric Oral Health Assessment Index. Gerodontology 2010;27:167–73. 2014;112:1182–7.
G Model
[15] Quiney D, Nishio Ayre W, Milward P. The effectiveness of adhesives on the [26] Bilhan H, Sulun T, Erkose G, Kurt H, Erturan Z, Kutay O, et al. The role of Candida
retention of mandibular free end saddle partial dentures: an in vitro study. J albicans hyphae and Lactobacillus in denture-related stomatitis. Clin Oral
Dent 2017;62:64–71. Investig 2009;13:363–8.
[16] Ellinger CW. Extensive damage to the lower ridge caused by use of home [27] Yamauchi M, Yamamoto K, Wakabayashi M, Kawano J. In vitro adherence of
reliner by a patient. Fortn Rev Chic Dent Soc 1965;49:13–5. microorganisms to denture base resin with different surface texture. Dent
[17] Woelfel JB, Kreider JA. Home reliner ruins dentures and causes shrinkage. J Mater J 1990;9:19–24.
Prosthet Dent 1968;20:319–25. [28] Scott JH, Schekman R. Lyticase: endoglucanase and protease activities that act
[18] Webb BC, Thomas CJ, Willcox MD, Harty DW, Knox KW. Candida-associated together in yeast cell lysis. J Bacteriol 1980;142:414–23.
denture stomatitis. Aetiology and management: a review. Part 2. Oral diseases [29] Cavalcanti YW, Wilson M, Lewis M, Williams D, Senna PM, Del-Bel-Cury AA,
caused by Candida species. Aust Dent J 1998;43:160–6. et al. Salivary pellicles equalise surfaces’ charges and modulate the virulence of
[19] Ramage G, Tomsett K, Wickes BL, López-Ribot JL, Redding SW. Denture Candida albicans biofilm. Arch Oral Biol 2016;66:129–40.
stomatitis: a role for Candida biofilms. Oral Surg Oral Med Oral Pathol Oral [30] Toyoda M, Cho T, Kaminishi H, Sudoh M, Chibana H. Transcriptional profiling of
Radiol Endod 2004;98:53–9. the early stages of germination in Candida albicans by real-time RT-PCR. FEMS
[20] Koba C, Koga C, Cho T, Kusukawa J. Determination of Candida species nestled in Yeast Res 2004;5:287–96.
denture fissures. Biomed Rep 2013;1:529–33. [31] Bandara HM, Cheung BP, Watt RM, Jin LJ, Samaranayake LP. Secretory products
[21] Nevzatoglu EU, Ozcan M, Kulak-Ozkan Y, Kadir T. Adherence of Candida of Escherichia coli biofilm modulate Candida biofilm formation and hyphal
albicans to denture base acrylics and silicone-based resilient liner materials development. J Investig Clin Dent 2013;4:186–99.
with different surface finishes. Clin Oral Investig 2007;11:231–6. [32] Samaranayake YH, Cheung BP, Yau JY, Yeung SK, Samaranayake LP. Human
[22] Sampaio-Maia B, Figueiral MH, Sousa-Rodrigues P, Fernandes MH, Scully C. serum promotes Candida albicans biofilm growth and virulence gene
The effect of denture adhesives on Candida albicans growth in vitro. expression on silicone biomaterial. PLoS One 2013;8:e62902.
Gerodontology 2012;29:e348–56. [33] Radford DR, Sweet SP, Challacombe SJ, Walter JD. Adherence of Candida
[23] Ozkan YK, Uçankale M, Ozcan M, Uner N. Effect of denture adhesive on the albicans to denture-base materials with different surface finishes. J Dent
micro-organisms in vivo. Gerodontology 2012;29:9–16. 1998;26:577–83.
[24] Rajaram A, Manoj SS. Influence of 3 different forms of a commercially available [34] Baillie GS, Douglas LJ. Role of dimorphism in the development of Candida
denture adhesive material on the growth of Candida species: an in vitro study. J albicans biofilms. J Med Microbiol 1999;48:671–9.
Prosthet Dent 2017;118:379–85. [35] Gow NA, Brown AJ, Odds FC. Fungal morphogenesis and host invasion. Curr
[25] Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Opin Microbiol 2002;5:366–71.
Virulence 2013;4:119–28.
Pertanyaan diskusi:
1. Berdasarkan presentasi tadi, terdapat 3 sediaan denture adhesive: cream, powder, dan
cushion. Apa perbedaan cara penggunaan masing-masing?
2. Tadi pada kesimpulan dikatakan penggunaan denture adhesive sediaan cream/powder
harus hati-hati, maksudnya seperti bagaimana?
3. Kesimpulannya tadi adalah denture adhesive dalam sediaan cream dan powder yang
bisa menginduksi perubahan Candida albicans menjadi bentuk hifa, jadi apakah
denture adhesive dalam sediaan cushion yang terbaik? Apa faktor-faktor pertimbangan
lain yang harus diperhatikan dalam pemilihan denture adhesive?
4. Apa yang dimaksud dari ekspresi gen hifa spesifik?
5. Apa yang dimaksud dengan metode RT-PCR yang digunakan untuk menghitung
jumlah Candida albicans?
Disadur dari: T. Nomura, et al., Effects of denture adhesives on
growth and morphological transformation of Candida albicans, J
Prosthodont Res 2019, 560, 1-7
Pembimbing: Penyaji:
Putri Welda Utami Ritonga, drg., MDSc, Sp. Pros (K) Kristin Halim (190631029)
NIP. 198708182009122005 Miftah Maharani (190631037)
Pendahuluan
Pendahuluan
Resorpsi linggir
Retensi dan Denture
sisa yang parah
stabilisasi adhesive
dan perluasan
buruk
distal
Pendahuluan
Kegunaan denture adhesive à meningkatkan
• kepuasan pasien, retensi gigi tiruan dan kemampuan
mastikasi
Salah satu dampak negatif dari denture adhesive à

• denture stomatitis.
Candida albicans à bentuk yeast atau bentuk hifa. C.

• albicans dalam bentuk hifa mempunyai kemampuan
menginfiltrasi mukosa oral dan bersifat patogenik
Pendahuluan
Untuk melihat dampak denture adhesive terhadap pertumbuhan dan
perubahan morfologi C. albicans :
02 Ada/tidaknya
pertumbuhan C.
albicans
Ekspresi gen hifa

spesifik
Perubahan C. albicans
menjadi bentuk hifa di
bawah SEM
Bahan dan Cara
Bahan dan Cara
1. Persiapan fungal strain 2. Persiapan bahan
dan fungal suspension spesimen
1 2
4
4. Analisis 3 3. Pertumbuhan dan
Statistik perubahan morfologi
C.albicans
Bahan dan Cara
1. Persiapan fungal strain
dan fungal suspension
Strain dari C.
Sel-selnya
albicans dikultur
disentrifugasi
dalam medium Fungal suspension
menggunakan
YPD dalam kondisi
larutan PBS steril
aerobik
Bahan dan Cara
Balok resin dari
2. Persiapan bahan
resin akrilik spesimen
polimerisasi panas
Dipotong menjadi
2
balok dengan
ukuran
10x10x5mm.
Balok resin
disterilisasi dengan
autoklaf dan diamati
di bawah SEM
Gambar 1. Gambaran SEM dari balok resin sebelum (kiri) dan
sesudah (kanan) disterilisasi dengan autoklaf
Bahan dan Cara
1 Fungal suspension (100 µL) ditanamkan pada 5 Ekspresi gen hifa spesifik pada setiap
masing-masing specimen (preinkubasi) masa inkubasi
Observasi permukaan spesimen dengan

2 Pengumpulan C. albicans 6
Scanning Electron Microscope (SEM)
3
Perhitungan jumlah C. albicans dan laju
adhesi inisial
4 Jumlah C. albicans yang melekat pada

3 3. Pertumbuhan dan
perubahan morfologi
setiap waktu inkubasi
C.albicans
Bahan dan Cara
Hasil yang didapat dari

10 percobaan à
mean dan standar deviasi
4 Uji Kruskal-Wallis dan

4. Analisis analisis post-hoc dengan
Statistik metode Bonferroni.
Hasil
Hasil
1. Persiapan kurva kalibrasi antara

densitas C. albicans dan Ct
Gambar 2 menunjukkan kurva kalibrasi yang

berkaitan dengan densitas C. albicans dan Ct.
Sebuah hubungan invers yang linear dapat
diamati antara densitas C. albicans dan Ct.
Hasil
2. Laju adhesi inisial dari C. albicans
Laju adhesi inisial dari C. albicans pada

spesimen kelompok Cr, Po, Cu dan Co adalah
3,15; 3,65; 3.02; dan 3,45% secara berurutan.
Tidak terdapat perbedaan yang signifikan
(p>0,05) (Gambar 3)
Hasil
3. Jumlah C. albicans yang melekat

ØJumlah dari C. albicans yang melekat pada

spesimen kelompok Cr, Po dan Cu adalah
secara signifikan lebih tinggi dibandingkan
pada spesimen kelompok Co saat diinkubasi
pada waktu yang sama (Gambar 4).
(#) adanya perbedaan yang signifikan secara statistik antara Cu dan Cr (p<0,05).
($) adanya perbedaan yang signifikan secara statistik antara Co dan Po (p<0,05).
(+) adanya perbedaan yang signifikan secara statistik antara Co dan Cu (p<0,05).
Hasil
4. Ekspresi gen hifa spesifik pada setiap

waktu inkubasi
ØEkspresi gen efg1 pada kelompok Cr à lebih

tinggi dibandingkan dengan kelompok kaldu (6
jam).
ØEkspresi gen efg1 pada kelompok Po à
lebih tinggi dibandingkan dengan kelompok
kaldu (6 dan 12 jam).
ØEkspresi gen cph1 dan eap1 adalah lebih
tinggi (Cr dan Po) setelah 6 dan 12 jam
ØEkspresi gen als3 dan hwp1 adalah lebih
tinggi pada kelompok Cr dan Po setelah 6 jam.
Hasil
5. Identifikasi bentuk C. albicans
ØC. albicans à bentuk yeast pada inkubasi

selama 3 jam pertama pada semua kelompok.
ØDijumpai bentuk hifa setelah 6 jam pada

kelompok Cr dan Po dan setelah 12 jam pada
semua kelompok.
Pembesaran SEM 1000x pada setiap spesimen yang diinkubasi selama 3, 6, dan 12 jam.
Lingkaran putih menunjukkan bentuk yeast dan panah putih menunjukkan bentuk hifa.
Diskusi
Diskusi
Tidak terdapat perbedaan signifikan yang

ditemukan pada saat laju adesi inisial dari
C. albicans antara spesimen kelompok Cr,
Po, Cu, dan Co (3,02-3,75%)
Diskusi
Penurunan pada laju
pertumbuhan à defisiensi
nutrisi pada medium YPD dan
Jumlah dari C. albicans kadar C. albicans yang terlalu
yang melekat à jenuh pada permukaan balok
meningkat seiring waktu resin.
pada semua kelompok
à namun tidak konstan.
Jumlah sel yang melekat

pada kelompok Cr, Po, dan
Cu adalah lebih besar
dibandingkan dengan
kelompok Co pada waktu
inkubasi yang sama.
Diskusi
C. albicans secara Ekspresi gen hifa

umum sering spesifik lebih tinggi
dijumpai dalam Pada penelitian pada kelompok Cr
bentuk yeast, tapi dan Po
ini à ekspresi
perubahan menjadi dibandingkan pada
bentuk hifa à
gen hifa spesifik kelompok kaldu
defisiensi nutrisi. pada setiap setelah 6 jam à
Bentuk hifa à waktu inkubasi. adanya perubahan
menginvasi mukosa menjadi bentuk
oral untuk hifa pada
mendapatkan nutrisi kelompok Cr dan
à inflamasi pada Po, namun tidak
mukosa oral pada kelompok Cu
dan Co.
Diskusi
Spesimen kelompok Cr dan Po berubah menjadi bentuk gel
à rendahnya suplai nutrisi dan oksigen. Akibatnya,
perubahan menjadi bentuk hifa akan terjadi lebih awal.
Penggunaan denture adhesive

(sediaan Cr dan Po) periode yang
Hasil penelitian ini menunjukkan bahwa lama dapat meningkatkan
patogenitas dari C. albicans à
penggunaan denture adhesive (sediaan Cr dan berbahaya pada mukosa oral.
Po) secara klinis, menyebabkan perubahan
C. albicans menjadi bentuk hifa lebih awal.
Kesimpulan
Kesimpulan
C. albicans
dapat melekat
pada denture
adhesive sama
halnya pada
gigi tiruan basis
resin akrilik.
Penggunaan denture Penggunaan denture

adhesive dalam adhesive pada penelitian
ini tidak mempengaruhi
sediaan Cr dan Po
laju adhesi inisial, tapi
harus lebih berhati- mempengaruhi proses
hati (perubahan awal percepatan
menjadi bentuk hifa) pertumbuhan.
Thank you
KEMENTERIAN PENDIDIKAN DAN KEBUDAYAAN
Jl. Alumni No. 2 Kampus USU Medan 20155
Telp.(061) 8216131 Fax.(061) 8213421
Laman: www.fkg.usu.ac.id
Laman : www.fkg.usu.ac.id
DAFTAR HADIR
Penyajian Makalah Dengan Metode Online (Pembelajaran Jarak Jauh)
Pengaruh Denture Adhesive Terhadap Pertumbuhan dan
Perubahan Morfologi Candida albicans
Nama Mahasiswa : Kristin Halim (190631029)

Miftah Maharani (190631037)
Pembimbing : Putri Welda Utami Ritonga, drg., MDSc, Sp. Pros (K)
NIP. 19870818 200912 2 005
Hari/Tanggal : Senin/22 Juni 2020
No. Nama NIM Keterangan

1. Sri Putri Ananda Situmeang 180631155 Hadir
2. Indah Kumala Sari 190631021 Hadir
3. Miftah Maharani 190631037 Hadir
4. Kristin Halim 190631029 Hadir
5. Annisa Rabela 190631001 Hadir
6. Dianta Mayutami Munthe 190631010 Hadir
7. Yussi Faradiba Bangun 190631052 Hadir
8. Khairiyani Asri Hasibuan 190631028 Hadir
9. Mirna RoryYohanita 190631104 Hadir
10. Ikhsan Dani Putra 190631020 Hadir
11. Laras Dwi Yanita 190631030 Hadir
12. Rosa Adani Putri Lubis 190631105 Hadir
13. Diana Verawati Simanjuntak 190631009 Hadir
14. Nabila 190631042 Hadir
15. Yulenda Muliana 180631141 Hadir
16. Calvina Hartanto 190631005 Hadir
17. Indah Permata Sari 190631022 Hadir
18. Nurul Agita Matondang 190631044 Hadir
19. Helen Gabriella Damanik 190631019 Hadir
20. Dian Zuhra 190631095 Hadir
21. Arwin Leonardy 190631002 Hadir
22. Cut Siti Rahma F. 190631007 Hadir
23. Ghina Verina Rahman 190631092 Hadir
24. Rahma Khairunnisa 190631091 Hadir
25. Mutiara Dewi P 190631041 Hadir
26. Yulia Dewi Harianto 190631051 Hadir
27. Mahrizka Desi Ory Lubis 190631033 Hadir
28. Wenny 190631049 Hadir
29. Grace Natalia 190631017 Hadir
KEMENTERIAN PENDIDIKAN DAN KEBUDAYAAN
Jl. Alumni No. 2 Kampus USU Medan 20155
Telp.(061) 8216131 Fax.(061) 8213421
Laman: www.fkg.usu.ac.id
Laman : www.fkg.usu.ac.id
30 Dian Fitriana 190631008 Hadir
31. Fitria Desiana Siregar 190631016 Hadir
32. Kevin Wijaya 190631027 Hadir
33. Keristian Perlindungan Hulu 190631026 Hadir
34. Muhammad Taufan 190631039 Hadir
35. Safira Alifa 190631097 Hadir
36. Febby Nabila Ruvi 190631075 Hadir
37. Sawindri Noviliani 180631129 Hadir
Medan, 22 Juni 2020

Diketahui,
Ketua Departemen Dosen Pembimbing
Syafrinani, drg., Sp.Pros (K) Putri Welda Utami Ritonga, drg.,

NIP. 19570831 198503 2 002 MDSc, Sp. Pros (K)
NIP. 19870818 200912 2 005
TUGAS TAMBAHAN
Paper: Pengaruh Denture Adhesive terhadap Pertumbuhan dan Perubahan

Morfologi Candida albicans
Dosen Pembimbing: Penyaji:
Putri Welda Utami Ritonga, drg., MDSc, Kristin Halim (190631029)

Sp.Pros(K) Miftah Maharani (190631037)
NIP. 198708182009122005
MEDAN 2020
Pendahuluan
Gigi tiruan lepasan dapat meningkatkan kemampuan mastikasi, quality of
life yang berhubungan dengan rongga mulut, dan kesehatan secara umum. Pasien
dengan resorpsi linggir sisa yang parah dan perluasan distal akan mengalami retensi
dan stabilisasi yang buruk, sehingga dapat digunakan denture adhesive yang dijual
di pasaran. 1
Selain memperbaiki retensi dan stabilitas gigi tiruan, pemakaian denture
adhesive juga dapat memberikan kepuasan psikologis kepada pasien, terutama saat
berinteraksi di publik. Namun, denture adhesive sebaiknya tidak digunakan sebagai
satu-satunya metode untuk memperbaiki retensi dan stabilitas gigi tiruan dan
digunakan sesuai dengan indikasi. 2
Indikasi dan Kontraindikasi Denture Adhesive

Indikasi pemakaian denture adhesive : 2
1. Untuk pemakaian gigi tiruan imediat pada masa interim
2. Untuk mencegah munculnya ulser, iritasi jaringan, inflamasi dan kompresi
mukosa oral
3. Pemakai gigi tiruan yang mengalami xerostomia (disebabkan oleh
radioterapi/konsumsi obat-obatan)
4. Untuk stabilisasi gigi tiruan pada pasien dengan perubahan hormonal dan
penyakit neuromuskular, seperti myasthenia gravis, penyakit Parkinson dan
Alzheimer
5. Untuk retensi protesa yang mengoreksi defek maksilofasial
Adapun kontraindikasi pemakaian denture adhesive : 2

1. Alergi terhadap bahan denture adhesive atau komponen-komponennya
2. Resorpsi tulang yang berlebihan dan shrinkage jaringan lunak yang
mengarah pada kehilangan dimensi vertikal
3. Untuk menyatukan gigi tiruan yang patah pada bagian sayap (flange)
4. Pasien yang tidak dapat mempertahankan kebersihan gigi tiruan
Pemakaian denture adhesive hanya boleh sesuai indikasi jika metode-
metode lain untuk meningkatkan retensi dan stabilisasi gigi tiruan sudah dilakukan,
seperti penggunaan saliva reservoir pada pasien xerostomia, perbaikan basis gigi
tiruan, modifikasi bentuk gigi tiruan sesuai dengan keadaan rongga mulut pasien.3
Jenis Denture Adhesive

Denture adhesive tersedia dalam banyak bentuk; salah satu di antaranya
adalah bentuk cream, pasta, gel, powder, cushion, dan sebagainya. Tiga jenis
denture adhesive yang paling sering digunakan adalah dalam bentuk cream, powder,
dan cushion. Adapun perbedaan dari ketiga bentuk denture adhesive dapat diamati
pada tabel 1. 4
Tabel 1. Perbedaan ketiga bentuk denture adhesive
No Cream Powder Cushion
1 Retensi yang baik dan tahan Retensi kurang baik (3 jam) Retensi kurang baik
lama (4-5 jam) dibandingkan cream dan
powder (< 3 jam)
2 Sulit dibersihkan Mudah dibersihkan Paling mudah dibersihkan
(hanya dilepas dari gigi
tiruan)
3 Lebih tahan terhadap Kurang tahan terhadap Kurang tahan terhadap
displacement dibandingkan displacement karena lama displacement
powder kelamaan akan larut
bersama saliva
4 Dianjurkan untuk Dibersihkan secara khemis Dibersihkan secara mekanis
dibersihkan secara khemis
5 Tidak bisa digunakan berkali-kali Bisa digunakan berkali-kali
(2-3 kali)
6 Bisa digunakan pada GTSL Bisa digunakan pada GTSL Tidak bisa digunakan pada
GTSL
Cara aplikasi denture adhesive tipe cream adalah sebagai berikut: cream
seukuran kacang polong (sekitar 5 mm) diaplikasikan pada permukaan intaglio gigi
tiruan yang sudah dibersihkan dan dikeringkan pada regio insisivus dan regio molar.
Pada rahang atas, cream juga diaplikasikan pada regio mid palatum. Gigi tiruan
yang sudah diolesi denture adhesive dipakaikan kembali ke rongga mulut pasien.
Cara aplikasi denture adhesive tipe powder adalah sebagai berikut: powder
diaplikasikan pada seluruh permukaan intaglio gigi tiruan yang sudah dibersihkan
dan dikeringkan (sampai keadaan lembab), kemudian gigi tiruan digoyangkan agar
seluruh permukaan intaglio gigi tiruan tercakup oleh powder. Kemudian powder
yang tersisa dituang dan gigi tiruan dipakaikan kembali ke rongga mulut pasien.3
Instruksi Pengunaan Denture Adhesive
Beberapa instruksi yang harus disampaikan kepada pasien pengguna
denture adhesive: 3, 5
1. Pada pasien pengguna denture adhesive, kontrol berkala setiap 1 bulan
sekali untuk memeriksa kebersihan rongga mulut dan gigi tiruan
2. Pada saat sebelum tidur, gigi tiruan harus dilepas dan dibersihkan secara
mekanis dan khemis
3. Saat membersihkan gigi tiruan, permukaan gigi tiruan disikat dengan sikat
gigi yang soft (bulu yang halus), diikuti perendaman secara khemis (larutan
klorheksidin atau natrium perborat)
4. Permukaan mukosa yang berkontak dengan denture adhesive harus
dibersihkan (dengan sikat gigi halus/kain kassa), kemudian pasien
berkumur dengan obat kumur antiseptik
Kesimpulan
Denture adhesive dapat meningkatkan retensi dan stabilisasi gigi tiruan,
kenyamanan fungsional pasien, mempermudah mastikasi dan meningkatkan
kepercayaan diri pasien. Meskipun penggunaan denture adhesive dapat
meningkatkan fungsi gigi tiruan dan psikologis pasien, penggunaanya harus
berdasarkan pertimbangan dokter gigi terhadap kekurangan gigi tiruan yang
longgar dan keadaan sistemik pasien. Sebaiknya dokter gigi tidak memperkenalkan
penggunaan denture adhesive sebagai solusi untuk gigi tiruan yang tidak stabil, dan
meninjau modifikasi-modifikasi gigi tiruan yang dapat mengembalikan retensi dan
stabilisasi gigi tiruan yang baik. Sebelum pasien menggunakan denture adhesive,
dokter gigi juga harus memberikan edukasi yang menyeluruh mengenai efek
samping dari penggunaan denture adhesive jangka panjang serta meyakinkan
kerjasama pasien agar mengikuti instruksi yang sesuai.3
Daftar Pustaka
1. Yamamoto S, Shiga H. Masticatory performance and oral health-related
quality of life before and after complete denture treatment. J Prosthodont
Res 2018;62:370–4
2. Kumar PR et al. Denture adhesives in prosthodontics: An overview. J Int
Oral Health 2015; 7(1): 93-5.
3. Shankar YR. Denture adhesives for complete denture: A literature review.
Indian J Dent Sci 2010; 1(1): 23-8.
4. El-Mekawy N, Gomaa A, Habib A. Comparison of three different forms of
denture adhesives: Direct measurement of denture retention and, study of
patient satisfaction. Egypt Dent J 2012; 58(3): 1-9.
5. Gantait et al. Comparative assessment of the effectiveness of different
cleaning methods on the growth of Candida albicans over acrylic surface.
Contemp Clin Dent 2016; 7(3): 336-42
POWERPOINT PENDUKUNG

Pembimbing: Penyaji:
Putri Welda Utami Ritonga, drg, MDSc, Sp. Pros(K) Kristin Halim (190631029)
NIP. 198708182009122005 Miftah Maharani (190631037)
DENTURE ADHESIVE YANG DIGUNAKAN
Denture adhesive sediaan Denture adhesive sediaan Denture adhesive sediaan

cream powder cushion
PERBEDAAN KETIGA DENTURE ADHESIVE
Cream Powder Cushion

1 Retensi yang baik dan tahan lama Retensi kurang baik (3 jam) Retensi kurang baik dibandingkan
(4-5 jam) cream dan powder (<3 jam)
2 Sulit dibersihkan Mudah dibersihkan Paling mudah dibersihkan (hanya
dilepas dari gigi tiruan)
3 Lebih tahan terhadap displacement Kurang tahan terhadap displacement Kurang tahan terhadap displacement
dibandingkan sediaan powder karena lama kelamaan akan larut
terhadap saliva
4 Dianjurkan untuk dibersihkan Dibersihkan secara khemis Dibersihkan secara mekanis
secara khemis (permukaan anatomis disikat lembut)
5 Bisa digunakan berkali-kali (2-3 kali)
6 Bisa digunakan pada gigi tiruan Bisa digunakan pada gigi tiruan Tidak bisa digunakan pada gigi tiruan
sebagian lepasan sebagian lepasan sebagian lepasan
C ARA APLIKASI
DENTURE
ADHESIVE CREAM
C ARA APLIKASI DENTURE ADHESIVE POWDER
C ARA APLIKASI DENTURE ADHESIVE CUSHION
RT-PCR
( REAL-TIME POLYMERASE CHAIN REACTION )
• Suatu teknik yang digunakan untuk memonitor progres

reaksi PCR pada waktu yang sama
• Teknik ini tidak hanya mendeteksi keberadaan suatu gen,
tetapi juga mengetahui jumlah gen target pada sampel,
hingga membandingkan ekspresi gen pada sampel (cocok
untuk penelitian tsb) à mengetahui jumlah gen hifa spesifik
pada C. albicans
STRUKTUR C ANDIDA ALBIC ANS
PERTUMBUHAN C ANDIDA ALBIC ANS
DALAM RONGGA MULUT
• Banyak faktor mempengaruhi adhesi dan pembentukan biofilm Candida albicans pada permukaan akrilik
gigi tiruan, pelikel saliva, interaksi hidrofobik dan elektrostatik, ikatan ligan-reseptor. Pertama kali, Candida
albicans melekat pada sel epitel host. Pada gigi tiruan yang tidak rapat dengan jaringan, dapat
menyebabkan iritasi berupa gesekan pada mukosa palatum dan ini dapat menyebabkan infiltrasi Candida
albicans ke dalam lapisan epitel. Pada beberapa kasus, sebuah soft liner gigi tiruan dapat digunakan sebagai
bantalan terhadap mukosa. Namun, bahan yang terkandung dalam soft liner (karet silikon) juga
merupakan suatu permukaan yang mudah dikolonisasi dan diinvasi Candida. Agar dapat mengkolonisasi
mukosa oral, Candida harus tersedia dalam jumlah cukup dan dalam laju pertumbuhan yang tinggi agar
dapat tetap berada pada epitel oral.
• Biofilm Candida albicans berprogresi dalam tiga tahap:
1. Fase pertama/fase awal à berlangsung selama 1-11 jam. Sel Candida melekat pada permukaan substrat dalam 2
jam. Pada permukaan sel Candida, terdapat glikoprotein yang dapat memfasilitasi adhesi yang lebih kuat.
Mikrokoloni mulai terbentuk pada 3-4 jam, dan setelah 11 jam, agregat Candida albicans mulai muncul.
2. Fase kedua/fase intermediat à berlangsung selama 12-30 jam. Komunitas biofilm Candida dapat terlihat sebagai
lapisan ganda yang terdiri dari yeast, tubes muda dan hifa muda, serta substansi polimerik ekstraseluler.
3. Fase ketiga/fase maturasi à berlangsung selama 38-72 jam. Matriks ekstraseluler membesar seiring waktu
inkubasi, dan Candida albicans dalam bentuk yeast, pseudohifa dan hifa mulai tertanam dalam matriks
PERUB AHAN MORFOLOGI C ANDIDA ALBIC ANS
DALAM PEMAKAIAN GIGI TIRUAN
• Candida albicans mampu berubah secara reversibel dari suatu bentuk menjadi bentuk lain (dari bentuk
yeast menjadi bentuk pseudohifa, bahkan menjadi bentuk hifa). Transisi morfologis dari yeast menjadi hifa
merupakan salah satu faktor utama dalam aktivitas patogenik Candida albicans. Pada bentuk hifa, Candida
albicans akan memproduksi asam proteinase yang akan merusak mukosa oral, dan merupakan bentuk
yang lebih berbahaya dibandingkan dalam bentuk yeast.
• Permukaan gigi tiruan yang menghadap jaringan lunak (permukaan anatomis) penuh dengan substansi
nutrisi dan merupakan inkubator ideal untuk spesies seperti Candida albicans. Candida albicans
merupakan mikroorganisme komensal dalam pada 45-65% individual dengan rongga mulut sehat. Pada
pemakai gigi tiruan, prevalensi Candida albicans meningkat hingga 60-100% dan merupakan
mikroorganisme oportunistik. Pemakaian gigi tiruan mengurangi aliran oksigen dan saliva pada jaringan
yang ditutupi gigi tiruan, sehingga menghasilkan lingkungan yang asam dan anaerobik dan merupakan
suatu keadaan yang menunjang pertumbuhan Candida albicans. Selain itu, Candida albicans mempunyai
afinitas terhadap permukaan akrilik dari gigi tiruan dan restorasi gigi.
INDIKASI PEMAKAIAN DENTURE ADHESIVE
1. Untuk pemakaian gigi tiruan imediat pada masa interim

2. Untuk mencegah munculnya ulser, iritasi jaringan, inflamasi dan kompresi mukosa oral
3. Pemakai gigi tiruan yang mengalami xerostomia (disebabkan oleh radioterapi/konsumsi obat-
obatan)
4. Untuk stabilisasi gigi tiruan pada pasien dengan perubahan hormonal dan penyakit
neuromuskular, seperti myasthenia gravis, penyakit Parkinson dan Alzheimer
5. Untuk retensi protesa yang mengoreksi defek maksilofasial
KONTRAINDIKASI PEMAKAIAN DENTURE ADHESIVE
1. Alergi terhadap bahan denture adhesive atau komponen-komponennya

2. Resorpsi tulang yang berlebihan dan shrinkage jaringan lunak yang mengarah pada kehilangan
dimensi vertikal
3. Untuk menyatukan gigi tiruan yang patah pada bagian sayap (flange)
4. Pasien yang tidak dapat mempertahankan kebersihan gigi tiruan
INSTRUKSI UNTUK PASIEN PEMAKAI
DENTURE ADHESIVE
1. Pada pasien pemakai denture adhesive, kontrol berkala setiap 1 bulan sekali à
periksa kebersihan rongga mulut dan gigi tiruan
2. Saat membersihkan gigi tiruan, harus dengan sikat gigi yang soft (bulu yang halus),
diikuti perendaman secara khemis (CHX atau Na perborat)
3. Permukaan mukosa yang berkontak dengan denture adhesive harus dibersihkan
(dengan sikat gigi halus/kain kassa) dan pasien berkumur dengan obat kumur
antiseptik
4. Pada saat sebelum tidur, gigi tiruan harus dilepas
TERIMA KASIH
G Model
journal of prosthodontic research xxx (2018) xxx–xxx
Contents lists available at ScienceDirect
Journal of Prosthodontic Research

journal homepage: www.elsevier.com/locate/jpor
Original article
Masticatory performance and oral health-related quality of life before

and after complete denture treatment
Saori Yamamoto, Hiroshi Shiga*
Department of Partial and Complete Denture, School of Life Dentistry at Tokyo, The Nippon Dental University, Tokyo, Japan
A R T I C L E I N F O A B S T R A C T
Article history: Purpose: To clarify the relationship between masticatory performance and oral health-related quality of
Received 27 September 2017 life (OHRQoL) before and after complete denture treatment.
Received in revised form 13 January 2018 Methods: Thirty patients wearing complete dentures were asked to chew a gummy jelly on their habitual
Accepted 16 January 2018
chewing side, and the amount of glucose extraction during chewing was measured as the parameter of
Available online xxx
masticatory performance. Subjects were asked to answer the Oral Health Impact Profile (OHIP-J49)
questionnaire, which consists of 49 questions related to oral problems. The total score of 49 question
Keywords:
items along with individual domain scores within the seven domains (functional limitation, pain,
Complete denture
Masticatory performance
psychological discomfort, physical disability, psychological disability, social disability and handicap)
OHRQoL were calculated and used as the parameters of OHRQoL. These records were obtained before treatment
OHIP-49 and 3 months after treatment. Each parameter of masticatory performance and OHRQoL was compared
Domain score before treatment and after treatment. The relationship between masticatory performance and OHRQoL
was investigated, and a stepwise multiple linear regression analysis was performed.
Results: Both masticatory performance and OHRQoL were significantly improved after treatment.
Furthermore, masticatory performance was significantly correlated with some parameters of OHRQoL.
The stepwise multiple linear regression analysis showed functional limitation and pain as important
factors affecting masticatory performance before treatment and functional limitation as important
factors affecting masticatory performance after treatment.
Conclusions: These results suggested that masticatory performance and OHRQoL are significantly
improved after treatment and that there is a close relationship between the two. Moreover, functional
limitation was found to be the most important factor affecting masticatory performance.
© 2018 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
1. Introduction measurement of the glucose extraction during chewing of gummy

jelly has attracted close attention, because of the simple
Restoration of masticatory function is one of the main manipulations needed, easy control of hygiene, possibility of
objectives of dental care; hence, many attempts have been made standardization of the physical and other properties of the gummy
to evaluate this function. Masticatory performance is an important jelly as the test food, and reports of a positive correlation between
parameter in evaluating masticatory function objectively. For the masticatory performance as measured by this method and that
many years, masticatory performance has been measured using measured by the sieving method [2].
the sieving method; [1] in this method, the subject chews a test Oral health-related quality of life (OHRQoL) has been increas-
food for a specific number of times, and the crushed test food is ingly recognized as an important outcome of dental care. Among
collected from the oral cavity and divided by sieving according to OHRQoL measures, Oral Health Impact Profile (OHIP) is most
the degree of crushing. However, because of the complicated and widely known and used to evaluate the effect of dental care [3–13].
time-consuming nature of this method, other relatively simpler Many reports have demonstrated that loss of teeth is associated
methods have been attempted in recent years. Among them, with a decline of the masticatory performance or OHRQoL and that
prosthetic treatment brings about improvements in masticatory
performance or OHRQoL [3–30]. It has been reported that the
masticatory performance and OHRQoL of patients wearing
* Corresponding author at: Department of Partial and Complete Denture, School
complete dentures are inferior to those of patients with removable
of Life Dentistry at Tokyo, The Nippon Dental University, 1-9-20 Fujimi, Chiyoda-ku,
Tokyo 102-0071, Japan. partial dentures or natural dentition [9,13,22,24] and are improved
E-mail address: h-shiga@tky.ndu.ac.jp (H. Shiga). after treatment [3–7,9–12,14–19,21,23,25–28,30]. From the results
https://doi.org/10.1016/j.jpor.2018.01.006
1883-1958/ © 2018 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.
Please cite this article in press as: S. Yamamoto, H. Shiga, Masticatory performance and oral health-related quality of life before and after
complete denture treatment, J Prosthodont Res (2018), https://doi.org/10.1016/j.jpor.2018.01.006
G Model
2 S. Yamamoto, H. Shiga / journal of prosthodontic research xxx (2018) xxx–xxx
of the previous reports so far, it is predicted to be high probability 2.3.2. OHRQoL

that improving masticatory function by dental prosthodontic OHRQoL was measured using the Japanese version of the Oral
treatment is related to OHRQoL. In order to demonstrate the Health Impact Profile (OHIP-J49) [31] derived from the English
relationship between masticatory performance and OHRQoL in language version (OHIP-49). The OHIP-J49 is composed of 49
patients wearing complete dentures, the relationship between question items in the following seven domains: functional
these two factors need to be investigated before treatment, where limitation, pain, psychological discomfort, physical disability,
a patient requires new dentures, and after treatment, where a psychological disability, social disability and handicap. For each
patient is satisfied with new dentures. However, while recent question, the subjects were asked how frequently they had
study investigating the relationship between these two factors experienced the event in the last month. Responses were made on
have found a significant correlation after treatment, they have not a scale of 0–4 (0 = never; 1 = hardly ever; 2 = occasionally; 3 = fairly
found a significant correlation before treatment [13]. Thus, the often; 4 = very often). Next, the total score of 49 question items and
relationship between the masticatory performance and OHRQoL the individual domain scores of seven domains were calculated
has not been elucidated to date. Therefore, in this study, we and used as parameters of OHRQoL.
analyzed the masticatory performance and OHRQoL before and Masticatory performance and OHRQoL were evaluated before
after complete denture treatment in order to clarify the relation- treatment and 3 months after treatment.
ship between these two parameters in complete denture wearers.
To clarify the relationship between masticatory performance and 2.3.3. Statistical analysis
OHRQoL is an attempt to make it possible to infer masticatory All the data were analyzed using a statistical software (SPSS for
performance from OHRQoL, and has clinical values to it. Windows 15.0J, Chicago, IL, USA). First, the parameter of
masticatory performance was compared before and after treat-
2. Materials and methods ment by a paired t-test. Normality was checked by a Kolmogorov–
Smirnov test. The parameters of OHRQoL were compared before
2.1. Ethics statement and after treatment by a Wilcoxon signed-rank test. The presence
or absence of a statistically significant correlation between the
All experimental procedures were approved by the Ethics parameter of masticatory performance and the parameters of
Committee of Nippon Dental University (NDU-T2012-29). In- OHRQoL was determined by calculating the Spearman’s correla-
formed consent was obtained from all subjects after they were tion coefficient. Subsequently, stepwise multiple linear regression
received the general nature of the study. analysis was performed using the masticatory performance as a
dependent variable and the parameters of OHRQoL as independent
2.2. Subjects variables. Calculation of Spearman’s correlation and stepwise
multiple linear regression analysis were performed twice, before
Thirty patients (15 males and 15 females; 68–82 years old; treatment and after treatment. All statistical analyses were
average age, 74.7 years) wearing complete dentures participated in performed with significance level set at p values of 0.05.
this study. The following inclusion criteria were applied: (1)
wearing a pair of complete dentures for at least 3 years, (2) 3. Results
requiring a new pair of complete dentures, (3) recognizing a
habitual chewing side. The masticatory performance after treatment was significantly
The patients received complete denture treatment by three better than that before treatment (Table 1). The parameters of
prosthodontists with clinical experience for over 20 years. OHRQoL after treatment were significantly lower than those before
treatment (Table 2). The masticatory performance was significant-
ly correlated with the total score, functional limitation, pain and
2.3. Recording method physical disability before treatment and with the total score,
functional limitation, pain, physical disability and psychological
2.3.1. Masticatory performance disability after treatment (Table 3). Stepwise multiple linear
The test food was a cylindrically shaped gummy jelly with a regression analysis showed functional limitation and pain as the
diameter of 14 mm, height of 10 mm, and weight of 2.3 g. important factors affecting masticatory performance before
Subjects were asked to chew the gummy jelly on their habitual treatment (Table 4). Furthermore, functional limitation was found
chewing side for 20 s. After chewing, they were asked to hold 10 ml to be factor affecting masticatory performance after treatment
of distilled water in their mouths for a moment and to spit into a (Table 5). The value of adjusted R2 was 0.51 before treatment and
cup with a filter. The cup containing the gummy jelly and the saliva 0.24 after treatment. Functional limitation was significantly
was then filtered, and the filtrate was collected. For evaluating related to masticatory performance both before and after
masticatory performance, the glucose concentration in the filtrate treatment. Among nine questions regarding functional limitations,
was measured as glucose extraction by means of a glucose testing treatment resulted in improvement in many subjects for the three
device (GS-2; GC, Tokyo, Japan). The amount of glucose extraction items, such as “difficult to chew”, “difficult to pronounce”, and
was used as the parameter of masticatory performance. “dentures not fitting well”.
Table 1
Mean values and standard deviations for masticatory performance before and after treatment
(mg/dL)
Before treatment After treatment p value
Mean SD Mean SD
Masticatory performance 95.0 21.3 173.3 27.6 0.000**
SD: standard deviation

**
p < 0.01
G Model
S. Yamamoto, H. Shiga / journal of prosthodontic research xxx (2018) xxx–xxx 3
Table 2
Median and quartiles for total score of OHIP-J49 and individual domain scores within 7 domains before and after treatment
Before treatment After treatment p value
Median Q25 Q75 Median Q25 Q75

Total score of OHIP-J49 55.0 42.5 70.3 28.5 13.8 45.8 0 000**
Domain score
(1) Functional limitation 15.5 11.8 19.0 7.5 3.8 9.0 0.000**
(2) Pain 10.0 8.0 13.3 5.5 1.8 10.3 0.000**
(3) Psychological discomfort 6.0 3.0 8.0 2.0 0.0 4.0 0.000**
(4) Physical disability 12.0 9.8 15.3 6.5 1.0 10.0 0.000**
(5) Psychological disability 5.5 1.8 6.0 2.5 0.0 6.0 0.008**
(6) Social disability 4.0 0.0 5.0 2.0 0.0 5.0 0.066
(7) Handicap 4.5 0.8 6.0 1.5 0.0 5.3 0.110
Q25: first quartile, Q75: third quartile; Wilcoxon signed-rank test

**
p < 0.01
Table 3
Correlation coefficients for the relationship between masticatory performance and parameters of OHIP-J49 before and after treatment
Correlation coefficient
Before treatment After treatment

**
Total score of OHIP-J49 0.488 0.463**
Domain
(1) Functional limitation 0.601** 0.427*
(2) Pain 0.615** 0.363*
(3) Psychological discomfort 0.334 0.292
(4) Physical disability 0.432* 0.479**
(5) Psychological disability 0.193 0.377*
(6) Social disability 0.140 0.138
(7) Handicap 0.130 0.303
*
p < 0.05, **p < 0.01
Table 4
Stepwise multiple linear regression analysis for masticatory performance before treatment
Dependent variable Independent variables B b t value VIF p value

Masticatory performance Intercept 145.842 15.471
Functional limitation 1.420 0.369 2.478 1.307 0.020
Pain 2.664 0.483 3.245 1.307 0.003
Adjusted R2 = 0.508 (F = 15.980, p < 0.001)

Masticatory performance = 145.842 1.420 functional limitation 2.664 pain
B: partial regression coefficient; b: standardised partial regression coefficient; VIF: Variance Inflation Factor
Table 5
Stepwise multiple linear regression analysis for masticatory performance after treatment
Dependent variable Independent variables B b t value VIF p value

Masticatory performance Intercept 196.735 21.568
Functional limitation 3.569 0.487 2.950 1.000 0.006
Adjusted R2 = 0.237 (F = 8.700, p = 0.006)

Masticatory performance = 196.735–3.569 unctional limitation
B: partial regression coefficient; b: standardised partial regression coefficient; VIF: Variance Inflation Factor
adaptation and that the functional assessment should be

4. Discussion conducted only after adaptation of dentures. Harris et al. [5]
examined the satisfaction and OHRQoL before insertion and 3 and
4.1. Timing of evaluation after treatment 6 months after insertion of new complete dentures and reported
that significant improvements in both satisfaction and OHRQoL
Panek et al. [32] investigated the number of follow-up visits were found at 3 months, whereas no further improvements were
after insertion of new removable dentures and found that the found at 6 months. Another study [16] demonstrated that a
majority of patients needed multiple follow-up visits. This report significant improvement in OHRQoL was required at least 12 weeks
indicates that sufficient adjustment of new dentures is needed for (approximately 3 months) after insertion of new complete
G Model
4 S. Yamamoto, H. Shiga / journal of prosthodontic research xxx (2018) xxx–xxx
dentures. Therefore, the masticatory performance and OHRQoL removable dentures and reported a significant correlation between
were measured before insertion and 3 months after insertion of the two. Cardoso et al. [13] investigated the relationship between
new complete dentures in this study. masticatory performance (using a colorimetric method) and
OHRQoL (using OHIP-EDENT) in patients wearing complete
4.2. OHRQoL dentures and reported that although there was no correlation
before treatment, a correlation was found between the two after
With regard to the total score of OHIP in patients with complete treatment. In this study, masticatory performance was significant-
dentures, although Forgie et al. [33] reported no significant ly correlated with total score, functional limitation, pain, and
difference before and after treatment, other researchers [3–7,9– physical disability both before and after treatment. The absence of
12,15,21] reported significant improvements after treatment. In any correlation between masticatory performance and OHRQoL
this study also, the total score was improved after treatment. before treatment in the study by Cardoso et al. [13] may be
Some researchers [5,6,8] analyzed the OHRQoL of patients attributed to the fact that only patients who were satisfied with the
wearing complete denture using scores of seven domains of OHIP- denture were selected before treatment.
49. Harris et al. [5] reported significant improvements in all OHIP Sun et al. [8] performed stepwise multiple linear regression
domains, except for social disability. Kuo et al. [6] reported that analysis in patients with maxillary complete dentures and
significant improvements were observed in functional limitation mandibular implant overdentures using the masticatory perfor-
and psychological discomfort. In this study, a significant improve- mance determined by a sieve method as a dependent variable and
ment was found in all OHIP domains, except for social disability the parameters of OHIP-49 as independent variables. They found
and handicap. that the total score, functional limitation, pain, physical disability
were the important factors affecting masticatory performance. In
4.3. Masticatory performance this study, functional limitation and pain before treatment, and
functional limitation after treatment were the important factors
A significant improvement in masticatory performance follow- affecting masticatory performance. It is very interesting that pain
ing prosthodontics treatment has been reported in subjective was not significantly related to masticatory performance after
evaluations [9,10,17,23,25,29], whereas both significant treatment. This result may be due to the fact that the new dentures
[8,14,19,26,27,30] and non-significant [4,13,14,28,30,34,35] were adjusted well and therefore the pain has been alleviated. In
improvements have been reported in objective evaluations. In other words, the presence of a slight pain was not sufficient to
this study, an objective evaluation was performed, and a significant affect masticatory function. Furthermore, functional limitation
improvement in masticatory performance was found following was significantly related to masticatory performance both before
dental treatment. In the study [4] that showed no significant and after treatment. Among nine questions regarding functional
improvement in masticatory performance, the adapting period for limitations, treatment resulted in improvement in many subjects
the denture was short and not all subjects were dissatisfied with for the three items, such as “difficult to chew”, “difficult to
their dentures before treatment. In another study [13], the pronounce”, and “dentures not fitting well”. Accordingly, while the
dentures were placed for a year, and only those subjects who other items were also important, it appears that these three items
were satisfied with them were selected. A study [28] comprising may be associated in particular with masticatory performance.
patients with maxillary complete dentures and mandibular The value of adjusted R2 was 0.51 before treatment and 0.24
removable dentures reported no significant improvement in after treatment. Depending on the OHRQoL parameters, 51 % of
masticatory performance, which was attributed to the fact that masticatory performance before treatment and 24 % of masticatory
the capsules used were too hard and difficult to chew. In the study performance after treatment can be explained. The value of
[13] the capsules was also used as a test food. Taken together, these adjusted R2 may have been smaller after treatment because a
findings indicated that the reasons for not observing significant significant improvement in post-treatment OHRQoL meant that
improvements in masticatory performance in complete denture the results of OHRQoL became less likely to be reflected in
patients could be the use of capsule, which were difficult for the masticatory performance.
patients to chew. Ishikawa et al. [35] reported that no changes In this study, only 30 patients were analyzed because the
were observed with the sieve method but an improving trend was subjects of study were wearers of complete dentures before and
revealed by the mixing method. Gunne [14] found that although a after undergoing complete denture prosthodontics treatment. A
significant improvement was noted when evaluation was based on repetitive investigation in a larger subject sample is therefore
gelatin summarized area, no significant improvement was noted needed moving forward.
when evaluation was based on gelatin with the sieve method. He
also reported that this difference in results may have been due to
different sample sizes, or as a result of the softness and size of the 5. Conclusion
gelatin. Small, soft gelatins were used in the experiment in which
significant improvement was noted. Suzuki et al. [30] reported that To clarify the relationship between masticatory performance
when masticatory performance was investigated using chewing and OHRQoL, we analyzed the glucose extraction during chewing
gum and gummy jelly, no significant improvement was noted for gummy jelly and the answer of the OHIP-J49 questionnaire. The
the gummy jelly, while significant improvement was observed for results suggest that masticatory performance and OHRQoL are
the chewing gum. The gummy jelly used was larger and harder significantly improved after treatment and that there is a close
than the gummy jelly used in this study. Thus, it appears that relationship between the two.
relatively soft and small test foods should be used when evaluating
masticatory performance in complete denture wearers. References
4.4. OHRQoL and masticatory performance [1] Manly RS, Braley LC. Masticatory performance and efficiency. J Dent Res
1950;29:
448–62.
Koshino et al. [36] investigated the relationship between [2] Kobayashi Y, Shiga H, Arakawa I, Yokoyama M. The effectiveness of measuring
masticatory performance (using a food intake questionnaire) and glucose extraction for estimating masticatory performance. Prosthodont Res
Pract 2006;5:104–8.
OHRQoL (questionnaire developed by them) in patients with
G Model
S. Yamamoto, H. Shiga / journal of prosthodontic research xxx (2018) xxx–xxx 5
[3] Ellis JS, Pelekis ND, Thomason JM. Conventional rehabilitation of edentulous and salivary flow in Japanese older adults: is ageing a risk factor for
patients: the impact on oral health-related quality of life and patient masticatory dysfunction? Arch Oral Biol 2011;56:991–6.
satisfaction. J Prosthodont 2007;16:37–42. [21] Goiato MC, Bannwart LC, Moreno A, Dos Santos DM, Martini AP, Pereira LV.
[4] Komagamine Y, Kanazawa M, Kaiba Y, Sato Y, Minakuchi S, Sasaki Y. Quality of life and stimulus perception in patients' rehabilitated with complete
Association between self-assessment of complete dentures and oral health- denture. J Oral Rehabil 2012;39:438–45.
related quality of life. J Oral Rehabil 2012;39:847–57. [22] Toman M, Toksavul S, Saracoglu A, Cura C, Hatipoglu A. Masticatory
[5] Harris D, Höfer S, O’Boyle CA, Sheridan S, Marley J, Benington IC, et al. A performance and mandibular movement patterns of patients with natural
comparison of implant-retained mandibular overdentures and conventional dentitions, complete dentures, and implant-supported overdentures. Int J
dentures on quality of life in edentulous patients: a randomized, prospective, Prosthodont 2012;25:135–7.
within-subject controlled clinical trial. Clin Oral Implants Res 2013;24:96–103. [23] Bajoria AA, Saldanha S, Shenoy VK. Evaluation of satisfaction with masticatory
[6] Kuo HC, Kuo YS, Lee IC, Wang JC, Yang YH. The association of responsiveness in efficiency of new conventional complete dentures in edentulous patients—a
oral and general health-related quality of life with patients’ satisfaction of new survey. Gerodontology 2012;29:231–8.
complete dentures. Qual Life Res 2013;22:1665–74. [24] Witter DJ, Woda A, Bronkhorst EM, Creugers NH. Clinical interpretation of a
[7] Viola AP, Takamiya AS, Monteiro DR, Barbosa DB. Oral health-related quality of masticatory normative indicator analysis of masticatory function in subjects
life and satisfaction before and after treatment with complete dentures in a with different occlusal and prosthodontic status. J Dent 2013;41:443–8.
dental school in Brazil. J Prosthodont Res 2013;57:36–41. [25] Madhuri S, Hegde SS, Ravi S, Deepti A, Simpy M. Comparison of chewing
[8] Sun X, Zhai JJ, Liao J, Teng MH, Tian A, Liang X. Masticatory efficiency and oral ability, oral health related quality of life and nutritional status before and after
health-related quality of life with implant-retained mandibular overdentures. insertion of complete denture amongst edentulous patients in a dental college
Saudi Med J 2014;35:1195–202. of Pune. Ethiop J Health Sci 2014;24:253–60.
[9] Perši
c S, Celebi
c A. Influence of different prosthodontic rehabilitation options [26] Bae JC, Jeong SH, Jeong CM, Huh JB. Comparison of the masticatory functions of
on oral health-related quality of life, orofacial esthetics and chewing function complete dentures and implant-retained overdentures. Int J Prosthodont
based on patient-reported outcomes. Qual Life Res 2015;24:919–26. 2015;28:345–7.
[10] Kurushima Y, Matsuda K, Enoki K, Ikebe K, Maeda Y. Does case severity make a [27] Berteretche MV, Frot A, Woda A, Pereira B, Hennequin M. Different types of
difference to clinical improvement following complete denture treatment? Int antagonists modify the outcome of complete denture renewal. Int J
J Prosthodont 2015;28:161–6. Prosthodont 2015;28:270–8.
[11] Sivakumar I, Sajjan S, Ramaraju AV, Rao B. Changes in oral health-related [28] De Carvalho Dias K, Da Fonte Porto Carreiro A, Bastos Machado Resende CM,
quality of life in elderly edentulous patients after complete denture therapy Soares Paiva Tôrres AC, Mestriner Júnior W. Does a mandibular RDP and new
and possible role of their initial expectation: a follow-up study. J Prosthodont maxillary CD improve masticatory efficiency and quality of life in patients with
2015;24:452–6. a mandibular Kennedy class I arch? Clin Oral Investig 2016;20:951–7.
[12] Kamalakidis SN, Anastassiadou V, Sofou A, Pissiotis AL. Comparative study of [29] Perši ci
c S, Kranj9 ci
c J, Pavi9 c DK, Miki
c VL, Celebi
c A. Treatment outcomes based
acceptance and adaptation to new complete dentures, using two construction on patients’ self-reported measures after receiving new clasp or precision
protocols. J Prosthodont 2016;25:536–43. attachment-retained removable partial dentures. J Prosthodont 2017;26:115–
[13] Cardoso RG, Melo LA, Barbosa GA, Calderon PD, Germano AR, Mestriner W 22.
Junior, et al. Impact of mandibular conventional denture and overdenture on [30] Suzuki H, Kanazawa M, Komagamine Y, Iwaki M, Jo A, Amagai N, et al. The
quality of life and masticatory efficiency. Braz Oral Res 2016;30:e102. effect of new complete denture fabrication and simplified dietary advice on
[14] Gunne J. Masticatory ability in patients with removal dentures. A clinical study nutrient intake and masticatory function of edentulous elderly: a randomized-
of masticatory efficiency, subjective experience of masticatory performance controlled trial. Clin Nutr 2017, doi:http://dx.doi.org/10.1016/j.
and dietary intake. Swed Dent J Suppl 1985;27:1–107. clnu.2017.07.022.
[15] John MT, Slade GD, Szentpétery A, Setz JM. Oral health-related quality of life in [31] Yamazaki M, Inukai M, Baba K, John MT. Japanese version of the oral health
patients treated with fixed, removable, and complete dentures 1 month and 6 impact profile (OHIP-J). J Oral Rehabil 2007;34:159–68.
to 12 months after treatment. Int J Prosthodont 2004;17:503–11. [32] Panek H, Krawczykowska H, Dobosz A, Napadłek P, Panek BA, Sosna-Gramza
[16] Veyrune JL, Tubert-Jeannin S, Dutheil C, Riordan PJ. Impact of new prostheses M. Follow-up visits as a measure of adaptation process to removable
on the oral health related quality of life of edentulous patients. Gerodontology prostheses. Gerodontology 2006;23:87–92.
2005;22:3–9. [33] Forgie AH, Scott BJ, Davis DM. A study to compare the oral health impact
[17] Gunji A, Kimoto S, Koide H, Murakami H, Matsumaru Y, Kimoto K, et al. profile and satisfaction before and after having replacement complete
Investigation on how renewal of complete dentures impact on dietary and dentures in England and Scotland. Gerodontology 2005;22:137–42.
nutrient adequacy in edentulous patients. J Prosthodont Res 2009;53:180–4. [34] Garrett NR, Kapur KK, Perez P. Effects of improvements of poorly fitting
[18] Shigli K, Hebbal M. Assessment of changes in oral health-related quality of life dentures and new dentures on patient satisfaction. J Prosthet Dent
among patients with complete denture before and 1 month post-insertion 1996;76:403–13.
using Geriatric Oral Health Assessment Index. Gerodontology 2010;27:167–73. [35] Ishikawa Y, Watanabe I, Hayakawa I, Minakuchi S, Uchida T. Evaluations of
[19] Goiato MC, Garcia AR, Dos Santos DM, Zuim PR. Analysis of masticatory cycle masticatory performance of complete denture wearers using color-changeable
efficiency in complete denture wearers. J Prosthodont 2010;19:10–3. chewing gum and other evaluating methods. J Med Dent Sci 2007;54:65–70.
[20] Ikebe K, Matsuda K, Kagawa R, Enoki K, Yoshida M, Maeda Y, et al. Association [36] Koshino H, Hirai T, Ishijima T, Tsukagoshi H, Ishigami T, Tanaka Y. Quality of life
of masticatory performance with age, gender, number of teeth, occlusal force and masticatory function in denture wearers. J Oral Rehabil 2006;33:323–9.
Denture adhesives … Kumar PR et al Journal of International Oral Health 2015; 7(Suppl 1):93-95
Received: 28th January 2015 Accepted: 20th April 2015 Conflicts of Interest: None Review Article
Source of Support: Nil
Denture Adhesives in Prosthodontics: An Overview

P Ranjith Kumar1, P A Shajahan1, Jyothis Mathew2, Anil Koruthu2, Prasad Aravind3, M Fazeel Ahammed4
Contributors: was only in the 19th century. Denture adhesives were initially
1
Professor, Department of Prosthodontics, Royal Dental College, formulated by mixing vegetable. The mucilaginous substratum
Chalissery, Palakkad, Kerala, India; 2Senior Lecturer, Department formed when they absorbed saliva stuck to the tissues and to
of Prosthodontics, Royal Dental College, Chalissery, Palakkad, the prosthesis.
Kerala, India; 3Reader, Department of Prosthodontics, MES Dental
College, Perinthalmanna, Kerala, India; 4Reader, Department of Kapur’s3 study in 1967 on 26 denture wearers, highlighted that
Oral Medicine and Radiology, Malabar Dental College, Edappal,
concomitant use of denture adhesives added to the retention
Kerala, India.
and improved denture wearers’ incisive ability.
Correspondence:
Dr. Kumar PR. Department of Prosthodontics, Royal Dental
College, Iron Hills, Chalissery, Palakkad - 679 536, Kerala, India.
Figueiral et al.4 evaluated the retentive effect of different
Phone: +91-9447235271. Email: drranjithp@hotmail.com denture adhesives on maxillary complete dentures using an
How to cite the article: intraoral transducer and demonstrated retention of complete
Kumar PR, Shajahan PA, Mathew J, Koruthu A, Aravind P, maxillary dentures were improved with the use of denture
Ahammed MF. Denture adhesives in prosthodontics: An overview. adhesives. The denture adhesives improved denture retention
J Int Oral Health 2015;7(Suppl 1):93-95. and stability and found that patients perceived improved
Abstract: confidence and comfort, better stability, and retention and
The use of denture adhesives is common among denture wearers, decreased accumulation of food particles beneath the denture.
and it is also prescribed by many dentists. Prescribing denture
adhesives has been viewed by many prosthodontists as a means of Coates5 studied about the incidence of usage of denture
compensating for any defects in the fabrication procedures. Denture adhesive and found that only 6.9% used denture adhesive on a
adhesives add to the retention and thereby improve chewing regular basis. The effectiveness of denture adhesive in improving
ability, reduce any instability, provide comfort and eliminate the
the stability and retention of the maxillary complete denture
accumulation of food debris beneath the dentures. Consequently,
were determined in vivo by Chew et al.6 using Kinseography.
they increase the patient’s sense of security and satisfaction.
However, obtaining the advice of the dental practitioner prior to
the use of adhesives is a must.
Panagiotouni et al.7 in his studies found that denture adhesive
materials showed a greater retentive ability compared to saliva,
Key Words: Bio-adhesion, cohesion, denture adhesives, retention, and when the adhesives were used in combination with artificial
stability, saliva, tragacanth, vegetable gums saliva their retentive ability was found to be significantly
increased. Chowdhry et al.8 in their studies found that the paste
Introduction form of adhesive materials is more resistant to dislodgement
Technical excellence during the fabrication of the prosthesis compared to the powder form. Abdelmelak and Michael9 in
and effective management of patient are the two important their studies demonstrated that the cushioning effect of denture
features for a successful complete denture therapy. Even the adhesives reduced the pressure and friction transmitted to the
most accomplished practitioners find difficulty in satisfying the underlying mucosa.
patient’s expectations for stability and retention of the denture
and it is often considered appropriate to prescribe a denture Composition
adhesive for these patients. Denture adhesives may also give The main ingredients of denture adhesives are classified into
psychological confidence for the patient1 as it supplements three groups.
retention and stability especially during occasions of public
interaction. However, denture adhesives should not be used Group 1 (Adhesive agents)
as a method to improve retention in an improperly fabricated Tragacanth, gelatin, methyl-cellulose, acacia, hydroxyl-methyl
ill-fitting denture, and under any circumstances excessive cellulose, Karaya gum, sodium carboxyl-methyl cellulose,
amounts of denture adhesive should be indicated. Standardized pectin, and synthetic polymers like acrylamides, acetic,
guidelines are needed for the application, use and removal of polyvinyl and polyethylene oxide.
denture adhesives.2
Group 2 (Anti-microbial agents)
Though the usage of denture adhesives dates back to the Sodium tetraborate, ethanol, hexachlorophene, and sodium
late 18th century, the first mention of adhesives in literature borate.
93
Group 3 (Other agents) • In the mandibular denture – adhesive must be applied

Plasticizing agents, flavoring agents like oil of peppermint, oil along the entire sulcus.
of wintergreen, and wetting agents, etc.
Mode of Action
Denture adhesives are supplied as a paste, powder or cream.
As the Adhesive powders absorb water, they swell to many

times their original volume and the anions so formed, interact
with cations in the proteins in the oral mucous membrane. The 4. Denture should be seated and held in place firmly by hand
viscosity of the adhesive is increased by the thick saliva formed, pressure for 5-10 s.
thereby increasing the denture retention. • Gauze is used to remove excess adhesive.
• Patient is advised to close into centric occlusion several
Newer adhesive materials provide stronger bio-adhesive and times to spread the adhesive as a thin even layer.
cohesive forces. Free carboxyl groups formed by the hydration
of adhesive such as methyl cellulose, hydroxyl methyl cellulose, Indications
sodium carboxyl-methyl cellulose or poly methyl vinyl-ether 1. Recording jaw relations and denture try in should be done
maleic anhydride, etc. form electrovalent bonds that produce using stable and retentive bases. Denture adhesives stabilize
stickiness or bio adhesion. the trial denture bases which show inadequate retention
and stability due to various reasons.
The increased viscosity of the adhesive creams results in their 2. Use of adhesives will increase denture try-in accuracy and
lateral spread excluding air and saliva thereby increasing the decrease the patient apprehension about the fit of the final
retention. prosthesis.
3. Use of adhesives in patients with compromised denture
Requirements of an Ideal Denture Adhesive10 bearing areas adds to their confidence thereby increasing
1. Available as gels, creams, and powders. the ability to adapt to the new prosthesis.
2. Biocompatible, nontoxic and non-irritant. 4. Immediate denture gets loosened soon due to tissue
3. It should have a neutral odor and taste. healing and resorption requiring relining, rebasing, or a
4. Easy application and removal from the tissue surface of the new denture fabrication. Comfort and function during the
denture. interim period are aided by the use of a denture adhesive.
5. Discourage microbial growth. 5. Reduced clinical findings of ulcers, tissue irritation,
6. Adhesiveness should be retained for 12-16 h. inflammation and compression of the oral mucosa of
7. Increase the comfort, retention and stability of the denture. denture wearers were seen with concomitant use of
adhesives.
Mode of Application 6. Xerostomia in denture wearers either drug or radiotherapy
Any residual adhesive should be removed from the tissue- induced can be alleviated with the use of denture adhesives.
bearing surface of the denture. 7. Stabilization of dentures in patients with hormonal changes
and neuromuscular disorders such as myasthenia gravis,
1. Food debris on the tissue surfaces of the denture is wiped Parkinson’s and Alzheimer’s disease, etc., can be achieved
clean. with denture adhesives.
8. Prosthesis to rehabilitate gross maxillofacial defects requires
denture adhesives for retention.
9. Denture adhesives are valuable adjuncts to the retention
of radiation carriers or radiation protection prostheses.
10. Usage of minimal amounts of adhesives provides high
profile patients like attorneys, executives, speakers, etc.
2. Wet dentures before application of adhesive. with psychological security in social situations.
3. Small amounts of adhesive are applied to the tissue-bearing
surface of the denture. Contraindications
1. Allergies to denture adhesives or any of its components.
2. Gross inadequacies in retention and function.
3. Excessive bone resorption and soft tissue shrinkage leading
to loss of vertical dimension.
• In the maxillary denture - anterior alveolar ridge, the 4. Adhesives should not be used to retain fractured dentures
center of the hard palate and posterior palatal seal region. or dentures with lost flanges.
94
5. Patients with inability to maintain proper hygiene of the 4. Figueiral MH, Fonseca PA, Pereira-Leite C, Scully C.
denture should avoid the use of denture adhesive. The effect of different adhesive materials on retention
of maxillary complete dentures. Int J Prosthodont
Conclusion 2011;24(2):175-7.
With proper use denture adhesives are beneficial to the 5. Coates AJ. Usage of denture adhesives. J Dent
patient in increasing retention and stability, enhanced 2000;28(2):137-40.
comfort, improved function, and in providing psychological 6. Chew CL, Phillips RW, Boone ME, Swartz ML. Denture
satisfaction. They should not be used as an aid to compensate stabilization with adhesives: A kinesiographic study.
for denture deficiencies even though adhesives enhance denture Compend Contin Educ Dent 1984;Suppl 4:S32-8.
performance. Patients should not use denture adhesives 7. P a n a g i o t o u n i E , P i s s i o t i s A , K a p a r i D ,
inadvertently without proper guidance and instructions from Kaloyannides A. Retentive ability of various denture
the dentists. adhesive materials: An in vitro study. J Prosthet Dent
1995;73(6):578-85.
References
8. Chowdhry P, Phukela SS, Patil R, Yadav H. A study to
1. Slaughter A, Katz RV, Grasso JE. Professional attitudes
evaluate the retentive ability of different denture adhesive
toward denture adhesives: A Delphi technique
survey of academic prosthodontists. J Prosthet Dent materials: An in vitro study. J Indian Prosthodont Soc
1999;82(1):80‑9. 2010;10(3):176-81.
2. Duqum I, Powers KA, Cooper L, Felton D. Denture adhesive 9. Abdelmalek RG, Michael CG. The effect of denture
use in complete dentures: Clinical recommendations and adhesives on the palatal mucosa under complete dentures.
review of the literature. Gen Dent 2012;60(6):467-77; A clinical and histological investigation. Egypt Dent J
quiz p 478. 1978;24(4):419-30.
3. Kapur KK. A clinical evaluation of denture adhesives. 10. Adisman IK. The use of denture adhesives as an aid to
J Prosthet Dent 1967;18:550-8. denture treatment. J Prosthet Dent 1989;62(6):711-5.
95
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/281268523
DENTURE ADHESIVES FOR COMPLETE DENTURE: A LITERATURE REVIEW
Article · January 2010
CITATION READS
1 1,047
1 author:
Ravi Shankar Y
GITAM Dental College & Hospital, Visakhapatnam
32 PUBLICATIONS 93 CITATIONS
SEE PROFILE
Some of the authors of this publication are also working on these related projects:
dentistry View project
All content following this page was uploaded by Ravi Shankar Y on 26 August 2015.
The user has requested enhancement of the downloaded file.

Review Article
DENTURE ADHESIVES FOR COMPLETE DENTURE:

A LITERATURE REVIEW
Ir-D-r-.
Y-.R-aV-i-S-h-a-n-k-a-r--1
ABSTRACT
This article is meant to be a useful contribution to the understanding of denture adhesives, their
clinical effectiveness and problems related. It is thought that dentist need to know more documented,
well organized details about these adhesives in order to be able to educate all denture patients
about the advantages, disadvantages and use of such products. Denture adhesives, when used
properly are safely and beneficial to the patient in improving retention and stability, incisive ability,
comfort, function, and in providing psychological security. Although adhesives enhance denture
performance and patient confidence, they should not be used to compensate denture deficiencies.
The patients should use denture adhesives only on the advice of their dentists and the dentists
too should instruct them about the proper use and caution against misuse of denture adhesives.
KEY WORDS: Denture Adhesives, Powder, Cream
INTRODUCTION This article is meant to be a useful

Successful complete denture therapy contribution to the understanding of denture
involves both technical excellences during adhesives, their clinical effectiveness and
prosthesis fabrication and effective patient problems related.
management once the dentures are placed. The ideal requirements of a denture
Satisfying the expectations of many patients adhesive are":
for optimal denture retention and stability is 1. Physically it should be in a powder, gel or
often beyond the technical skills of even the cream form.
most accomplished practitioners. Discussing
2. It should be non toxic, non irritant and it
and implementing the judicious use of denture
should be bio-compatible.
adhesives may satisfy patient's expectations
3. It should be odour less and tasteless.
and achieve the intended treatment goals.
4. It should be easy to apply on the tissue
It is thought that dentist need to know more
surface of the denture.
documented, well organized details about
these adhesives in order to educate all 5. It should not promote microbial growth.
denture patients about the advantages, 6. It should posses retentive adhesive
disadvantages and use of such products". In qualities for longer period ( 12 - 16 hours ).
addition, to identify those patients for whom 7. It should provide comfort, retention and
such products are advisable and or stability during functions.
necessary for a satisfactory denture wearing
COMPOSITION:
experience. Denture adhesives create an
The major constituents of denture adhesives
increased sense of security and satisfaction
among patients, but they should use denture AUTHORS
adhesives only on the advice of their dentist. Dr. Y. Ravi Shankar, M.D.S.
Patients should also be instructed about the Prof. & HOD
proper use and cautioned against misuse of Department of Prosthodontics
denture adhesives, as a part of denture post Gitam Dental College And Hospital,
delivery instructions. Visakhapatnam, A.P.
23 Indian Journal of Dental Sciences Volume 11....., 1 jAN-2010
Review Article
can be broadly divided in to three groups: adhesive agents, the resulting anions are
Group 1: attracted to cations in mucus membrane
Materials responsible for adhesive properties proteins, producing stickiness.
such as: Karaya gum, Tragacanth, Acacia, The properties of current adhesives depend
Pectin, Gelatin, Methyl-cellulose, Hydroxyl- on a combination of both physical and
methyl cellulose, Sodium carboxy-methyl chemical forces. The physical forces are
cellulose and Synthetic polymers based on a principle defined by Stefan' over
( Polyethylene oxide, Acrylamides, Acetic a century ago, which states that the forces
polyvinyl ). require pull two discs or plates apart is
Group 2: directly proportional to the viscosity of the
Anti microbial agents such as liquid between them. Saliva increases the
Hexachlorophene, Sodium borate, Sodium viscosity of the adhesive, there by increasing
tetraborate and ethanol. the force required to separate the prosthesis
from the oral surface.
Group 3:
Modern adhesives increase this force by
Additives, Plasticizers, wetting agents and
using materials that provide strong
flavoring agents such as oil of wintergreen,
bioadhesive and cohesive forces. Most
oil of peppermint, etc.
adhesives use ingredients that provide
Currently the denture adhesives can be
bioadhesion via carboxyl groups. As the
divided as :
adhesive hydrates, free carboxyl group form
Soluble Group : That includes Creams,
electrovalent bonds that produce stickiness.
Pastes, Powders. They have active
Polymethyl vinyl ether-maleic anhydride, or
ingredients like Carboxymethyl cellulose
PVM-MA, copolymer is a synthetic
(CMC) and Polyvinylether methyl
compound widely used in denture adhesives
methacrylate (PVM-MA). The CMC
because of its high level of carboxyl groups.
compound has strong initial hold but due to
Sodium carboxy methyl cellulose (CMC ), a
its high solubility it dissolves quickly and loses
naturally derived adhesive ingredient, also is
its effectiveness within short period when
commonly used because of its carboxyl
compared to PVM-MA compound.
groups. CMC has the advantage of being
Insoluble Group: Include Pads and more soluble in water than PVM-MA salts.
synthetic wafers. A laminated fabric with Although it provides a strong initial hold when
water active component like sodium alginate used alone, CMC quickly dissolves due to its
or ethylene oxide polymer impregnated within high level of solubility. They enhance retention
fabric's mesh. through optimizing interfacial forces by9.4:
It is reported in literature the use of dentrifices 1) increasing the adhesive and cohesive
as denture adhesives in emergencies, but the properties and viscosity of the medium lying
retentive qualities are poor and short acting. between the denture and its basal seat.
MECHANISM OF ACTION: 2) eliminating voids between the denture
To understand today's adhesives we must base and its basal seat.
first explore the mechanism by which they ADVANTAGES AND DISADVANTAGES
work. ADVANTAGES:
Sharry' described this mechanism in his 1. Increased stability.
1919 review article" the material swells 50 to 2. Increased retention.
150 percent by volume in presence of water,
3. Reduction in denture mediolateral
filling in space between the prosthesis and
movement and dislodqement'".
the tissues. As water is absorbed by the
24 Indian Journal of Dental Sciences VoIWIIe 1 Issue 1 JAN-2010

Review Article
4. Greater levels of incisal bite force during the retention, comfort and function.
function 10. Xerostomia:
DISADVANTAGES OF DENTURE Patients who suffer from Xerostomia due to
ADHESIVES: medication side effects, a history of head and
1. Prevent from recognizing that denture was neck radiation, systemic disease or diseases
not fit properly. of salivary glands, have a great difficulty
2. Can lead to a false sense of security for managing complete dentures due to impaired
the patient using denture adhesive. retention and an increased tendency for
3. Can contribute to the development of ulceration of the bearing tissues.
candidiasis, denture stomatitis, imbalance of Neurological diseases:
oral flora as a result of microbial Several neurological diseases can
contamination, resorption of alveolar bone. complicate the use of complete dentures, but
4. Denture adhesive containing Karaya gum adhesive may help to overcome the
will form a solution with ph below 5.5-6.5 impediments imposed. Cerebrovascular
which can lead to decalcification of enamel, accidents ( stroke) may render part of the oral
if used for partial dentures. cavity insensitive to tactile sensation, or
Indications and Contraindications partially or wholly paralyzed oral musculature.
Indications: Adhesives can assist in helping these
Denture adhesives are indicated when well patient's accommodate new dentures or to
made complete dentures do not satisfy a prosthesis that were fabricated prior to the
patient's perceived retention and stability stroke but that the patient is now unable to
expectations. manage due to lost sensory feedback and
During Jaw Relations: neuromuscular control.
For stabilizing record bases during jaw Orofacial Dyskinesia:
relations, as trail denture bases have poor Orofacial dyskinesia is a prominent side
retention and stability. effect of phenothiazine-class tranquilizers
During Try -in: (e.g., Fluphenazine, trifluoperazine,
Unstable and non retentive denture bases will thioridazine or thiroxine ), other neuroleptics
make the verification of jaw relation records (e.g. haloperidol ), and even gastrointestinal
difficult or inaccurate. Use of adhesives will medications ( e.g., prochlorperazine,
improve the accuracy of the denture try in, and metaciopramide). This movement disorder,
also allow the patient's apprehension about sometimes termed "tardive dyskinesia"
the fit of the final processed dentures. because it is often a late-onset side effect of
Insertion of dentures: dopamine-blocking drugs, is characterized
Patients with compromised denture bearing by exaggerated, uncontrollable muscular
area can be benefited with the use of denture actions of the tongue, cheeks, lips and
adhesives because it adds to their mandible. In such situations, denture
confidence and also increase their ability to retention, stability, and function may be a
adapt to new denture. virtual impossibility without adjunctive
Immediate denture: retention, such as that made possible with
Immediate denture soon becomes loose due denture adhesive.
to soft tissue healing and bony resorption Respective surgery:
advocating to its relining, rebasing, or to a Patient who have undergone a respective
new denture fabrication. During this interim surgery for removal of oral neoplasia, or
period, a soft liner can be used to augment those who have lost intraoral structures and
25 Indian Journal of Dental Sciences Volume 1 Issue l)AN ·2010

Review Article
integrity due to trauma, may have significant mouth.

difficulty in functioning with a tissue borne 2. An ill-fitting denture.
prosthesis unless denture adhesive is 3. A denture that has not recently been
employed, even if retentional undercut have evaluated by a dentist.
been surgically created to resist displacement 4. A patient who cannot or will not maintain
of the prosthesis. adequate oral and prosthesis hygiene.
Reduction of tissue irritation: 5. Patients allergic to denture adhesives or
Studies indicate that the use of denture components of adhesives.
adhesives reduce clinical findings of tissue 6. Dentures those are grossly inadequate in
irritation, compression ulcers, and fit and function.
inflammation of the oral mucosa of denture
7. Dentures that demonstrate excessive loss
wearers. Denture adhesives are
of vertical dimensions because of bone
recommended for patients with extremely
resorption and soft tissue shrinkage.
sensitive oral mucosa because they aid in
8. Patients with broken dentures or dentures
denture retention and alleviate the discomfort
with missing flanges or with sectional fracture
of tissue irritation.
should not use denture adhesives to retain
Patients with Systemic diseases:
their denture.
Denture patients having dryness of mouth
Patients who use denture adhesives without
either due to drug therapy or radiotherapy can
thoroughly cleaning the previously used
be benefited with the use of denture
adhesives resulting in a lining of a layered,
adhesives. Patients using dentures
caked deposit of hardened adhesive should
experiencing hormonal changes and
be instructed about the proper method of
disorders in which muscle control is effected
cleaning the adhesive from the denture, or
such as Myasthenia gravis, Parkinson's and
should be discouraged from further use of
Alzheimer's disease may stabilize their
denture adhesive.
dentures with denture adhesives.
PATIENT EDUCATION:
Maxillofacial Surgery patients:
It is mandatory that dentist educate denture
Patients who are edentulous with gross
patients about denture adhesives and their
maxillofacial defects require the use of
use, abuse, advantages, disadvantages and
denture adhesives to retain large prosthesis.
available choices. The major information
Administration of drug therapy: resource for a patient should be the dentist
Denture adhesives are valuable adjunct to the and not magazines or television
retention of prosthesis designed for the advertisements or the testimonials of
administration of drug therapy and for relatives and acquaintances.
prosthesis designated as radiation carriers The choice between cream and powder is
or radiation protection prosthesis. largely subjective, but certain facts may
For extra security of stable denture: underscore a patient's selection". Powder
Denture patients who are executives, formulations, as a rule, do not confer the same
speakers etc., while socializing in public use degree of "hold", nor do their effects last as
denture adhesives for the extra security for long, in comparison to comparable cream
retention of dentures. The use of minimal formulations. However powders can be used
amounts of denture adhesive provides them in smaller quantities, are generally easy to
a psychological security. clean out of denture and off tissues, and are
Contraindications ; not perceived as "messy" by patients.
1. A patient with open cuts or sores in the Furthermore, the initial "hold" for powders is
26 Indian Journal of Dental SciencesVolume I Issue 1 JAN·2010
Review Article
achieved sooner than it is with cream

formulations.
Obtaining the greatest advantage from the
use of an adhesive product is dependent on
its proper usage. For powder and cream
products, the least amount of material that is
effective should be used. This is
approximately 0.5 to 1.5 gms per denture unit
( more for larger alveolar ridges, less for
smaller ones ). For powders, the clean
prosthesis should be moistened and then a
Types of Powder Adhesives and
thin, even coating of the adhesive sprayed
Application technique.
onto the tissue surface of the denture [fig. 1].
The excess is shaken off, and the prosthesis
is inserted and seated firmly. If the patient
suffers from inadequate or absent saliva, the
sprayed denture should be moistened lightly
with water before insertinq".
For creams, two approaches are possible.
Most of the manufacturers recommend
1) placement of thin beads of the denture
adhesive in the depth of the dried denture in
the incisor and molar regions, and, in the
maxillary unit, an anterio-posterior bead along
Cream application (type 1)
mid palate [fig.2]. 2) However, even more
distribution of the material can be achieved
if small spots of cream placed at 5mm
intervals throughout the fitting surface of the
dried denture [fig.3]. Regardless of the pattern
selected, the denture is then inserted and
seated firmly". As with powders, use of
denture adhesive cream by Xerostomia
patient requires that the adhesive material be
moistened with water prior to inserting the
denture".
Patients must be instructed that daily removal Cream application (type 2)
of adhesive product from the tissue surfaces
of the denture is an essential requirement. needs to be placed, removal is facilitated by
running warm water over the tissue surface
Removal is facilitated by letting the prosthesis of the denture while scrubbing with a suitable,
soak in water or in soaking solution over night, hard-bristle denture brush. Adhesive that is
duringwhich the product will be fully solublized adherent to the tissues ( alveolar ridges,
and can then be readily rinsed off. If soaking palate) is best removed by rinsing with warm
is not possible before new adhesive material or hot water swished around, and then firmly
27 Indian Journal of Dental Sciences Volume tIssue t }AN-20tO
Review Article
wiping the area with gauze or a wash cloth REFERENCES:

saturated with hot water or brush the gums 1. Denture adhesive - Joseph E
and the roof of mouth with a fluoride rinse". Grasso.DCNA July2004;48:721-734.
Another method is by using very cold water 2. Zarb G, Bolender C, Eckert, Jacob,
or using ice, it hardens the denture adhesive, Fenton, Mericske, stern. Prosthodontic
once hardened it becomes easy to pick it off treatment for edentulous patients. 12th ed. St
by hand. Louis: CV Mosby, 2004:443-447.
Finally, patient need to be educated about the 3. Heartwell C, Rahn A. Syllabus of complete
limitations of denture adhesive". Discomfort dentures. 3rd ed. Philadelphia: Lea &
will not be resolved by placing a "cushioning Febiger, 1986: 104.
layer" of adhesive under denture. In fact, pain 4. John J. Shaery. Complete Denture
or soreness signals a need for professional Prosthodontics, 3rd ed.
management. Gradual increase in the 5. Grasso Je, Rendell j, Gay T: effect of
quantity of adhesive required for acceptable denture adhesive on the retention and stability
fit of the denture is also a clear signal to seek of maxillary dentures, J Prosthet Dent. 72:
professional care. In all cases, denture 399-405, 1994.
patients need to be recalled annually for oral 6. Kapur KK. A clinical evaluation of denture
mucosal evaluation and prosthesis adhesives. J Prosthet Dent.1967;18:550-8.
assessment, but they also need to be 7. Stafford GO, Denture adhesives- a review
educated about the warning signs that should of their use and composition. Dent Pract
alert them to seek professional attention 1970:21:17-19.
between the check-ups. 8. Shay K : denture adhesives: choosing the
Common problems that come across due to right powders and pastes, J Am Dent Assoc.
injudicious usage are increase in vertical 122: 70-76,1991.
dimension( reduction of freeway space), ill- 9. Chew C, Boone M, Swarm M, Phillips R.
fitting dentures can cause residual ridge Denture adhesives: their effect on denture
resorption, gag reflex, erosions on the retention and stability. J Dent 1985;13:152-9.
mucosa, prolonged usage cause 10. Tarbet WJ, Boone M, Schmidt NF. Effect
constipation, helps in growth of of denture adhesive on complete denture
microorganisms can cause candidal infections dislodgement during mastication. J Prosthet
and also can cause allergic reactions to Dent. 1980; 44: 374-8.
mucosa. 11. Benson 0, Rothman R, Sims T. The effect
CONCLUSION of a denture adhesive on the oral mucosa and
vertical dimension of complete denture
Denture adhesives, when used properly are
patients. J South Calif Dent Assoc
safer and beneficial to the patient in improving
1972;40:468-73.
retention and stability, incisive ability, comfort,
function, and in providing psychological
security.Although adhesives enhance denture ADDRESS FOR CORRESPONDENCE:
performance and patient confidence, they Dr. Ravi Shankar Y.
should not be used to compensate denture Plot N023, Door No: 7-5-148,
deficiencies. The patients should use denture Ocean View Layout, Pandurangapuram,
adhesives only on the advice of their dentists
Visakhapatnam, AndhraPradesh. - 530003.
and the dentists too should instruct them
about the proper use and caution against Ph:-0891-2560646.
misuse of denture adhesives. e-mail:-raviyalavarthy@yahoo.com
28 Indian Journal of Dental Sciences Vo/wne 1 Issue 1 )AN-2010
View publication stats

(116)
EGYPTIAN Vol. 58, 1:9, July, 2012

DENTAL JOURNAL I.S.S.N 0070-9484
w w w. e d a - e g y p t. o r g
Comparison of three different forms of denture

adhesives: Direct measurement of denture
retention and, study of patient satisfaction
Nesreen El-Mekawy;* Amira Gomaa* and Ahmed Habib**
ABSTRACT
Statement of problem: poor fit denture is one of the most annoying problems among
complete denture wearers. Denture adhesives can successfully solve this problem. They are
supplied into different forms including; paste, powder and cushions to fit for the patient demands.
However, there is no available guide to select one form by the dentist or the patient. Therefore
this study is attempted to give a suitable guidance to select the proper form of denture adhesive
in respect to the retention force and patient satisfaction.
Purpose: The purpose of this study was to evaluate and compare three different forms
of commercially available denture adhesives as regards to patient satisfaction and direct
measurement of dentures retention.
Materials and Methods: Fifty completely edentulous patients (30 males and 20 females;
age range, 58-70 years; mean age, 62 years) who attended for treatment of poor fit maxillary
denture at the Prosthodontic Department, Faculty of Dentistry, Mansoura University were
included in this study. Patient perceptions for five commercial complete denture adhesive types
(Supercorega paste, Supercorega Powder, Protefix paste, Protefix Powder, Protefix Cushion)
were assessed by a questionnaire on dentures (maxillary & mandibular) retention, chewing
ability, taste, duration of adhesives in the mouth, and ease of removal for the denture adhesives
from the oral mucosa after use. A digital force meter was used to objectively measure retention
strength afforded in grams; the results were compared to those obtained with and without a
denture adhesive.
Results patient satisfaction showed significant difference in dentures retention (maxillary &
mandibular), duration of the adhesive in patient mouth, taste and, removal of the adhesive from
the patient mouth. Improvement of the chewing ability was observed by the using of different
adhesive types but there were insignificant difference between the different adhesives. The direct
measurement of dentures retention showed that a significant improvement in dentures retention
was observed when the paste type, powder type, or cushion type denture adhesive was used.
And that Protefix paste and Protefix powder offers the best retention performance, followed
by Supercorega paste and Supercorega powder, and finally Protefix cushion offers the lowest
retention performance. While for the mandibular dentures the protefix paste and the supercorega
paste offer the best retention.
Conclusions The clinical value of a denture adhesive relates to improvement of function
and its effect on the underlying tissue health. There is sufficient information to support the use
of denture adhesives to increase denture retention, stability, and incisive ability for ill, fair, and
well-fitting prostheses. Also, The use of adhesive creams significantly increased the denture
retention
Key words: Retention, complete dentures, dentures adhesives
* Assistant Professor, Department of Removable Prosthodontics, Faculty of Dentistry, Mansoura University, Mansoura, Egypt
** Professor and Chairman of Removable Prosthodontic Department, Faculty of Dentistry, Mansoura University, Mansoura, Egypt
(2) E.D.J. Vol. 58, No. 3 Nesreen El-Mekawy, et al.
INTRODUCTION The purpose of this study was to evaluate and

compare three different forms of denture adhesives
Rehabilitation of completely edentulous patients
as regards to direct measurement of denture
is one of the main challenges in dentistry 1. In spite
retention and patient satisfaction.
of the increasing use of dental implants, the most
common way to treat edentulousness is still by
means of a conventional full denture 2. Material and Methods
Unfortunately; edentulism and conventional Subjects

complete denture treatment have been shown to Fifty healthy completely edentulous patients (30
have a negative impact on oral health quality of life
males and 20 females; age range, 58-70 years; mean
(OHQoL) 3. One of the most annoying problems
age, 62 years) who attended for complete denture
posed by complete dentures is poor fit denture.
treatment at the Prosthodontic Department, Faculty
Although highly sophisticated prosthodontics
of Dentistry, Mansoura University. Detailed written
techniques were suggested to overcome this
information about treatment strategy was provided
problem, patients with compromised physiological
to all participants, and then they signed an informed
and /or anatomical factors of retention still represent
consent.
a challenge to conventional complete denture
therapy. All subjects received conventional maxillary
and mandibular complete dentures with a standard
In order to solve this problem, dentists and the
thickness (0.01mm) tinfoil spacer adapted on the
dental industry for a long time have attempted to
improve denture adhesion by developing a range master casts before processing into heat cured
of prosthetic denture adhesives of highly varied acrylic resin. All patients were satisfied and free of
composition and efficacy 4. They can be successfully any discomfort with dentures.
used as a simple, convenient alternative approach
Study Design
to implant assisted prosthesis due to their positive
impact on denture retention and stability. 3 Simply According to the denture adhesive form, the
they can maintain the patient’s quality of life. patients were randomly classified into equal five
Research has demonstrated that denture patients groups as follows: Group I: where the patient used
using adhesives masticate in a similar fashion to type I paste form denture adhesive,: Group II:
patients who have natural teeth 5. where the patient used type II paste form denture
adhesive; Group III: where the patient used type
The denture adhesives provide an interface
I powder denture adhesive,: Group VI: where the
between the oral mucosa and the denture fitting
patient used type II powder denture adhesive, and
surface that allow retentive forces to be transmitted
between the mucosa and denture via an intermediary Group V: where the patient used cushion denture
film of saliva 6. Thus it bonds the denture to the adhesive. The manufacturers and the compositions
underlying oral tissues by physical and chemical of the five denture adhesive forms are presented in
actions. The major elements of adhesive products table I
are ingredients which swell by absorbing water and
Measuring the dentures retention:
become viscous and sticky 7. They are supplied
into different forms including; powder, paste The dentures were delivered in the patient
and cushions to fit a variety of patient demands. mouth after necessary adjustments. After removal
However, there is no suggested clinical guidance to of the foil spacers from the denture fitting surfaces,
recommend the use of specific adhesive form. each patient was instructed to follow the modified
Comparison of three different forms of denture adhesives (3)
Table (I) lists the products, compositions and, manufacturers of the five commercial brands of denture
adhesives tested.
Commercial
Denture adhesive form Composition manufacturer
name
Carboxymethyl cellulose, monosodium

SuperCorega Stafford-Miller Ltd. Welwyn
Type I paste phosphate, prophyl-hydroxybenzoate, white
paste (CP) Garden City, Herts, U.K.
petrolatum, light liquid paraffinp
Sodium&Calcium salts of the copolymer of

methyl vinyl ether and maleic acid anhydride,
Protefix paste Queisser Pharma 24914
Type II paste Carboxymethyl cellulose, Paraffin, Vaseline,
(PP) Flensburg-Germany
Silica, menthol, azorubin, P-hydroxy-benzoic
acid methyl ester
SuperCorega Ca and Na salts of the copolymer PVM-MA, Stafford-Miller Ltd. Welwyn

Type I powder
powder (CPo) cellulose gum, flavoring agent Garden City, Herts, U.K.
Protefix Powder
Type II powder Sodium alginate, Na-Cu chlorophyllin , menthol
(PPo) Queisser Pharma 24914
Protefix Sodium alginate, viscose fibre, polypropylene Flensburg-Germany
Cushion
Cushion (PCu) fibre
questionnaire of Kelsey et al 8 (Table 2). Denture was instructed to maintain maximum, non-forced
retention measurement was done by using a digital intercuspidation during 5 minutes. The retention
force meter (Mecmesin Corp, Virginia, USA) to measurements were recorded, and repeated three
measure the retention force (in grams) needed to times at 3 minute intervals for each group 4.
dislodge the maxillary and mandibular denture
bases from their basal seats Ready made screwed Patient perceptions
metallic hooks were fixed to the geometric centers
The principal investigator gave patient’s
of both maxillary and mandibular denture base of
instructions and a demonstration about the use of
each patient 9,10. When a denture was dislodged, the
different denture adhesive forms according to the
maximum value measured before dislodgment was
manufacturers’ recommendation. The patients, in
recorded and taken as a measurement for retention.
turn, demonstrated to the investigator the placement
The patient was seated in upright position with of the adhesive in their dentures and their cleaning.
his mouth opened and the lower lip relaxed in order After one week the patients were recalled to follow
to avoid losing peripheral seal. The patient head a new questionnaire for the Group II. The principal
was oriented to allow the upper jaw to be at 45 investigator thoroughly cleaned the dentures and
degree to the floor. The dentures were inserted and instructed the patients to apply the adhesive form
allowed to remain for settling times of 3 minutes to their dentures. The patients’ evaluations of each
before the hook of the dentures were engaged. The of the adhesive types followed the same seven day
measurements were recorded, and repeated 3 times
testing cycle 8.
at 3 minute intervals 11. Then, 0.8gm of denture
adhesive form in Group I was thinly and uniformly The order of application of the adhesive types
applied on the maxillary and mandibular denture was randomized, and all measurements were
fitting surfaces. After denture insertion, the patient made by the same investigator. Thus, each patient
was subjected to three measurements of retention The data were subjected to the Wilcoxon ranks
strength without adhesive (control values), together signed test for nonparametric nominal data at a
with three measurements involving each of the five significance level of p ≤ 0.05 (StatView 5.0, SAS
commercial adhesives 4. Institute Inc., Cary, NC).
Results
Table (2) Questionnaire (Modified from Kelsey et
al, 1997) 12 Retention force measurement
Arithmetic means were Calculated for all
1- How satisfied are you with the retention of six retention force measurements (in grams)
your upper denture when using this adhesive? corresponding to control value (without adhesive)
a- Very satisfied b-Fairly satisfied and for each group (I, II, III, IV, V) respectively.
c-Not quite d-Dissatisfied Table (3) shows the mean retention values for
2- How satisfied are you with the retention of maxillary dentures (in grams) for all six series of
your lower denture when using this adhesive? measurements (control, group I, II, III, IV, V)
respectively. Retention was markedly low in the
a- Very satisfied b-Fairly satisfied
absence of prosthetic denture adhesive (1314.250 ±
c-Not quite d-Dissatisfied
764.250g), while the highest values corresponded to
3- Did the use of this denture adhesive have an group II (4059.00 ±1411.78g).
effect on your ability to chew?
a- Much better b-Little better Table (3) shows mean retention values for
c-No difference d-Worse maxillary dentures.
4- How long did this denture adhesive have an

group Count Mean St. Dev
effect on your dentures?
Control 50 D 1314.250 764.07
a- ≤2 hours b- 2 to 4 hours
c- 4 to 6 hours d-6 to 12 hours Group I 50 ABC 3211.333 1303.76
5- Did you like the taste of this denture adhesive? Group II 50 A 4059.000 1411.78
a-Good b- Fairly good c-Worse Group III 50 BC 2697.167 1244,99

6- How was the removal of the adhesive from Group IV 50 AB 3504.167 1396,19
your dentures?
Group V 50 C 1412.300 591.27
a-Easy b- Not easy c-Very difficult
F- value 7.892
After testing all groups, the patients returned for
LSD 960.0
a final session and were asked to respond to these
questions: Which of the five denture adhesive types The results showed that all prosthetic denture
that you have tested do you consider to be the best adhesives, regardless of the commercial brand
for your existing upper and lower dentures?, Which involved, significantly improved retention versus
of the five denture adhesive types that you have the control values. The existence of differences
tested to be more comfortable? among the five groups was evaluated by analysis of
variance (ANOVA). The adhesive performances of Table (4) shows mean retention values for
the diferrent groups were seen to differ significantly mandibular dentures.
(p<0.001). Specifically, the best adhesive
performance corresponded to group II, followed by
group IV, I, then group III and, finally group V. Group Count Mean St. Dev
Table (4) shows the mean retention values for Control 50 D 460.333 273.47
mandibular dentures (in grams) for all six series
Group I 50 AB 2512.917 1069.35
of measurements (control, group I, II, III, IV, V)
respectively. Retention was markedly low in the Group II 50 A 2914.500 1222.17
absence of prosthetic denture adhesives (460.333 ±
273.47g), while the highest values corresponded to Group III 50 C 1526.083 755.53
group II (2914.500 ±1222.17g).

Group IV 50 BC 2026.000 968.16
The results showed that all the prosthetic denture
Group V 50 C 797.300 287.80
adhesives, regardless of the commercial brand
involved, significantly improved retention versus F- value 12.641
the control values. The existence of differences 700.1
among the five groups was evaluated by analysis LSD
of variance (ANOVA). The adhesive performances

of the five groups were seen to differ significantly Patient perceptions
(p<0.001). Specifically, the best adhesive
performance corresponded to group II, followed by The frequency of distribution of patients’
group I, IV, then group III and finally group V. responses to the questions is displayed in Table 5.
Table (5) Frequency of Distribution of Patients’ Responses
Number (%) of Respondents

Question Response
Group I Group II Group III Group IV Group V
Very satisfied 40 (80%) 50 (100%) 35 (70%) 37 (74%) 34 (68%)
Retention of upper Fairly satisfied 10 (20%) 0 (0) 15 (30%) 13 (26%) 12 (24%)
dentures Not quite 0 (0) 0 (0) 0 (0%) 0 (0) 4 (8%)
Dissatisfied 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Very satisfied 30 (60%) 10 (20%) 15 (30%) 18(36%)

23(46%)
Retention of lower Fairly satisfied 17(34%) 25 (50%) 23(46%) 30 (60%)
24 (48%)
dentures Not quite 3 (6%) 15 (30%) 12(24%) 2 (4%)
3 (6%)
Dissatisfied 0 (0) 0 (0) 0 (0) 0 (0)
0 (0)
Much better 34(68%) 40(80%) 28(56%) 35(70%) 33(66%)
Little better 16 (32%) 10 (20%) 22 (44%) 15 (30%) 17 (34%)
Chewing ability
No difference 0(0) 0 (0) 0 (0) 0 (0) 0 (0)
Worse 0(0) 0(0) 0(0) 0(0) 0(0)
≤2 hours 1 (2%) 0 (0%) 3 (6%) 2 (4%) 37 (74%)
Duration of denture 2 to 4 hours 12 (24%) 5 (10%) 26 (52%) 15 (30%) 10 (20%)
adhesives 4 to 6 hours 32 (64%) 35 (70%) 20 (40%) 30 (60%) 3 (6%)
6 to 12 hours 5 (10%) 10 (20%) 1 (2%) 3 (6%) 0 (0%)
Good 5 (10%) 42 (84%) 18 (36%) 37 (74%) 47 (94%)
Taste of denture
Fairly 39 (78%) 7 (14%) 27 (54%) 10 (20%) 3 (6%)
adhesives
Worse 6 (12%) 1 (2%) 5 (10%) 3 (0) 0 (0)
Easy 5 (10%) 8 (16%) 14 (28%) 22 (44%) 50(100%)
Removal of denture
Not easy 38 (76%) 35 (70%) 31 (62%) 27 (54%) 0 (0)
adhesives
Very difficult 7 (14%) 7 (14%) 5 (10%) 1 (2%) 0 (0)
Retention
For maxillary dentures (Fig 1): forty (80%),
fifty (100%), thirty five (70%) thirty seven (74%)
and thirty four (68%) of the 50 subjects were very
satisfied with the retention of the maxillary denture
of group I, II, III, IV and V respectively. While
ten (20%), fifteen (30%), thirteen (26%), twelve
(24%) were fairly satisfied with the retention of the
maxillary denture when using dentures adhesive
of group I, III, IV, and V respectively. Only four
(8%) who were not quite satisfied with the retention
of the maxillary denture with group V dentures Fig (1) Shows Responses of 50 patients to the following
question: How satisfied are you with the retention of
adhesive. There was statistically significant your upper denture when using this adhesive?
difference between the five different adhesive types
on maxillary denture retention {total =34.0551
degree of freedom = 8}.
For mandibular dentures (Fig 2):Satisfaction
with the retention of mandibular dentures was higher
with group II denture adhesive (60%), followed by
group I adhesive (46%), then group V adhesive
(36%), then group IV (30%) and finally group III
(20%). While twenty four (48%), seventeen (34%),
twenty five (50%), twenty three (46%) and thirty
(60%) were fairly satisfied with the retention of the
mandibular denture with group I, II, III, IV and V
respectively. Whereas three (6%), three (6%), fifteen Fig (2) Shows Responses of 50 patients to the following
(30%), twelve (24%), and two (4%) were Not quite question: How satisfied are you with the retention of
your lower denture when using this adhesive.
satisfied with the mandibular denture retention by
using denture adhesives of group I, II, III, IV and
V respectively. There was a statistically significant
difference between the five adhesive types on
mandibular denture retention {total= 40.75772
degree of freedom = 12, P=0.0001}
Chewing Ability (fig 3): Relative to the
effectiveness of chewing, thirty four (68%), forty
(80%), twenty eight (56%), thirty five (70%) and,
thirty three (66%) found that they were able to chew
much better when using denture adhesives of group
I, II, III, IV, and V respectively. Whereas sixteen
(32%), ten (20%), twenty two (44%), fifteen (30%) Fig (3) Shows Responses of 50 patients to the following
and, seventeen (34%) were responded that they were question: Did the use of this denture adhesive have an
able to chew much better with the using of denture effect on your ability to chew?
adhesive of group I, II, III, IV, and V respectively.

Insignificant differences were found between the
five adhesives on chewing ability. {total = 6.801471,
degree of freedom = 4, P = 0.1468000}.
Duration of Retention (fig 4): 1 subject (2%),
3 subjects (6%), 2 subjects (4%), and 37 subjects
(74%) reported denture adhesive of group I, III,
IV, and V respectively were effective up only to
2 hours. While, twelve (24%), five (10%), twenty
six (52%), fifteen (30%), ten (20%) patients found
that adhesives of group I, II, III, IV, and V were
effective up from two to four hours. Whereas, Fig (4) Shows Responses of 50 patients to the following
question how long did this denture adhesive have an
denture retention duration between four to six effect on your dentures?
hours were reported by thirty two (64%), thirty
five (70%), twenty (40%), thirty (60%) and, three
(6%) when using denture adhesive of group I, II,
III, IV, and V. Less number of patients reported that
the denture retention duration is ranged between six
to twelve hours. Significant differences were also
found between the five adhesives on the duration
of retention effectiveness in the mouth {total
=180.6197, degree of freedom=12}.
Taste of denture adhesives (fig 5): Five (10%),
forty two (84%), eighteen (36%), thirty seven
(74%), and 47 of the respondents (94%) rated the
taste denture adhesives of group I, II, III, IV, and V Fig (5) Shows Responses of 50 patients to the following
respectively as good. While patients who found that question: Using this adhesive form, how satisfied is you
with the taste of this adhesive forms?
the taste were fairly good were thirty nine (78%),
seven (14%), twenty seven (54%), ten (20%) and,
three (6%) with the using of adhesive of group I, II,
III, IV, and V respectively. Whereas, less patients
number reported that the five denture adhesive
forms had worse taste. Significant differences
were found between the five denture adhesives on
the taste properties. {total = 98.70686, degree of
freedom = 8}.
Removal of denture adhesives (fig 6): While
the all fifty patients found that the removal of group
V denture adhesive was easy, less patients’ number
reported that the removal of denture adhesive of Fig (6) Shows Responses of 50 patients to the following
group I, II, III, and IV was easy. Whereas, thirty question how was the removal of the adhesive from
eight (76%), thirty five (70%), thirty one (62%), your dentures?
and twenty seven (54%) found the removal of the denture adhesive of both group I and II. Obviously,
remaining adhesive types was not easy, also seven the retention effect is dependent on the adhesive
(14%), seven (14%), five (10%), and 1 (2%) reported properties of the composition 14. So this longer
that the removal of the adhesive types was very duration may be due to ingredients that provide
difficult. There were significant differences between adhesion via carboxyl groups. As the adhesive
the five adhesives on removal from the dentures hydrates, free carboxyl groups form electrocovalent
{total = 112.4751 , degree of freedom = 8 }. bonds that produce stickiness; which provides
greater cohesive strength for longer duration
Discussion because of the stronger covalent bonds. While
with the group III denture adhesive, and the group
In this study, the prosthetic denture adhesives
V adhesive this reduction in duration may be due
improved the retention of the complete denture for
to the percentage of loss of adhesive which was
the majority of the patients. In addition, patients
probably due to their solubility in saliva 12. Similar
were more comfortable with their dentures.
findings have been reported in earlier studies where
In this study, the majority of patients were either peak retention of dentures with adhesives was 3 to 5
very satisfied or fairly satisfied when they used the hours for adhesives with different formulations 15, 16.
five commercial prosthetic denture adhesives in
This study showed that most patients reported
their maxillary dentures. The satisfaction rate for
good taste with either protefix paste, powder and,
retention was still worse for mandibular dentures
cushion; while with the supercorega paste or
when compared with maxillary dentures. This
powder the patient reported fairly or worse taste
finding agreed with Kulak et al 12 where they
this may be attributed to the presence of menthol,
reported that non retentive unstable mandibular
azorubin, P-hydroxy-benzoic acid methyl ester in
denture is common complains of complete denture
the composition of Protefix paste type, and menthol
patient. They claimed that not only the denture
in the ingredients of the Protefix powder type 17
adhesive itself, but also the heights of the existing
and, the absence of these ingredients from either
ridges played a role in the poor satisfaction with
supercorega paste or powder.
retention of mandibular dentures.
In this study, it was difficult to remove the paste-
This study revealed that the chewing ability was
type denture adhesive (supercorega or protefix)
rated from a little better to much better .Neill and
from the denture fitting surface by using mouth
Roberts 13, reported that the use of denture adhesives
rinses and/or cotton gauze. Because of the presence
provided significant improvement in mastication
of water, denture adhesives include carboxymethyl
performance in subjects with poor- and fair-fitting
cellulose hydrates, and display ionic adherence to
dentures. This improvement of the chewing ability
dentures and the mucosa. Also the presence of the
may be related to an increased sense of security
water-insoluble wax will counteract swelling and
and added comfort, even though an adhesive is
dissolution of the poly (oxyethylenes) and sodium
not required for proper denture retention. With the
carboxymethylcellulose, which results in good
increased stability and retention provided by denture
adhesive 18. On the other hand, the patients used
adhesives, denture wearers can apply an increase in
protefix cushion reported that it was so easy to
force during mastication, thus needing less chewing
remove it from the denture and the oral mucosa this
strokes to reach deglutition 5.
may be due to this denture adhesive type hydrated
One important finding of this study was that the mainly outside of the mouth; The advantages of
retention duration was continued after 4 hours for hydrating with water beforehand are not only the
ease of removal, but also the initial adhesive force 5. Psillakis JJ, Wright RF, Grbic JT, Lamster IB.: In practice
in the mouth, or the intended adhesive force with evaluation of a denture adhesive using a gnathometer. J
Prosthodont. 2004 Dec;13(4):244-50.
little saliva 12. Pads and wafers are reported to be
more convenient for disabled patients because 6. Adisman IK: The use of denture adhesives as an aid to
denture treatment. J Prosthet Dent 1989;62:711-715.
there is less adhesive left in the mouth after denture
7. Shay K: Denture adhesives. Choosing the right powders
removal, and cleansing of the denture is easy to do
and pastes. J Am Dent Assoc (1991) 122:70–76.
by peeling off the pad with only light scrubbing 3.
8. Kelsey CC, Lang BR, Wang RF: Examining patients’
However, dentists should not allow its use because
responses about the effectiveness of five denture adhesive
it changes the occlusal relationship and can be a
pastes. J Am Dent Assoc 1997;128:1532-1538.
cause of ridge absorption 12.
9. Nawar N, Eid H, Sabet M: A study on the effect of border
molding on retentive efficiency of maxillary complete
Conclusion denture. Cairo Dent. J. 2005;21(2): 135-140.
The clinical value of a denture adhesive relates 10. Badra H, Radi I, Aboulela A: The effect of ultra-suction
system on the retention of mandibular complete denture.
to improvement of function and its effect on
EDJ .2010;56: 101-109.
the underlying tissue health. There is sufficient
11. Sato Y, Kaiba Y, Hayakawa I: The Evaluation of Denture
information to support the use of denture adhesives
Retention and Ease of Removal from Oral Mucosa on a
to increase denture retention, stability, and incisive
New Gel-Type Denture Adhesive. J Jpn Prosthodont 2008;
ability for ill, fair, and well-fi ting prostheses. Also, 52:175-182.
the use of adhesive creams significantly increased 12. Kulak Y, Özcan M, Arikan A: Subjective Assessment by
the denture retention Patients of the Efficiency of Two Denture Adhesive Pastes.
J Prosthodont 2005;14:248-252.
References 13. Neill DJ, Roberts BJ: The effect of denture fixatives on
1. Liz Pocztaruk R, Vidal RA, Fontoura Frasca LC, masticatory performance in complete denture patients. J
Rivaldo EG, Gavião MBD, Bilt A: Satisfaction level Dent 1973;1:219-222.
and masticatory performance of patient rehabilitated 14. Uysal H, Altay OT, Alparslan N, Bilge A.: Comparison
with implant-supported overdentures. Rev. odonto ciênc. of four different denture cushion adhesives--a subjective
2009;24(2):109-115. study.J Oral Rehabil. 1998 Mar; 25(3):209-13.
2. Celebić A, Knezović-Zlatarić D, Papić M, Carek V, Baucić 15. Swartz ML, Norman RD, Phillips RW: A method for
I, Stipetić J.: Factors related to patient satisfaction with measuring retention of denture adherents: an in vivo study.
complete denture therapy. J Gerontol A Biol Sci Med Sci. J Prosthet Dent 1967;17:456-463.
2003 Oct;58(10):M948-53. 16. Kanapka JA: Bite force as a measure of denture adhesive
3. Nicolas E, Veyrune JL, Lassauzay C.: A Six-Month efficacy. Compend Contin Educ Dent 1984;5(Suppl.
Assessment of Oral Health-Related Quality of Life of 4):S26- S30.
Complete Denture Wearers Using Denture Adhesive: A 17. Al RH, Dahl JE, Morisbak E, Polyzois GL: Irritation and
Pilot Study. J Prosthodont. 2010 Aug;19(6):443-8 cytotoxic potential of denture adhesives Gerodontology.
4. Mañes JF, Selva EJ, De-Barutell A, Bouazza K.: 2005 Sep;22(3):177-83.
Comparison of the retention strengths of three complete 18. Koppang R, Berg E, Dahm S, Real C, Fløystrand F.: A
denture adhesives: An in vivo study. Med Oral Patol Oral method for testing denture adhesives. J Prosthet Dent.
Cir Bucal. 2011 Jan 1;16 (1):e132-6. 1995 May;73(5):486-91.
[Downloaded free from http://www.contempclindent.org on Monday, June 22, 2020, IP: 103.47.133.158]
Comparative assessment of the effectiveness of different cleaning methods

on the growth of Candida albicans over acrylic surface
Subhajit Gantait, Jayanta Bhattacharyya, Samiran Das, Shibendu Biswas1, Amit Ghati1, Soumitra Ghosh, Preeti Goel
Abstract
Context: This study evaluated the efficacy of denture adhesive, cleanser, chlorhexidine, and brushing against Candida albicans biofilm
developed on an acrylic surface and predicted the most effective, simple, and inexpensive way to maintain denture health, thereby
preventing denture stomatitis. Aims: To find the best possible method for maintaining denture hygiene. Settings and Design: This
retrospective analysis was conducted in the Guru Nanak Institute of Dental Sciences and Research, Kolkata, and this in vitro
study was designed to minimize denture stomatitis among denture wearing population. Subjects and Methods: Sixty acrylic
discs of equal dimensions after exposure to C. albicans were treated for a duration of 24 h with denture adhesive, cleanser, 0.2%
chlorhexidine individually, or in combinations simulating clinical conditions dividing in six groups, ten samples each (n = 10).
Statistical Analysis Used: After treatment, colony count was evaluated and statistically analyzed by post hoc Tukey’s test and
Dunnett’s test to determine the most effective way of prevention. Results: The statistical post hoc analysis (Tukey’s test and
Dunnett’s test) showed high significance (P < 0.0001). The group treated with adhesive showed high fungal growth compared to
the control group, whereas chlorhexidine showed high potency to prevent C. albicans, whereas adhesive increased the adhesion
of C. albicans to acrylic surface. Conclusions: Denture adhesive increases the adherence of C. albicans to denture surface.
Other cleaning chemicals such as cleanser and chlorhexidine decrease the adherence. Moreover, among the all denture cleaning
protocol, chlorhexidine drastically inhibit the adherence, as well as growth of C. albicans over denture surface.
Keywords: Candida albicans, chlorhexidine, denture adhesive, denture cleanser, denture stomatitis
Introduction leads to bacterial and fungal colonization causing denture

stomatitis.[3] Denture stomatitis is one of the most common
Increasing life expectancy has led to a rising number of inflammatory conditions that affects denture wearers.[4]
elderly people worldwide, resulting in a high prevalence Although different microbes are responsible for denture
of edentulism and complete denture wearing.[1] It has been stomatitis, most of the cases are caused by colonization of
reported that the fitting surface of maxillary and mandibular Candida species on denture materials among which Candida
dentures is more susceptible for microbial contamination albicans are the most commonly concerned yeast.[5]
and contains significantly high plaque due to stagnation,
pooling of saliva, and the absence of contact with the Different products are commonly used to clean and
tongue[2] along with its inherent unpolished nature which maintain dentures with their specific efficacy. Studies have
contains microscopic pores and irregularities. This often revealed that chemical cleansers contain a variety of active
agents. Effective disinfection can be attained by enzymes,
hypochlorite solutions, acids, mouthwashes, and peroxide
Department of Prosthodontics and Crown & Bridge and
1
solutions. [6] The sodium hypochlorite‑based denture
Department of Microbiology, Guru Nanak Institute of Dental
cleansers are fungicidal and are known to be effective
Sciences and Research, Kolkata, West Bengal, India
by dissolving mucin and other organic substances. [7]
Correspondence: Dr. Jayanta Bhattacharyya, Alkaline peroxides are the most commonly used denture
Department of Prosthodontics and Crown & Bridge, cleaners due to its good antimicrobial activity against
Guru Nanak Institute of Dental Sciences and Research, denture biofilms in the absence of odor and after taste.[8]
Kolkata ‑ 700 114, West Bengal, India. Chlorhexidine is one of the most widely used agents in
E‑mail: drjb68@gmail.com dentistry and has been used as an adjunct in the treatment
This is an open access article distributed under the terms of the Creative
Access this article online Commons Attribution-NonCommercial-ShareAlike 3.0 License, which allows
Quick Response Code: others to remix, tweak, and build upon the work non-commercially, as long as the
Website: author is credited and the new creations are licensed under the identical terms.
www.contempclindent.org For reprints contact: reprints@medknow.com
How to cite this article: Gantait S, Bhattacharyya J, Das S, Biswas S,

DOI: Ghati A, Ghosh S, et al. Comparative assessment of the effectiveness of
10.4103/0976-237X.188554 different cleaning methods on the growth of Candida albicans over acrylic
surface. Contemp Clin Dent 2016;7:336‑42.
© 2016 Contemporary Clinical Dentistry | Published by Wolters Kluwer - Medknow 336

Gantait, et al.: Effectiveness of denture cleaning methods on C. albicans growth
of oral candidiasis since the 1970s. Being an antiseptic Table 1a: List of instruments
agent with a broad spectrum of antimicrobial activity Instruments Manufacturer
including C. albicans and other common nonalbican yeast Conical flask Borosil, India
species, chlorhexidine‑based treatments have the ability
Beaker Borosil, India
to remove denture biofilm.[9] Many denture wearers use
Petri dish Borosil, India
denture adhesives for better retention and stability of
denture. Various studies have shown conflicting results. Test tube Borosil, India
While some in vitro studies showed that some denture Glass rod Borosil, India
adhesives supported C. albicans growth, inducing Inoculation loop Nova biotech, India
hyphal formation,[10] others have suggested that denture Autoclave Labquip, India
adhesives possessed antifungal activity.[11] In light of these
Hot air oven Tempstar, India
observations, this study was undertaken to evaluate the
Incubator Tempstar, India
efficacy of denture adhesive, cleanser, chlorhexidine, and
combination of these agents against C. albicans biofilm Centrifugal machine Remi, India
developed on the acrylic surface to find the most effective, Ultrasonic cleaner Sturdy Industrial Co., Ltd., Taiwan
simple, and inexpensive way to maintain denture health, Electronic weighing machine CAS - ME 310, Japan
thereby preventing denture stomatitis. Compound microscope Olympus, Japan
CH21, CH20i
Subjects and Methods Acrylizer unit Unident Instruments Pvt. Ltd., India
Instruments and materials

Table 1b: List of materials
The instruments and materials used in this study are given in
Tables 1a and b, respectively. To avoid cross‑contamination, Materials Manufacturer
strict principle of sterilization was followed as shown in Heat cure polymethyl methacrylate resin DPI, India
Table 1c. Artificial saliva ICPA, India
0.2% CHX mouthwash ICPA, India
Methods
Denture adhesive paste DENTAIDS, India
In this study, sixty acrylic samples were divided into six groups
of ten each. Each acrylic sample was 10 mm in diameter and Denture CL tablets DENTAIDS, India
1.5 mm in thickness. Polymerization was done in an acrylizer Sample of Candida albicans CSIR-IMTECH, India
at 74°C for 90 min and 100°C for 30 min following which it Culture media
was allowed to bench cool for 2 h. All acrylic specimens were Saboraud dextrose agar media HiMedia Laboratories
removed from the flask and immersed in distilled water at Saboraud dextrose agar broth Pvt. Ltd., India
37°C for 12 h for residual monomer release followed by an
Cotton swab stick (sterile) Nova biotech, India
ultrasonic cleaning in an ultrasonic cleaner for 20 min in
Absolute alcohol HiMedia Laboratories
distilled water. Finishing and polishing were not done as the Pvt. Ltd., India
samples were meant to simulate the rough intaglio surface
ICPA: Indian Commercial Pilots Association; CSIR: Council of Scientific
of the denture. and Industrial Research; IMTECH: Institute of Microbial Technology;
CL: Cleanser; CHX: Chlorhexidine
Instead of direct spore application, a suspension preparation
of C. albicans in artificial saliva was used in this study to Table 1c: Methods of sterilization
enable a uniform adherence on all samples. The fungal agent Materials/instruments Method of sterilization
(C. albicans MTCC‑227) was cultured on Sabouraud dextrose
Acrylic discs Hot air oven (for surface sterilization)
agar (SDA) at 37°C for 48 h aerobically, and the inoculum of Culture media followed by autoclaving at 121°C
this fungal agent was prepared in 50 ml Sabouraud dextrose Culture broth temperature and 15 lb psi pressure
broth (SDB) by incubating at 37°C for 48 h with vigorous Distilled water for 15 min
shaking and adjusted to 1 × 107 cells/ml according to 0.5 Test tube
McFarland test standard turbidimetrically.[12] After affluent Petri dish
Conical flask
fungal growth, cells were harvested by centrifugation at Measuring pipette
4000 ×g for 10 min and transferred to a sterile conical flask Glass rod
containing 60 ml of artificial saliva and mixed homogeneously Inoculation loop Dry heat for 30 s
to prepare a cell suspension. This was divided into six test
tubes each containing 10 ml of cell suspension. Ten sterilized
acrylic discs were added to each test tube which were kept Following exposure to C. albicans, each group as described
still for 6 h and then shaken well at every 1 h interval to in Table 2 was treated by a particular cleaning protocol over
achieve adherence of C. albicans. a period of 24 h with adhesive (Group I) or cleanser (Group
337 Contemporary Clinical Dentistry | Jul-Sep 2016 | Vol 7 | Issue 3

II) or chlorhexidine mouthwash (Group III) or adhesive + cleanser solution was made by dropping one‑half of a tablet
chlorhexidine (Group IV) or adhesive + chlorhexidine (Group in distilled water to give instant effervescence. At the 24th h,
V). Cleaning under regular tap water mechanically without samples were kept in solution for 3 min as instructed by the
any other chemical was considered as the control group manufacturer.
(Group VI). The duration of the cleaning protocol with each
agent was chosen such that it simulated clinical conditions For Group III
as depicted in Table 2. The summarized flowchart depicting Treatment was performed as in Group II. After exposure of
the methodology of the study is shown in Figure 1. acrylic discs with fungal suspension and incubation, samples
were kept in 0.2% chlorhexidine for 5 min at the 24th h.
Cleaning protocol
For Group I For Group IV
All the acrylic discs (n = 10) were incubated with C. albicans All the acrylic discs (n = 10) were incubated with C. albicans
cells in artificial saliva for 12 h initially and then discs were cells in artificial saliva for 12 h initially and then discs were
aseptically immersed in a thin suspension of adhesive paste aseptically immersed in a thin suspension of adhesive and
and mixed homogeneously for 10 min to coat adhesive on mixed homogeneously for 10 min to coat adhesive on the
the whole surface of acrylic discs. Coated acrylic discs were whole surface of acrylic discs. Coated acrylic discs were
then retransferred to the test tube containing C. albicans then retransferred to the test tube containing C. albicans
suspension and further reincubated for more 12 h duration. suspension and further reincubated for more 12 h duration.
After incubation of overall 24 h, the acrylic discs were then After incubation of overall 24 h, the acrylic discs were then
recoated once with adhesive. recoated once with adhesive and each acrylic disc was gently
collected from the tubes and immersed in 0.2% chlorhexidine
For Group II for 5 min with gentle shaking.
All acrylic discs (n = 10) were incubated with C. albicans
suspension in artificial saliva for 24 h. A freshly prepared For Group V
Acrylic discs (n = 10) were incubated with C. albicans
Table 2: Study design of different treatment group suspension in artificial saliva for 12 h initially and then discs
Groups Treatment Methods of treatment
were aseptically immersed in a thin suspension of adhesive
and mixed homogeneously for 10 min to coat adhesive on
I ADH ADHs applied 12 hourly (at 12th and 24th h)
the whole surface of acrylic discs. Coated acrylic discs were
aseptically in thin layer
then retransferred to the test tube containing C. albicans
II CL Cleansing done by keeping in effervescent
suspension and again reincubated further 12 h duration.
solution of CL for 3 min at 24th h
After incubation of overall 24 h, the acrylic discs were then
III CHX Kept in 0.2% CHX for 5 min after 24th h
recoated with adhesive one more time. Samples were then
IV ADH + CHX ADHs applied 12 hourly (at 12th and 24th h) treated with freshly prepared cleanser solution; one‑half of
+ kept in 0.2% CHX for 5 min at 24th h
a tablet (clanden) was dropped in distilled water which gave
V ADH + CL ADHs applied 12 hourly (at 12th and instant effervescence and readily made a greenish color
24th h) + cleansing by effervescent
solution of CL for 3 min at 24th h
cleanser solution. Samples were kept in solution for 3 min
at the 24th h as instructed by the manufacturer.
VI Control Washing done under regular water
flow 8 hourly for 2 min for each sample
(at 8th, 16th, and 24th h) For Group VI
ADH: Adhesive; CL: Cleanser; CHX: Chlorhexidine; ADH + CHX: Adhesive + In the case of the control group (Group VI), acrylic discs
chlorhexidine; ADH + CL: Adhesive + cleanser (n = 10) were incubated with C. albicans suspension in
Sterilized acrylic samples (60)
Exposure to Candida albicans
Samples divided into six groups
Group 1 Group 2 Group 3 Group 4 Group 5 Group 6

Application of Cleaning by Cleaning by Application of Application of Cleaning by
denture adhesive denture cleanser chlorhexidine denture adhesive denture adhesive brush thrice daily
+ + under regular tap
Cleaning by Cleaning by water
chlorhexidine denture cleanser
Figure 1: The summarized flowchart depicting the methodology of the study

Contemporary Clinical Dentistry | Jul-Sep 2016 | Vol 7 | Issue 3 338
artificial saliva for overall 24 h with intermittent washing multiple comparison analysis between groups [Table 3b]
under regular water flow for a duration of 2 min at every indicated that mean of most of the treatment groups was
8 h interval. highly significant (P < 0.0001). Besides, post hoc Dunnett’s
multiple comparison test between the control group
After treatment, each acrylic disc across all groups was then (Group VI) and treatment groups (Group I, II, III, IV, and V)
transferred to corresponding test tubes containing 10 ml showed high significance (P < 0.0001). Though, Group I
sterilized SDB and incubated for 24 h, shaken 8 hourly, at which was treated with adhesive alone showed noticeably
37°C. After incubation, each acrylic disc was gently discarded high fungal growth compared to control group (Group VI)
from the tubes, and all the tubes containing fungal growth and was statistically highly significant (P < 0.0001) according
were diluted to 10−4 and 100 μl amount of specimen was to post hoc Dunnett’s multiple comparison test [Table 3c].
seeded onto SDA medium and incubated for 48 h at 37°C. Whereas, other groups of treatment also showed statistically
After incubation, the colonies were counted and expressed high significance (P < 0.0001) compare to control group, but
as colony‑forming units per milliliter to evaluate the it was on the basis of suppressing the fungal growth.
effectiveness of different cleaning protocol.
Statistical analysis of data

Statistical analysis was performed by one‑way analysis of
variance (ANOVA) and post hoc analysis was done to compare
in between two groups by Tukey’s multiple comparison test
and also for each group to the control by Dunnett’s multiple
comparison test using GraphPad Prism 5.03 (GraphPad
Software, Inc. San Diego, CA, USA). The significance level a b
was set at P ≤ 0.05.
Results
The residual colony‑forming unit of C. albicans after treatment

with different protocol is given Table 3a. Comparative
examination showed that chlorhexidine (Group III) was the
most effective agent in reducing the growth of C. albicans c d
followed by the treatment with a combination of adhesive and
chlorhexidine (Group IV) and treatment with cleanser (Group II).
Treatment with combination product of adhesive and cleanser

(Group V) also showed reduced fungal growth with respect to
control group (Group VI), while denture material treated with
adhesive (Group I) alone showed markedly high fungal growth
not only with respect to control group but also with respect
to all other groups of treatment [Figure 2]. Mean of fungal e f
colony‑forming unit after treatment with different groups was Figure 2: Residual candidal growth after treatment with
statistically compared by one‑way ANOVA which indicated different methods: (a) adhesive, (b) cleanser, (c) chlorhexidine,
significant differences among these groups. Post hoc Tukey’s (d) adhesive + chlorhexidine, (e) adhesive + cleanser, (f) control
Table 3a: Residual colony-forming units of Candida albicans after treatment with different methods
Group Total CFU Mean±SEM
Group 1 - ADH 1117 1088 1107 1076 997 1023 1049 1153 1167 1137 1091±18
Group 2 - CL 69 63 67 58 54 59 62 67 75 63 64±1.9
Group 3 - CHX 0 0 0 0 0 0 0 0 0 0 0.00±0.00
Group 4 - ADH+CHX 1 2 1 3 1 1 0 2 1 0 1.20±0.29
Group 5 - ADH+CL 527 486 507 458 437 446 457 503 519 497 484±10
Group 6 - washing 937 912 924 884 867 883 898 1012 1026 997 934±18
with tap water (control)
CFU: Colony-forming units; SEM: Standard error of mean; ADH: Adhesive; CL: Cleanser; CHX: Chlorhexidine; ADH + CHX: Adhesive + chlorhexidine;
ADH + CL: Adhesive + cleanser

Table 3b: Post hoc Tukey’s multiple comparison test study of Stafford and Russell[10,11] who found that most
between treatment groups. Significant level was set as denture adhesives promoted the growth of C. albicans by
P ≤0.05
inducing hyphal formation. This study also supported the
Tukey’s multiple Mean Significant findings of Sampaio‑Maia et al.[14] where they found that
Summary
comparison test differences P <0.05 among ten studied adhesives, four adhesives had an inducing
ADH versus CL 1028 Yes *** effect on fungal growth while others had an inhibitory
ADH versus CHX 1091 Yes *** effect. In an in vivo study conducted by Oliveira et al.,[15] it
ADH versus ADH + CHX 1090 Yes *** was found that denture adhesives did not significantly alter
ADH versus ADH + CL 608 Yes *** the oral microbiota over a 14‑day trial period, the results of
which may have been influenced by the level of oral hygiene
ADH versus tap water (control) 157 Yes ***
maintenance across different subjects. The present in vitro
CL versus CHX 64 Yes **
study was an attempt to keep most of the variables same for
CL versus ADH + CHX 63 Yes ** all the samples. The discrepancies in the previous studies may
CL versus ADH + CL −420 Yes *** be attributed to the fact that each study evaluated different
CL versus tap water (control) −870 Yes *** denture adhesives and employed different techniques to
CHX versus ADH + CHX −1.2 No NS assay microbial growth. The present study showed that
CHX versus ADH + CL −484 Yes *** acrylic treated with adhesive had the highest contamination
by C. albicans which may have been caused due to adhesive
CHX versus tap water (control) −934 Yes ***
increasing the surface area of acrylic sample. In the present
ADH + CHX versus ADH + CL −483 Yes ***
study, Group II treated with cleanser (clanden, GLOBAL DENT
ADH + CHX versus tap −933 Yes *** AIDS PVT LTD NOIDA, New Delhi, India), contains sodium
water (control)
perborate, showed a significant inhibitory effect on fungal
ADH + CL versus tap −450 Yes *** growth, and exhibited almost 94% fungicidal activity with
water (control)
respect to control. Many authors have proved the efficacy of
**P<0.001, ***P<0.0001. ADH: Adhesive; CL: Cleanser; CHX: Chlorhexidine;
ADH + CHX: Adhesive + chlorhexidine; ADH +CL: Adhesive + cleanser; NS:
alkaline perborate denture cleanser like sodium perborate
Not significant (Na2H4B2O8) tablets to be efficient in removing biofilm.[16,17]
The fungicidal mechanism of cleanser might be explained
Table 3c: Post hoc Dunnett’s multiple comparison test by the fact that it contains sodium perborate (Na2H4B2O8).
between treated group with control group In aqueous solution, it produces hydrogen peroxide (H2O2)
Dunnett’s multiple Mean Significant which chemically possesses both the oxidizing and reducing
Summary
comparison test differences P <0.05 properties and easily decomposes to form water and nascent
Tap water (control) versus ADH −157 Yes *** oxygen. H2O2 is a strong oxidizer, containing oxygen‑oxygen
Tap water (control) versus CL 870 Yes ***
single bond (O‑O) which makes it thermodynamically
unstable. This nascent oxygen or singlet oxygen creates
Tap water (control) versus CHX 934 Yes ***
oxidative stress on the fungal cells and arrests their metabolic
Tap water (control) versus 933 Yes ***
machinery and the fungal cells eventually die. Again in basic
ADH + CHX
solution, H2O2 produces hydroxyl radicals (·OH) and reduces
Tap water (control) versus 450 Yes ***
many inorganic and organic elements. These hydroxyl radicals
ADH + CL
readily react with and damage vital cellular components.
***P<0.0001. Significant level was set as P ≤0.05. ADH: Adhesive; CL:
Cleanser; CHX: Chlorhexidine; ADH + CHX: Adhesive + chlorhexidine; Alkaline peroxides when dissolved in water forms solution of
ADH + CL: Adhesive + cleanser hydrogen peroxide and liberate nascent oxygen or hydroxyl
radicals depending on the pH of the solution and damage
Discussion vital cellular components.[18] The oxygen bubbles also exert
a mechanical cleansing effect.[19] Thus, alkaline peroxide
The guidelines outlined by the American College of cleansers are able to remove Candida from the acrylic surface
Prosthodontics recommend that dentures should be cleaned either by oxidation or reduction or both.
daily by soaking and brushing with an effective, nonabrasive
denture cleanser.[13] However, for denture wearers with Chlorhexidine showed a remarkable fungicidal activity
limited motor function, use of denture adhesives are a which was most potent among all the studied groups in
commonly suggested method to maintain dentures. The the present study. Chlorhexidine is a cationic polybiguanide
effect of different denture adhesives on controlling the (bisbiguanide) that shows a broad spectrum antimicrobial
candidal growth on denture materials is quite controversial. activity against many Gram‑positive and Gram‑negative
Several past studies have suggested that denture adhesives bacteria and fungi. It has both bacteriostatic and bactericidal
suppress fungal growth.[6,11] In the present study, it has mechanisms of action, depending on its concentration.
been seen that denture adhesive promotes the growth of Chlorhexidine acts against fungi, as well as bacteria, by
C. albicans on denture material. This finding supports the disrupting the cell membrane and inducing cytoplasmic
precipitation. Chlorhexidine is a positively‑charged molecule environment. Various alternative cleaning methods such as
that binds to the negatively charged sites on the cell ultraviolet radiation and microwaves were not included as a
wall which destabilizes the cell wall and interferes with parameter in this study.
osmosis.[20,21] McDonnell and Russell[21] proposed that the
bacterial uptake of chlorhexidine was very rapid, typically Conclusion
working within 20 s. In low concentrations, it affects the
integrity of the cell wall. Once the cell wall is damaged, Within limitations of the study, the following conclusions
chlorhexidine then crosses into the cell itself and attacks can be drawn: Denture adhesive increases the adherence of
the cytoplasmic membrane (inner membrane). Damage C. albicans to denture surface to a large extent. When denture
to the cytoplasm’s delicate semipermeable membrane adhesives are to be used special care to clean the denture
allows for leakage of components leading to lysis and cell with chlorhexidine or a cleanser must be taken to remove the
death. In high concentrations, chlorhexidine causes the Candida biofilm. Chlorhexidine should be the first choice for
cytoplasm to congeal or solidify. The present study proved cleaning rather than a cleanser used alone or in combination
the efficacy of chlorhexidine to be 100% against C. albicans in with denture adhesives.
a concentration of 0.2% for 5 min. This could be correlated
with a study by Vianna et al. in 2004 on disinfection of Financial support and sponsorship
infected root canals where 2.0% chlorhexidine showed its Nil.
efficacy against C. albicans >99.99%. Pusateri et al.[22] tested
the sensitivity of chlorhexidine on C. albicans grown on Conflicts of interest
denture acrylic. This study also suggested chlorhexidine There are no conflicts of interest.
to be significantly effective against C. albicans. de Andrade
et al.[23] proposed that 0.12% for 20 min and 2.0% for 5 min References
worked with equal efficacy to remove denture biofilm and
suggested any of these methods as an auxiliary for cleaning 1. Orsi IA, Junior AG, Villabona CA, Fernandes FH, Ito IY. Evaluation
denture. of the efficacy of chemical disinfectants for disinfection of
heat-polymerised acrylic resin. Gerodontology 2011;28:253-7.
2. Keng SB, Lim M. Denture plaque distribution and the effectiveness
The present study also investigated two groups which of a perborate-containing denture cleanser. Quintessence Int
contained a combination of two denture products, namely 1996;27:341-5.
“adhesive + chlorhexidine” (Group IV) and “adhesive + 3. Jagger DC, Al-Akhazam L, Harrison A, Rees JS. The effectiveness
of seven denture cleansers on tea stain removal from PMMA
cleanser” (Group V). No previous study using this combination acrylic resin. Int J Prosthodont 2002;15:549-52.
was found although these situations are very common 4. Webb BC, Thomas CJ, Willcox MD, Harty DW, Knox KW.
clinically where a patient uses both these products. It has Candida-associated denture stomatitis. Aetiology and
been seen that Group IV was more efficient than Group V management: A review. Part 1. Factors influencing distribution of
Candida species in the oral cavity. Aust Dent J 1998;43:45-50.
with respect to fungicidal activity (99% and 52%, respectively). 5. Budtz‑Jörgensen E. The significance of Candida albicans in
This may be explained by the fact that although adhesive denture stomatitis. Scand J Dent Res 1974;82:151-90.
promoted C. albicans to colonize efficiently, the strong 6. Jagger DC, Harrison A. Denture cleansing – the best approach.
Br Dent J 1995;178:413-7.
fungicidal activity of chlorhexidine was still potent against
7. Harrison Z, Johnson A, Douglas CW. An in vitro study into
C. albicans. In Group V, i.e., in the case of “adhesive + the effect of a limited range of denture cleaners on surface
cleanser” group, the fungal count was higher when compared roughness and removal of Candida albicans from conventional
to “adhesive + chlorhexidine” group because the main heat-cured acrylic resin denture base material. J Oral Rehabil
2004;31:460-7.
fungicidal agent of cleanser (H2O2) might not have efficiently
8. Paranhos HF, Silva-Lovato CH, de Souza RF, Cruz PC,
penetrated the adhesive‑coated acrylic samples due to its low de Freitas-Pontes KM, Watanabe E, et al. Effect of three methods
half‑life. Thus, C. albicans in the outer surface of the adhesive for cleaning dentures on biofilms formed in vitro on acrylic resin.
layer was affected by H2O2, but fungal cells protected by the J Prosthodont 2009;18:427-31.
9. Ellepola AN, Samaranayake LP. Adjunctive use of chlorhexidine
adhesive layer were unaffected as they are beyond the reach
in oral candidoses: A review. Oral Dis 2001;7:11-7.
of H2O2. Moreover, in this study, contamination of the acrylic 10. Stafford GD, Russell C. Efficiency of denture adhesives and
samples was avoided by directly inoculating the acrylic discs their possible influence on oral microorganisms. J Dent Res
in SDB containing fungal growth which might have influenced 1971;50:832-6.
11. Makihira S, Nikawa H, Satonobu SV, Jin C, Hamada T. Growth of
the results. Candida species on commercial denture adhesives in vitro. Int J
Prosthodont 2001;14:48-52.
Limitation 12. Mcfarland J. The nephelometer: An instrument for estimating the
The limitations of the study could be the use of acrylic discs number of bacteria in suspensions used for calculating the opsonic
index and for vaccines. JAMA 1907;49:1176-8.
instead of dentures where the surface roughness of acrylic 13. Felton D, Cooper L, Duqum I, Minsley G, Guckes A, Haug S,
surface did not mimic the roughness of intaglio surface of et al. Evidence-based guidelines for the care and maintenance
the denture. Moreover, there was no simulation of the oral of complete dentures: A publication of the American College of

Prosthodontists. J Prosthodont 2011;20 Suppl 1:S1-12. Chem 2007;79:2325-38.

14. Sampaio-Maia B, Figueiral MH, Sousa-Rodrigues P, Fernandes MH, 19. Vianna ME, Gomes BP, Berber VB, Zaia AA, Ferraz CC,
Scully C. The effect of denture adhesives on Candida albicans de Souza-Filho FJ. In vitro evaluation of the antimicrobial activity
growth in vitro. Gerodontology 2012;29:e348-56. of chlorhexidine and sodium hypochlorite. Oral Surg Oral Med
15. Oliveira MC, Oliveira VM, Vieira AC, Rambob I. In vivo assessment Oral Pathol Oral Radiol Endod 2004;97:79-84.
of the effect of an adhesive for complete dentures on colonisation 20. Gomes BP, Vianna ME, Matsumoto CU, Rossi Vde P,
of Candida species. Gerodontology 2010;27:303-7. Zaia AA, Ferraz CC, et al. Disinfection of gutta-percha cones with
16. Kumar MN, Thippeswamy HM, Raghavendra Swamy KN, chlorhexidine and sodium hypochlorite. Oral Surg Oral Med Oral
Gujjari AK. Efficacy of commercial and household denture Pathol Oral Radiol Endod 2005;100:512-7.
cleansers against Candida albicans adherent to acrylic denture 21. McDonnell G, Russell AD. Antiseptics and disinfectants: Activity,
base resin: An in vitro study. Indian J Dent Res 2012;23:39-42. action, and resistance. Clin Microbiol Rev 1999;12:147-79.
17. Dhamande MM, Pakhan AJ, Thombare RU, Ghodpage SL. 22. Pusateri CR, Monaco EA, Edgerton M. Sensitivity of Candida
Evaluation of efficacy of commercial denture cleansing agents albicans biofilm cells grown on denture acrylic to antifungal
to reduce the fungal biofilm activity from heat polymerized proteins and chlorhexidine. Arch Oral Biol 2009;54:588-94.
denture acrylic resin: An in vitro study. Contemp Clin Dent 23. de Andrade IM, Cruz PC, Silva-Lovato CH, de Souza RF,
2012;3:168-72. Souza-Gugelmin MC, Paranhos Hde F. Effect of chlorhexidine
18. Prousek J. Fenton chemistry in biology and medicine. Pure Appl on denture biofilm accumulation. J Prosthodont 2012;21:2‑6.

Gabungan Paper Prosto

Diunggah oleh

Informasi Dokumen

Hak Cipta

Format Tersedia

Bagikan dokumen Ini

Bagikan atau Tanam Dokumen

Opsi Berbagi

Apakah menurut Anda dokumen ini bermanfaat?

Apakah konten ini tidak pantas?

Hak Cipta:

Format Tersedia

Gabungan Paper Prosto

Diunggah oleh

Hak Cipta:

Format Tersedia

PENGARUH DENTURE ADHESIVE TERHADAP

PERTUMBUHAN DAN PERUBAHAN

Dosen Pembimbing: Penyaji:

Putri Welda Utami Ritonga, drg., MDSc, Kristin Halim (190631029)

Pengaruh Denture Adhesive Terhadap Pertumbuhan dan

1. Pendahuluan tiruan menggunakan denture

Pada beberapa tahun yang lalu, adhesive tidak mempunyai pengaruh

alat ini dapat dideteksi struktur dipolish dengan kertas waterproof

2.2 Persiapan bahan spesimen

adalah jumlah minimum yang spesimen, diikuti preinkubasi pada

2.3.2 Perhitungan jumlah C. Tabel 2. Primer yang digunakan dalam

masing 10 µM primer (tabel 2), dan inkubasi

7.5 µL air destilasi steril (volume total Setelah preinkubasi,

2.3.4 Ekspresi gen hifa spesifik 2.3.5 Observasi permukaan

Institute Inc., Cary, NC, USA), 3.2 Laju adhesi inisial

kelompok Co saat diinkubasi pada dengan kelompok kaldu setelah

Gambar 4. Jumlah perlekatan C. albicans

3.4 Ekspresi gen hifa spesifik

bentuk yeast pada inkubasi selama 3 sedikit yang menunjukkan perubahan

4. Diskusi Tidak terdapat perbedaan

Meskipun sudah ada beberapa signifikan yang ditemukan pada saat

penelitian mengenai perlekatan C. laju adesi inisial dari C. albicans

dan bahan soft-lining akrilik 21, 27, 33

yang dilaporkan mengenai denture penelitian ini menyimpulkan bahwa

adhesive 22-24. Penelitian sebelumnya penggunaan denture adhesive tidak

mengenai denture adhesive dimana memiliki pengaruh pada adhesi inisial

fokus utamanya adalah terhadap dari C. albicans. Hasil penelitian ini

jumlah mikroorganisme, dan masih konsisten dengan hasil penelitian

yang dilakukan oleh Sampaio-Maia setelah pasien membersihkan gigi

C. albicans diklasifikasikan pada kelompok Cr dan Po dengan

menyebabkan stomatitis oral setelah 5. Kesimpulan

life before and after complete using denture adhesive: a pilot

by a patient. Fortn Rev Chic 23. Ozkan YK, Uçankale M,

Arch Oral Biol 2016;66:129– albicans to denture-base

journal of prosthodontic research xxx (2019) xxx–xxx

Contents lists available at ScienceDirect

Journal of Prosthodontic Research

Effects of denture adhesives on growth and morphological

1. Introduction adhesives has been reported to improve patient satisfaction,

2 T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx

2. Materials and methods 2.3.1. Harvesting of C. albicans adhering to each specimen

Fig. 1. SEM images of resin blocks before and after autoclaving.

T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx 3

Table 1. Denture adhesives used in this study

Type Cream Powder Cushion

Table 2. Primers used in quantitative real-time RT-PCR

2.3.4. Expression of hyphae-speciﬁc genes at each incubation time

2.3.5. Observation of the surface of specimens by the scanning electron

4 T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx

3.2. Initial adhesion rate

3.3. Adhering number of C. albicans at each incubation time

The numbers of C. albicans adhering to the specimens increased

The expressions of hyphae-speciﬁc genes of C. albicans adhering

3.5. Identiﬁcation of the C. albicans form

Figure 6 shows the surface of the specimens at each incubation

T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx 5

Fig. 5. Hyphae-speciﬁc genes expression at each incubation time.

6 T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx

Fig. 6. Identiﬁcation of C. albicans form.

T. Nomura et al. / journal of prosthodontic research xxx (2019) xxx–xxx 7

Salah satu dampak negatif dari denture adhesive à

Candida albicans à bentuk yeast atau bentuk hifa. C.

Ekspresi gen hifa

Observasi permukaan spesimen dengan