LEMBAR HASIL IDENTIFIKASI MOLEKULER FUNGI

I. Deskripsi Sampel

No Asal sampel Kode/ nomor Kode Identifikasi Media

sampel tumbuh

1. Bapak San Paris Mataputun, PARIS 082/F-01/Mol/09/2016 PDA*

Program Studi Kimia - ITB

Ket. (*): Potato Dextrose Agar

II. Proses Identifikasi

Identifikasi isolat fungi dilakukan secara molekuler berdasarkan analisis genetika secara
parsial pada lokus Internal Transcribed Spacer (ITS) ribosomal DNA fungi.

Isolasi DNA diawali dengan menumbuhkan isolat fungi dalam media cair Potato Dextrose
Broth (PDB) dan diinkubasi selama 72 jam. Biomassa berupa miselia fungi selanjutnya dipanen
untuk proses ekstraksi DNA. Ekstraksi DNA fungi dilakukan dengan menggunakan reagen nucleon
PHYTOpure (Amersham LIFE SCIENCE).

Amplifikasi PCR pada ITS menggunakan Primer ITS 4: 5`-- TCC TCC GCT TAT TGA
TAT GC 3` dan Primer ITS 5: 5`--GGA AGT AAA AGT CGT AAC AAG G 3` (White et al.,
1990; O`Donnell, 1993).

Purifikasi PCR product dilakukan dengan PEG precipitation method (Hiraishi et al., 1995)
dan dilanjutkan dengan siklus sekuensing. Hasil siklus sekuensing dipurifikasi kembali dengan
Ethanol purification method. Analisis pembacaan urutan basa nitrogen menggunakan automated
DNA sequencer (ABI PRISM 3130 Genetic Analyzer) (Applied Biosystems).

Data mentah hasil sekuensing selanjutnya di trimming dan di assembling menggunakan

program BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Data sekuens yang telah di
assembling selanjutnya di BLAST dengan data genom yang telah didaftarkan di DDBJ/ DNA Data
Bank of Japan (http://blast.ddbj.nig.ac.jp/) atau NCBI/ National Center for Biotechnology
Information( http://www.ncbi.nlm.nih.gov/BLAST/) guna menentukan takson/ spesies yang memiliki
homology/ similarity terbesar dan terdekat secara molekuler.

1
III. Hasil Identifikasi Molekuler

A. Sekuen ITS rDNA Isolat

>P_ITS4
TTGGGGGGTTTTACGGCAAGAGTCCCTCCGGATCCCAGTGCGAGACGTAAAGTTACTACGCAAAGGAGG
CTCCGGGAGGGTCCGCCACTACCTTTGAGGGCCTACATCAGCTGTAGGGCCCCAACACCAAGCAGAGCT
TGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAG
ATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAA
CCAAGAGATCCGTTGTTAAAAGTTTTGATTATTTGCTTGTACCACTCAGAAGAAACGTCGTTAAATCAGAGT
TTGGTTATCCTCCGGCGGGCGCCGACCCGCCCGGAGGCGGGAGGCCGGGAGGGTCGCGGAGACCCTA
CCCGCCGAAGCAACAGTTATAGGTATGTTCACAAAGGGTTGTAGAGCGTAAACTCAGTAATGATCCCTCC
>P_ITS5
TTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAGGGTCTCCG
CGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAACCAAACTCTGATTTAA
CGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGA
TGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC
ACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTG
GTGTTGGGGCCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCG
TAGTAACTTTACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCCAATTTTCCAAAGGTT
GACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGC

>Contig-PARIS
GGAGGGATCATTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTA
GGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAACCAAAC
TCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAACTTTTAACAACGGATCTCTTGGTT
CTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT
CTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAA
GCTCTGCTTGGTGTTGGGGCCCTACAGCTGATGTAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGC
CTCCTTTGCGTAGTAACTTTACGTCTCGC

B. Takson Terdekat Hasil BLAST

2
 Kode/ Takson Fungi Terdekat Hasil Homologi BLAST di DDBJ/NCBI
Nomor Kode Sekuen [ http://www.ncbi.nlm.nih.gov/ ]
Sampel
ITS1, 5.8S, ITS2 of rDNA

Colletotrichum queenslandicum isolate RHCOL3

(Accession no: KT372378) [ Homologi: 100%; Max score:
998; Total score: 998; Query coverage: 100%; E-value: 0.0;
PARIS >Contig_PARIS Max identities: 540/540 (100%); Gaps: 0/540 (0%) ]
Colletotrichum queenslandicum isolate RHCOL1
(Accession no: KT372377) [ Homologi: 100%; Max score:
998; Total score: 998; Query coverage: 100%; E-value: 0.0;
Max identities: 540/540 (100%); Gaps: 0/540 (0%)

IV. Daftar Pustaka

Erlich, H.A. 1989. PCR technology: Principle and applications for DNA amplification. Stockton
Press, London: x + 246 p.
Davis, L.G., W.M. Kuehl & J.F. Battey. 1994. Basic methods in molecular biology. 2nd ed.
Prentice-Hall International Inc., USA: xiii + 777 p.
Hiraishi,A., Kamagata, Y., & Nakamura, N. 1995. Polymerase chain reaction amplification and
restriction fragment length polymorphism analysis of 16S rRNA genes from methanogens.
Journals of Fermentation Bioengineering. 79: 523--529.
Moore, D. & L.N. Frazer. 2002. Essential fungal genetics. Springer-Verlag, New York: vii + 357 p.
O`Donnell, K. 1993. Fusarium and its near relatives. In: Reynolds, D.R. & Taylor, J.W. (eds). The
fungal holomorph: Mitotic, meiotic, and pleomorphic specification in fungal systematics.
CAB International, Wallingford, pp. 225--233.
Sato, H. 2007. Workshop on: Molecular Approaches for The Identification of Microorganisms.
NITE & Research Center for Biotechnology-LIPI, Cibinong: 11-13 July 2007.
Thomson, J.D., T.J. Gibson, F. Plewniak, F. Jeanmougin & , D.G. Higgins.1997. The Clustal X
windows interface: Flexible strategies for multiple sequences allignment aided by quality
analysis tools. Nucleic Acid Research. 25: 4876-4882.
Viljoen, G.J. , L.H. Nei, & J.R. Crowther. 2005. Molecular diagnostic PCR handbook. Springer, The
Netherlands: xviii + 307 p.
White, T.J., Bruns, T.D., Lee, S.B. & Taylor, J.W. 1990. Amplification and direct sequencing of
fungal RNA genes for phylogenetics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White,
T.J. (eds). PCR protocols. Academic, San Diego, pp. 315--322.

Pelaksana: Muhammad Ilyas, M.Si. (............................................................................)

3
Catatan: 1. Hasil pengujian bukan untuk keperluan komersial
2. Hasil pengujian hanya pada sampel yang diujikan

Cibinong, 24 Oktober 2016

Max Total Query E

Description Ident Accession
score score cover value
Colletotrichum gloeosporioides strain B1519 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
RNA gene and internal transcribed spacer 2, complete 832 832 100% 0.0 100%KT968455.1
sequence; and 28S ribosomal RNA gene, partial
sequence
Colletotrichum gloeosporioides strain B1524 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
RNA gene and internal transcribed spacer 2, complete 832 832 100% 0.0 100%KT968454.1
sequence; and 28S ribosomal RNA gene, partial
sequence
Colletotrichum sp. CPC 15692 18S ribosomal RNA 832 832 100% 0.0 100%KP703353.1
gene, partial sequence; internal transcribed spacer 1,
5.8S ribosomal RNA gene, and internal transcribed

4
spacer 2, complete sequence; and 28S ribosomal RNA
gene, partial sequence
Colletotrichum ti isolate TRIT356 18S ribosomal
RNA gene, partial sequence; internal transcribed
spacer 1, 5.8S ribosomal RNA gene, and internal 832 832 100% 0.0 100%KT966508.1
transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence
Colletotrichum queenslandicum isolate RHCOL3 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KT372378.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum queenslandicum isolate RHCOL1 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KT372377.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Fungal endophyte isolate 818 18S ribosomal RNA
gene, partial sequence; internal transcribed spacer 1
832 832 100% 0.0 100%KR016894.1
and 5.8S ribosomal RNA gene, complete sequence;
and internal transcribed spacer 2, partial sequence
Glomerella cingulata isolate D5b4a 18S ribosomal
RNA gene, partial sequence; internal transcribed
spacer 1, 5.8S ribosomal RNA gene, and internal 832 832 100% 0.0 100%JQ341135.1
transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence
Colletotrichum siamense strain ZJCG-1 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KP635210.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum sp. 2 ONH-2014 strain MANB2 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KM510430.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum sp. 2 ONH-2014 strain PTA7 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KM510427.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum cf. gloeosporioides ROG-2010 strain
CM171 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA
832 832 100% 0.0 100%HQ022371.1
gene, and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial
sequence
Colletotrichum cf. gloeosporioides ROG-2010 strain 832 832 100% 0.0 100%HQ022368.1
CM81 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA

5
gene, and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial
sequence
Colletotrichum cf. gloeosporioides ROG-2010 strain
CM56 18S ribosomal RNA gene, partial sequence;
internal transcribed spacer 1, 5.8S ribosomal RNA
832 832 100% 0.0 100%HQ022364.1
gene, and internal transcribed spacer 2, complete
sequence; and 28S ribosomal RNA gene, partial
sequence
Colletotrichum queenslandicum strain BRIP 57981a
18S ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%KF877315.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum gloeosporioides strain HXCG01 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%JQ277720.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum gloeosporioides strain P909 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JX532707.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence
Colletotrichum gloeosporioides strain P604 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JX532700.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence
Colletotrichum gloeosporioides strain P1109 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JX532691.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence
Colletotrichum gloeosporioides strain P108 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JX532684.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence
Colletotrichum gloeosporioides strain M909 18S
ribosomal RNA gene, partial sequence; internal
transcribed spacer 1, 5.8S ribosomal RNA gene, and 832 832 100% 0.0 100%JX402169.1
internal transcribed spacer 2, complete sequence; and
28S ribosomal RNA gene, partial sequence
Colletotrichum gloeosporioides strain RP262 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JF441203.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence
Colletotrichum gloeosporioides strain RP258 internal
transcribed spacer 1, partial sequence; 5.8S ribosomal
832 832 100% 0.0 100%JF441202.1
RNA gene, complete sequence; and internal
transcribed spacer 2, partial sequence