Anda di halaman 1dari 4

Struktur polipeptida

Polipeptida merupakan polimer yang tersusun dari beberapa peptida hasil pengikatan gugus
karboksil (COOH) dengan gugus amino. Satu atau lebih polipeptida dapat membentuk protein,
contohnya enzim.
Polipeptida terbentuk melalui proses ekspresi gen yang terjadi di dalam sel.
Polipeptida merupakan nama lain dari protein. Polipeptida tersusun atas asam amino-asam amino
yang terhubung satu sama lain dengan ikatan peptida membentuk diri seperti rantai. Protein
merupakan zat yang sangat penting bagi kehidupan mahluk hidup. Kata protein berasal dari
bahasa Yunani protos atau proteos yang artinya pertama atau utama. Disebut demikian karena
protein memegang peranan penting dalam penyusunan tubuh mahluk hidup, dan jika tidak
karena protein yang menyusunnya, maka manusia dan mahluk lainnya tidak akan hidup.jika
kekurangan saja, ia akan sakit, dan jika sudah sangat kronis kekurangannya, maka ia akan mati
secara perlahan-lahan.
Manusia memperoleh protein dari tumbuhan dan hewan karena ia tidak dapat membentuk
protein. Protein yang didapatkan atau berasal dari hewan disebut protein hewani, sedangkan
protein yang didapatkan dari tumbuhan disebut protein nabati. Beberapa makanan yang
mengandung protein diantaranya susu, ikan, telur, dan daging.
Tumbuhan dapat membentuk protein dari zat-zat anorganik, yaitu karbon dioksida, air, dan
senyawa nitrogen. Hewan dan manusia yang memakan tumbuhan dan hewan adalah suatu proses
mengubah protein nabati menjadi protein hewani. Komposisi rata-rata unsur kimia yang terdapat
pada protein antara lain: Karbon 50 %, hidrogen 7%, oksigen 23%, nitrogen 16%, belerang 03%, dan fosfor 0-3%.
Sebuah protein tersusun atas asam amino-asam amino dalam jumlah yang banyak. Asam amino
merupakan asam karboksilat yang mempunyai gugus amino.
Terdapat dua puluh jenis asam amino yang sampai sekarang sudah diketahui. Asam amino-asam
amino tersebut dapat dikelompokkan menjadi asam amino esensial dan asam amino non-esensial.
Asam amino esensial adalah asam amino yang tidak dapat dibuat atau disintesis oleh tubuh
manusia. Sedangkan asam amino non-esensial adalag asam amino yang dapat dibuat oleh tubuh
manusia.
Berikut merupakan jenis asam amino-asam amino yang termasuk essensial dan non-esensial.
Asam amino non-esensial

Asam amino esensial

Triptofan

Isoleusin

Tirosin

Arginin

Treonin

Fenilalanin

Sistein

Glutamin

Metionin

Valin

Serin

Histidin

Lisin

Leusin

Prolin

Alanin

Glisin

Asparagin

Asam glutamat Asam aspartat

Pada pembahasan sebelumnya diketahui bahwa asam amino-asam amino dapat dibuat atau
disintesis oleh tubuh. Asam amino tersebut dikodekan dengan sebuah kodon. Ingat bahwa sebuah
kodon terditi dari tiga buah nukleotida, yang dengan kata lain terdiri dari tiga gula, tiga asam
pospat, dan tiga basa nitrogen. Jadi, satu asam amino dikodekan oleh tiga basa nitrogen.
Pada proses sintesis protein dengan cara transkripsi dan translasi, protein disusun dengan cara
penerjemahan kode-kode basa nitrogen menjadi asam amino, dan asam amino-asam amino
disusun menjadi sebuah protein. Demikianlah proses yang terjadi pada sebuah sel yang
memproduksi protein untuk keperluan dirinya melanjutkan hidup.
Fungsi polipeptida

Protein yang dikonsumsi manusia dan hewan akan berfungsi untuk:


1. Pembentukan dan pertumbuhan tubuh dengan cara berikatan dengan lipid
atau lemak,atau zat anorganik seperti fosfor menjadi fosfolipid.
2. Sebagai biokatalis, yaitu protein yang menyusun sebuah enzim, berfungsi
untuk mempercapat reaksi-reaksi kimia yang ada di dalam tubuh.
3. Mengangkut berbagai jenis gas. Misalnya jenis protein yang membangun
hemoglobin yang berada di dalam sel-sel darah merah(eritrosit), berfungsi
mengangkut oksigen dan karbon dioksida dari paru-paru ke seluruh tubuh
dan sebaliknya.
4. Sebagai antigen atau antibodi yang melawan zat-zat asing yang masuk ke
dalam tubuh manusia, misalnya sel darah putih.
5. Sumber energi. Protein dapat dijadikan sebagai bahan bakar untuk
menghasilkan energi jika sumber energi utama, yaitu karbohidrat, sedang
mengalami kekurangan, atau karena aktivitas otot yang terlalu aktif.
6. Sebagai zat yang menguatkan ikatan antara tulang dan daging, misalnya
tendon dan kolagen.
7. Untuk penyimpanan, misalnya feritin untuk menyimpan besi dalam darah dan
gliadin untuk menyimpan asam amino dalam biji gandum yang dorman.

Sebuah polinukleotida merupakan polimer, atau rantai, nukleotida. Anda


mungkin pernah mendengar tentang sepasang terkenal polinukleotida disebut DNA. Sepupu
RNA adalah juga sebuah polinukleotida. Dalam pelajaran ini, kita akan belajar bagaimana
nukleotida bergabung bersama untuk membuat untai polinukleotida.

Struktur
Pikirkan tali bendera misal pada upacara bendera atau bahkan bendera Anda mungkin yang
akan lihat di dealer mobil. Tali yang dimaksud ada seperti tulang punggung yang memegang
bendera bersama-sama.
Sebuah polinukleotida memiliki tulang belakang juga. Ini terbuat dari gula dan fosfat bagian
nukleotida, jadi kita menyebutnya sebagai tulang punggung gula-fosfat.

Bendera adalah seperti basa


nitrogen. Sama seperti sehelai bendera dapat memiliki urutan mengatakan merah, merah, biru,
merah, hijau Untai polinukleotida memiliki urutan basa. Alih-alih warna, basa memiliki
nama kimia yang berbeda. Dalam DNA, basa adalah adenin, guanin, sitosin, dan timin. Ini
berarti bahwa urutan polinukleotida yang akan terlihat seperti:
ACGTCGTATATCGTAGCTGTCAGTCGAGTAC
(polinukleotida RNA adalah sedikit berbeda, basa mereka meliputi adenin, guanin, sitosin, dan
urasil Mereka juga memiliki berbagai jenis gula dalam tulang punggung mereka..)

Bagaimana Nukleotida Bergabung Bersama

Setiap nukleotida memiliki basa, gula, dan fosfat. Sebuah enzim yang disebut polimerase
bergabung dengan gula ke fosfat. (Sejak polinukleotida masuk dalam dua jenis DNA dan RNA
masing-masing memiliki polimerase sendiri.)
Polimerase menambahkan nukleotida baru ke bagian bawah untai, yang kita sebut ujung 3
(diucapkan prime tiga) . Bagian atas untai disebut ujung 5. (Nama-nama berasal dari mana
gugus fosfat yang menempel:. Pada karbon ketiga atau kelima gula ini)
Dalam polinukleotida ganda, seperti DNA, dua untai yang antiparalel. Ini berarti bahwa satu
adalah relatif terbalik terhadap yang lain, dengan ujung dekat ujung 5 yang lain 3.

Jenis & Fungsi


DNA dan RNA adalah dua jenis polinukleotida yang ditemukan di alam. Masing-masing dari 46
kromosom dalam sel Anda adalah untai ganda DNA, yang berarti dua polinukleotida dengan
urutan yang cocok, saling menempel. polinukleotida ini jutaan basa panjang (pikirkan jutaan
bendera pada setiap untai).
Di dalam sel, banyak pekerjaan penting yang dilakukan oleh polinukleotida lebih pendek dari
RNA. RNA Messenger, yang membawa instruksi untuk membangun protein, adalah untai
tunggal yang biasanya panjang beberapa ribu basa. RNA Transfer, yang memiliki pekerjaan yang
berbeda dalam membangun protein, kurang dari seratus basa.
Para ilmuwan juga dapat membuat helai polinukleotida di laboratorium. Salah satu proses yang
umum disebut Polymerase Chain Reaction, atau PCR, membuat salinan DNA. Untuk
mendapatkan proses dimulai, ilmuwan akan menambah polinukleotida pendek, disebut primer,
yang panjang sekitar 20 basa.