Anda di halaman 1dari 222

1|DIKTAT UAS 2018 SEMESTER 4 TEKKIM

DAFTAR ISI

I. Biologi Molekuler

a. Soal Kuis Biologi Molekuler: Karbohidrat ........................................................ 8

b. Soal Latihan Biologi Molekuler (1) ................................................................... 9

c. Jawaban Latihan Biologi Molekuler (1) ............................................................ 10

d. Soal Kuis Biologi Molekuler ............................................................................. 14

e. Jawaban Kuis Biologi Molekuler ....................................................................... 15

f. Soal Latihan Biologi Molekuler (2) ................................................................... 19

g. Jawaban Latihan Biologi Molekuler (2) ............................................................ 20

h. Soal UAS Biologi Molekuler 2013 .................................................................... 23

i. Jawaban UAS Biologi Molekuler 2013 ............................................................. 25

j. Soal UAS Biologi Molekuler 2016 (1) .............................................................. 30

k. Soal UAS Biologi Molekuler 2016 (2) .............................................................. 31

l. Soal UAS Biologi Molekuler 2016 (3) .............................................................. 35

m. Jawaban UAS Biologi Molekuler 2016 (3)........................................................ 36

n. Soal UAS Biologi Molekuler ............................................................................. 41

o. Jawaban UAS Biologi Molekuler ...................................................................... 42

II. Pemodelan Teknik Kimia

a. Soal UAS Pemodelan Teknik Kimia 2014 ....................................................... 52

b. Soal UAS Pemodelan Teknik Kimia 2011 ...................................................... 54

c. Jawaban UAS Pemodelan Teknik Kimia 2011 ................................................. 56

d. Soal UAS Pemodelan Teknik Kimia 2012 ....................................................... 58

e. Jawaban UAS Pemodelan Teknik Kimia 2012 ................................................. 60

f. Soal UAS Pemodelan Teknik Kimia 2015 (1) .................................................. 62

2|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


g. Jawaban UAS Pemodelan Teknik Kimia 2015 (1) ........................................... 64

h. Soal UAS Pemodelan Teknik Kimia 2016 (1) .................................................. 68

i. Jawaban UAS Pemodelan Teknik Kimia 2016 (1) ........................................... 71

j. Soal UAS Pemodelan Teknik Kimia 2016 (2) .................................................. 73

III. Mekanika Fluida

a. Soal UAS Mekanika Fluida 2007 ...................................................................... 77

b. Jawaban UAS Mekanika Fluida 2007 ............................................................... 81

c. Soal UAS Mekanika Fluida 2011 (1) ..................................................................89

d. Jawaban UAS Mekanika Fluida 2011 (11) .........................................................91

e. Soal UAS Mekanika Fluida 2011 (2) ................................................................. 93

f. Soal UAS Mekanika Fluida 2012 ...................................................................... 95

g. Jawaban UAS Mekanika Fluida 2012 ................................................................ 97

h. Soal UAS Mekanika Fluida 2013 (1) ................................................................. 101

i. Soal UAS Mekanika Fluida 2013 (2) ................................................................. 104

j. Soal UAS Mekanika Fluida 2014 ..................................................................... 107

k. Jawaban UAS Mekanika Fluida 2014 ................................................................ 109

l. Soal UAS Mekanika Fluida 2015 (1) ................................................................. 111

m. Jawaban UAS Mekanika Fluida 2015 (1) .......................................................... 113

n. Soal UAS Mekanika Fluida 2015 (2) ................................................................. 118

o. Soal UAS Mekanika Fluida 2015 (3) ................................................................. 119

p. Jawaban UAS Mekanika Fluida 2015 (3) .......................................................... 120

q. Soal dan Jawaban UAS Mekanika Fluida 20xx ................................................. 123

r. Soal UAS Mekanika Fluida 2016 (1) ................................................................. 131

s. Jawaban UAS Mekanika Fluida 2016 (1) .......................................................... 134

t. Soal UAS Mekanika Fluida 2016 (2) ................................................................. 140

3|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


IV. Perpindahan Kalor

a. Soal UAS Perpindahan Kalor ............................................................................ 144

b. Jawaban UAS Perpindahan Kalor ...................................................................... 146

c. Soal UAS Perpindahan Kalor 2007 ....................................................................152

d. Soal UAS Perpindahan Kalor 2011 ....................................................................153

e. Soal UAS Perpindahan Kalor 2012 (1) ...............................................................155

f. Jawaban UAS Perpindahan Kalor 2012 (1) ........................................................157

g. Soal UAS Perpindahan Kalor 2012 (2) ...............................................................160

h. Soal UAS Perpindahan Kalor 2014 ...................................................................162

i. Soal UAS Perpindahan Kalor 2015 (1) ...............................................................164

j. Jawaban UAS Perpindahan Kalor 2015 (1) ........................................................166

k. Soal UAS Perpindahan Kalor 2015 (2) ...............................................................168

l. Jawaban UAS Perpindahan Kalor 2015 (2) ........................................................170

m. Soal UAS Perpindahan Kalor 2016 (1) ...............................................................172

n. Jawaban UAS Perpindahan Kalor 2016 (1) ........................................................173

o. Soal UAS Perpindahan Kalor 2016 (2) ...............................................................178

p. Soal UAS Perpindahan Kalor 2017 ....................................................................180

q. Jawaban UAS Perpindahan Kalor 2017 ..............................................................182

V. Termodinamika

a. Soal UAS Termodinamika 2010 ........................................................................ 187

b. Jawaban UAS Termodinamika 2010 ................................................................. 188

c. Soal UAS Termodinamika 2012 .........................................................................190

d. Jawaban UAS Termodinamika 2012 ..................................................................192

e. Soal UAS Termodinamika 2013 .........................................................................197

f. Jawaban UAS Termodinamika 2013 ..................................................................199

4|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


g. Soal UAS Termodinamika 2014 (1) ...................................................................205

h. Soal Latihan UAS Termodinamika 2016 ............................................................207

i. Jawaban Latihan UAS Termodinamika 2016 .....................................................208

j. Soal UAS Termodinamika 2016 .........................................................................214

VI. Menggambar Teknik Proses

a. Soal UAS Menggambar Teknik Proses 2007 .................................................... 217

b. Soal UAS Menggambar Teknik Proses 2015 .................................................... 218

c. Jawaban UAS Menggambar Teknik Proses 2015 .............................................. 220

CATATAN
JANGAN TERPAKU PADA DIKTAT INI.
Diktat ini dijawab oleh mahasiswa.
Pemikiran dosen mungkin berbeda.
Untuk penggunaan diktat yang efektif,
berkonsultasilah dengan asisten dosen.

JANGAN MENJADIKAN DIKTAT INI


SEBAGAI SUMBER CONTEKAN

5|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


CONTACT PERSON
Kirana Widiani
(0811879726 / kiranawidiani)
Rafdi Aufar
(081318106867 / rafdi_soul)
M. Nabil Hifzhan
(081364998125 / Nabil.hifzhan
Yuwendi
(081212800720 / wendii_)
Nanda Adjeng
(08561976516 / nadjeng)

“Don’t study hard. Study smart.” – Any Lucas

Semangat UASnya 😊

6|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


BIOLOGI MOLEKULER

7|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


SOAL KUIS BIOLOGI MOLEKULER: KARBOHIDRAT

Hari, Tanggal : -
Waktu :-
Sifat Ujian :-
Dosen :-

1. Tuliskan tiga reaksi yang dapat terjadi pada gula sederhana. Jelaskan dengan
persamaan reaksinya!
2. Buatlah analisis singkat tentang gula pereduksi dan non-pereduksi
3. Tuliskan persamaan reaksi yang terlibat dalam biosintesis sukrosa.
4. Dunia iptek belakangan ini berlomba-lomba mengembangkan biopolimer turunan
polisakarida sebagai produk komersial untuk berbagai kegunaan yang luas, bahkan
dianggap sebagau biomaterial masa depan yang berperan dalam dunia industri.
Berikan contoh dan analisis singkat tentang pemanfaatan polisakarida dalam berbagai
bidang.

8|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


SOAL LATIHAN BIOLOGI MOLEKULER (1)

Mata Kuliah : Biologi Molekuler


Dosen :-
Sifat Ujian : Close Book
Waktu Ujian : 60 menit

1. Lipid berperan dalam proses transduksi sinyal. Jelaskan proses terjadinya transduksi
sinyal tersebut! (UTS 2015)
2. Apa yang dimaksud dengan RNAi? (UAS 2016)
3. Jelaskan perbedaan proses transkripsi RNA di sel prokariotik dan sel eukariotik (UAS
2016)
4. Jelaskan prinsip kerja sekuensi DNA dengan metode Sanger! (UAS 2016)

9|DIKTAT UAS 2018 SEMESTER 4 TEKKIM


JAWABAN LATIHAN BIOLOGI MOLKULER (1)

Mata Kuliah : Biologi Molekuler


Dosen :-
Asisten Dosen : Jessica Balgani (Teknik Kimia 2015)
ID Line : jessicabalgani

1. Pensinyalan lipid dapat muncul melalui aktivasi protein G dan anggota beberapa
kategori lipid berbeda telah dikenal sebagai molekul-molekul pensinyalan. Secara
umum, tahapan persinyalan ekstraseluler adalah:
i. Sintesis molekul sinyal oleh sel yang memberi sinyal.
ii. Pelepasan molekul sinyal oleh sel yang memberi sinyal.
iii. Transpor sinyal oleh sel target.
iv. Pengikatan sinyal oleh reseptor spesifik yang menyebabkan aktivasi reseptor
tersebut.
v. Inisiasi satu atau lebih jalur transduksi sinyal intrasel.
vi. Perubahan spesifik fungsi, metabolisme, atau perkembangan sel.
vii. Pembuangan sinyal yang mengakhiri respon sel
Transduksi sinyal tersebut terbagi:

i. Reseptor intraselluler: ligandnya senyawa yg larut dalam lipid sehingga


dapat menembus membran sel → masuk sel meneju reseptor.
ii. Reseptor membran sel: ligan tidak dapat larut dalam lipid → tidak dapat
menembus membran, tetapi reseptor ada di membran sel sehingga ligan
menempel pada reseptor.
2. RNAi (interference RNA) memiliki peran dalam penghambatan aktivitas atau ekspresi
dari suatu gen tertentu. RNAi terdiri dari 2 jenis RNA yaitu microRNA (miRNA) dan
small interfering (siRNA).
• miRNA terlibat dalam gene silencing. miRNA mengontrol tingkat transkripsi
mRNA target dan dengan demikian, menghalangi proses translasi protein.
• siRNA terlibat dalam proses pertahanan terhadap virus. siRNA berperan
menghapuskan mRNA target.
3. Perbedaan Transkripsi RNA

10 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
No. Sel Prokariot Sel Eukariot

Transkripsi dan translasi tidak dapat


Transkripsi dan translasi dapat
1 berlangsung serentak. Terdapat jeda waktu
berlangsung serentak.
yang bernama fase pasca-transkripsi.

RNA polimerase menempel pada promoter


RNA polimerasi menempel langsung
2 melalui perantara protein-protein lain
pada daerah promoter.
(faktor transkripsi)

Gen prokariotik terdiri dari 3 bagian


Gen eukariotik dibedakan menjadi 3 kelas
utama:
yaitu:
Promoter: gen yang mengendalikan
Gen kelas I: gen-gen yang mengkode
proses transkripsi
18SrRNA, 28SrRNA dan 5,8SrRNA.
Bagian struktural: gen yang berada
Gen kelas II: Meliputi semua gen yang
3 disebelah hilir (downstream) dari
mengkode protein dan RNA yang berukuran
promoter
kecil
Terminator: Bagian gen yang berada
Gen kelas III: Meliputi gen-gen yang
disebelah hilir dari bagian struktural.
mengkode tRNA, 5S rRNA dan beberapa
Gen yang berperan dalam
RNA berukuran kecil
pengakhiran transkripsi

4 Terdapat sistem operon Tidak adanya sistem operon.

mRNA bersifat polisistronik: dalam


mRNA bersifat monosistronik: satu mRNA
satu transkrip dapat terkandung lebih
5 hanya membawa satu macam rangkaian
dari satu rangkaian kodon untuk
kodon untuk satu macam polipeptida
polipeptida yang berbeda

Gen tidak dibagi menjadi intron dan


6 Gen dibagi menjadi intron dan ekson
ekson

4. Sekuensi DNA metode Sanger


i. DNA yang ingin diketahui sekuensnya diinkubasi dalam tabung bersama dengan
bahan lain seperti primer, DNA polymerase, deoxyribonucleotides, dan sejumlah
tertentu dideoxyribonucleotides yang dibutuhkan untuk sintesis DNA. Inkubasi

11 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
dilakukan dalam tabung-tabung yang berbeda, dimana masing-masing tabung
hanya berisi salah satu jenis ddNTP (ddATP, ddCTP, ddTTP, ddGTP).

ii. Sintesis DNA akan berlangsung dan berhenti jika dideoksiribonukleotida


digunakan. Proses ini menghasilkan DNA dengan panjang yang bervariasi sesuai
urutan nukleotida. Dideoxyribunucleotides (ddNTP) adalah deoxyribonucleotides
(dNTP) yang mana oksigen pada gula pentosa yang digunakan untuk berikatan
dengan gugus fosfat dari nukleotida lain dihilangkan. Akibatnya, ketika polimerasi
DNA sedang berlangsung, jika yang berpasangan dengan nukleotida pada strand
induk adalah ddNTP dan bukannya dNTP, pemanjangan DNA terhenti pada titik
tersebut. Lebih jelasnya, perhatikan gambar.

iii. Campuran kemudian dielektroforesis dengan gel polyacrilamide. Fluoresensi dari


dideoksiribonukleotida yang digunakan dideteksi oleh detector. Prinsipnya sama
dengan elekroforesis biasa. Sampel yang dielektroforesis berasaldari masing-
masing tabung reaksi yang memiliki ddNTP yang berbeda (misal, tabung yang

12 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
berisi ddG dimasukkan ke dalam well 1, sampel yang berisi ddA dimasukkan ke
dalam well 2, dst). Dari hasil elektroforesis diperoleh sekuens utuh dengan
menggabungkan hasil elektroforesis dari keempat sampel tersebut.

13 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL KUIS BIOLOGI MOLEKULER

Mata Kuliah : Biologi Molekuler


Dosen :-
Sifat Ujian : Close Book
Waktu Ujian : 60 menit

1. Tuliskan tiga reaksi yang dapat terjadi pada gula sederhana. Jelaskan dengan
persamaan reaksinya!
2. Buatlah analisis singkat tentang gula pereduksi dan non-pereduksi!
3. Dunia IPTEK belakangan ini berlomba-lomba mengembangkan biopolimer turunan
polisakarida sebagai produk komersial untuk berbagai kegunaan yang luas, bahkan
dianggap sebagai biomaterial masa depan yang berperan dalam dunia industri.
Berikan contoh dan analisis singkat tentang pemanfaatan polisakarida dalam berbagai
bidang!

14 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN KUIS BIOLOGI MOLEKULER

Mata Kuliah : Biologi Molekuler


Dosen :-
Asisten Dosen : Rizka
ID Line :-

1. a. Reaksi Oksidasi

Aldosa mudah teroksidasi karena sifat asam karboksilat yang dimiliki, yaitu asam
aldonik. Sifat sebagai reduktor ini digunakan untuk keperluan identifikasi karbohidrat
maupun analisis kuantitatif.

b. Reaksi Reduksi

Aldosa dan Ketosa yang direaksikan dengan NaBH4 akan mereduksi mereka menjadi
polialkohol yang disebut aldehid. Reduksi ini menyebabkan pemutusan bentuk siklik
dan membuatnya menjadi rangkaian terbuka.

15 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
c. Reaksi Hidrolisis

Hidrolisis adalah reaksi penguraian polisakarida oleh air atau asam. Hidrolisis pada
karbohidrat terjadi pada pati dan sukrosa menjadi gugus gula yang lebih sederhana.

d. Tollen’s Reagent

Reaksi antara gula perduksi dengan pereaksi Tollen akan menghasilkan warna silver
metalik seperti kaca pada dinding tabung reaksi. Pereaksi Tollen menyebabkan
dekomposisi pada karbohidrat (terutama bagi aldosa), sehingga diberikan buffer
berupa larutan Br2.

e. Benedict’s Reagent

Glukosa dapat meredudiksi ion Cu2+ dari kuprisulfat yang terkandung dalam benedict
mejadi ion Cu+ yang akan mengendap sebagai Cu2O yang berwarna merah bata.
Adanya natrium karbonat dan natrium sitrat dalam benedict membuat pereaksi
benedict bersifat basa lemah.

f. Fehling’s Reagent

Pereaksi fehling terdiri atas dua larutan, yaitu larutan Fehling A (CuSO4 dalam air)
dan B (garam K Natartat dan NaOH dalam air). Dengan larutan glukosa 1%, pereaksi
Fehling menghasilkan endapan berwarna merah bata, sedangkan apabila digunakan

16 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
larutan yang lebih encer misalnya larutan glukosa 0,1%, endapan yang terjadi
berwarna hijau kekuningan.

2. - Gula Pereduksi
Gula pereduksi adalah gula yang dapat dioksidasi oleh zat pengoksidasi lembut seperti
reagen Tollens. Yang menyebabkan sifat pereduksi pada gula adalah gugus hemiacetal
pada karbohidrat. Gugus ini didapat dengan mereaksikan aldehida dengan alkohol.
Gula pereduksi adalah semua gula yang memiliki kemampuan untuk mereduksi
dikarenakan adanya gugus aldehid atau keton bebas. Monosakarida yang termasuk
gula reduksi antara lain glukosa, fruktosa, gliseraldehida, dan galaktosa. Untuk
disakarida, contohnya adalah laktosa dan maltosa.

- Gula non-pereduksi
Gula non-reduksi dicirikan dengan tidak adanya struktur rantai terbuka, sehingga tidak
rentan terhadap proses oksidasi reduksi. Yang termasuk gula non-reduksi adalah
sukrosa.

3. - Plastik Biodegradable

Plastik biodegradable merupakan plastik yang dapat didegradasi oleh mikroorganisme


lebih cepat dibandingkan plastik sintetik. Pati merupakan polimer alami yang dapat
digunakan untuk produksi material biodegradable. Pati merupakan senyawa
karbohidrat kompleks dengan ikatan a-glikosidik. Pati dihasilkan oleh tumbuhan
untuk menyimpan kelebihan glukosa. Bahan dasar pembuatan plastik biodegradable
adalah singkong atau pun onggok singkong yang merupakan sisa dari pembuatan

17 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
tepung tapioka. Dibutuhkan plasticizer untuk meningkatkan elastistas material, salah
satunya adalah sorbitol.

➔ Proses Pembuatan
- Ekstraksi Pati
- Pencampuran dengan nano ZnO dan gliserol (plasticizer) ke dalam gelas beaker
500 ml berisi aquadest 100 ml.
- Meletakkan gelas beaker yang berisi aquadest, ZnO, dan gliserol ke dalam
ultrasonic processor.
- Menambahkan pati sambil melakukan pengadukan.
- Pemanasan di atas hot plat dan diaduk menggunakan magnetic stirrer
- Memanaskan gelas beaker yang berisi campuran tersebut pada hot plate,
temperatur diatur pada suhu 90oc.
- Pencetakan

- Nanofiber

Serat nano atau nanofiber adalah serat yang mempunyai diameter kurang dari 100
nanometer meter. Serat nano mempunyai sifat yang sangat khas, yaitu sangat kuat,
rasio permukaan terhadap volume yang besar. Nanofiber yang umum digunakan
berasal dari nanocellulose Nanocellulose merupakan filamen dari fibril berukuran
nano yang dapat diekstrak dari selulosa. Nanofiber dari nanoselulosa terdiri dari
polimer -polimer yang dihubungkan dengan ikatan hidrogen, sehingga memiliki
kekuatan dan ketahanan besar. Molekul lurus dengan unit glukosa rata -rata sebanyak
5000 ini beragregasi membentuk fibril yang terikat melalui ikatan hidrogen di antara
gugus hidroksil pada rantai di sebelahnya.

18 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL LATIHAN BIOLOGI MOLEKULER (2)

Mata Kuliah : Biologi Molekuler


Dosen :-
Sifat Ujian : Close Book
Waktu Ujian : 45 menit

1. Jelaskan peran lipid dalam proses drug delivery!


2. Apa yang kamu ketahui tentang metode uji Salkowski?
3. Jelaskan proses biosintesis pati pada tanaman C4!
4. Apa yang kamu ketahui tentang sistem penamaan stereokimia D-L?

19 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN LATIHAN BIOLOGI MOLEKULER (2)

Mata Kuliah : Biologi Molekuler


Dosen :-
Asisten Dosen : Jessica Balgani (Teknik Kimia 2015)
ID Line : jessicabalgani

1. Tahap pertama adalah tahap penyebaran obat ke seluruh tubuh yaitu setelah
meninjeksikan liposom ke dalam pembuluh darah. Liposom yang terdiri atas lipid
alami akan lebih mudah tersebar ke seluruh tubuh dengan bantuan sistem imun dalam
peredaran darah. Namun penambahan waktu sirkulasi liposom ke seluruh peredaran
darah akan meningkatkan akumulasi obat di sel kanker, yang merupakan hal yang
diinginkan, sehingga dalam kasus ini lipid yang digunakan adalah lipid sintesis.
Sebagai media penyebaran obat, tingkat stabilitas and permeabilitas yang rendah dari
liposom merupaka sifat yang. Tahap kedua adalah lisosom yang telah tersebat akan
menentukan sel spesifik sebagai target. Tahap ketiga adalah pelepasan obat pada sel
spesifik tersebut.
2. Uji Salkowski
• Uji Salkowski adalah uji kolesterol menggunakan chloroform dan H2SO4.
• Jika sterol tidak jenuh direaksikan dengan asam kuat dalam kondisi bebas air akan
memberikan warna yang khas.
• Reaksi positif yaitu timbul warna merah di bagian kloroform sedangkan dibagian
asam berwarna kuning.
• Kolesterol dilarutkan dengan kloroform anhidrat lalu dengan volume yang sama
ditambahkan asam sulfat.
• Penambahan asam sulfat pekat berfungsi sebagai pemutus ikatan ester lipid.
3. Fotosintesis pada tanaman C4 terjadi di sel-sel mesofil. CO2 diikat dengan
fosfoenolpiruvat membentuk oksaloasetat. Oksaloasetat kemudian direduksi menjadi
malat lalu ditransfer ke sel seludang pembuluh melalui plasmodesmata. Dalam sel

20 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
seludang pembuluh, malat dipecah menjadi CO2 yang kemudian memasuki siklus
Calvin.

4. Umum digunakan pada penamaan karbohidrat dan asam amino. D menandakan atom
C nomor 2 dari gugus paling bawah terletak di sebelah kanan pada proyeksi Fischer. L
menandakan atom C nomor 2 dari gugus paling bawah terletak di sebelah kiri pada
proyeksi Fischer. Bukan digunakan untuk menunjuk arah pemutar bidang polarisasi
cahaya. Umumnya karbohidrat ditemukan dalam bentuk D .

21 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
22 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS BIOLOGI MOLEKULER 2013

Hari, Tanggal : 27 Mei 2013


Waktu : 120 Menit
Sifat Ujian :-
Dosen :-

Explanation

− Open Book Examination


− The examination is contain 8 problems, each problem have same grade, 12,5.
− You can random your answer in answer sheet.

Problems :

1. Draw the structure of the following of triglycerides !


a. LAS
b. OPO

L = (9z,12z)-9,12-Octadecatetraenoic acid

A = (5z,8z,11z,14z)-5,8,11,14-eicosatetraenoic acid.

S = (6z,9z,12z,15z)-6,9,12,15-Octadecatetraenoic

O= 18:1(n-9)

P = 16:0

2. Draw the ring structures of chitin, Amylose and glycogen?


3. Explain by figure the biosynthesis of N-acetylglucosamine from glucose ?
4. Phospatidic acid is the main compound for phospholipid synthesis, explain the
mechanism of phospatidic acid biosynthesis from glucose ?
5. There are two modes mechanism of cell response the extracellular signal. Explain the
mode which lipid act as relay signal, directly !

23 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
6. Write the general reaction of glycolisis proses (from glucose to CO2 and H2O), how
many energy molecules are generated ?
7. The Indonesian Standard of cooking oil is the following

No. Criteria Requirement

1. Odor and Taste Normal

2. Color Yellow clear

3. Water contain Max. 0.3%

4. Free Fatty Acid Max. 0.3%

5. Peroxide Number Max. 2 mg/kg

6. Iodine number 45 - 46

7. Saponification number 196- 205

Write your idea how to measure Water contain, free fatty acid, peroxide number,
Iodine and Saponification numbers ?

8. Explain the application of starch in ceramics and construction industry ?

24 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS BIOLOGI MOLEKULER 2013

Mata Kuliah : Biologi Molekuler


Dosen :-
Asisten Dosen : Muhammad Afif (Teknologi Bioproses 2016)

1. –
2. Chitin, Amylose, and glycogen
a.) Kitin

b.) Amilosa

c.) Glikogen

25 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
3.

Phosphorylated glucose enters either the glycogen synthetic pathway or is further


converted to fructose-6-phosphate by glucose-6-phosphate isomerase. The majority of
fructose-6-phosphate is channeled to glycolysis. Less than 5% of glucose uptake is
ultimately channeled to a unique accessory pathway for glucose metabolism, the
HBP. This pathway begins with the rate-limiting enzyme, GFAT, followed by
acetylation of gluocsamine-6-phosphate by Emeg32 (glucosamine-6-phosphate
acetyltransferase) to GlcNAc-6-P (N-acetylglucosamine-6-phosphate). Next are 2
reversible reactions: the conversion of GlcNAc-6-P to GlcNAc-1-P by phosphate-
acetylglucosamine mutase and then the formation UDP-GlcNAc by UDP-GlcNAc
pyrophosphorylase. This high-energy molecule serves as the monosaccharide donor
for the posttranslational modification by O-GlcNAc transferase (OGT). O-GlcNAcase
(OGA) removes O-GlcNAc modification from proteins.

26 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
4.

• Trigliserida diproduksi di 2 titik yaitu hati/liver dan jaringan adiposa/lemak


• Trigliserida dibentuk ketika asupan gizi (terutama karbohidrat) yang masuk
melebihi kebutuhan tubuh sehingga disimpan dalam bentuk trigliserida
Alur:
• Trigliserida terbentuk dari gliserol-3-fosfat yang mengikat 3 asil menjadi
trigliserida (pada bentuk asam fosfatidat mengalami pertukaran ion fosfat menjadi
ion hidroksil kemudian menjadi asil)
• Pada liver, gliserol-3-fosfat diperoleh melalui fosforilasi gliserol (bahan baku
adalah gliserol dan didukung dengan adanya enzim gliserol kinase) dan hasil
glikolisis
• Pada jaringan adiposa, gliserol-3-fosfat hanya dapat diperoleh dari glikolisis
(bahan baku glukosa yang diubah menjadi DHAP sebelum menjadi gliserol-3-
fosfat)
• DHAP : Dihidroxyacetone phosphate
Tambahan: Pembentukan Fosfolipid dari Asam Fosfatidat
• Pembentukan fosfolipid sebenarnya memiliki awal yang sama dengan trigliserida
• Pada bentuk asam fosfatidik, ion fosfat tidak berganti dengan ion hidroksil
menjadi diasilgliserol melainkan mengikat gugus lain lagi menjadi turunan
fosfolipid.
5. –

27 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
6. Glikolisis adalah rangkaian reaksi dan ekstraksi energi dari glukosa dengan cara
memecahnya menjadi 2 C3 yang disebut piruvat. Glikolisis adalah jalur metabolik
purba yang berarti sudah ada sejak zaman dahulu kala. Dalam suatu organisme yang
melakukan respirasi seluler, glikolisis adalah tahapan pertama dari proses ini.
Glikolisis tak memerlukan oksigen.

Secara umum reaksinya adalah sebagai berikut:

Secara detail:
1. Tahapan Membutuhkan Energi:

2. Tahapan Melepas Energi:

28 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
7. –
8. –

29 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS BIOLOGI MOLEKULER 2016 (1)

Hari, Tanggal : 25 Mei 2016


Waktu : 120 Menit
Sifat Ujian :-
Dosen : Muhamad Sahlan

Keterangan

a. Ujian ini terdiri dari 5 soal dengan bobot nilai yang sama.
b. Ujian ini bersifat close book.
c. Silahkan dikerjakan dari yang dianggap mudah terlebih dahulu.

Soal

1. Gambarlah kemungkinan struktur sekunder RNA berikut ini;


5' U UUAAA UACCCUGUUUCGGUAUUUAAA 3!
2. Berikut ini adalah hasil DNA sekuensing dengan metode sanger

Sebutkan urutan DNA tersebut dari ujung 5 ke ujung 3

3. Jelaskan proses transkripsi mRNA pada sel prokariotik !


4. Jelaskan tahapan translasi pada sel prokariotik !
5. Jelaskan bagaimana menentukan struktur tersier atau quarterner protein dengan
metode difraksi sinar X?

30 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS BIOLOGI MOLEKULER 2016 (2)

Hari, Tanggal : 23 Mei 2016


Waktu : 120 Menit
Sifat Ujian :-
Dosen : Muhamad Sahlan

EXPLANATION
a. 25 question exam, 20 questions in multipe choice (0.5 credit per question) and 5
essai (5 credits per question).
b. close book examination.
A. Select the appropriate answer I
1. Which fatty acid is omega 3

2. A class lipid that are a major component of all cell membranes is


A. Triglyceride
B. Phopholipid
C. Sterol
D.glycolipid
3. The following group is lipid except ?
A. Chitin
B. Wax

31 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
C. Sterol
D. Protaglandin
4. The following unsaturated fatty acid except ?
A. DNA
B. EPA
C. Omega 9
D. Palmitic acid
5. The major intermediate compound in fatty acid biosynthesis is ?
A. Pyruvate
B. Malonyl Co-A
C. Glucose
D. Eicosanoids
6. The enzyme that assist triglyceride hydrolysis is ?
A. Fatty Acid synthase
B. Triglyceride synthase
C. Lipase
D. Hydrolase inhibitor
7. Which step exclude in 4 step cholesterol synthesis ?
A. Mevalonate synthesis
B. Isoprenoid synthesis
C. Squalene synthesis
D. Wax synthesis
8. Which lipids have function as insulation ?
A. DNA
B. Unsatured Fatty acid
C. Saturated fatty acid
D. HDL
9. Which Vitamin can't suluble in Fat ?
A. A
B. C
C. D
D. E
10. Iodine test in Lipid analysis is to measure ?

32 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
A. Double bond in unsaturated fatty acids
B. Single bond in unsaturated fatty acids
C. Double bond in saturated fatty acids
D. Single bond in saturated fatty acids
11. The empirical formula of carbohydrate is
A. 𝐶𝑚 (𝐻2 𝑂)n
B. 𝐶𝑚 (𝐻2 𝑂)nN
C. 𝐶𝑚 (𝐻2 𝑂)nS
D. 𝐶𝑚 (𝐻2 𝑂)n𝑁2 S
12. Which molecule that make different between strach synthesis and animal
polysaccharide
A. ADP-Glucose
B. Glucose -1- phosphate
C. Glucose -6-phosphate
D. Hexose
13. The enzyme which responsible to catalyze the synthesis cellulose from
monosaccharide is
A. Cellulose hydrolase
B. Cellulose synthase
C. Cellulose transferase
D. Cellulose helikase
14. Polysaccharide which commonly found in shrimp skin is
A. Starch
B. Glycogen
C. Chitin
D. Alginate
15. Common tests for detection of reducing sugas is, except ?
A. Benedict test
B. Fehling test
C. Bradford test
D. Bial test
16. Bio energy comes from polysaccharides is ?
A. Bio avtur
B. Bio ethanol
33 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
C. Bio diesel
D. Bio solar
17. One of properties of monosccharide is chiral, how to observe chiilarity of it ?
A. Spectropolarimeter
B. Mass spectroscopy
C. Spectroscopy UV-Vis
D. Colorimeter
18. In 1 gram carbohydrate how may kcal is produced ?
A. 4 kcal
B. 5 kcal
C. 8 kcal
D. 9 kcal
19. The energy produced in glucolysis process in the shape of
A. ADP
B. AMP
C. ATP
D. GTP
20. The cycle reaction in glycolysis process is
A. Krebs cycle
B. Dark cycle
C. Lowry cycle
D. Light cycle
B. Ansywer the following question !
21. Write general structure of triglyceride
22. Figure the following fatty acid : (6Z,9Z,12Z,15Z)-6,9,12,15-Octadecatetraenoic
acid.
23. Write the reaction of saponification (soap synthesis from fat)
24. Explain the application of polisaccharide in Reneable Energy
25. What is the main enzyme in Cellulose, strarch, and glycogen ?

34 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS BIOLOGI MOLEKULER 2016 (3)

Hari, Tanggal : 1 Juni 2016

Waktu : 120 Menit

Sifat Ujian :-

Dosen : Muhammad Sahlan

1. Di dalam RNA nanusia, kita mengenal istilah intron dan ekstron. Apa yang,
dirnaksud dengan intron dan ekstron, jelaskan juga fungsi-fungsi dari kedua bagian
tersebut
2. Ketika kita tnengisolasi dan metnurnikan plasmid dari bakteri, bagailnana menganalisis
kernurnian suatu DNA '? Jelaskan !
3. RNAi adalah asam nukleat yang saat ini sedang trend diteliti, apa istimewanya
dari RNAi ini dan aplikasi apa yang membuat RNAi ini menjadi menarik ? jelaskan
satu aplikasinya ?
4. Struktur sekunder apa yang umum terdapat di dalam protein struktural dan
struktur sekunder apa yang terdapat di dalam protein storage '?
5. Jelaskan perbedaan antara proses biosintesis protein pada sel prokariotik dan
eukariotik.

35 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS BIOLOGI MOLEKULER 2016 (3)

Asisten Dosen : Reysa Anggraini

Jurusan, Angkatan : Teknologi Bioproses 2015

1. Gen eukariotik terdiri dari susunan kode protein yang disebut exons sebagai
expressed sequences dan introns sebagai intervening sequences. Ekson didefinisikan
sebagai urutan DNA yang diterjemahkan menjadi RNA, sedangkan intron adalah
urutan DNA yang berada diantara ekson yang akan dihilangkan untuk menghasilkan
molekul RNA yang matang.

Urutan intron pada mRNA tidak mengkode protein fungsional sehingga intron harus
sepenuhnya dihapus sebelum sintesis protein. Dengan begitu, ekson dapat bergabung
bersama untuk mengkode asam amino yang benar. Jika terjadi kesalahan pada
nukleotida tunggal dan urutan ekson yang bergabung mengalami pergeseran, maka
protein yang dihasilkan tidak akan berfungsi. Proses mengeluarkan intron dan
menghubungkan kembali ekson disebut splicing.

Gambar 1. Proses splicing (penghilangan introns, pengabungan ekson)


dan penambahan cap 5’ dan 3’tail
Sumber: quizover.com

Untuk dapat mentransfer mRNA dari nukleus ke sitoplasma dan mentranslasikannya


menjadi protein, proses transkripsi mRNA harus melalui beberapa tahapan. Pada
36 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
transkripsi mRNA dilakukan mofidikasi dengan menambahkan cap dan poli-A tail.
Struktur tersebut melindungi mRNA dari degradasi dan membantu mengeluarkannya
dari nukleus. mRNA eukariotik juga harus melalui tahapan splicing, dimana intron
harus dihapuskan sehingga ekson dapat dihubungkan dengan akurasi nukleotida
tunggal. Hanya mRNA yang telah melalui proses ini yang dapat dikeluarkan dari
nukleus ke sitoplasma.

2. Spektrofotometri merupakan metode yang dapat digunakan untuk mengetahui


konsentrasi dan kemurnian suatu zat berdasarkan pengukuran nilai absorbansi dan
niali transmitansi. Jenis spektrofotometri yang digunakan untuk uji kuantitatif DNA
adalah spektrofotometri Visible dan spektrofotometri UV-Vis.
Pita ganda DNA/RNA dapat menyerap cahaya pada 260 nm, sedangkan kontaminan
protein atau fenol pada 280 nm.
Å260
Kemurnian=Å280

• Kemurnian DNA berkisar antara 1,8-2,0.


• Kemurnian < 1,8: isolasi belum murni
• Kemurnian > 2,0: nilai ddH2O yang diambil lebih banyak dari DNA/RNA

3. RNA interference (RNAi) atau Post-Transcriptional Gene Silencing (PTGS)


merupakan teknik yang sangat berpotensi untuk menghambat ekspresi gen secara in
vitro. Sampai saat ini, beberapa penelitian menunjukkan bahwa RNAi bekerja di
dalam Planaria, Typanosoma, lalat, mencit dan tumbuhan. Penelitian-penelitian
tersebut dapat dijadikan acuan yang mendasari digunakannya RNAi untuk inaktivasi
gen pada manusia.

RNAi atau PTGS adalah fenomena yang baru ditemukan, dimana pengenalan double
stranded RNA (dsRNA) ke dalam sitoplasma sel menghasilkan degradasi mRNA
yang spesifik dan efisien. Mekanisme ini adalah pengaturan gen baru dengan
membatasi tingkat traskrip sehingga dapat mengurangi produksi protein. Selain itu
juga menjanjikan untuk merevolusi biologi eksperimental dan memiliki aplikasi
praktis penting dalam genomik fungsional, intervensi terapeutik, pertanian dan bidang
lainnya.

37 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Model yang disederhanakan untuk jalur RNAi didasarkan pada dua langkah, masing-
masing melibatkan enzim ribonuklease.
1) Langkah pertama: RNA pemicu (baik dsRNA atau miRNA) diproses menjadi
short interfering (siRNA) oleh enzim RNase II, Dicer dan Drosha.
2) Langkah kedua: siRNA dimuat ke dalam RNA-induced silencing complex
(RISC). SiRNA dilepaskan selama perakitan RISC dan RNA untai tunggal ber-
hibridisasi dengan target mRNA. Pembungkaman gen/ gene silencing adalah hasil
dari degradasi nukleolitik dari mRNA yang ditargetkan oleh enzim RNase H
Argonaute (Slicer). Jika siRNA / mRNA duplex berisi ketidaksesuaian, mRNA
tidak dibelah dan pembungkaman gen adalah hasil dari penghambatan translasi.

Gambar: Model Sederhana Jalur RNAi


Sumber: ncbi.nlm.nih.gov/probe/docs/techrnai/

Contoh aplikasi RNAi: Pengembangan Terapi Gen untuk Epsilepsi


Para peneliti mengembangka pendekatan pembungkaman gen (gene silencing)
untuk menghilangkan gen Adenosin Kinasi (ADK) di stem cell jelly mesenkimal
Wharton (sejenis sel manusia). Mereka menargetkan mRNA ADK pada ujung 3’
dengan delapan kaset pengkode yang mengandung anti-adenosin kinasi shRNAs.
Kaset-kaset tersebut pertama kali di klon pada vektor lentiviral (vektor yang
digunakan untuk terapi gen dengan meyisipkan, memodifikasi atau
menghilangkan gen pada organisme dengan menggunakan lentivirus). Kemudian
dilakukan screening vektor-vektor untuk menemukan vektor yang paling efisien
mengekspresikananti-ADK miR-shRNA. Vektor tersebut digunakan untuk

38 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
mentransduksi sel secara stabil. Hasilnya adalah 95% regulasi ADKyang
dimediasi dengan RNAi menjadi menurun. Studi ini menunjukkan penggunakan
efisien dari kaset shRNA untuk mengurangi gen ADK. Metode ini dapat
menghasilkan sel yangdapat digunakan untuk pengembangan terapi untuk
epilepsi.

4. Struktur sekunder protein:


- Alpha helix: untuk protein struktural
- Beta pleated sheet: untuk protein storage
5. Perbedaan biosintesis protein pada prokariotik dan eukariotik
TRASKRIPSI
Prokariotik Eukariotik
Terjadi di sitoplasma, karena tidak punya Traskripsi terjadi di dalam inti sel, translasi
membran inti terjadi di sitoplasma
Translasi terjadi sebelum transkripsi selesai Translasi terjadi setelah proses transkripsi
sempurna, terlaksana hampir serempak selesai, tidak dapat terjadi secara bersamaan
Gen eukariotik:
• Gen kelas 1 (ditranskripsi oleh RNA
Gen prokariot: polimerase 1)
• Promotor: mengendalikan transkripsi 18srRNA, 28SrRNA, dan 8srRNA.
terletak pada ujung 5’ Mengandung promotor antara dan
• Struktural: terletak di hilir promotor utama
mengandung urutan DNA yang akan • Gen kelas 2 (ditranskripsi olehRNA
ditranskripsi polimerase 2)
• Terminator: memberi sinyak pada Mengkode protein dan beberapa
RNA polimerase untuk menghentika RNA brukuran kecil di dalam
transkripsi nukleus, yaitu mRNA dan snRNA
• Gen kelas 3
Mengkode tRNA 5srRNA
Dioperasikan dalam 1 sistem operon (1
promotor untuk mengendalikan seluruh gen Tidak ada sistem operon, bersifat spesifik
struktural)
Sifat ekspresi gen mRNA polistronik (dalam Sifat ekspresi gen mRNA monostronik ( 1
1 transkrip terkandung > 1 rangkaian kodon transkrip hanya mengkode 1 macam produk
(sistron) polipeptida yang berbeda) ekspresi gen.
Tidak terjadi splicing, capping dan Terjadi splicing, capping dan poliadenilasi
poliadenilasi

TRANSLASI

39 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Prokariotik Eukariotik
RNA polimerase menempel langsung pada Terdapat transkripsi faktor, berupa protein
DNA di promoter tanpa ada ikatan dengan sebagai tempat menempelnya RNA
protein tertentu polimerase
Subunit ribosomal:70S (unit Subunit ribosomal: 80S (bervariasi dari
Svedberg,ukuran berdasarkan perbandingan spesies ke spesies). Terdiri dari bagian besar
sedimentasi). Terdiri dari bagian besar 50S 60S dna bagian kecil 40S
dan bagian kecil 30S
Inisiator: IF1, IF2, IF3, GTP Inisiator: elF4A, elF4E, elF4G
Faktor release: RF1 (UAA & AG), RF2 eRF1, eRF3 (mengenali stop kodon)
(UAA & UGA), RF3 (merangsang
pelepasan RF1)

40 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS BIOLOGI MOLEKULER

Waktu : 120 Menit


Sifat Ujian :-
Dosen : Muhamad Sahlan

Keterangan

a. Ujian ini bersifat close book.


b. Silahkan dikerjakan dari yang dianggap mudah terlebih dahulu.

Soal

1. Gambarlah struktur DNA double helix berikut ini : CCGGTTAA


2. Jelaskan prinsip kerja sekuensi DNA metode Sanger!
3. Jelaskan perbedaan proses biosintesis RNA di sel prokariotik dan sel eukariotik !
4. Jelaskan prinsip kerja microRNA di dalam menjalankan fungsinya !
5. Jelaskan tahapan post transisi pada sel eukariotik.
6. Jelaskan apa yang anda ketahui tentang kolagen !
7. Jelaskan prinsip kerja analisis berat molekul dengan menggunakan Sodium dodesil sulfat
poliakrilamid gel elektroforesis?
8. Sebutkan dan jelaskan jenis-jenis ikatan yang terdapat di dalam struktur tersier suatu
protein?

41 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS BIOLOGI MOLEKULER

Asisten Dosen : Reysa Anggraini


Jurusan, Angkatan : Teknologi Bioproses, 2015

1. Struktur DNA double helic

Note: ini Cuma masang-masangin basa aja kok, C-G, A-T, terus dibuat dalam bentuk
dua strand

2. Prinsip kerja metode sekuensing Sanger


• DNA yang ingin diketahui sekuensnya diinkubasi dalam tabung bersama dengan
bahan lain seperti primer, DNA polymerase, deoxyribonucleotides, dan sejumlah
tertentu dideoxyribonucleotides yang dibutuhkan untuk sintesis DNA. Inkubasi
Dilakukan dalam tabung-tabung yang berbeda, dimana masing-masing tabung hanya
berisi salah satu jenis ddNTP (ddATP, ddCTP, ddTTP, ddGTP).

42 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
• Sintesis DNA akan berlangsung dan berhenti jika dideoksiribonukleotida digunakan.
Proses ini menghasilkan DNA dengan panjang yang bervariasi sesuai urutan
nukleotida.

Penjelasan: Dideoxyribunucleotides (ddNTP) adalah deoxyribonucleotides (dNTP)


yang mana oksigen pada gula pentosa yang digunakan untuk berikatan dengan gugus
fosfat dari nukleotida lain dihilangkan. Akibatnya, ketika polimerasi DNA sedang
berlangsung, jika yang berpasangan dengan nukleotida pada strand induk adalah
ddNTP dan bukannya dNTP, pemanjangan DNA terhenti pada titik tersebut. Lebih
jelasnya, perhatikan gambar

• Campuran kemudian dielektroforesis dengan gel polyacrilamide. Fluoresensi dari


dideoksiribonukleotida yang digunakan dideteksi oleh detector.

43 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Prinsipnya sama dengan elekroforesis biasa. Sampel yang dielektroforesis berasal dari
masing-masing tabung reaksi yang memiliki ddNTP yang berbeda (misal, tabung
yang berisi ddG dimasukkan ke dalam well 1, sampel yang berisi ddA dimasukkan ke
dalam well 2, dst). Dari hasil elektroforesis diperoleh sekuens utuh dengan
menggabungkan hasil elektroforesis dari keempat sampel tersebut.

3. Perbedaan transkripsi di organisme eukariotik dan prokariotik


Prokariot Eukariot
Translasi dilakukan ketika proses Translasi dan transkripsi dilakukan di
transkripsi masih berlangsung tempat yang berbeda
Transkripsi dilakukan di sitoplasma Transkripsi dilakukan di nukleus
Tidak ada fase definit kapan terjadi
Terjadi pada fase G1 dan G2 di siklus sel
transkripsi
RNA polymerase I, II, dan III secara
Sebuah RNA polymerase mensintesis
berturut-turut mensintesis rRNA, mRNA
ketiga tipe RNA (mRNA, tRNA, rRNA)
dan tRNA
Membutuhkan factor transkripsi untuk
Tidak membutuhkan protein atau factor mengenali TATA box dan menginisiasi
inisiasi transkripsi (TFIIA, TDIIB, TFIID, TFIIF,
dan TFIIH)

4. Prinsip kerja microRNA

44 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Micro RNA atau miRNA berfungsi untuk meregulasi ekspresi gen, baik dengan
merepresi atau menginterferensi, pada proses translasi dengan cara mengadakan base
pairing dengan mRNA sehingga memblok proses translasinya oleh ribosom. Berbeda
dengan siRNA, mekanisme bloking transkripsi dari miRNA tidak melibatkan proses
degradasi mRNA.

Gambar yang lebih baik bisa diakses di http://bit.ly/1mTMgVq

5. Post translasi pada eukariotik


• Protein Folding
Polipeptida yang terbentuk dari hasil translasi masih dalam bentuk inaktif. Pelipatan
polipeptida kedalam bentuk aktifnya dapat terjadi bersamaan dengan proses translasi.
Beberapa jenis protein dapat melipat dirinya sendiri, namun sebagian besar jenis
protein lainnya memerlukan bantuan dari molekul yang disebut chaperone.
Komponen terkait dalam proses pelipatan protein adalah chaperone, kalsium, da
beberapa enzim terkait (glukosidase, Enzim GT (UDP glucose glycoprotein
glucosyltransferase), dll.

45 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Chaperone merupakan protein yang membantu pelipatan protein sehingga protein
dapat berada pada bentuk fungsionalnya. Fungsi dari chaperone yaitu:
o Membantu proses folding protein
o Melambatkan kecepatan folding protein sehingga dapat mencegah terjadinya
agregasi protein
o Melindungi protein dari kondisi stres misal perubahan suhu drastis yang
mendadak
o Menjaga homeostasis kalsium di dalam lumen RE
Terdapat beberapa jenis Chaperon pada eukariot, sesuai dengan fungsinya
masingmasing. Diantaranya yang cukup fungsional adalah chaperone yang berfungsi
melindungi protein dari degradasi saat masih dalam proses sintesis yaitu Hsp70.

Chaperon lain yang berperan penting adalah Hsp100 dan Hsp60 yang berperan dalam
folding protein.
• Fosforilasi
Fosforilasi adalah modifikasi protein dengan penambahan fosfat. Tujuannya adala
untuk mengatur aktivitas biologis protein dan bersifat sementara. Selain itu juga
sebagai aktivitas reseptor faktor pertumbuhan. Gugus fosfat dapat ditambahkan dan
dihapuskan kembali. Enzim yang memfosforilasi protein disebut kinase Sedangkan
enzim untuk menghapus fosfat disebut fosfatase. Jenis – jenis fosforilasi ada tiga yaitu
Phosphoserine, Phosphothreonin dan Phosphotyrosine sesuai dengan jenis asam
amino yang terfosforilasi.
• Sulfonasi

46 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Sulfonasi adalah modifikasi protein dengan penambahan gugus sulfat. Terjadi pada
residu tirosin. Penambahan sulfat untuk tirosin berperan dalam modulasi interaksi
antar protein. Proses sulfonasi pada tirosin penting untuk proses pembekuan darah,
fungsi kekebalan berbagai peradangan intraseluler, dan pengenalan ligan oleh
beberapa G-protein-coupled receptors (GPCRs). Contoh : protein koagulasi factor
VIII, dan usus peptida gastrin dan cholecystokinin (CCK).
• Isopronylasi
Isoprenylasi adalah modifikasi protein dengan penambahan gugus isoprenyl.
Mekanisme isoprenylasi adalah pembentukan ikatan thioether antara gugus isoprenyl
dan residu Cys pada protein. Gugus isoprenyl terbentuk dari pyrophosphorylated
intermediate pada biosintesis kolestrol, seperti farnesyl pyrophosphate. Jenis protein
dari modifikasi ini diantaranya protein Ras (produk dari rasoncogenes dan
protoonkogen), G protein, lamins (protein yang ditemukan dalam matriks nuklir).
Kelompok isoprenyl berfungsi membantu protein melekat pada membran sel.
• Glikosilasi
Glikosilasi adalah proses modifikasi protein dengan karbohidrat (terutama sakarida).
Proses ini adalah modifikasi post translasi yang terbesar dan penting. Tujuannya
adalah membentuk glikoprotein. Monosakarida yang biasa ditambahkan adalah
glukosa (Glc), galaktosa (Gal), Mannosa (Man), Fukosa (Fuc), Nacetylgalactosamine
(GalNAc), N-acetylglucosamine (GlcNAc) dan Nacetylneuraminic acid (NANA) /
sialic acid (Sia).
Macam glikosilasi Keterangan
N- Linked Glikosilasi Glycan mengika gugus amino asparagino
di RE
O- Linked Glikosilasi Monosakarida mengikat gugus hidroksil
pada Serine atau Threonine pada RE,
golgi, sitosol dan nucleus
C- Linked Glikosilasi Manosa terikat dalam cincin tryptophan
Glipiasi Glycan mengubungkan fosfolipid dan
protein

• Metilasi

47 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Metilasi merupakan proses transfer gugus Metil (CH3) ke Nitrogen (N) atau Oksigen
(O) pada rantai asam amino secara irreversibel. Tujuannya untuk meningkatkan
hydrophobisitas protein dan bisa menetralkan muatan negatif asam amino ketika
terikat dengan asam karboksilat. Enzim yang terlibat dalam proses metilasi adalah
methyltransferases, metionin S-adenosyl (SAM).
• Lipidasi
Lipidasi adalah proses modifikasi protein dengan menambahkan gugus lipid.
Tujuannnya adalah untuk membentuk sistem yang mengatur kegiatan dan peredaran
protein dalam sel dan jaringan. Lipidasi biasanya terjadi pada protein target di
membran mel (endoplasma [ER], Badan Golgi, mitokondria), vesikula (endosomes,
lisosom) dan membran plasma.
• Proteolisis
Proteolisis adalah proses pemecahan protein menjadi polipeptida yang lebih kecil atau
asam amino secara irreversibel. Proteolisis berfungsi sebagai pengaturan penting
beberapa proses fisiologis dan seluler, serta mencegah akumulasi protein dalam sel
yang tidak diinginkan atau abnormal. Enzim yang terlibat dalam proses proteolysis
adalah protease. Penyebab lain dari proses proteolisis adalah hidrolisis ikatan peptida,
pencernaan intra molekul, pengaruh panas dan mineral lain.
Fungsi proteolisis dan contohnya:
o Proteolitik degradative menghilangkan subunit protein yang belum dirakit,
protein yang gagal melipat, serta mempertahankan konsentrasi protein pada
konsentrasi homeostatik dengan mengurangi protein yang diberikan dengan
peptida (tingkat kecil) dan asam amino tunggal.
o Protease berperan dalam biosintesis Penghilangan sinyal peptida dari protein
baru dan mengaktifkan zymogens (prekursor enzim yang tidak aktif yang
memerlukan pembelahan di situs tertentu untuk fungsi enzim). Dalam hal ini,
protease bertindak sebagai molekul switch untuk mengatur aktivitas enzim.

6. Kolagen
Kolagen adalah salah satu protein yang menyusun tubuh manusia. Keberadaannya
mencapai 30% dari seluruh protein yang terdapat di tubuh. Kolagen juga merupakan
struktur organic pembangun tulang, gigi, sendi, otot, dan kulit. Serat kolagen memiliki
daya tahan yang kuat terhadap tekanan. Kolagen menjadi komponen pembangun utama

48 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
pada dermis, salah satu lapisan terendah pada kulit. Kolagen penting untuk menjaga kulit
tetap kencang dan lentur. Kolagen membantu untuk memberikan kekuatan untuk
berbagai struktur tubuh dan juga melindungi struktur seperti kulit dengan mencegah
penyerapan dan penyebaran patogen zat, racun-racun lingkungan, mikro - organisme dan
sel-sel kanker.
Sel yang
Jenis Tempat Ciri-ciri
dihasilkan
Lapisan kulit, tendon Fibroblas
Tersebar (areolar),
memadati jaringan Sel reticular dan
penyambung, serat- otot halus
Hidroksilisin
serat kolagen
Tipe I rendah, karbohidrat
Hampir kebanyakan
rendah
tersebar di organ
internal
Tulang Osteoblas
Dentin (gigi) Odontoblas
Tulang rawan hialin Hidroksilisin tinggi,
Kondrosit
dan elastin karbohidrat tinggi
Tipe II
Lensa mata, jaringan Sel-sel retina (fibril lebih tipis dari
invertebral kondrosit tipe I)
Menyebar di
jaringan
penyambung;
Fibroblas dan sel- Hidroksiprolin
serabut retikuler,
sel reticular tinggi, hidroksilisin
Tipe III lapisan kulit papiler
rendah, karbohidrat
(pada fase
rendah
perkembangan)
Sel oto halus, sel
Pembuluh darah
endotelial
Sel epithelial dan Hidroksilisin sangat
Lamina basal
Tipe IV sel endothelial tinggi, karbohidrat
Kapsul lensa mata Epitel lensa tinggi (menahan

49 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
prokolagen menjadi
peptide)
Membran fetal
Fibroblas
(pkasenta)
Membran lapisan
Tipe V Sel-sel epithelial
dasar tulang
Osteoblas
Otot halus
Sel-sel otot halus

7. Prinsip kerja SDS FAGE


SDS PAGE merupakan metode identifikasi, pemisahan, dan purifikasi molekul selular
berdasarkan ukurannya dengan menggunakan medan listrik yang melalui medium gel
poliakrilamid. SDS PAGE menggunakan prinsip dasar elektroforesis, yakni teknik
pemisahan komponen atau molekul bermuatan berdasarkan perbedaan tingkat
migrasinya dalam sebuah medan listrik. Kecepatan molekul yang bergerak pada medan
listrik tergantung pada muatan, bentuk dan ukuran. Protein dengan Mr kecil (lebih
ringan)bergerak lebih cepat dan menempuh jarak yang lebih jauh pada agar. DNA yang
bermuatan negatif akan bergerak menuju kutub positif dari gel yang telah dialiri listrik.
Gel yang digunakan, sodium dodesil sulfat, berfungsi mendenaturasi protein, memutus
ikatan disulfida, dan menambah muatan negatif pada protein.

8. Jenis ikatan yang terdapat pada struktur tersier protein


Struktur tersier terjadi karena pelipatan struktur sekunder akibat adanya interaksi antar
gugus alkil (R) satu sama lain, yaitu interaksi hidrofobik, ionik, ikatan hidrogen, gaya
dispersi van der waals dan jembatan disulfida. Sehingga, membentuk struktur tiga
dimensi. Dalam struktur ini, ikatan hidrofobik sangat penting bagi protein. Asam amino
yang memiliki sifat hidrofobik akan berikatan di bagian dalam protein yang tidak
berikatan dengan air, sementara asam amino yang bersifat hidrofilik akan berada di
permukaan luar yang berikatan dengan air.

50 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
PERMODELAN TEKNIK
KIMIA

51 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PEMODELAN TEKNIK KIMIA 2014

Hari, Tanggal : Jumat, 6 Juni 2014


Waktu : 90 menit
Sifat Ujian : Open book
Dosen :-

1. Kembangkan model matematis satu dimensi kolom absorpsi untuk mengabsorbsi


oksigen di udara ke dalam air seperti gambar di bawah!

Udara mengalir dari bawah ke atas dengan kecepatan VG. Air mengalir dari atas ke
bawah dengan kecepatan VL. Konsentrasi oksigen di udara adalah CG. Konsentrasi
oksigen di air adalah CL. Karena ukuran gelembung udara sangat kecil, maka
transportasi oksigen di udara secara difusif dan konvektif hanya terjadi ke arah aksial
kolom. Di air, oksigen bertransportasi secara difusif dan konvektif ke arah aksial
kolom. Koefisien difusi oksigen di udara dan air masing-masing adalah DG dan DL.
Konsentrasi oksigen di udara dan air yang masuk kolom masing-masing adalah CG0
dan CL0. Koefisien kelarutan oksigen di air adalah kO2. Konsentasi kelarutan oksigen
di air adalah Csat. Fluks difusif oksigen di udara dan air yang keluar kolom adalah nol.

52 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝑑2 𝑦 𝑑𝑦
2. Selesaikan persamaan diferensial + 𝑎1 (𝑡) 𝑑𝑡 + 𝑎0 (𝑡)𝑦 = 𝑢 (𝑡) dengan kondisi batas
𝑑𝑡 2

𝑦(𝑡0 ) = 𝑦0 , 𝑦(𝑡𝑓 ) = 𝑦𝑓 dengan menggunakan metode selisih berhingga. Jumlah segmen


adalah N, selisih t adalah h, representasi turunan pertama adalah center difference. Tuliskan
jawaban Anda dalam hubungan matriks Ay=b!

53 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERMODELAN TEKNIK KIMIA 2011

Hari, Tanggal : Jumat, 20 Mei 2011


Waktu :-
Sifat Ujian :-
Dosen :-

Sebuah reaktor aliran sumbat non-isotermal untuk reaksi perangkahan aseton fasa uap
CH3COCH3↔CH2CO + CH4
dimodelkan dengan persamaan diferensial berikut:
𝑑𝑋 − 𝑟𝐴
=
𝑑𝑉 𝐹𝐴0
𝑑𝑇 𝑈𝑎 (𝑇𝑎−𝑇)+𝑟𝐴 ∆𝐻𝑔
=
𝑑𝑉 𝐹𝐴0 (𝐶𝑝𝐴+𝑋∆𝐶𝑝)

Aseton masuk ke dalam reaktor pada temperatur T0 = 1035 K dan tekanan P0 = 162 kPa.
Temperatur gas internal di dalam heat exchanger adalah konstan, yaitu Ta = 1150 K. Data
lain adalah sebagai berikut:
• Laju alir volumetrik masuk reaktor, υ0 = 0,002 m3/detik
• Volume rekator, VR = 1m3
• Koefisien perpindahan panas keseluruhan, U = 110W/m2K
• Luas perpindahan panas, A = 150 m2/m3 reaktor
1 1
• Koefisien laju reaksi, k = 3,58exp [ 34222(1035 − 𝑇)] detik-1

• Panas reaksi:
∆HR = 80770 + 6,8 (T – 298) – 5,75x10-3 (T2 – 2982) – 1,27exp10-6 (T3 – 2983) J/mol
• Kapasitas panas aseton, CpA = 26,63 + 0,1830T – 45,86x10-6T2 J/mol.K
• Kapasitas panas ketene, CpB = 20,04 + 0,0945T – 30,9586x10-6T2 J/mol.K
• Kapasitas panas metana, CpC = 13,39 + 0,0770T – 18,7186x10-6T2 J/mol.K
1−𝑋 𝑇0
• FA0 = CA0 υ0 ∆Cp = CpB + CpC - CpA -rA = kCA0 1+𝑋 𝑇

• CA0 = konsentrasi aseton di inlet reaktor (gunakan hukum gas ideal untuk menghitung
CA0)

54 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Soal:
1. Buat program Ms. Excel untuk solusi sistem di atas dengan h = 0,001 dan
menggunakan metode Runge-Kutta-Gill.
2. Buat temperatur masuk reaktor, tekanan masuk reaktor, laju alir volumetrik masuk
reaktor, konversi aseton masuk reaktor, volume reaktor, temperatur gas eksternal,
koefisien perpindahan panas keseluruhan, dan luas perpindahan panas sebagai
variabel input program!
3. Plot profil konversi aseton (X) dan temperatur (T) sepanjang reaktor!

55 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERMODELAN TEKNIK KIMIA 2011

Asisten Dosen :-
Jurusan, Angkatan :-

Contoh SPANL#5Eq: Berikut adalah program Ezy PASCAL untuk solusi SPANL dengan 5
buah persamaan yang dimaksud.

𝑓1 (𝑥1 , 𝑥2 , 𝑥3 , 𝑥4 , 𝑥5 ) = 𝑥12 − 𝑥22 + 𝑥32 − 11

𝑓2 (𝑥1 , 𝑥2 , 𝑥3 , 𝑥4 , 𝑥5 ) = 𝑥1 𝑥3 − 2𝑥22 + 𝑥4 𝑥5 − 20

𝑓3 (𝑥1 , 𝑥2 , 𝑥3 , 𝑥4 , 𝑥5 ) = 5𝑥1 − 3𝑥2 + 2𝑥3 − 3𝑥4 + 𝑥5

𝑓4 (𝑥1 , 𝑥2 , 𝑥3 , 𝑥4 , 𝑥5 ) = 3𝑥2 − 2𝑥4 + 1

𝑓5 (𝑥1 , 𝑥2 , 𝑥3 , 𝑥4 , 𝑥5 ) = √𝑥1 𝑥3 𝑥5 − 12 − 6

𝜕𝑓1 𝜕𝑓1 𝜕𝑓1 𝜕𝑓1 𝜕𝑓1


𝜕𝑥1 𝜕𝑥2 𝜕𝑥3 𝜕𝑥4 𝜕𝑥5
𝜕𝑓2 𝜕𝑓2 𝜕𝑓2 𝜕𝑓2 𝜕𝑓2 2𝑥1 2𝑥2 2𝑥3 0 0
𝜕𝑥1 𝜕𝑥2 𝜕𝑥3 𝜕𝑥4 𝜕𝑥5 𝑥3 −4𝑥2 𝑥1 𝑥5 𝑥4
𝜕𝑓3 𝜕𝑓3 𝜕𝑓31 𝜕𝑓31 𝜕𝑓3 5 −3 2 −3 1
= 0 3 0 −2 0
𝜕𝑥1 𝜕𝑥2 𝜕𝑥3 𝜕𝑥4 𝜕𝑥5
0,5𝑥3 𝑥5 0,5𝑥1 𝑥5 0,5𝑥1 𝑥3
𝜕𝑓4 𝜕𝑓4 𝜕𝑓4 𝜕𝑓4 𝜕𝑓4 0 0
𝜕𝑥1 𝜕𝑥2 𝜕𝑥3 𝜕𝑥4 𝜕𝑥5 [√𝑥1 𝑥3 𝑥5 − 12 √𝑥1 𝑥3 𝑥5 − 12 √𝑥1 𝑥3 𝑥5 − 12]
𝜕𝑓5 𝜕𝑓5 𝜕𝑓5 𝜕𝑓5 𝜕𝑓5
[𝜕𝑥1 𝜕𝑥2 𝜕𝑥3 𝜕𝑥4 𝜕𝑥5 ]

Dengan menggunakan metode Newton-Raphson untuk solusi SPANL di atas, dengan


menggunakan harga-harga awal [x0] = [5], maka akan didapatkan solusi sebagai berikut:

56 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝑥1 = +1,9999999999 …

𝑥2 = +2,9999999999 …

𝑥3 = +3,0000000012 …

𝑥4 = +4,9999999999 …

𝑥5 = +1,0000000002 …

Jumlah iterasi yang dibutuhkan adalah antara 25-30 untuk harga-harga FTOL = 1.0E-12 dan
XTOL = 1.0E-12. Pelajarilah contoh ini agar supaya saudara dapat menyelesaikan tugas
PROYEK yang diberikan!

57 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERMODELAN TEKNIK KIMIA 2012

Hari, Tanggal : Rabu, 6 Juni 2012


Waktu : 75 Menit
Sifat Ujian : Buka selembar catatan
Dosen : Prof. Dr. Ir. Setijo Bismo DEA.

Suatu reaktor sumbat non-isothermal satu dimensi dapat dimodelkan oleh persamaan berikut

𝑑𝐶𝐴 𝑑2 𝐶𝐴
𝑣 − 𝐷 2 − 𝑘(𝑇)𝐶𝐴 = 0 (1)
𝑑𝑧 𝑑𝑧

𝑑𝑇 𝑑2𝑇
𝑣 − 𝑘 2 − ∆𝐻(𝑇)𝑘(𝑇)𝐶𝐴 = 0 (2)
𝑑𝑧 𝑑𝑧

Kondisi batasnya adalah:

𝑑𝐶𝐴
𝑃𝑎𝑑𝑎 𝑧 = 0, 𝑣𝐶𝐴 − = 𝐶𝐴0 𝑑𝑎𝑛 𝑇 = 𝑇0
𝑑𝑧

𝑑𝐶𝐴 𝑑𝑇
𝑃𝑎𝑑𝑎 𝑧 = 𝐿, = 0 𝑑𝑎𝑛 = 0
𝑑𝑧 𝑑𝑧

1. Ubah kedua persamaan di atas beserta kondisi batasnya menjadi seperengkat


persamaan aljabar dengan menggunakan metode finite difference!
• Jumlah titik grid adalah 10.
• Representasi untuk turunan orde ke-1 adalah central finite difference.
• Representasi untuk kondisi batas pertama adalah forward finite difference.
• Representasi untuk kondisi batas kedua adalah backward finite difference.

2. Untuk persamaan 1 dan 2 di atas:


a. Ubah persamaan 1 dan 2 menjadi persamaan kanonisnya.

58 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
b. Ubah persamaan Runge-Kutta orde keempat di bawah menjadi bentuk yang
khusus untuk persamaan 1 dan 2.

1
𝑦𝑖+𝑙,𝑗 = 𝑦𝑖𝑗 + 6 (𝑘1𝑗 + 2𝑘2𝑗 + 2𝑘3𝑗 + 𝑘4𝑗 ) 𝑗 = 1,2, … , 𝑛

𝑘𝑖𝑗 = ℎ𝑓𝑗 (𝑥𝑖 , 𝑦𝑖1 , 𝑦𝑖2 , … , 𝑦𝑖𝑛 ) 𝑗 = 1,2, … , 𝑛


ℎ 𝑘11 𝑘12 𝑘1𝑛
𝑘2𝑗 = ℎ𝑓𝑗 (𝑥𝑖 + 2 , 𝑦𝑖1 + , 𝑦𝑖2 + , … , 𝑦𝑖𝑛 + ) 𝑗 = 1,2, … , 𝑛
2 2 2
ℎ 𝑘21 𝑘22 𝑘2𝑛
𝑘3𝑗 = ℎ𝑓𝑗 (𝑥𝑖 + 2 , 𝑦𝑖1 + , 𝑦𝑖2 + , … , 𝑦𝑖𝑛 + ) 𝑗 = 1,2, … , 𝑛
2 2 2

𝑘4𝑗 = ℎ𝑓𝑗 (𝑥𝑖 + ℎ, 𝑦𝑖1 + 𝑘31 , 𝑦𝑖2 + 𝑘32 , … , 𝑦𝑖𝑛 + 𝑘3𝑛 ) 𝑗 = 1,2, … , 𝑛

59 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERMODELAN TEKNIK KIMIA 2012

Asisten Dosen :-
Jurusan, Angkatan :-

1. [Cara 1]

Z=0→0

Z = n → 1 sampai 9
(𝐶𝐴𝑛+1 − 𝐶𝐴𝑛 ) 𝐶𝐴𝑛 − 2𝐶𝐴𝑛 + 𝐶𝐴𝑛−1
𝑣 −𝐷( ) − 𝑘(𝑇) 𝐶𝐴𝑛 = 0
∆𝑍 ∆𝑧 2
𝑇𝑛+1 − 𝑇𝑛 𝑇𝑛+1 − 2𝑇𝑛 + 𝑇𝑛−1
𝑣( )−𝑘( ) − ∆𝐻(𝑇) 𝑘(𝑇) 𝐶𝐴𝑛 = 0
∆𝑍 ∆𝑍 2

Z = 10
−𝑘(𝑇)𝐶𝐴10 = 0
−∆𝐻(𝑇) 𝑘(𝑇) 𝐶𝐴10 = 0

[Cara 2]
𝑑𝐶𝐴 𝑑 2 𝐶𝐴
𝑘(𝑇)𝐶𝐴 = 𝑣 −𝐷
𝑑𝑧 𝑑𝑧 2
𝑑𝑇 𝑑2𝑇
∆𝐻(𝑇)𝑘(𝑇)𝐶𝐴 = 𝑣 −𝑘 2
𝑑𝑧 𝑑𝑧
i = 10
z=0
(𝐶𝐴2 − 𝐶𝐴1 )
𝑣𝐶𝐴1 − 𝐷 = 𝐶𝐴0
∆𝑧
(𝑇2 − 𝑇1 )
𝑣𝑇1 − 𝑘 = 𝑇0
∆𝑧
z=1
i = 10

60 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
(𝐶𝐴10 − 𝐶𝐴9 )
=0
∆𝑧
(𝑇10 − 𝑇9 )
=0
∆𝑧
i = 2, 3, 4, ..., 9
(𝐶𝐴3 − 𝐶𝐴1 ) (𝐶𝐴3 − 2𝐶𝐴2 + 𝐶𝐴1 )
𝑣 −𝐷 =𝑘
2∆𝑧 ∆𝑧 2

Rumus:
(𝐶𝐴𝑖+1 − 𝐶𝐴𝑖−1 ) (𝐶𝐴𝑖+1 − 2𝐶𝐴𝑖 + 𝐶𝐴𝑖−1 )
𝑉 −𝐷 =𝑘
2∆𝑧 ∆𝑧 2
yang T sama

61 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERMODELAN TEKNIK KIMIA 2015 (1)

Hari, Tanggal : Jumat, 29 Mei 2015


Waktu : 120 Menit
Sifat Ujian : Open Book
Dosen : Prof. Dr. Ir. Setijo Bismo DEA.

1. Kembangkan persamaan neraca massa mikroskopis beserta kondisi batasnya untuk


sebuah system berupa gelembung udara berdiameter D yang berisi zat A. Koefisien
difusi zat A di dalam udara adalah DA. Gelembung tersebut berada di dalam cairan yang
mengandung A dengan konsentrasi CAL. Koefisien perpindahan massa antara cairan dan
gelembung adalah k. (Kerjakan di buku jawaban)

2. Selesaikan sistem persamaan diferensial berikut


𝑑𝑦1
= x(y1 + y2)
𝑑𝑥
𝑑𝑦1
= 2y1y2
𝑑𝑥
Dengan menggunakan Metode Shooting dari x = 0 hingga x = 1. Diketahui bahwa pada x
= 0, nilai y1 = 0 dan pada x = 1, nilai y2 = 1. Runge-Kutta orde-4 digunakan untuk
mengintegrasi persamaan-persamaan diferensial tersebut dengan increament Δx = 0,1.
Kondisi awal taksiran untuk y2, ү = 1. Faktor relaksasi, ρ = 0,5. Kriteria konvergensi, Δү
= 0,001. dg untuk mengevaluasi Matriks Jacobian = 0,01. (Tuangkan jawaban Anda pada
tabel di bawah)

x1 y1 y2

62 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
63 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERMODELAN TEKNIK KIMIA 2015 (1)

Asisten Dosen : Danny Leonardi


Jurusan, Angkatan : Teknik Kimia 2013

1. Bentuk volume kontrol:

𝑁𝐴𝑟 |𝑟+∆𝑟

𝑁𝐴𝑟 |𝑟

Asumsi:
a. Tidak ada laju perpindahan massa sepanjang sisi bola, sehingga hanya ada
perpindahan ke arah radial.
b. Perpindahan massa akibat pengaruh konveksi diabaikan.
c. Steady state.
d. Tidak ada generasi massa dalam sistem.

Persamaan fluks massa:


𝑑𝐶𝐴
𝑁𝐴 = 𝐽𝐴 = 𝐷𝐴 𝑑𝑟

Persamaan neraca massa awal:


𝐼𝑛 − 𝑂𝑢𝑡 + 𝐺𝑒𝑛 = 𝐴𝑐𝑐
(𝑁𝐴𝑟 |𝑟+∆𝑟 (4𝜋(𝑟 + ∆𝑟)2 )) − (𝑁𝐴𝑟 |𝑟 (4𝜋𝑟2 )) = 0
1
Bila dibagi dengan 4𝜋𝑟, maka:
(𝑁𝐴𝑟 |𝑟+∆𝑟 (𝑟+∆𝑟)2 )−(𝑁𝐴𝑟 |𝑟 𝑟2 )
𝑟
=0
Bila dilimitkan, maka akan menjadi:

64 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
(𝑁𝐴𝑟 |𝑟+∆𝑟 (𝑟+∆𝑟)2 )−(𝑁𝐴𝑟 |𝑟 𝑟 2 )
lim =0
𝑟→0 𝑟

𝑑(𝑁𝐴𝑟 𝑟 2 )
=0
𝑑𝑟
𝒅𝑪𝑨
𝒅(𝒓𝟐 𝑫𝑨 )
𝒅𝒓
=𝟎
𝒅𝒓

Kondisi batas:
𝑑𝐶𝐴
𝑟=0 =0
𝑑𝑟
𝑑𝐶𝐴
𝑟=𝑅 = 𝑘(𝐶𝐴𝐿 − 𝐶𝐴 )
𝑑𝑟

Dari soal, diketahui bahwa kita harus menggunakan metode Runge-Kutta orde 4
untuk melakukan integrasi numeris dari persamaan diferensial biasa yang ada. Rumus
dasarnya adalah:

Maka, untuk persamaan diferensial biasa yang diberikan, persamaan Runge-Kutta


orde 4 tersebut menjadi (h = 0,1):

a. PDB 1:
1
𝑦𝑖+1 = 𝑦𝑖 + (𝑘1 + 2𝑘2 + 2𝑘3 + 𝑘4 )
6
𝑘1 = ℎ𝑓(𝑥𝑖 , 𝑦𝑖 )
ℎ 𝑘1
𝑘2 = ℎ𝑓 (𝑥𝑖 + , 𝑦𝑖 + )
2 2
ℎ 𝑘2
𝑘3 = ℎ𝑓 (𝑥𝑖 + , 𝑦𝑖 + )
2 2
𝑘4 = ℎ𝑓(𝑥𝑖 + ℎ, 𝑦𝑖 + 𝑘3 )

1
𝑦1,𝑖+1 = 𝑦1,𝑖 + (𝑘1 + 2𝑘2 + 2𝑘3 + 𝑘4 )
6
𝑘1 = (0.1) (𝑥𝑖 (𝑦1,𝑖 + 𝑦2,𝑖 ))

𝑘1 𝑘1
𝑘2 = (0.1) ((𝑥𝑖 + 0.05) ((𝑦1,𝑖 + ) + (𝑦2,𝑖 + )))
2 2

𝑘2 𝑘2
𝑘3 = (0.1) ((𝑥𝑖 + 0.05) ((𝑦1,𝑖 + ) + (𝑦2,𝑖 + )))
2 2

65 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
𝑘4 = (0.1) ((𝑥𝑖 + 0.1) ((𝑦1,𝑖 + 𝑘3 ) + (𝑦2,𝑖 + 𝑘3 )))

b. PDB 2:
1
𝑦2,𝑖+1 = 𝑦2,𝑖 + (𝑘1 + 2𝑘2 + 2𝑘3 + 𝑘4 )
6
𝑘1 = (0.1) (2(𝑦1,𝑖 𝑦2,𝑖 ))

𝑘1 𝑘1
𝑘2 = (0.1) (2 (𝑦1,𝑖 + ) (𝑦2,𝑖 + ))
2 2

𝑘2 𝑘2
𝑘3 = (0.1) (2 (𝑦1,𝑖 + ) (𝑦2,𝑖 + ))
2 2

𝑘4 = (0.1) (2(𝑦1,𝑖 + 𝑘3 )(𝑦2,𝑖 + 𝑘3 ))

Perhitungan tersebut dilakukan untuk x = 0,1 hingga x = 1. Perlu diketahui


bahwa perhitungan Runge-Kutta orde 4 dimulai dari x = 0,1 , karena nilai y1
pada x = 0 sudah diketahui, sehingga tidak perlu dicari lagi, dan nilai y2 pada x
= 0 akan kita tebak dan iterasi untuk mencapai nilai y2(xf,γ) yang sama dengan
1.

Dari tebakan awal y2 adalah γ = 1, didapat bahwa nilai y1(xf,γ) dan y2(xf,γ)
adalah 0,75085 dan 1,522. Nilai y2 tersebut belum mencapai nilai yang
diinginkan, yaitu 1. Oleh karena itu, diperlukan langkah iterasi untuk mencari
tebakan γ baru yang dapat memberi hasil yang lebih mendekati nilai akhir
yang diinginkan. Iterasi tersebut dilakukan dengan rumus berikut.

𝛾𝑏𝑎𝑟𝑢 = 𝛾𝑙𝑎𝑚𝑎 + 𝜌∆𝛾


−(𝑦2 (𝑥𝑓 , 𝛾) − 𝑦2,𝑓 )
∆𝛾 =
𝜕𝑦2 (𝑥𝑓 , 𝛾)
[ ]
𝜕𝛾

Bila iterasi sudah konvergen (∆𝛾 < 0.001), akan didapatkan hasil sebagai berikut.
x y1 y2
0 0 0.738077
0.1 0.0037 0.738258
0.2 0.014922 0.73954

66 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
0.3 0.034063 0.74307
0.4 0.061862 0.750117
0.5 0.0995 0.762185
0.6 0.14873 0.781176
0.7 0.21209 0.809665
0.8 0.293206 0.851345
0.9 0.397277 0.911808
1 0.531858 1

Maka, nilai y2 awal yang tepat adalah 0,738077. Berikut adalah grafik dari hasil akhir
tersebut.

Grafik Hasil Shooting


1,2

0,8

0,6
y

y1
0,4 y2

0,2

0
0 0,2 0,4 0,6 0,8 1 1,2
x

67 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERMODELAN TEKNIK KIMIA 2016 (1)

Mata Kuliah : Pemodelan Teknik Kimia


Dosen :-
Sifat Ujian : Close Book
Waktu Ujian : 120 Menit

1. Kembangkan model matematis skala mikroskopis untuk sistem pelet katalis berbentuk
bola dengan jari-jari R. Di dalam pelet tersebut senyawa reaktan A berpindah secara
molekular ke arah radial dengan koefisien difusi DA, kemudian beraksi dengan laju
reaksi r = k1XCA. Kondisi batas pada permukaan luar bola adalah kondisi Robbins dengan
koefisien perpindahan massa antar-fasa k, sedangkan konsentrasi senyawa A yang masuk
ke dalam pelet katalis adalah CAinlet.
Tulislah jawaban Anda ke dalam tabel di bawah!
a. Geometri Sistem b. Volume Kontrol

c. Fluks Massa

d. Persamaan Pengembangan (persamaan diferensial)

e. Kondisi batas

68 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
2. Ubah persamaan diferensial yang anda dapat dari soal 1 beserta kondisi batasnya ke
dalam sejumlah persamaan aljabar dengan menggunakan Metode Selisih Berhingga.
Jumlah titik meshing adalah 5. Untuk representasi turunan pertama gunakan selisih maju!
Tulislah jawaban anda ke dalam tabel di bawah ini!
i =1

i =2

i =3

i =4

i =5

3. Fermentasi glukosa menjadi etanol dilakukan di dalam reaktor batch dengan


menggunakan sel organisme seperti Saccharomyses cerevisiae. Hitung konsentrasi sel,
substrat glukosa, dan produk etanol sebagai fungsi waktu. Konsentrasi awal sel adalah
1,0 g/L dan substrat adalah 250 g/L.
Persamaan neraca massa:
𝑑𝐶𝑐 𝐶𝑝 𝐶𝑐 𝐶𝑠
Sel : = 𝜇𝑚𝑎𝑥 (1 − 𝐶° )0,52 − 𝑘𝑑 𝐶𝑐
𝑑𝑡 𝑝 𝐾𝑠 +𝐶𝑠

𝑑𝐶𝑠 𝐶𝑝 𝐶𝑐 𝐶𝑠
Substrat : = −𝑌𝑠/𝑐 𝜇𝑚𝑎𝑥 (1 − 𝐶° )0,52 − 𝑚𝐶𝑐
𝑑𝑡 𝑝 𝐾𝑠 +𝐶𝑠

𝑑𝐶𝑝 𝐶𝑝 𝐶𝑐 𝐶𝑠
Produk : = 𝑌𝑝/𝑐 𝜇𝑚𝑎𝑥 (1 − 𝐶° )0,52
𝑑𝑡 𝑝 𝐾𝑠 +𝐶𝑠

Dimana: 𝜇𝑚𝑎𝑥 = 0,33/jam; 𝐶°𝑝 = 93 g/L; 𝐾𝑠 = 1,7 g/L; 𝑘𝑑 = 0,01/jam; 𝑌𝑠/𝑐 = 0,08
g/g; 𝑌𝑝/𝑐 = 5,6 g/g; m=0,03

69 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Selesaikan sistem persamaan diferensial terebut dengan menggunakan metode Runge-
Kutta-Gill dengan h=0,01 dari t=0 hingga t=12 jam

Tuliskan sebagian jawabannya ke dalam tabel berikut:

T[jam] C c [g/L] Cs [g/L] CP [g/L]

10

12

70 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS PERMODELAN TEKNIK KIMIA 2016 (1)

Mata Kuliah : Pemodelan Teknik Kimia


Dosen :-
Asisten Dosen : Dimas Nurwansyah
ID Line :-

1. Pelet Katalis Bola

a) Geometri Sistem

b) Volume Kontrol

𝑁𝐴𝑟 𝐼𝑟

𝑁𝐴𝑟 𝐼𝑟

c) Fluks Massa
𝜕𝐶𝐴 𝜕𝐶𝐴
- 𝑁𝐴𝑟 = −𝐷𝐴𝐵 + 𝐶𝐴 𝑉𝑟∗ = −𝐷𝐴𝐵
𝜕𝑟 𝜕𝑟
𝐷𝐴𝐵 𝜕𝐶𝐴
- 𝑁𝐴𝜃 = − + 𝐶𝐴 𝑉𝜃∗ = 0
𝑟 𝜕𝜃
𝐷 𝜕𝐶𝐴
- 𝐴𝐵
𝑁𝐴∅ = − 𝑟𝑠𝑖𝑛∅ + 𝐶𝐴 𝑉∅∗ = 0
𝜕∅

71 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
d) Persamaan Pengembangan
Neraca Massa
In – Out + Gen = Acc
𝑁𝐴𝑟 𝐼𝑟 𝜋𝑟 2 − 𝑁𝐴𝑟 𝐼𝑟+∆𝑟 4𝜋(𝑟 + ∆𝑟)2 − 4𝜋𝑟 2 ∆𝑟𝑘𝐶𝐴 = 0
dibagi 4𝜋∆𝑟 dan dilimitkan ∆𝑟 → 0
(𝑟 2 𝑁𝐴𝑟 )𝐼𝑟 − (𝑟 2 𝑁𝐴𝑟 )𝐼𝑟+∆𝑟
lim − 𝑟 2 𝑘𝐶𝐴
𝑛→∞ ∆𝑟

𝑑(𝑟 2 𝑁𝐴𝑟 )
− − 𝑟 2 𝑘𝐶𝐴 = 0
𝑑𝑟

𝐷𝐴𝐵 𝑑 𝑑𝐶𝐴
(𝑟 2 ) − 𝑘𝐶𝐴 = 0
𝑟 2 𝑑𝑟 𝑑𝑟

e) Kondisi Batas
𝑑𝐶𝐴
pada r=0→ =0
𝑑𝑟
𝑑𝐶𝐴
pada r=0→ = 𝑘(𝐶𝐴𝑖𝑛𝑙𝑒𝑡 − 𝐶𝐴 )
𝑑𝑟

2. Dibahas pada saat asistensi

3. Dibahas pada saat asistensi

72 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS PERMODELAN TEKNIK KIMIA 2016 (2)

Mata Kuliah : Pemodelan Teknik Kimia


Dosen :-
Sifat Ujian : Close Book
Waktu Ujian : 120 menit

1. Kembangkan model matematis skala mikroskopis untuk reaktor berbentuk silinder


dengan panjang L dan jari-jari R. Di dalam reaktor tersebut senyawa reaktan A berpindah
secara konvektif ke arah aksial dan secara difusif ke arah radial dengan koefisien difusi
DA, kemudian beraksi dengan laju reaksi r = k1XCA. Kondisi batas pada sisi masuk
reaktor adalah kondisi Dirichlet dengan konsentrasi A masuk = CAinlet, pada sisi keluar
reaktor adalah outflow (yaitu fluks difusi = 0), dan tidak ada fluks massa di dinding
reaktor. Tulislah jawaban Anda ke dalam tabel di bawah!
a. Geometri Sistem b. Volume Kontrol

c. Fluks Massa

d. Persamaan Pengembangan (persamaan diferensial)

e. Kondisi batas

73 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
2. Ubah persamaan diferensial yang anda dapat dari soal 1 beserta kondisi batasnya ke
dalam sejumlah persamaan aljabar dengan menggunakan Metode Selisih Berhingga.
Jumlah titik meshing ke arah radial dan aksial masing-masing adalah 5. Untuk
representasi turunan pertama gunakan selisih maju! Tulislah jawaban anda ke dalam
tabel di bawah ini!
i =1, j=3

i =2, j=1

i =3, j=3

i =4, j=5

i =5, j=3

3. Sebuah reaktor alir sumbat non-isotermal untuk reaksi perengkahan aseton fasa uap
CH3COOH ↔ CH2CO + CH4
dimodelkan dengan persamaan diferensial berikut:
𝑑𝑋 −𝑟𝐴
Konversi : 𝑑𝑉 = 𝐹𝐴0

𝑑𝑇 𝑈𝑎 (𝑇𝑎−𝑇)+𝑟𝐴 ∆𝐻𝑅
Temperatur: 𝑑𝑉 = 𝐹𝐴0 (𝐶𝑃𝐴 +𝑋∆𝐶𝑝

Aseton masuk ke dalam reaktor pada temperatur T0 = 1035 K dan tekanan P0= 162000
Pa. Temperatur gas internal di dalam heat exchanger adalah konstan, yaitu Ta = 1200 K.
Data lain adalah sebagai berikut:
• Laju alir volumetrik masuk reaktor, vo = 0,002 m3/detik
• Volume reaktor, VR= 0,0005 m3
• Koefisien perpindahan panas keseluruhan, U=110 W/m2K

74 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
• Luas perpindahan panas, a= 150 m2/m3 reaktor
1 1
• Koefisien laju reaksi, k=3,58exp[3422 (1035 − 𝑟 )] detik-1

• Panas reaksi:
∆𝐻𝑅 = 80770 + 6,8(𝑇 − 298) − 5,75𝑥10−3 (𝑇 2 − 2982 ) − 1,27𝑒𝑥𝑝10−6 (𝑇 3 −
2983 )𝐽/𝑚𝑜𝑙
• Kapasitas panas aseton, CPA= 26,63 + 0,1830T – 45,86 x 10-6 T2 J/mol.K
• Kapasitas panas ketone, CPA= 20,04 + 0,0945T – 30,95 x 10-6 T2 J/mol.K
• Kapasitas panas metana, CPA= 13,39 + 0,0770T – 18,71 x 10-6 T2 J/mol.K
1−𝑋 𝑇
• 𝐹𝐴0 = 𝐶𝐴0 𝑣0 ∆𝐶𝑝 = 𝐶𝑃𝐵 + 𝐶𝑃𝐶 − 𝐶𝑃𝐴 −𝑟𝐴 = 𝑘𝐶𝐴0 (1+𝑋) 𝑇0
𝑃
• 𝐶𝐴 0 = 𝐾𝑜𝑛𝑠𝑒𝑛𝑡𝑟𝑎𝑠𝑖 𝑎𝑠𝑒𝑡𝑜𝑛 𝑑𝑖 𝑖𝑛𝑙𝑒𝑡 𝑟𝑒𝑎𝑘𝑡𝑜𝑟 = 𝑅𝑇0 𝑚𝑜𝑙/𝑚3
0

• R=8,314 J/K mol


Hitung profil konversi aseton X dan temperatur T sebagai fungsi dari panjang reaktor tak
berdimensi V/VR dengan menggunakan metode Runge-Kutta-Gill dengan h=0,00003

Tuliskan sebagian jawabannya ke dalam tabel berikut:

V/VR [m3] X T [K]

0,2

0,4

0,6

0,8

KETERANGAN:

1. Memjadi soal latihan

2. Memjadi soal latihan

3. Akan dibahas pada saat asistensi

75 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
MEKANIKA FLUIDA

76 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2007

Hari, Tanggal : 7 Juni 2007


Waktu : 120 Menit
Sifat Ujian :-
Dosen :-

1. Diketahui suatu nosel yang ditunjukkan di gambar di bawah ini dilalui udara (k = 1,4)
dari reservoir dengan tekanan 100 psia ke atmosfir (tekanan 14,7 psia). Nol0F =
4600R.

a. Berapa Mach number di mulut nosel?


b. Berapa tekanan di mulut nosel (pc) (dalam psia)?
c. Berapa velocity di mulut nosel (Vc) (dalam ft/detik)?
d. Berapa luas penampang mulut nosel (Ac) (dalam in2)?

2. Helikopter mempunyai 3 baling-baling yang berotasi 200 rpm. Masing-masing


baling-baling dianggap pelat tipis empat persegi panjang dan mempunyai panjang 12
ft dan lebar 1,5 ft. Setiap baling-baling dianggap pelat datar. Satu lbf = 32,3
lbm.ft/det2. Pada kondisi standard (600F dan 1 atm), ρ udara = 0,07677 lbm/ft3, v udara
= 1,61 10-4 ft2/det, µ udara = 0,0183 cp. Satu cp = 6,72 lbm/(ft.det) = 2,09 10-5
lbf.det/ft2.
a. Gambarkan secara skematis suatu luasan diferensial pada permukaan baling-

77 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
baling dan jaraknya dari pusat baling-baling, yang akan dipakai untuk
perhitungan pertanyaan-pertanyaan berikut.
b. Formulasikan tegangan gesek (τ0) di luasan diferensial
c. Berapa total torsi yang dibutuhkan untuk mengatasi friksi pada baling-baling
(dalm lbfft)?

3. Tes filtrasi di laboratorim menggunakan plate and frame press pada slurry CaCO3
(filtrasi berlangsung dari 2 sisi). Luas penampang filter = 0,283 ft2 dan ketebalannya
= 1,18 inch. Semua tes dilakukan pada temperature 660F dengan konsentrasi slurry =
0,0723 fraksi berat CaCO3. Densitas cake = 100 lb/ft3, ρ padatan CaCO3 = 183 lb/ft3,
ρ air = 62,4 lb/ft3, v air = 1,08 10-5 ft2/det, µair = 1 cp. ΔP konstan = 40 psi. Satu
Darcy = (1 cm/det). Cp/(atm/cm) = 0,99 10-8 cm2 = 1,06 10-11 ft2. Satu ft3 = 28,316
liter. Data hasil tes sebagai berikut:
Volume fitrat, liter Waktu, detik
0,2 1,8
0,4 4,2
0,6 7,5
0,8 11,2
1,0 15,4
1,2 20,5
1,4 26,7
1,6 33,4
1,8 41,0
2,0 48,8
2,2 57,7
2,4 67,2
2,6 77,3
2,8 88,7

a. Buatlat tabulasi dan plotting Δt/ΔV (dalam detik/ft3) vs V (dalam ft3) di kertas
grafik untuk bisa menjawab pertanyaan-pertanyaan berikut
b. Berapa porositas cake?
c. Berapa tahanan medium filter?

78 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
d. Berapa permeabilitas cake (dalam darcy)?

4. Kompresos tiga tahap digunakan untuk mengkompresi 180 standar ft3/min metana
dari 14 ke 900 lbf/in2 abs. Kompresos dirancang secara adiabatic dengan minimal
kebutuhan listrik. Temperatur masuk ke masing-masing kompresor 800F. Untuk
cakupan temperature di kompresos, Cp metana = 9,3 Btu/(lbmol.0F) dan k metana =
1,31. Satu lbmol = 378,7 standar ft3. Satu Btu/lbmol = 2,3247 Joule/mol.
a. Berapa rasio tekanan luar terhadap tekanan masuk di masing-masing
kompresor?
b. Berapa brake kW masing-masing kompresos kalua efisiensi mekanis= 80%
(dalam kW)?
c. Berapa temperatur metana keluar dari masing-masing kompresor (dalam 0F)?
d. Berapa beban panas di masing-masing intercooler (antar kompresor) (dalam
Btu/jam)?
Kontanta gas= 1,987 Btu/lbmol.0R) = 1,987 kal/(mol.K)

5. Udara mengalir secara steady state dan secara isentropic dalam nosel konvergen
divergen sebagai berikut.

Pada throat (kerongkongan), udara pada tekanan 140 kPa (abs) dan temperature 600C.
Luas penampang throat = 0,05 m2. Pada posisi 1 bagian divergen, tekanan = 70 kPa
(abs). Cp/Cv = 1,4; R = 287 J/(kg.K); densitas udara = 1,4 kg/m3. Titik 0 dianggap
posisi reservoir. Tentukan:
a. P0 (kPa)
b. T0 (0C)
c. Mach number di titik 1 (Ma1)
d. T1 (0C)
e. V1 (m/detik)
f. A1 (m2)

79 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
6. Udara pada kondisi 250C, 1 atm mengalir melalui pelat dengan kecepatan free-stream
(V∞) = 3 m/detik. Profil kecepatan pada pelat memenuhi persamaan V/V∞ = 3/2η –
½ η3, dimana η = y/δ dan δ adalah tebal boundary layer, pada sembarang x dari ujung
depan pelat. Untuk udara, v = 1,5 10-5 m2/detik; ρ = 1,23 kg/m3. Tentukan pada x = 1
meter.
a. Rex
b. δ (dalam m)
c. τ w (dalam Newton/m2)

7. Sebuah pompa yang dites di lab untuk menyedot air. Kavitas terjadi ketika jumlah
head tekanan static dan kecepatan pada inlet pompa = 3,5 m pada tekanan atmosfir
150 mmHg dan tekanan uap 1,8 kPa. Jika diameter dalam pipa 2 inch dan panjang
pipa 10 m digunakan dari reservoir air ke inlet pompa dan densitas air = 9,98 kg/m3;
densitas air raksi 13600 kg/m3; viskositas = 1,1 10-3 kg/(m.detik) dan g = 9,81
m/detik2, tentukan kavitas terjadi
a. Kecepatan air pada inlet pompa (V1) dalam m/detik
b. Friction loss head (hf1) dalam m pada pipa
c. Posisi pompa di atas reservoir air (z1) dalam m
d. Sebutkan minimum 3 cara untuk bisa menaikkan posisi pompa tanpa terjadi
kavitas

80 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS MEKANIKA FLUIDA 2007

Asisten Dosen :-
Jurusan, Angkatan :-

1. Kerjakan sendiri.

2.
a. Gambar plat tipis; ω= 200 rpm

b. Tegangan geser (τo) di luasan diferensial

𝑑𝐹
𝜏𝑜 =
𝑑𝐴
Gaya di keseluruhan permukaan plat:

81 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
1
𝜌 𝑥 𝑉∞2 𝑥 𝐴
𝐹 = 𝐶𝑓 𝑥
2
1
𝑑𝐹 = 𝐶𝑓 𝑥 𝜌 𝑥 𝑉∞2 𝑥 𝑑𝐴
2
1,328 1
𝜏𝑜 = 1 𝑥 𝑥 𝜌 𝑥 (𝜔. 𝑟)2 𝑑𝐴
2
𝑅𝑥2
1,328 1
𝜏𝑜 = 𝑥 𝑥 𝜌 𝑥 (𝜔. 𝑟)2 𝑑𝐴
𝑉∞ 𝑥 2
𝑣
1
1,328𝑣 2 1
𝜏𝑜 = 1 𝑥 𝑥 𝜌 𝑥 (𝜔. 𝑟)2 𝑑𝐴
2
(𝜔. 𝑟. 𝑥)2
1
1,328𝑣 2 1 1 3
𝜏𝑜 = 𝑣 2 𝑥 (𝑥 −2 ) 𝑥 𝜌 𝑥 (𝜔. 𝑟)2 𝑑𝐴
2
1
1,328𝑣 2 1 3
𝜏𝑜 = 𝑥 (𝑥 −2 ) 𝑥 𝜌 𝑥 (𝜔. 𝑟)2 𝑑𝐴
2
1,328 1 3 3 1
𝜏𝑜 = { 𝑥 𝑣 2 𝑥 𝜌 𝑥 𝜔 2 } 𝑥 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴
2
3
1,328 1 200 2 3 1
𝜏𝑜 = { 𝑥 (1,61 𝑥 10−4 )2 𝑥 0,07677 𝑥 (2𝜋 𝑥 ) } 𝑥 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴
2 60

3 1
𝜏𝑜 = 0,062 𝑥 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴

c. Total torsi
3 1
𝑑𝐹 = 0,062 𝑥 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴
3 1
𝐹 = ∫ 0,062 𝑥 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴
3 1
= 0,062 ∫ 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴

𝑅=12 𝑋=1,5
3 1
= 0,062 ∫ ∫ 𝑟 2 𝑥 (𝑥 −2 ) 𝑑𝐴
0 0
𝑅=12
3 1
= 0,062 ∫ 𝑟 2 𝑥 (𝑥 −2 )]1,5
0 𝑑𝑟
0
𝑅=12
3
= 0,062 ∫ 𝑟 2 𝑥 1,225 𝑑𝑟
0

82 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
2 5
= 0,076 𝑟 2 ]12
5 0
𝑙𝑏𝑚 𝑓𝑡 𝑙𝑏𝑓 𝑠 2
= 15,164 𝑥 32,2
𝑠2 𝑙𝑏𝑚 𝑓𝑡
= 488,2808 𝑙𝑏𝑓

𝑅=12

Total torsi = 3 ∫ 𝐹 𝑑𝑟
0
𝑅=12

= 3 ∫ 488,2808 𝑑𝑟
0

= 3 𝑥 488,2808 𝑥 𝑟 ]12
0

= 3 𝑥 488,2808 𝑥 12
= 17578,1088

3. Kerjakan sendiri.

4. Diketahui:
• Kompresor 3 tahap
• Q = 180 ft3/min metana = 0,475 lbmol/min = 7,605 lb/min = 3449,55 gr/min
• P1 = 14 psia
• P4 = 900 psia
• Tin = 800F
• Cp metana = 9,3 Btu/(lbmol.0F)
• M metana = 16 lb/lbmol = 16 gr/mol; k metana = 1,31

Jawab:
Untuk soal ini sketsa gambarnya adalah seperti ini:
a. Rasion tekanan luar terhadap tekanan masuk di masing-masing kompresor;
Total power yang dibutuhkan akan minimum jika ratio tekanan di setiap stage
sama:
1⁄ 1⁄ 1⁄
𝑃𝐷 𝑛 𝑃3 𝑛 900 3
𝑅𝑎𝑡𝑜 = ( ) =( ) =( ) = 4,0059 ≈ 4
𝑃𝑖 𝑃1 14

83 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Dengan demikian, rasio antara
𝑃2 𝑃3 𝑃4
= = =4
𝑃1 𝑃2 𝑃3
Jika kita ingin menghitung tekanan masuk, maupun keluar pada masing-
masing kompresos, maka kita akan memperoleh:
𝑃2 900
= 4 → 𝑃2 = 56 𝑝𝑠𝑖𝑎 = 4 → 𝑃3 = 225 𝑝𝑠𝑖𝑎
14 𝑃3

b. Brake kW masing-masing kompresor kalua efisiensi mekanis = 80%.


𝑘−1
𝑑𝑊 𝑅𝑇1 𝐾 𝑃𝑜𝑢𝑡 𝑘
− = [( ) − 1]
𝑑𝑚 𝐾 − 1 𝑃𝑖𝑛

Persamaan di atas adalah persamaan untuk kerja pompa secara adiabatik.


Karena rasio kompresor (nilai Pout/Pin) sama dan temperatur fluida masuk
fluida ke setiap kompresor adalah sama, maka kerja dari ketiga pompa adalah
sama.
𝑑𝑊 300 𝐾 . 8,314 𝐽 . 1,4 0,4
− = [(4) 1,4 − 1]
𝑑𝑚 16 𝑔 . 𝑚𝑜𝑙 . 𝐾 . 0,4
𝑚𝑜𝑙
𝑑𝑊 𝑔 𝐽 𝐽 𝑊
𝑃𝑜 = 𝑚 (− ) = 3449,55 . 65,16 = 914682,678 .
𝑑𝑚 𝑚𝑖𝑛 𝑔 𝑚𝑖𝑛 𝐽. 𝑠
𝑃𝑜 = 15244,7113 𝑊 = 15,244 𝑘𝑊
𝑓𝑙𝑢𝑖𝑑 𝑤𝑜𝑟𝑘
𝜂=
𝑏𝑟𝑎𝑘𝑒
15,244 𝑘𝑊
0,8 =
𝑏𝑟𝑎𝑘𝑒
𝐵𝑟𝑎𝑘𝑒 = 19,055 𝑘𝑊
Jadi brake atau kerja sesungguhnya dari masing-masing kompresor tersebut
adalah sebesar 19,055 kW.

c. Temperatur metana keluar dari masing-masing kompresor


𝑑𝑊
∆ℎ − 𝑑𝑚
∆𝑇𝑟𝑒𝑎𝑙 = =
𝐶𝑝 𝐶𝑝

d. Beban panas di masing-masing intercooler (antar kompresor)


𝑞 = 𝑚𝑖𝑛 𝑥 𝐶𝑝(𝑚𝑒𝑡𝑎𝑛𝑎) 𝑥 ∆𝑇

84 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
5. Diketahui: Steady state dan isentropik.
• Pth = 140 kPa
• Tth = 600C = 333 K
• Ath = 0,05 m2
• P = 1,4 kg/m3
• P1 = 70 kPa
• K = Cp/Cv = 1,4
• R = 287 J/kg.K

Jawab:
a. P0 = ?
P1 < Pth → chocked flow → Math = 1
Hubungan antara tekanan dengan suhu pada aliran gas satu dimensi adalah
𝑘⁄
𝑃0 𝑇0 𝑘−1
=( )
𝑃𝑡ℎ 𝑇𝑡ℎ
Karena nilai T0 tidak diketahui, nilai T0/Tth diperoleh dengan persmaan, yaitu
𝑇0 2
𝑘−1
= 𝑀𝑎𝑡ℎ ( )+1
𝑇𝑡ℎ 2
𝑇0 1,4 − 1
= 12 ( )+1
𝑇𝑡ℎ 2
Nilai T0/Tth, kemudian dimasukkan dalam persamaan dan diperoleh Po, yaitu
𝑃0 1,4 1,4
= (1,2) ⁄0,4 → 𝑃𝑜 = 𝑃𝑡ℎ(1,2) ⁄0,4 = 165,01 𝑘𝑃𝑎
𝑃𝑡ℎ

b. To = ?
Dengan menggunakan nilai T0/Tth, nilai T0 dapat diketahui, yaitu sebagai
berikut
To = 1,2 Tth = 399,6 K

c. Ma1 =?
Dengan menggunakan persamaan, yaitu
𝑘
𝑃𝑜 𝑘−1 𝑘−1
= (𝑀𝑎1 + 1)
𝑃1 2

85 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Nilai Ma1 dapat dicari yaitu sebagai berikut
𝑘
2 𝑘−1 𝑃
𝑜
𝑀𝑎1 = ( √ − 1)
𝑘−1 𝑃1

1,4
2 1,4−1 265,01
𝑀𝑎1 = ( √ − 1) = 6,7 (supersonic flow)
1,4 − 1 70

T1 = ?
Nilai T1 dapat ditentukan pula dengan persamaan, yaitu sebagai berikut
𝑘
𝑃1 𝑘−1
𝑇1 = 𝑇𝑜 √
𝑃0
1,4
1,4−1 70
𝑇1 = 399,6 𝐾 √ = 273,2 𝐾
265,01

d. V1 =?
Dengan mengasumsikan udara yang mengalir merupakan gas ideal, besar
kecepatan suara dalam udara ditentukan dengan persamaan, yaitu
1⁄
𝑘𝑅𝑇 2
𝐶=( )
𝑀
Di mana M udara = 29. Besarnya c kemudian digunakan untuk menentukan
kecepatan aliran udara dengan persamaan V1 = c Ma1, sehingga kecepatan
aliran adalah sebagai berikut
1
1 𝐽 2
𝑘𝑅𝑇 1,4 𝑥 287 𝑥 273,2 𝐾 𝑚
2 𝑘𝑔. 𝐾
𝑉1 = ( ) 𝑀𝑎1 → 𝑉1 = ( ) 6,7 = 412,21
𝑀 29 𝑠

e. A1 = ?
Dengan menggunakan bilangan Mach dan nilai k, besarnya luas penampang
A1 dapat ditentukan dengan persamaan, yaitu sebagai berikut
𝑘+1
𝑘
−1 2(𝑘−1)
𝐴𝑡ℎ 𝑀𝑎12 ( ) + 1
𝐴1 = ( )( 2 )
𝑀𝑎1 𝑘−1
2 +1

86 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
1,4+1
2 1,4 − 1 2(1,4−1)
0,05 𝑚2 6,7 ( 2 ) + 1
𝐴1 = ( )( ) = 4,29 𝑚2
6,7 1,4 − 1
2 +1

6. Diketahui:
• T = 250C
• P = 1 atm
• V∞ = 3 m/s
• Η = y/δ
• δ = tebal boundary layer
• V = 1,5 10-5 m2/s
Jawab;
V/ V∞ = 1,5η – 0,5η3 ρ = 1,23 kg/m3 x=1m

a. Rex =?
V∞ x 3𝑥1
𝑅𝑒𝑥 = = = 2 105
𝑉 1,5 10−5

b. δ =?
Tebal boundary layer dapat ditentukan dengan persamaan
𝑉𝑥 0,5 1,5 105
𝛿 ≈ 5( ) ≈ 5 0,5
V∞ 3

c. Shear stress dintentukan dengan persamaan yaitu


𝑑𝑉𝑥
𝜏=µ
𝑑𝑦
Nilai V = V∞ (1,5η – 0,5η3) dan µ = vp kemudian disubsitusi dalam
persamaan dan diperoleh
𝑑𝑉∞ (1,5𝜂 − 0,5𝜂3)
𝜏 = 𝑣𝑝
𝑑𝑦
𝑑 𝑦 𝑦3
𝜏 = 𝑣𝑝𝑉∞ (1,5 − 0,5 3 )
𝑑𝑦 𝛿 𝛿
𝑦 3𝑦 3
𝜏 = 𝑣𝑝𝑉∞ (1,5 − 0,5 3 )
𝛿 𝛿

87 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Pada dinding y = 0, sehingga diperoleh
1,5
𝜏 = 𝑣𝑝𝑉∞
𝛿
1,5 𝑘𝑔
𝜏 = 1,5 𝑥 10−5 𝑥 1,23 𝑥 3 𝑥 = 0,0075
0,011 𝑚 . 𝑠2

7. Kerjakan sendiri.

88 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2011 (1)

Hari, Tanggal : Rabu, 18 Mei 2011


Waktu : 105 Menit
Sifat Ujian :-
Dosen :-

1. High Velocity Gas Flow (35%). Udara mengalir secara isentropik melalui
converging nozzle yang menempel pada suatu tangka besar sebagai reservoir dengan
tekenan PR = 171 kPa dan temperature TR = 270C. Pada titik masuk nozzle (titik 1),
Mach number Ma1 = 0,2. Pada titik outlet nozzle (titik 2) ke atmosfir, luas penampang
A2 = 0,015 m2. Tekanan atmosfir Patm = 101 kPa. CP/CV udara = 1,4. Konstanta gas R
= 8317 m2.kg/(detik2.kmol.K). BM udara = 29. Dengan asumsi P2 = Patm, tentukan:
a. Mach number di titik 2, Ma2. Apakah aliran di titik 2 pada kondisi choking?
b. Temperatur di titik 2, T2 (dalam K)
c. Kecepatan di titk 2, V2 (dalam m/detik)
d. Densitas di titik 2, ρ2 (dalam kg/m3)
e. Laju alir massa, m (dalam kg/detik)
f. Temperatur di titik 1, T1 (dalam K)
g. Tekanan di tiik 1, P1 (dalam kPa)
h. Densitas di titik 1, ρ1 (dalam kg/m3)
i. Luas penampang di titik 1, A1 (dalam m2)
j. Gaya untuk menahan nozzle supaya tidak bergerak (dalam Newton). Gunakan
rumus: F = ρ1A1 – ρ2A2 + m(V1-V2). Arah gaya ke mana, ke kiri atau ke
kanan?

2. Boundary Layer (35%). Air mengalir pada 150C di atas suatu pelat datar pada
kecepatan free-strean (V∞) = 1,2 m/detik. Pelat punya panjang 0,3m dan lebar 2m.
Boundary layer pada setiap sisi (atas dan bawah) adalah laminar. Profil kecepatan
diasumsikan mempunyai bentuk umum V/V∞ = a + bƞ dimana ƞ = y/δ, yang
berkorespondensi dengan δ/x = 3,46/Rex0,5. Untuk air, viskositas kinematik v = 1,1

89 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
10-6 m2/detik; ρ= 1000 kg/m3.
a. Dengan menggunakan kondisi batas boundary layer di y = 0 dan y = δ, apa
formulasi V/V∞ sebagai fungsi y/δ (subsitusi konstanta a dan b dengan nilai
tertentu)?
b. Tentukan pada x = 0,3 m
1) Rex
2) δ (dalam m)
3) τw (dalam Newton/m2)

3. Drag Coefficient (30%). Sebuah bola ping pong beratnya 2,6 gram dan mempunyai
diameter 38 mm. Bola tersebut disembur jet udara dari bagian bawahnya sehingga
bolat tersebut mengambang di udara pada posisi tetap. Densitas udara = 1,225 kg/m3,
viskositas udara µ = 1,78 10-5 kg/(m.detik), dan g = 9,81 m/detik2. Dengan asumsi
berat bola = gaya gesek, tentukan:
a. Berat Bola, W (dalam Newton).
b. Dengan asumsi aliran sekitar bola adalah aliran Newton (see lecture’s slide),
tentukan koefisien gaya gesek, CD, dan Reynold number pada bola Re.
c. Kecepatan jet udara (dalam m/detik).
d. Cek apakah Re memenuhi kategori aliran Newton.

90 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS MEKANIKA FLUIDA 2011 (1)

Asisten Dosen : Kanya Citta Hani Alifia


Jurusan, Angkatan : Teknologi Bioproses 2015

1. –
2.
a.) Dengan menggunakan kondisi batas pada boundary layer di y=0 dan y= 𝛿, apa
formulasi V/V∞, sebagai fungsi y/ 𝛿 (substitusi konstanta a dan b dengan nilai
tertentu)?
➢ Menggunakan persamaan Blasius untuk pelat datar aliran laminar.

𝑢 𝑉𝑥
= = 𝑓(𝜂) = 𝑎 + 𝑏𝜂
𝑈 𝑉∞
0,5
𝑚
1,2 𝑠 1 0,5
𝑓(𝜂) = 𝑦 ( ) . ( )
10−6 𝑚2 𝑥
1,1. 𝑠
𝑦
𝑓(𝜂) = 1044,46 . 0,5 = 𝑎 + (1044,46√𝑥)𝜂
𝑥
➢ Meninjau kondisi batas pada boundary layer

• Kondisi batas y = 0 → 𝜂 = 0
𝑉𝑥
= 𝑓(𝜂) = 𝑎 + (1044,46√𝑥)𝜂
𝑉∞
𝑉𝑥
= 𝑎 → nilai a
1,2 𝑚/𝑠
• Kondisi batas y = δ → 𝜂 = 1
𝑉𝑥
= 𝑓(𝜂) = 𝑎 + (1044,46√𝑥)𝜂
𝑉∞
𝑉𝑥 𝑉𝑥
= + (1044,46√𝑥)
𝑉∞ 1,2
(1044,46√𝑥) = 𝑏 → Nilai b

b.) Tentukan pada x = 0.3 meter

91 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
➢ Rex
𝛿 3,46
= 0,5
𝑥 𝑅𝑒

𝑚
𝐿 1,2 𝑠 . 0,3 𝑚
𝑅𝑒 = 𝑈. = = 𝟑𝟐𝟕. 𝟐𝟕𝟐, 𝟕𝟑
𝑣 1,1. 10−6 𝑚2 /𝑠

➢ 𝛿 (dalam m)
𝛿 3,46
= → 𝛿 = 𝟏, 𝟖𝟏𝟒𝟒 . 𝟏𝟎−𝟑 𝒎
0,3 𝑚 327.272,730,5

➢ 𝜏w (dalam Newton/m2)
𝑚 0,5
1,2
−3 𝑠
𝜏𝑤 (𝑥) = 0,332 (1,1375 . 10 ).(1,2 m/s).( 10 𝑚2
−6 ) = 0,8642 N/m2
1,1. .0,3 𝑚
𝑠
3.
a.) Berat bola, W (dalam Newton)
𝑚
𝑤 = 𝑚. 𝑔 = (2,6. 10−3 𝑘𝑔) (9,81 ) = 𝟎, 𝟎𝟐𝟓𝟓 𝑵 → 𝑏𝑒𝑟𝑎𝑡 𝑠𝑎𝑚𝑎 𝑑𝑒𝑛𝑔𝑎𝑛 𝑔𝑎𝑦𝑎 𝑔𝑒𝑠𝑒𝑘
𝑠2
b.) Dengan asumsi aliran sekitar bola adalah aliran Newton (see lecture's slide),
tentukan koefisien gaya gesek, CD dan Reynold number pada bola, Re
c.) Kecepatan jet udara (dalam m/detik)
➢ Dalam aturan aliran Newton, nilai R’/ρu2 konstan dan diasumsikan sama dengan
0,22
𝑅′
𝐶𝐷 = 2 2 = 2(0,22) = 𝟎, 𝟒𝟒
𝜌𝑢

𝐹 0,0255𝑁
𝑅′ = = = 22,496 𝑁/𝑚2
(0,25)𝜋𝑑2 0,25(3,14)((38. 10−3 𝑚)2 )

𝑅′ 22,496 𝑁/𝑚2
= = 0,22
𝜌𝑢2 𝑘𝑔 2
1,225 3 (𝑢 )
𝑚
22,496
𝑢=√ = 𝟗, 𝟏𝟑𝟔𝟒 𝒎/𝒔
1,225(0,22)
➢ Substitusi nilai u ke persamaan Re.
𝜌. 𝑑. 𝑢 (1,225)(38. 10−3 )(9,1364)
𝑅𝑒 = = = 𝟐𝟑. 𝟖𝟗𝟑, 𝟐𝟑
𝜇 1,78. 10−5
d.) Cek apakah Re memenuhi kategori aliran Newton.
➔ Syarat aliran Newton adalah 500-1000 < Re < 200.000 sehingga bilangan Reynold
aliran memenuhi kategori aliran Newton.

92 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2011 (2)

Hari, Tanggal : Selasa, 24 Mei 2011


Waktu : 105 Menit
Sifat Ujian :-
Dosen :-

1. High Velocity Gas Flow (35%). Udara mengalir secara steady state dan secara
isentropic dalam nosel konvergen-divergen sebagai berikut.

Pada throat (kerongkongan), udara pada tekanan, Pth = 140 kPa (abs) dan
temperature, Tth = 600C. Luas penampang throat Ath = 0,05 m2. Pada posisi 1 dibagian
divergen, tekanan P1 = 70 kPa (abs). CP/CV = 1,4; konstanta gas R = 8317
m2.kg/(detik2.kmol.K). BM udara= 29. Titik R dianggap posisi reservoir. Tentukan:
a. Berapa Mach number di throat (Math)? Berikan penjelasan untuk menyokong
jawabn tersebut.
b. Tekanan di reservoir PR (kPa)
c. Temperatur di reservoir TR (dalam Kelvin)
d. Kecepatan di kerongkongan Vth (dalam m/detik)
e. Mach number di titik 1 Ma1
f. Temperatur di titik1 T1 (dalam Kelvin)
g. Kecepatan di titik 1 V1 (dalam m/detik)
h. Luas penampang di titik 1 A1 (dalam m2)

93 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
2. Boundary Layer (30%). Udara pada kondisi 250C, 1 atm mengalir melalui pelat
dengan kecepatan free-stream (V∞) = 3 m/detik. Profil kecepatan pada boundary
layer laminar memenuhi persamaan V/V∞ = 3/2 ƞ – ½ ƞ3, dimana ƞ = y/δ dan δ =
tebal boundary layer, pada sembarang jarak x dari ujung depan pelat dan δ/x =
4,64/Rex0,5. Untuk udara, viskositas kinematik v = 1,5 10-5 m2/detik; ρ = 1,23 kg/m3.
Tentukan pada x = 1 meter:
a. Rex
b. δ (dalam m)
c. τw (dalam Newton/m2)

3. Drag Coefficient (35%). A sphere 1.5 mm diameter falls in water in its terminal
velocity (Ut). The density of sphere is 2500 kg/m3. The density and dynamic viscosity
pof water (ρ and µ) are 997 kg/m3 and 0.89 10-3 Ns/m2 respectively. The drag
coefficient is given by the formula CD= 24(1+0.15 Re0.687)/Re.
a. Calculate pairs of Re vs CD.Re2 using formula of CD above at Re = 100; 200;
300; 400 & 500 (for general case).
b. Formulate force balance by keeping the presence of variavle CD in the
balance.
c. Calculate CDRe2 (dimensionless) directly using force balance in point b for
this sphere case (no variable Ut involved in the calculation).
d. By interpolation using data in point a; calculate Re for this sphere case, which
corresponds to CDRe2 calculated in point c.
e. Calculate Ut (in m/sec).

94 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2012

Hari, Tanggal : Kamis, 31 Mei 2012


Waktu : 110 Menit
Sifat Ujian :-
Dosen :-

1. High Velocity Gas Flow. Udara mengalir secara tunak steady dan isentropic melalui
converging-diverging nozzle. Pada kerongkongan nozzle, tekanan Pth= 140 kPa (abs)
dan temperature Tth = 600C. Luas penampang kerongkongan = 0,05 m2. Pada suatu
posisi di diverging section, tekanan P1= 70 kPa (bs). CP/CV udara = 1,4. Konstanta
udara = 287 Pa/(K.kg/m3). Tentukan:
a. Mach number di kerongkongan, Math. Apakah alasan jawaban tersebut?
b. Tekanan di reservoir P0 (dalam kPa)
c. Temperatur di reservoir T0 (dalam K)
d. Kecepatan di kerongkongan Vth (dalam m/detik)
e. Mach number di titik 1, Ma1
f. Temperatur di titik 1, T1 (dalam K)
g. Kecepatan di titik 1, V1 (dalam m/detik)
h. Luas penampang di titik1, A1 (dalam m2)

2. Boundary Layer. Distribusi kecepatan pada lapisan batas laminar (laminar boundary

95 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
layer) di atas pelat datas mengikuti persamaan berikut; Vx/V∞= a + by + cy2.
Ketebalan boundary layer = δ
a. Berapa nilai Vx pada y= 0 dan berapa nilai a?
b. Berapa nila dVx/dy pada y= δ dan apa alasannya?
c. Berapa nilai Vx pada y=δ dan apa alasannya?
d. Berapa nilai b dan c?
e. Apa formulasi Vx/V∞ sebagai fungsi ƞ dimana ƞ= y/δ sebagai hasil jawaban a
hingga d di atas?
f. Apa nilai τw?
g. Apa nilai δ jika pada x = 0, δ = 0. Pecahkan dengan persamaan integral
1
momentum τw = ρ V∞2 dδ/dx ∫0 𝑉𝑥 /𝑉∞ (1 − 𝑉𝑥 /𝑉∞ ) 𝑑ƞ.

3. Motion of Particles in Fluid. A cyclone separator is used to remove sand grains


from an airstream at 1500C. the cyclone body has diameter of 0.6 m and the average
tangential velocity near the wall is 16 m/s. Density of grains= 2196 kg/m3. Gravity
acceleration= 9.8066 m/sec2. At 1500C, density of air= 0.836 kg/m3 and dynamic
viscosity= 0.23 10-3 kg/(m.sec).
a. What is the rate of grain rotation near the wall of the cyclone (in radian/sec)?
b. What is the centrifugal acceleration near the wall (rω2) (in m/sec2)?
c. What is the terminal velocity near the wall of grains of 40 µm diameter (in
m/sec)? Check with Galileo number to obtain correct value of Re0.
d. How much is the drag coefficient and Reynolds number of grains?
e. What is the terminal velocity of grains of 40 µm diameter if the grains are
under gravity acceleration (in m/sec)? How much greater is the terminal
velocity under influence of centrifugal compared to that under gravity
acceleration?

96 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS MEKANIKA FLUIDA 2012

Asisten Dosen :-
Jurusan, Angkatan :-

1.
a. Mth= 1, karena kecepatan di kerongkongan mendekati kecepatan suara.

b.
𝐾⁄
𝑃𝑅 2
𝑘−1 𝐾−1
= (𝑀𝑡ℎ + 1)
𝑃𝑡ℎ 2
1,4⁄
𝑃𝑅 1,4 − 1 0,4
= (12 + 1)
140 2
𝑃𝑅 = 265,01 𝑘𝑃𝑎

𝑇𝑅 2 𝑘−1
c. = 𝑀𝑡ℎ +1
𝑇𝑡ℎ 2

𝑇𝑅 1,4 − 1
= 12 +1
333 2
𝑇𝑅 = 399,6 𝐾

d.
𝑉 = 𝑀𝑐
𝑚 𝑚
𝑉 = 1 . 400,7 = 400,7
𝑠 𝑠

e.
1,4⁄
265,01 1,4 − 1 0,4
= (𝑀12 + 1)
70 2
𝑀1 = 1,52

𝑇𝑅 𝑘−1 399,6 1,4−1


f. = 𝑀12 +1→ = 1,522 +1
𝑇1 2 𝑇1 2

97 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
𝑇1 = 273,31 𝐾

g.
𝑉 = 𝑀𝑐
𝑚 𝑚
𝑉 = 1,52 . 331,8 = 503,7
𝑠 𝑠

h. Mth = M1
𝜌𝑡ℎ 𝐴𝑡ℎ 𝑉𝑡ℎ = 𝜌1 𝐴1 𝑉1
𝜌𝑡ℎ 𝑉𝑡ℎ
𝐴1 = 𝐴
𝜌1 𝑉1 𝑡ℎ
1⁄
𝑘−1 𝑘−1
(𝑀12
𝐴1 = 2 + 1) 400,7
0,05
1⁄
𝑘−1 𝑘−1 503,7
2
(𝑀𝑡ℎ 2 + 1)
1,522 0,2 + 1 400,7
𝐴1 = ( ) 0,05
12 0,2 + 1 503,7
𝐴1 = 0,065 𝑚2

2. Vx/V∞ = a + by + cy2
a. Pada 𝑦 = 0; 𝑉𝑥 = 0
0
=𝑎+0+0 → 𝑎 =0
𝑉∞

b. Pada 𝑦 = 𝛿; 𝑑𝑣/𝑑𝑦 = 0 karena sudah tidak terjadi perubahan kecepatan.

𝑑𝑉𝑥
c. Pada 𝑦 = 𝛿; 𝑉𝑥 = 𝑉∞ pada 𝑦 = 𝛿; =0
𝑑𝑦

d. 1 = 𝑏𝛿 + 𝑐𝛿 2 → 𝑏𝛿 + 𝑐𝛿 2 − 1 = 0 → 𝑐𝛿 2 − 2𝑐𝛿 2 − 1 = 0
1
𝑐(𝛿 2 − 2𝛿 2 ) − 1 = 0 → 𝑐 = −
𝛿2
𝑏 + 2𝑐𝑦 = 0 → 𝑏 + 2𝑐𝛿 = 0 → 𝑏 = −2𝑐𝛿
1 2
𝑏 = −2 (− 2
)𝛿 → 𝑏 =
𝛿 𝛿

98 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝑉𝑥
e. = 𝑎 + 𝑏𝑦 + 𝑐𝑦 2
𝑉2

𝑉𝑥 2 1
= 0 + 𝑦 + 2 𝑦2
𝑉2 𝛿 𝛿
𝑉𝑥
= 2ƞ − ƞ2
𝑉2

f. 𝜏𝑤 = τ di dinding (pada y= 0)
µ 𝑑𝑣𝑥 2
𝜏𝑤 = = µ(𝑏 + 2𝑐𝑦) = µ ( + 0)
𝑑𝑦 𝛿

𝜏𝑤 = µ
𝛿

g. Tidak dikerjakan

3. Asdas
𝑚
𝑉 16 𝑟𝑎𝑑
𝑠
a. 𝜔 = = 0,3 𝑚 = 53,3
𝑟 𝑠

𝑚
b. 𝑐𝑒𝑛𝑡𝑟𝑖𝑓𝑢𝑔𝑎𝑙 𝑎𝑐𝑐𝑒𝑙𝑟𝑎𝑡𝑖𝑜𝑛 = 𝑟𝜔2 = 0,3 53,32 = 853,3
𝑠2

𝑅0′ 2 2𝑑3 (𝜌𝑠 −𝜌)𝜌𝑟𝜔 2


c. 𝑅𝑒0′ 2 = 3 𝐺𝑎 =
𝜌𝑈02 3µ2

2(4 10−5 )3 (2196 − 0,836) 0,836 . 853,3


= = 1,263 102
3(0,023 10−3 )2
𝐺𝑎 = 1,895 102 (𝑘𝑎𝑟𝑒𝑛𝑎 𝑎𝑑𝑎 𝑝𝑎𝑑𝑎 𝑟𝑎𝑛𝑔𝑒 3,6 < 𝐺𝑎 < 105 ) maka
𝐺𝑎 = 18𝑅𝑒0′ + 2,7𝑅𝑒0′ 1,687
1,687
𝑈0 4 10−5 0,836 5
1,687 4 10 0,836
189,5 = 18 + 2,7𝑈0 ( )
0,023 10−3 0,023 10−3
189,5 = 26,1𝑈0 + 5,05 𝑈01,687
➢ Trial U0= 3,5
5,05 𝑈01,687 + 26,1𝑈0 − 189,5 = −56
➢ Trial U0= 5
5,05 𝑈01,687 + 26,1𝑈0 − 189,5 = 17,29
𝑈0 − 3,5 0 − (−56) 𝑚
= → 𝑈0 = 4,65
5 − 3,5 17,29 − (−56) 𝑠

99 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
d. Drag coef. & Re0
𝑈0 𝑑 𝑒 4,65 4 10−5 0,836
𝑅𝑒0′ = = = 6,76
µ 0,023 10−3
𝑅0′ ′2 2
𝑅0′ 1,895 102
𝑅𝑒 = 1,895 10 → = = 28,03
𝜌𝑈02 0 𝜌𝑈02 6,76
𝑅0′ 𝑅0′
𝐶𝐷 = =2 = 56,06
1 2 𝜌𝑉02
2 𝜌𝑉0

e. Gravity
𝑅0′ ′2
2𝑑3 (𝜌𝑠 − 𝜌)𝜌𝑔
𝑅𝑒 = = 1,45
𝜌𝑈02 0 3µ2
𝑅′
Dari grafik 𝜌𝑈02 𝑅𝑒0′ 2 vs 𝑅𝑒0′ 𝑅𝑒0′ = 0,3
0

𝑈0 𝜌𝑑 0,836 𝑈0 4 10−5 𝑚
𝑅𝑒0′ = → 0,3 = −3
→ 𝑈0 = 0,206
µ 0,023 10 𝑠
𝑈0 1 4,65
= = 22,54 𝑙𝑒𝑏𝑖ℎ 𝑏𝑒𝑠𝑎𝑟
𝑈0 2 0,206

100 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2013 (1)

Hari, Tanggal : 28 Mei 2013


Waktu : 105 Menit
Sifat Ujian : Open Book
Dosen :-

Catatan: semua peralatan elektronik kecuali kalkulator tidak diperkenankan dipakai selama
UAS

No 1. Boundary layer
Suatu terowongan angin (wind tunnel) yang digunakan dalam percobaan mekanika fluida
mempunyai penampang empat persegi panjang sama sisi 0,4 x 0,4 m. Pada kecepatan udara
U1 = 24,4 m/detik di suatu lokasi di wind tunnel (lokasi 1), pengukuran boundary layer
menunjukkan ketebalan 𝛿 1 = 9,75mm dan mempunyai profil kecepatan turbulen berpangkat
1/7. Gradien tekanan pada lokasi 1, dp/dx = -0.035 mm H2O/mm. Densitas udara = 1,23
kg/m3 dan air = 999 kg/m3. Tentukan:
a. Pengurangan luas penampang efektif (didasarkan pada 𝛿*) dibanding luas penampang
di ujung depan wind tunnel, (%).
b. Kecepatan perubahan ketebalan momentum boundary layer, d𝜃/dx, di lokasi 1,
(m/detik)
c. Kecepatan perubahan ketebalan momentum boundary layer, d𝜃/dx, di lokasi 2 (di
ujung belakang wind tunnel) di mana x = 254 mm, (m/detik).
d. Lokasi manakah yang mempunyai drag force lokal yang lebih kecil, di lokasi 1 atau
2?
e. Kenaikan kecepatan aliran utama, dU/dx, di lokasi 1.

No 2. Fluidised bed and entrainment


3.6 kg unggun partikel padat dengan densitas partikel 2590 kg/m3 dan ukuran rata-rata
partikel 748 mikron membentuk unggun diam pada bejana berbentuk silinder dengan
ketinggian unggun 0.475m dalam bejana dengan diameter 0.0757 m. Air dengan densitas

101 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
1000 kg/m3 dan viskositas 0.001 Pa.s dilalukan secara vertikal ke atas melalui unggun.
Hitunglah
a. Porositas unggun, yang dihitung menggunakan data di atas.
b. Perbedaan tekanan unggun pada awal fluidisasi, (Newton/m2).
c. Kecepatan superfisial air pada awal fluidisasi (m/detik)
d. Porositas unggun pada kecepatan superfisial air 1,5 cm/detik
e. Ketinggian unggun pada kecepatan superfisial air 1,5 cm/detik, (m)
f. Kecepatan superfisial air pada awal entrainment partikel, (m/sec)

Tabel 3.4 Values of log Re’ as a function of Log [(R' / ρu2) Re’2] for spherical particles
Log [(R' / ρu2)
Re’2] 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9
2 3,62 3,72 3,819
1 3,919 2,018 2,117 2,216 2.315 2.414 2,513 2,612 2,711 2,810
0 2,908 1,007 1,105 1,203 1.301 1,398 1,495 1,591 1,686 1,781
1 1,874 1,967 0,008 0,148 0,236 0,324 0,410 0,495 0,577 0,659
2 0,738 0,817 0,895 0,972 1,048 1.124 1,199 1,273 1,346 1,419
3 1,491 1,562 1,632 1,702 1,771 1,839 1,907 1,974 2,040 2,106
4 2,171 2,236 2,300 2,363 2,425 2,487 2,548 2,608 2,667 2,725
5 2,783 2,841 2,899 2,956 3,013 3,070 3,127 3,183 3,239 3,295

102 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
103 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS MEKANIKA FLUIDA 2013 (2)

Hari, Tanggal : Kamis, 30 Mei 2013


Waktu : 105 Menit
Sifat Ujian : Open Book
Dosen :-

1. Boundary layer
Pengamatan dilakukan terhadap boundary layer laminar pada sebuah pelat datar.
Diasumsikan bahwa profil kecepatan di boundary layer mengikuti persamaan
sinusoidal, u/U = sin (π/2.y/δ) dimana nilau U konstan. Tentukan :
a. Korelasi antara τw dan dδ/dx. Gunakan persamaan integral momentum yang
melibatkan τw
b. Ketebalan boundary layer, δ sebagai fungsi dari x
c. Ketebalan perpindahan (displacement thickness), δ* sebagai fungsi x
d. Secara konseptual, displacement thickness menunjukkan besaran apa dalam kaitan
dengan perpindahan massa dari lairan fluida utama ke boundary layer jika kita
mengamati boundary layer pada jarak x dari ujung depan pelat?
e. Gaya friksi total pada pelat yang panjangnya L dan lebarnya b sebagai fungsi ReL

2. Particle separation by cyclone


Suatu separator siklon digunakan untuk memisahkan butiran-butiran pasir dari aliran
udara pada temperatur 1500 C. Densitas butiran pasir = 2196 kg/m3. Densitas dan
viskositas udara masing-masing 0,836 kg/m3 dan 0,023 x 10-3 kg/(m.det.). kalau
siklon mempunyai diameter 0,6 m dan kecepatan tangensial rata-rata udara dekat
dinding dalam siklon 16 m/detik, tentukan
a. Kecepatan rotasi udara dekat dinding siklon, (radian/ detik)

b. Kecepatan terminal relatif (relatif terhadap kecepatan udara) dan yang


sebenarnya (relatif terhadap dinding diam siklon) pada partikel yang berukuran

104 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
40 mikron dekat dinding dalam siklon, (m/detik). Cek dengan Galileo number
untuk memperoleh Re’.
c. Kecepatan tangensial udara pada lintasan ½ jari-jari siklon, (m/detik)
d. Kecepatan terminal relatif dan sebenarnya pada partikel yang berukuran 40
mikron pada lintasan berjarak ½ jari-jari siklon (m/detik)
e. Apakah partikel yang berukuran 40 mikron mengalami percepatan atau
perlambatan saat bergerak dari lintasan yang berjarak ½ jari-jari siklon ke dinding
siklon?
Tabel 3.4 Values of log Re’ as a function of log (( R’/ρu2) Re’2)

105 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
106 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2014

Hari, Tanggal : Kamis, 12 Juni 2014


Waktu : 60 menit
Sifat Ujian : Buka Buku Coulson Bab 4 dan 6
Dosen :-

Unggun Diam (fixed bed) dari sejumlah partikel dengan sphericity = 1 terletak di dalam
kolom dengan diameter kolom 0,1m dan ketinggian unggun 0,5m. Fluida air dialirkan ke atas
melalui unggun. Data partikel : berat unggun = 7,8688 kg; densitas partikel = 3200 kg/m 3 dan
diameter partikel = 750 mikron. Data air : densitas = 1000 kg/m3 dan viskositas = 0,001 Pa.s.
Kecepatan superfisial air = 0,001 m/detik. Percepatan gravitasi = 9,8 m/detik3. Jika
diperlukan, gunakanlah tabel yang telah disediakan di bawah ini.

1. a.) Hitunglah pororsitas unggun diam


b.) Hitunglah volume partikel dalam unggun (m3)
c.) Hitunglah specific surface area S (m2/m3)
d.) Hitunglah Permeabilitas unggun diam B (dalam m2) dengan menggunakan
konstanta Kozeny Kn = 5
e.) Hitunglah penurunan tekanan (pressure drop) unggun diam (dalam Pa)

2. a.) Jika partikel terfluidisasi, hitunglah penurunan tekanan unggun (dalam Pa)
b.) Hitunglah permeabilitas unggun pada fluidisasi minimum (m2) jika porositas
unggun = 0,414
c.) Hitunglah ketinggian unggun pada fluidisasi minimum (m)
d.) Hitunglah kecepatan superficial (m/detik) pada fluidisasi minimum dengan
persamaan Carman-Kozeny
e.) Cek keberlakuan penggunaan persamaan Carman-Kozeny pada jawaban 2d

107 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
f.) Hitunglah bilangan Galileo

3. Perkirakanlah terminal velocity untuk partikel berukuran 80-100 mesh dari batu kapur (ρp
= 2800 kg/m3) yang jatuh ke dalam air pada 30oC. Dari handbook diperoleh data bahwa
diameter partikel untuk 100 mesh = 0,147 mm dan diameter partikel untuk 80 mesh = 0,175
mm. Viskositas = 0,801 Cp dan ρ = 995,7 kg/m3.

108 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS MEKANIKA FLUIDA 2014

Asisten Dosen : Batara Triargi


Jurusan, Angkatan : Teknik Kimia, 2015

3. Diketahui
• Diameter A : 0.147 mm
• Diameter B : 0.175 mm
• 𝜌𝑠 : 2800 kg/m3
• 𝜌 : 995.647 kg/m3
• 𝜇 : 803.4 . 10-6 Ns/m2
• G : 9.8 m/s2

Algoritma pengerjaan:
2
• Menghitung nilai dari 3 𝐺𝑎
• Mencari Log dari nilai yang sudah di dapat
• Menggunakan tabel 3.4 untuk mendapatkan nilai Re0’
• Mencari nilai u0
Rumus yang digunakan:
2 𝑅0 ′ 2
𝐺𝑎 = 2
𝑅𝑒′0
3 𝜌𝑢0
2 𝑑3 𝜌(𝜌𝑠 − 𝜌)𝑔
𝐺𝑎 =
3 𝜇2
Perhitungan:

Ukuran 80 mesh Ukuran 100 mesh

2 𝑑3 𝜌(𝜌𝑠 − 𝜌)𝑔 2 𝑑3 𝜌(𝜌𝑠 − 𝜌)𝑔


𝐺𝑎 = 𝐺𝑎 =
3 𝜇2 3 𝜇2
2 2
𝐺𝑎 = 57.7630 𝐺𝑎 = 97.4568
3 3
2 2
log 𝐺𝑎 = 1.7616 log 𝐺𝑎 = 1.9888
3 3
Menggunakan tabel 3.4 Menggunakan tabel 3.4

log 𝑅𝑒′0 = 0.544 log 𝑅𝑒′0 = 0.722

109 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
𝑅𝑒′0 = 3.499 𝑅𝑒′0 = 5.272

3.499 𝑥 803.4. 10−6 5.272 𝑥 803.4. 10−6


𝑢𝑜 = = 0.6829 𝑥 10−2 𝑚/𝑠 𝑢𝑜 = = 0.8643𝑥 10−2 𝑚/𝑠
1.47. 10−4 . 2800 1.75. 10−4 . 2800

110 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2015 (1)

Hari, Tanggal : Selasa, 31 Maret 2015


Waktu : 100 Menit
Sifat Ujian :-
Dosen :-

1. Boundary layer
Udara dengan densitas 1,23 kg/m3 dan viskositas kinematik 2,5 x 10-4 m2/s, masuk ke
saluran pipa horizontal (radius 0,25 m) dengan kecepatan rata-rata 0,35 m/det. Pada
titik amsuk (titik 1) diasumsikan profil kecepatan seragam. Tetapi, sepanjang pipa
terbentuk laminar boundary layer di dinding pipa.
a. Kalau boundary layer dalam pipa diperlakukan seperti pada pelat datar dan
bahwa pada jarak 20 m dari titik 1 (yaitu titik 2), kecepatan udara dianggap
mendekati 0,35 m/detik, hitunglah bilangan Reynolds di titik 2.
b. Hitunglah displacement thickness di titik 2 (dalam m) dengan rumus Blasius.
c. Adanya displacement thickness menunjukkan bahwa kecepatan di luar
boundary layer tidak sama dengan 0,35 m/detik. Hitunglah menurut neraca
massa kecepatan udara sebenarnya di aliran utama di titik 2 (m/detik).
d. Hitunglah perbedaan tekanan antara titik 1 dan 2 (dalam Newton/m2).

2. Motion of particles in fluid


Dalam centrifuge tipe kontinyu, suatu suspense partikel dipisahkan partikel-
partikelnya yang mempunyai diameter 10 mikron atau lebih dengan kecepatan cairan
di dinding 15 m/detik. Diameter centrifuge 0,5 m. Densitas partikel dan cairan
masing-masing 2800 dan 1000 kg/m3 dan viskositas cairan 10-3 Pa.sec.
a. Hitunglah kecepatan angular partikel 10 mikron partikel pada dinding
(rad/detik).
b. Dengan asumsi Stoke’s law berlaku, hitunglah kecepatan terminal partikel-
partikel 10 mikron dalam medan gravitasi (m/det). Cek apakah asumsi benar.
c. Dengan asumsi Stoke’s law berlaku, hitunglah kecepatan terminal partikel 10

111 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
mikron dalam medan sentrifugal di dinding (m/det). Cek apakah asumsi benar.
d. Hitunglah waktu yang dibutuhkan partikel 10 mikron yang bergerak dari
radius 0,05 ke 0,25 m di centrifuge (detik).
e. Berapa kali waktunya jika pemisahan dilakukan di medan gravitasi pada jarak
yang sama (0,2 m)?

3. Fixed bed and fluidized bed


Partikel-partikel sejumlah 15 ton dengan densitas 1505 kg/m3 hendak difluidisasi
dengan udara pada tekanan absolut 1,36 atm dan 450°C dalam suatu bejana
berdiameter 3 m. Densitas udara = 0,487 kg/m3 dan viskositasnya = 3,43 x 10-5
kg/(m.sec). Diameter rata-rata partikel 200 mikron mengisi bejana setinggi 2,2 m.
Percepatan gravitasi = 9,8 m/detik2.
a. Hitunglah porositas unggun diam, ε, berdasarkan data partikel dan bejana.
b. Hitunglah kecepatan terminal partikel (m/det) dan Re pada kecepatan tersebut.
c. Hitunglah nilai eksponen n pada persamaan Richardson-Zaki.
d. Hitunglah kecepatan superfisial udara pada fluidisasi minimum yang
diestimasi oleh persamaan Leva di bawah (m/detik).
e. Hitunglah ε pada fluidisasi minimum. Berapa besar % kenaikan ε dari kondisi
unggun diam ke kondisi fluidisasi minimum?

112 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS MEKANIKA FLUIDA 2015 (1)

Asisten Dosen : Julianto Gautama


Jurusan, Angkatan : Teknik Kimia 2013

1. Diketahui:
• 𝜌 = 1.23 𝑘𝑔⁄𝑚3
𝜇
• = 2.5 𝑥 10−6 𝑚2 ⁄𝑠
𝜌

• 𝑟 = 0.25 𝑚
• 𝑢 = 0.35 𝑚/𝑠

Ditanya:
a. Reynolds saat L = 20 m
b. Displacement thickness Blasius
c. U real
d. ∆P

Jawab:
a. Reynolds saat L = 20 m
𝒎
𝒖𝑳 𝟎. 𝟑𝟓 𝒔 𝒙 𝟐𝟎 𝒎
𝑹 𝒆𝒍 = = = 𝟐. 𝟖 𝒙 𝟏𝟎𝟔
𝜸 𝟐. 𝟓 𝒙 𝟏𝟎−𝟔 𝒎𝟐 ⁄𝒔

b. Displacement thickness Blasius


𝜹 𝟓. 𝟎
= = 𝟐. 𝟗𝟖 𝒙 𝟏𝟎−𝟑
𝒙 𝑹𝟎.𝟓
𝒆

𝛿 = 2.98𝑥10−3 . 20 𝑚 = 0.06 𝑚
𝛿 ∗ 1.721
= 0.5 = 1.025 𝑥 10−3
𝑥 𝑅𝑒
𝛿 ∗ = 1.025 𝑥10−3 . 20 𝑚 = 0.02 𝑚

113 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
c. U real
𝐾𝑜𝑛𝑡𝑢𝑖𝑛𝑖𝑢𝑖𝑡𝑎𝑠
𝑄1 = 𝑄2
𝐴1 𝑢1 0.252 . 3.5
𝑈 𝑟𝑒𝑎𝑙 = = = 4.96 𝑚/𝑠
𝐴2 (0.25 − 2𝑥0.02)2

d. ∆P
∆𝑃 ∆𝑣 2
+ =0
𝜌 2
∆𝑃 (4.1352 − 3.52 )
+ =0
1.23 2
∆𝑃 = 2.98 𝑃𝑎

2. Diketahui:
• 𝐷𝑃 = 10𝜇𝑚
𝑚
• 𝑢 = 15 𝑠

• 𝐷 = 0.5 𝑚
𝑘𝑔
• 𝜌𝑠 = 2800
𝑚3
𝑘𝑔
• 𝜌𝐿 = 1000 𝑚3

• 𝜇 = 10−3 𝑃𝑎. 𝑠

Ditanya:
a. U angular
b. U terminal (Stokes) gravitasi
c. U terminal (Stokes) percepatan sentrifugal 𝑡0.05→0.25𝑚
d. Rasio perbedaan t untuk penggunaan gravitasi dan sentrifuge pada jarak
perpindahan sebesar 0,2 m.

Jawab:
a. U angular
𝑢 15 𝑟𝑎𝑑
𝑈 𝑎𝑛𝑔𝑢𝑙𝑎𝑟 = = = 60
𝑟 0.25 𝑠

114 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
b. U terminal (Stokes) gravitasi
𝑑𝐴2 𝑔
𝑢0𝐴 = (𝜌 − 𝜌)
18𝜇 𝐴
𝑑𝑝2 𝑔
𝑢0 = (𝑝 − 𝑝𝑙 )
18𝜇 𝑠
9.8𝑚
10𝑥10−6 𝑚 .
= 𝑠 2 (2800 − 1000) 𝑘𝑔⁄𝑚3
−3
18.10 𝑃𝑎. 𝑠
= 9.8 𝑚/𝑠

c. U terminal (Stokes) percepatan sentrifugal 𝑡0.05→0.25𝑚


2
𝑑𝑝2 𝑈𝑎𝑛𝑔𝑢𝑙𝑎𝑟 .𝑟
𝑢0 = (𝑝𝑠 − 𝑝𝑙 )
18𝜇
𝑟𝑎𝑑 2
10𝑥10−6 𝑚 . (60 𝑠 ) . 0.25
= (2800 − 1000) 𝑘𝑔⁄𝑚3
18.10−3 𝑃𝑎. 𝑠
= 90 𝑚/𝑠

d. Rasio perbedaan t untuk penggunaan gravitasi dan sentrifuge pada jarak


perpindahan sebesar 0,2 m.
𝑠 0.25 − 0.02
(𝐶𝑒𝑛𝑡𝑟𝑖𝑓𝑢𝑔𝑒)𝑡0.02→0.25 𝑚 = = = 2 𝑥 10−3 𝑠
𝑢𝑜 90𝑚
𝑠
𝑠 0.25 − 0.02
(𝐺𝑟𝑎𝑣𝑖𝑡𝑎𝑠𝑖)𝑡0.02→0.25 𝑚 = = = 2.3 𝑥 10−2 𝑠
𝑢𝑜 9.8𝑚
𝑠
2.3 𝑥 10−2 𝑠
𝑅𝑎𝑠𝑖𝑜 = = 11.5 𝑘𝑎𝑙𝑖 𝑙𝑒𝑏𝑖ℎ 𝑐𝑒𝑝𝑎𝑡 𝑚𝑒𝑛𝑔𝑔𝑢𝑛𝑎𝑘𝑎𝑛 𝑐𝑒𝑛𝑡𝑟𝑖𝑓𝑢𝑔𝑒
2 𝑥 10−3 𝑠

3. Diketahui:
• 𝑚𝑆 = 15 𝑡𝑜𝑛
𝑘𝑔
• 𝜌𝑠 = 1505 𝑚3

• 𝑃𝑎𝑏𝑠 = 1.36 𝑎𝑡𝑚 𝑇𝑢𝑑𝑎𝑟𝑎 = 450 𝐶


• 𝐷 =3𝑚
𝑘𝑔
• 𝜌𝑢𝑑𝑎𝑟𝑎 = 0.487 𝑚3
10−5 𝑘𝑔
• 𝜇 = 3.43 𝑥 𝑚.𝑠

115 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
• 𝐷𝑃 = 200 𝜇𝑚
• 𝐻 = 2.2 𝑚
𝑚
• 𝑔 = 9.8 𝑠2

Ditanya:
a. Porositas unggun
b. U terminal dan Re
c. Hitung n pada persamaan Richardson-Zaki
d. U superfisial dengan Leva
0.94
0.0093. 𝑑𝑝1.82 (𝜌𝑠 − 𝜌𝑔 )
𝑈𝑚𝑓 =
𝜇 0.88 𝜌𝑔0.06
e. Hitung ε pada MF, berapa besar kenaikan ε dari fixed ke MF

Jawab:
a. Porositas unggun

𝑉𝑘𝑜𝑠𝑜𝑛𝑔 𝑉𝑝𝑎𝑟𝑡𝑖𝑘𝑒𝑙 15000𝑘𝑔 1 2


𝜀= = 1− =1−( ⁄ 𝜋3 . 2.2𝑚) = 0.64
𝑉𝑡𝑜𝑡𝑎𝑙 𝑉𝑡𝑜𝑡𝑎𝑙 1505𝑘𝑔 4
𝑚3

b. U terminal dan Re
1
𝑈𝑡𝑒𝑟𝑚𝑖𝑛𝑎𝑙 = ( 𝜋𝑑 3 ) (𝜌𝑠 − 𝜌)𝑔 = 0,055𝜋𝑑 2 𝜌𝑢02
6
𝑎𝑡𝑎𝑢
(𝜌𝑠 − 𝜌)
𝑢02 = 3𝑑𝑔
𝜌

0.5
𝑑𝑔 𝑚
𝑈𝑡𝑒𝑟𝑚𝑖𝑛𝑎𝑙 = (3 (𝜌 − 𝜌)) = 3.63
𝜌 𝑠 𝑠
𝜌𝑢𝑑 0.487𝑥3.63𝑥3
𝑅𝑒 = = = 1.54 𝑥 105
𝜇 3.43𝑥10−5

c. Hitung n pada persamaan Richardson-Zaki


4,8 − 𝑛 0,57
𝑑𝑝 0,27
= 0,043𝐴𝑟 [1 − 2,4 ( ) ]
𝑛 − 2,4 𝐷

116 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Ar is the Archimedes number dp3f(p- f)g/2.
Sehingga 𝑛 = 2.548

d. U superfisial dengan Leva


0.94
0.0093. 𝑑𝑝1.82 (𝜌𝑠 − 𝜌𝑔 ) 𝑚
𝑈𝑚𝑓 = = 1.48 𝑥 10−2
𝜇 0.88 𝜌𝑔0.06 𝑠

e. Mencari nilai Emf


2 2
(1 − 𝑒𝑚𝑓 ) 𝜇𝑢𝑚𝑓 (1 − 𝑒𝑚𝑓 ) 𝜌𝑢𝑚𝑓
(1 − 𝑒𝑚𝑓 )(𝜌𝑠 − 𝜌)𝑔 = 150 ( 3 )( ) + 1,75 ( 3 ) ( )
𝑒𝑚𝑓 𝑑2 𝑒𝑚𝑓 𝑑

Nilai Emf = 0.16 (kayanya ini masih salah, masih belum nemu cara benarnya).

117 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS MEKANIKA FLUIDA 2015 (2)

Hari, Tanggal : 4 Juni 2015


Waktu : 90 Menit
Sifat Ujian : Buku Terbuka: 1 buku teks dan 1 lembar A4
Dosen :-

1. A tower having a diameter of 0.1524 m is being fluidized with water at 20.2°C. The
uniform spherical beads in the tower bed have a diameter of 4.42 mm and a density of
1603 kg/m3. Estimate the minimum fluidizing velocity
2. A packed bed of spherical particles of 3 mm diameter and 5000 kg/m3 density is
fluidised by a liquid of viscosity 1 mNs/m2 and density 1200 kg/m2. Calculate the
ratio of minimum fluidisation velocity to the settling of the particles in the bed.
3. Explain why the sedirnentation velocity of uniform course particles in a suspension
decreases as the concentration is increased.

118 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2015 (3)

Mata Kuliah : Mekanika Fluida


Dosen :-
Sifat Ujian : Open Book
Waktu Ujian : 90 menit

1. Water is being pumped through a 3-in pipe. The length of the pipe plus the equivalent
length for fittings is 2300 ft. The design flowrate is 130 gal/min. At that flowrate, what
pressure rise across the pump is required? If the energy losses at the pump and motor is
30%, calculate the pump power.
2. A typical centrifugal pump runs at 3600 rpm. If the fluid being pumped is water, what is
the maximum pressure difference across the pump for impeller diameters of 3 inch, if
energy losses in the pump is 30%?
3. A centrifugal pump is to be placed above a large, open water tank, and is to pump water
at rate of 0.5 ft3/s. At this flowrate the required net positive suction head. NPSHR is 15 ft,
as specified by the pump manufacturer. If the water vapor pressure at 80 °F is 0.49 psi,
and atmospheric pressure is 14.7 psi, determine the maximum height that the pump can
be located above the water surface without cavitation.
4. The flowrate of the water is measure by orificemeter. The orifice was mounted at pipe 2
in, and it designed to give differential height (h) = 40 in at normal flowrate (500 ft 3/min).
If the discharge coefficient is 0.8, Calculate the diameter of the orifice.

119 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS MEKANIKA FLUIDA 2015 (3)

Mata Kuliah : Mekanika Fluida


Dosen : Dr. Ir. Sukirno, M.Eng
Asisten Dosen : Rickson Mauricio (Teknik Kimia 2014)
ID Line : ricksonmauricio

1. Dik : D = 3 inch = 0,25 ft 𝜌 = 61.2 lmb/ft3

Leq = 2300 ft g = 32,2 ft/s2

Q = 130 gal/min = 0,289 ft3/s

Energy losses = 30%

Dit = ∆P ? BHP?

Jawab :

• Persamaan Bernoulli dalam bentuk Head :


P v2 dWother F
∆( +Z+ ) = - −g
ρg 2g g. dm
dWother F
- = K V2 Q
g. dm g F= ; V=A
2
F
Head = Leq
g K= D

2300 0,2892
0,25
x 2
π
( . 0,252 )
4
F = = 159.446,03 ft2/s2
2

F 159.446,03
Head = = = 4951,74 ft.
g 32.2

∆P = 𝜌 𝑔 ℎ𝑒𝑎𝑑

120 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
lbm ft 1 1 ft 2
= 61,3 . . 32,2 2 . 4951,74 ft. lbm. ft
ft 3 s 32,2 144 inch2
lbf. s 2

= 2107,93 psia.

• Energy losses = 30% → 𝜇 = 0.7

FHP g head Q ρ
BHP = =
µ µ
Btu
ft ft 3 lbm 1.
lbm
32,2 2 . 4951,74 ft. 0,289 s . 61,3 3 .
s ft ft 2
25,037 2
s
BHP =
0,7
= 227,94 hp

3. Dik : NPSHR = 15 ft at 0,5 ft3/s


PV at 8°F = 0,49 psi
P atm = 14,7 psi
Dit : ∆Z ?

Jawab :

P2 - Pv
NPSHR =
𝜌𝑔

lbf
(P2-0,49) 2 lbm. ft in2
in
15 ft = lbm ft x 32,3 x 144
61,3 3 . 32,2 2 lbg. s2 ft 2
ft s

= 18,37 ft

4. Dik : D = 2 inch = 0,167 ft


∆h = 40 inch = 3,333 ft
Q = 500 ft3/min
C = 0,8
Dit : diameter orifice?

121 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Jawab :

ṁ = 𝜌. Q

1 min
= 61,3 lbm/ft3 . 500 ft3/min.
60 s

= 510,83 lbm/s

∆P = 𝜌 g ∆h

= 61,3 lbm/ft3 . 32,2 ft/s2. 3,333 ft

= 6513,74 lbm/ft. s2

d d
𝛽 = = 1 = 6d
D ⁄6

C. Aorifice √2ρ. ∆P
ṁ =
√1-β4

π
(0,8). ( . d2 )(√2. 61,3. 6513,74)
4
510,83 =
√1-(6d)4

d = 8,166 ft

122 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL DAN JAWABAN UAS MEKANIKA FLUIDA 20XX

Asisten Dosen :-
Jurusan, Angkatan :-

1. Boundary Layer
Diketahui:
• Penggambaran sistem

• Persamaan sinusoidal
𝑢 𝜋𝑦
= 𝑠𝑖𝑛 ( )
𝑈 2𝛿

Ditanya:
1) Korelasi τw dan dδ/dx
2) δ
3) δ*
4) Kaitan perpindahan massa
5) Total friction force (F)

Jawaban:
Sebelum menyelesaikan soal kita harus menentukan profil kecepatan pada boundary
layer, yaitu:
1) Kecepatan pada dinding pelat adalah 0

123 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
2) Kecepatan di luar boundary layer ialah U
3) Tidak ada perubahan kecepatan di luar boundary layer (seragam)

LANGKAH-LANGKAH:
1) Menentukan Profil
Kecepatan pada dinding pelat adalah 0
𝑢 𝜋𝑦 𝜋0
𝑦=0 → = sin ( ) = sin ( ) = sin 0 = 0
𝑈 2𝛿 2𝛿
Kecepatan di luar boundary layer adalah U (u = U)
𝑢 𝜋𝑦 𝜋𝛿
𝑦=𝛿 → = sin ( ) = sin ( ) = sin 90 = 1
𝑈 2𝛿 2𝛿
Tidak ada perubahan kecepatan di luar boundary layer
𝑑𝑢 𝜋 𝜋𝑦 𝜋 𝜋𝛿 𝜋
𝑦=𝛿 → = 𝑈 cos ( ) = 𝑈 cos ( ) = cos(90) = 0
𝑑𝑦 2𝛿 2𝛿 2𝛿 2𝛿 2𝛿

2) Menentukan persamaan awal yang digunakan


∞ 𝑢
Displacement thickness: 𝛿 ∗ = ∫0 (1 − 𝑈) 𝑑𝑦
∞𝑢 𝑢
Momentum thickness: 𝜃 = ∫0 (1 − 𝑈) 𝑑𝑦
𝑈
𝑑𝜃
Persamaan Von Karman: 𝜏𝑤 = 𝜌𝑈 2 𝑑𝑥
𝑑𝑢
Persamaan Newton (Shear Stress): 𝜏 = 𝜇 𝑑𝑦

Total friction on a plate: 𝐹 = ∫𝐴 𝜏𝑤 𝑑𝐴

3) Menghubungkan persamaan Von Karman dan persamaan Newton


Persamaan Von Karman meninjau shear stress dari sumbu x sedangkan
Newton meninjau shear stress dari sumbu y. Kedua persamaan ini dapat
digunkan dan dihubungkan karena persoalan yang kita miliki adalah aliran
fluida di atas pelat dimana fluida mempunyai gradient kecepatan pada bagian
boundary layer. Sebelum menghubungkan keduanya, kita harus mencari
terlebih dahulu du/dy dan θ.

𝑑𝑢
Mencari 𝑑𝑦

𝑑𝑢 𝜋 𝜋𝑦 𝜋 𝜋0 𝑈𝜋 𝑈𝜋
𝑦=0 → = 𝑈 cos ( ) = 𝑈 cos ( ) = cos(0) =
𝑑𝑦 2𝛿 2𝛿 2𝛿 2𝛿 2𝛿 2𝛿

124 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Mencari θ

𝑢 𝑢
𝜃=∫ (1 − ) 𝑑𝑦
𝑈 𝑈
0
Nilainya 0,
𝛿 ∞
𝑢 𝑢 𝑢 𝑢 karena u = U,
=∫ (1 − ) 𝑑𝑦 + ∫ (1 − ) 𝑑𝑦 maka 1 – 1 = 0
𝑈 𝑈 𝑈 𝑈
0 𝛿
𝛿
𝜋𝑦 𝜋𝑦
= ∫ 𝑠𝑖𝑛 ( ) (1 − 𝑠𝑖𝑛 ( )) 𝑑𝑦
2𝛿 2𝛿
0
𝛿
𝜋𝑦 𝜋𝑦 1 𝑐𝑜𝑠2𝐴
= ∫ [𝑠𝑖𝑛 ( ) − 𝑠𝑖𝑛2 ( )] 𝑑𝑦 𝑠𝑖𝑛2 𝐴 = −
2𝛿 2𝛿 2 2
0
𝛿 𝜋𝑦
𝜋𝑦 1 𝑐𝑜𝑠2 ( 2 𝛿 )
= ∫ [𝑠𝑖𝑛 ( ) − + ] 𝑑𝑦
2𝛿 2 2
0

2𝛿 𝜋𝑦 1 1 𝛿 𝜋𝑦
= (− 𝑐𝑜𝑠 ( ) − 𝑦 + 𝑠𝑖𝑛 ( ))]𝛿0
𝜋 2𝛿 2 2 𝜋𝑦 𝛿
1 2𝛿
= (0 − 𝛿 + 0) − (− − 0 + 0)
2 𝜋
1 2𝛿
=− 𝛿+
2 𝜋
1 2
= (− + ) 𝛿
2 𝜋

a. Korelasi τw dan dδ/dx


Hubungkan hasil diatas kedalam persamaan Von Karman
𝑑𝜃
𝜏𝑤 = 𝜌𝑈 2
𝑑𝑥
𝑑 . 0,137𝛿
𝜏𝑤 = 𝜌𝑈 2
𝑑𝑥
𝑑𝜃
𝜏𝑤 = 0,137 𝜌𝑈 2
𝑑𝑥

b. Mencari ketebalan boundary layer (δ)


Persamaan von Karman dan Newton setelah digabungkan

125 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
𝑑𝛿 𝑈𝜋
𝜌𝑈 2 0,137 =𝜇
𝑑𝑥 2𝛿
𝛿 𝛿
𝜇 1 𝜋
∫ 𝛿 𝑑𝛿 = ∫ 𝑑𝑥
0 0 𝜌𝑈 0,137 2
1 2 𝜇
𝛿 = 11,5𝑥
2 𝜌𝑈

𝜇 𝜇 𝟒, 𝟕𝟗
𝜹 = √2 . 11,5 𝑥 = √23 𝑋= 𝑿
𝜌𝑈 𝜌𝑈𝑥 √𝑹𝒆

c. Mencari δ*
Menggunakan persamaan displacement thickness.


𝑢
𝛿 = ∫ (1 − ) 𝑑𝑦
𝑈
0

𝜋𝑦
= ∫ (1 − 𝑠𝑖𝑛 ( )) 𝑑𝑦
2𝛿
0

2𝛿 𝜋𝑦
=𝑦+ 𝑐𝑜𝑠 ( )]𝛿0
𝜋 2𝛿
2𝛿
= (𝛿 + 0) − (0 + )
𝜋
2𝛿
=𝛿−
𝜋
2
= (1 − ) 𝛿
𝜋
= 0,363 𝛿
4,79
= 0,363 𝑥
√𝑅𝑒
1,74
𝛿∗ = 𝑥
√𝑅𝑒

d. Mencari kaitan perpindahan massa


Displacement thickness menunjukkan ketebalan, di mana terjadi perubahan
besaran nilai kecepatan aliran fluida hingga mencapai kecepatan 99% dari
stream awal. Berdasarkan rumus yang disediakan pada jawaban b, terlihat
bahwa semakin jauh jarak aliran leading edge, maka aliran akan bersifat
semakin turbulen. Berdasarkan teori, semakin besar nilai Re, maka

126 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
kencederungan suatu aliran fluida untuk tertahan di permukaan suatu plat akan
semakin kecil sehingga itu menyebabkan boundary layer yang terbentuk
semakin tipis. Begitu pula sebaliknya, untuk aliran laminar, pelannya aliran
menyebabkan aliran lebih cenderung tertahan oleh gaya gesek dengan
permukaan plat sehingga distribusi kecepatannya pada boundary layer lebih
beragam dibandingkan distribusi kecepatan pada boundary layer turbulen.

e. Mencari total friction force (F)


Menggunakan persamaan gaya friksi.

𝐹 = ∫ 𝜏𝑤 𝑑𝐴
𝐿

= ∫ 𝜏𝑤 𝑏 𝑑𝑥
0
Persamaan Von Karman
𝐿
𝑑𝜃
= ∫ 𝜌𝑈 2 𝑏 𝑑𝑥
𝑑𝑥
0

= 𝜌𝑈 2 𝑏 𝜃 ]𝐿0
= 𝜌𝑈 2 𝑏 (𝜃𝐿 − 0)
= 𝜌𝑈 2 𝑏 𝜃𝐿

Mencari θL
𝛿𝐿
𝑢 𝑢
𝜃𝐿 = ∫ (1 − ) 𝑑𝑦 Penurunannya ada pada langkah 3
𝑈 𝑈
0

= 0,137 𝛿𝐿
4,79
= 0,137 𝐿
√𝑅𝑒𝐿
0,658𝐿
=
√𝑅𝑒𝐿

Maka F menjadi:
0,658𝐿
𝐹 = 𝜌𝑈 2 𝑏 𝜃𝐿 = 𝜌𝑈 2 𝑏
√𝑅𝑒𝐿

2. Particle Separation by Cyclone


127 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Diketahui:

• ρ pasir = 2196 kg/m3


• ρ udara = 0,836 kg/m3
• μ udara = 0,023 x 10-3 kg/ms
• V tangensial udara = 16 m/s

Ditanya:
a. Kecepatan Udara (ω)?
b. µo relative dan µo sebenarnya untuk partikerl de = 40µ?
c. V tangensial udara pada 0,5 rsiklon?
d. µo relative dan µo sebenarnya untuk partikerl de = 40µ pada 0,5 rsiklon?
e. Perbandingan b dan d?

Jawaban:
𝑚
𝑉𝑡𝑎𝑛𝑔𝑒𝑛𝑠𝑖𝑎𝑙 16 𝑟𝑎𝑑
𝑠
a. 𝜔 = = = 53,33
𝑟𝑠𝑖𝑘𝑙𝑜𝑛 0,3 𝑚 𝑠

𝑟𝑎𝑑 2 𝑚
b. 𝛼 = 𝜔2 𝑅𝑠𝑖𝑘𝑙𝑜𝑛 = (53,33 ) (0,3 𝑚) = 853,33 𝑠2
𝑠

𝑅 ′ . (𝑅𝑒 ′ )2 2 𝑑3 (𝜌𝑠 − 𝜌)𝜌𝑎


=
𝜌𝜇𝑜2 3 𝜇2
2 (40. 10−6 )3 (2196 − 0,836)(0,836)(853,33)
= = 126
3 (0,023. 10−3 )2
𝑅 ′ (𝑅𝑒 ′ )2
log = 2,1
𝜌µ20

Melihat tabel untuk hasil log = 2,1 maka nilai log (Re’) = 0,817.
𝑅𝑒 ′ = 100,817 = 6,56
𝜌𝜇𝑜 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 𝑑
𝑅𝑒 ′ =
𝜇

128 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
0,836 𝜇𝑜 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 40. 10−6
6,56 =
0,023 . 10−3
𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 = 4,5 𝑚/𝑠
𝜇𝑜 𝑠𝑒𝑏𝑒𝑛𝑎𝑟𝑛𝑦𝑎 = 𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 − 𝑉𝑡𝑎𝑛𝑔𝑒𝑛𝑠𝑖𝑎𝑙 𝑢𝑑𝑎𝑟𝑎
= 4,5 − 16
𝑚
= −11,5 (berlawanan arah)
𝑠

c. Konsep kecepatan radial tetap


ω di R = ω di 0,5 R
𝑉𝑡𝑎𝑛𝑔 1 𝑉𝑡𝑎𝑛𝑔 2
=
𝑅 0,5 𝑅
𝑚 𝑚
𝑉𝑡𝑎𝑛𝑔 2 = 0,5 𝑉𝑡𝑎𝑛𝑔 1 = 0,5 (16 )=8
𝑠 𝑠

𝑉𝑡𝑎𝑛𝑔1 2 8 2 𝑚
d. 𝑎 𝑑𝑖 𝑅 = 𝑎 𝑑𝑖 0,5𝑅 = 𝜔2 𝑅 = ( ) 𝑅 = (0,15) 0,15 = 426,67 𝑠2
𝑅

𝑅 ′ . (𝑅𝑒 ′ )2 2 𝑑3 (𝜌𝑠 − 𝜌)𝜌𝑎


=
𝜌𝜇𝑜2 3 𝜇2
2 (40. 10−6 )3 (2196 − 0,836)(0,836)(426,67)
= = 63
3 (0,023. 10−3 )2
𝑅 ′ (𝑅𝑒 ′ )2
log = 1,8
𝜌µ20

Melihat tabel untuk hasil log 1,8 maka nilai log (Re’) = 0,577.
𝑅𝑒 ′ = 100,577 = 3,78


𝜌𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 40 . 10−6
𝑅𝑒 =
0,023 . 10−3
𝜌𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 40 . 10−6
3,78 =
0,023 . 10−3
𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 = 2,6 𝑚/𝑠
𝜇𝑜 𝑠𝑒𝑏𝑒𝑛𝑎𝑟𝑛𝑦𝑎 = 𝜇0 𝑟𝑒𝑙𝑎𝑡𝑖𝑓 − 𝑉𝑡𝑎𝑛𝑔𝑒𝑛𝑠𝑖𝑎𝑙 𝑢𝑑𝑎𝑟𝑎
= 2,6 − 8
𝑚
= −5,4 (berlawanan arah)
𝑠

129 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
e. Jawaban b (R), µo relative = 4,5 m/s; µo sebenarnya = -11,5 m/s
Jawaban d (R), µo relative = 2,6 m/s; µo sebenarnya = -5,4 m/s
Hal ini berarti saat partikel dari lintasan yang berjarak 0,5R mengalami
perlambatan dibandingkan saat di R.

130 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MEKANIKA FLUIDA 2016 (1)

Mata Kuliah : Mekanika Fluida


Dosen :-
Sifat Ujian : Open Book
Waktu Ujian : 100 menit

1. Lapisan Batas
a. Mengapa muncul lapisan batas pada fluida yang mengalir pada permukaan pelat
datar?
b. Apa pengertian ketebalan momentum secara fisik?
c. Gambarkan secara skematis profil kecepatan pada lapisan batas laminar dari aliran
fluida yang mengalir di atas pelat di bagian depan dan belakang pelat sehingga jelas
perbedaan shear stress nya. Mana yang lebih besar harga shear stressnya, di bagian
depan atau belakang pelat?

2. Suatu unggun diam seberat 3,6 kg mengandung partikel-partikel padat dengan densitas
2590 kg/m3 dan ukuran partikel 750 mikron tingginya 0,475 m dan diameternya 0,0757
m. Suatu cairan dengan densitas 1000 kg/m3 dan viskositas 0,001 Pa.s dialirkan ke atas
melalui unggun. Hitunglah:
a. Porositas unggun diam
b. Jatuh tekan pada unggun terfluidisasi, dalam Pa
c. Kecepatan superfisial cairan pada fluidisasi minimum jika porositas pada fluidisasi
minimum = porositas unggun diam, dalam m/detik (gunakan persamaan Ergun)
d. Galileo number partikel dan kecepatan terminal partikel (dalam m/detik)
e. Porositas unggun ketika kecepatan superfisial cairan 0,01 m/detik
f. Tinggi unggun ketika kecepatan superfisial cairan 0,01 m/detik, dalam m.

3. Suatu larutan viskos yang berisi partikel-partikel dengan densitas 1450 kg/m3 akan
dipisahkan partikel-partikel tersebut berdasarkan diameter partikel. Densitas dan
viskositas larutan masing-masing 800 kg/m3 dan 0,01 Pa.s. Centrifuge merupakan
tubular bowl centrifuge dengan radius luar r2=0,0225 m dan radius dalam r1=0,0072 m

131 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
dan tinggi b=0,1970m. Kecepatan putaran centrifuge = 23000 putaran/min dan laju alir
volume = 0,002832 m3/jam. Efek inersia partikel diabaikan. Tentukan:
a. Kecepatan angular centrifuge (radial/detik)
b. Volume bowl (m3)
c. Ukuran partikel yang mencapai dinding centrifuge dengan waktu tinggal yang tersedia
dengan asumsi Stokes’law region berlaku (dalam micron). Apakah ini ukuran partikel
maksimum atau minimum? Jelaskan.

Cek bilangan Reynolds partikel dalam medan sentrifugal untuk mengecek apakah jawaban di
pertanyaan c benar.

132 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
133 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS MEKANIKA FLUIDA 2016 (1)

Mata Kuliah : Mekanika Fluida


Dosen :-
Asisten Dosen : Adeline Jessica
ID Line :

1. Lapisan Batas
a. Mengapa muncul lapisan batas pada fluida yang mengalir pada permukaan pelat
datar?
Ketika fluida mengalir pada plat datar, fluida pada plat menjadi sama dengan nol.
Shear stress menahan gerakan fluida, sehingga kecepatan aliran yang dekat pada
permukaan plat secara kontinu berkurang. Namun, semakin jauh suatu titik dari plat
datar, kecepatan akan sama dengan kecepatan aliran bebas sebelum berkontak
dengan plat datar. Maka itu, terdapat gradien kecepatan pada fluida pada arah yang
tegak lurus terhadap aliran. Terbentuk suatu lapisan tipis dekat dengan permukaan
plat datar dimana terdapat profil kecepatan karena tertahan oleh shear stress
(viskositas), dimana kecepatannya 99% dari kecepatan aliran bebas.

134 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
b. Apa pengertian ketebalan momentum secara fisik?
Ketebalan dari lapisan fluida inviscid dimana besar fluks momentum sama dengan
besar defisit fluks momentum dalam lapisan batas pada fluida viscid.

c. Gambarkan secara skematis profil kecepatan pada lapisan batas laminar dari aliran
fluida yang mengalir di atas pelat di bagian depan dan belakang pelat sehingga jelas
perbedaan shear stress nya. Mana yang lebih besar harga shear stressnya, di bagian
depan atau belakang pelat?

Lebih besar shear stress pada bagian belakang plate karena alirannya yang
terhambat lebih besar akibat boundary layer.

2. Diketahui: MS = 3,6 kg
ρ = 1000 kg/m3
ρs = 2590 kg/m3
Dp = 750 × 10-6 m
Dv = 0,0757 m
L = 0,475 m
µ = 0,0001 Pa.s

a. Porositas unggun diam

MS = (1-e) ρs A H
3,6 = (1-e) (2590 kg/m3)(π×0.25×(0,0757 m)2) (0,475 m)
3,6 𝑘𝑔
(1-e) = 𝑘𝑔 𝜋 (0,0757 𝑚)2
2590 3 × ×0,475 𝑚
𝑚 4

(1-e) = 0,65017
e = 0,34983 ≈ 0,35

135 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
b. Jatuh tekan pada unggun terfluidisasi, dalam Pa
𝐴𝑠𝑝ℎ𝑒𝑟𝑒
ψ= =1
𝐴𝑝𝑎𝑟𝑡𝑖𝑐𝑙𝑒
0.029 0.021
−0.7
𝜇2 ρ
emf = 0.586 ψ ( ) ( )
dp3 𝑔 (ρ𝑠 − ρ) ρ ρ𝑠
0.029
−0.7 (10−3 )2 1000 0.021
= 0.586 1 ( ) ( )
(7,5 x 10−4 )3 × 9,8 × 1590 × 1000 2590
= 0,29326 ≈ 0,293

(1 − 𝑒𝑚𝑓 )(𝜌𝑠 − 𝜌) 𝑔 𝐴𝑙
−∆𝑃 =
𝐴
−∆𝑃 = (1 − 𝑒𝑚𝑓 )(𝜌𝑠 − 𝜌) 𝑔𝑙
kg m
−∆P = (1 − 0,293)(2590 − 1000) (9,8 ) (0,475 m) = 5232,82515 Pa
m3 s2
c. Kecepatan superfisial cairan pada fluidisasi minimum jika porositas pada fluidisasi
minimum = porositas unggun diam, dalam m/detik (gunakan persamaan Ergun)
2 2
(1 − 𝑒𝑚𝑓 ) 𝜇𝑈𝑚𝑓 (1 − 𝑒𝑚𝑓 ) 𝜌𝑈𝑚𝑓
(1 − 𝑒𝑚𝑓 )(𝜌𝑠 − 𝜌) 𝑔 = 150 ( ) ( 2 ) + 1,75 ( )( )
𝑒𝑚𝑓 3 𝑑 𝑒𝑚𝑓 3 𝑑
2
(1 − 0,34983)2 10−3 𝑈𝑚𝑓 (1 − 0,34983) 1000 𝑈𝑚𝑓
(1 − 0,34983)(2590 − 1000) 9,8 = 150 ( ) ( ) + 1,75 ( ) ( )
0,349833 (7,5 𝑥 10−4 𝑚)2 0,349833 7,5 𝑥 10−4 𝑚
2
10130,94894 = 2633003,492 𝑈𝑚𝑓 + 20248577,23 𝑈𝑚𝑓
𝑚
𝑈𝑚𝑓 = 0,016
𝑠
d. Galileo number partikel dan kecepatan terminal partikel (dalam m/detik)
𝑑𝑝3 𝜌(𝜌𝑠 − 𝜌)𝑔 (750 𝑥 10−6 )3 (1000)(2590 − 1000)9,8
𝐺𝑎 = = = 6573,65625
𝜇2 0,0012
2
log ( 𝐺𝑎) = 3,64
3
log(𝑅𝑒1) = 1.907
𝑅𝑒1 = 80,7235

𝑅𝑒1 𝜇
𝑈𝑐𝑇 =
𝜌𝑑𝑝

136 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝑘𝑔
(80,7235) (0,001
𝑚𝑠)
𝑈𝑐𝑇 =
𝑘𝑔
(1000 ) (7,5 𝑥 10−4 𝑚)
𝑚3
=0,10763 m/s
e. Porositas unggun ketika kecepatan superfisial cairan 0,01 m/detik

4,8 − 𝑛 0,57
𝑑𝑝 0,27
= 0,043 𝐺𝑎 (1 − 2,4 ( ) )
𝑛 − 2,4 𝐷
0,27
4,8 − 𝑛 750 × 10−6
= 0,043(6573,65625)0,57 (1 − 2,4 ( ) )
𝑛 − 2,4 0,0757
4,8 − 𝑛
= 1,99697
𝑛 − 2,4
𝑛 = 3,2

𝑈𝑐 = 𝑈𝑐𝑇 𝑒 𝑛
𝑚 𝑚
0,01 = (0,10763 ) (𝑒 3,2 )
𝑠 𝑠
0,0929 = 𝑒 3,2
𝑒 = 0,47589

f. Tinggi unggun ketika kecepatan superfisial cairan 0,01 m/detik, dalam m.

MS = M S

(1 − 𝑒1 ) 𝜌𝑠 𝐴𝑙1 = (1 − 𝑒2 ) 𝜌𝑠 𝐴𝑙2

(1 − 𝑒1 )
𝑙2 = 𝑙
(1 − 𝑒2 ) 1

(1 − 0,34983)
𝑙2 = (0,475 𝑚)
(1 − 0,47589)

𝑙2 = 0,589 𝑚

137 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
3. Diketahui: ρ = 1450 kg/m3

ρs = 800 kg/m3

µ = 0,01 Pa.s

r2 = 0,0225 m

r1 = 0,0072 m

b = 0,197 m

q = 0,002832 m3/h

N = 23000 putaran/min

a. Kecepatan angular centrifuge (radial/detik)


2𝜋𝑁 2𝜋23000
ω= = = 2408,56 𝑟𝑎𝑑/𝑠
60 60

b. Volume bowl (m3)


𝑉 = 𝜋𝑏(𝑟22 − 𝑟12 )
= 𝜋 × 0,197 × (0,02252 − 0,00722 )
= 2,812 × 10−4 𝑚3

c. Ukuran partikel yang mencapai dinding centrifuge dengan waktu tinggal yang tersedia
dengan asumsi Stokes’law region berlaku (dalam micron). Apakah ini ukuran partikel
maksimum atau minimum? Jelaskan.
0,002832 𝑚3 𝑚3
𝑞= = 7,867 × 10−7
3600 𝑠 𝑠
𝑚3 2408,562 𝐷𝑝2 2(9,8)(1450 − 800)(2,812 × 10−4 )
7,867 × 10−7 =
𝑠 18(0,01) 2(0,0225)
ln [ ]
0,0225 + 0,0072)

Dp = 7,525 × 10-8 m = 752,5 µm

Ukuran diameter partikel tersebut merupakan ukuran diameter partikel minimum


karena partikel dengan diameter lebih kecil dari Dp tidak akan mencapai dinding dari
bowl dan keluar dengan larutan yang keluar. Partikel akan keluar jika mempunyai
waktu tinggal yang cukup untuk mencapai dinding.

138 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
d. Cek bilangan Reynolds partikel dalam medan sentrifugal untuk mengecek apakah
jawaban di pertanyaan c benar.

𝜔 2 𝑟2 𝐷𝑝2
Vt = (𝜌𝑝 − 𝜌)
18𝜇

(2408,56)2 (0,0225)(7,525 × 10−8 )2


= (1450 − 800)
18(0,01)
𝑚
= 2,669 × 10−6
𝑠

𝐷𝑃 𝑣𝑡 𝜌
NRe = 𝜇

(7,525 × 10−8 )(2,669 × 10−6 )(1450)


=
0,01

=2,912 × 10-8 m < 1, maka hukum Stokes berlaku

139 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS MEKANIKA FLUIDA 2016 (2)

Mata Kuliah : Mekanika Fluida


Dosen :-
Sifat Ujian : Open Note (2 pcs of A4 paper)
Waktu Ujian : 100 menit

1. Lapisan Batas
a. Mengapa muncul lapisan batas pada fluida yang mengalir pada permukaan
pelat datar?
b. Apa pengertian ketebalan momentum secara fisik?
c. Apa bedanya pengertian koefisien friksi Cf dan CD untuk fluida yang mengalir
pada permukaan pelat datar. Gambarkan daerah berlakunya masing-masing
koefisien tersebut pada pelat datar.

2. Suatu unggun diam seberat 50 kg yang mengandung partikel padat dengan densitas
2500 kg/m3 dan ukuran partikel 1 mm tingginya 1 m dan luas penampangnya 0,04 m2.
Suatu cairan dengan densitas 800 kg/m3 dan viskositas 0,002 Pa.s dialirkan ke atas
melalui unggun. Hitunglah:
a. Porositas unggun diam
b. Jatuh tekan unggun diam, jika laju alir cairan 1,44 m3/jam, dalam Pa
c. Jatuh tekan pada unggun terfluidisasi jika porositas unggun diam = porositas
pada fluidisasi minimum, dalam Pa
d. Galileo number partikel dan kecepatan terminal partikel (dalam m/detik)
e. Jika laju alir cairan dinaikkan 10x, apakah unggun pada kondisi terfluidisasi
atau entertainment?

3. Droplet (butiran) minyak dengan diameter 20 mikrometer dijatuhkan bebas di udara


yang densitasnya 1,137 kg/m3 dan viskositasnya 1,9 x 10-5 Pa.s. Densitas minyak
adalah 900 kg/m3. Tentukan
a. Kecepatan terminal butiran minyak jika butiran dianggap berbentuk bola,
dalam m/detik
b. Bilangan Reynolds butiran tersebut

140 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
c. Waktu yang dibutuhkan butiran tersebut sejak dijatuhkan bebas hingga
mencapai 99% kecepatan terminalnya, dalam detik. Untuk penyelesaian
persamaan diferensial gunakan metoda di bawah ini dengan variabel u(t) dan t
(bukan u(x) dan x) dengan nilai K yang ditentukan dari kondisi batas: t=0, u=0

∫ 𝑒 𝑎𝑥 𝑑𝑥 = 𝑒 𝑎𝑥 /𝑎

Solution of linear, Non-homogeneous equations (P.50)


Typical differential equation:
𝑑𝑢(𝑥)
+ 𝑝(𝑥)𝑢(𝑥) = 𝑔(𝑥) (3.6)
𝑑𝑥
The appearance of function g(x) in equation (3.6) makes the DE non-homogeneous

The solution of ODE in equation (3.6) is similar by a little more complex than that for
the homogeneous equation in (3.3)
1 𝐾
𝑢(𝑥) = ∫ 𝐹(𝑥)𝑔(𝑥) + (3.7)
𝐹(𝑥) 𝐹(𝑥)
Where function F(x) can be obtained from equation (3.5) as:

𝐹(𝑥) = 𝑒 ∫ 𝑝(𝑥)𝑑𝑥

141 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
142 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
PERPINDAHAN KALOR

143 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR

Hari, Tanggal : -
Waktu :-
Sifat Ujian :-
Dosen :-

1. Suatu unit pendingin menggunakan Heat Exchanger (HE) yang sederhana. Pada unit
ini panas berpindah dari aliran panas ke aliran dingin melalui dinding pipa.
Sayangnya unit pendingin ini tidak lagi mendinginkan aliran cairan panas sampai
suhu yang diinginkan agar dapat diproses di tahap berikutnya.

a. Menurut anda, apa sesungguhnya yang salah dari sistem yang ada?
b. Jika anda diberikan instruksi untuk merancang dan memasang unit pendingin
baru yang lebih besar sebagai salah satu alternatif penyelesaian masalah,
bagaimana tanggapan anda?
c. Langkah apa yang anda ambil sebagai seorang engineer desain proses, untuk
menyelesaikan masalah di atas?
d. Bagaimana anda mengetahui suatu unit pendingin masih beroperasi atau
tidak?

2. Sebanyak 32.000 lb/hr minyak ringan pada suhu 3400F digunakan untuk memanaskan
nafta dari suhu 2000F - 2300F, sehingga suhunya menjadi 2400F. Diketahui Uo = 69,3
Btu/jamft2 0F, diameter pipa = 0,75 in (BWG 16), panjang pipa 18 ft. Letak pipa

144 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
square pitch dengan ID shell = 15,25 in, PT = 1 in, dan jarak antar baffle 3,5 in.
Aliran pipa 4 pass dalam shell 2 pass.
Sifat-sifat fluida diasumsikan konstan sebagai berikut:
k,
Zat Cair μ, c.p. Cp, Btu/lb.0F
Btu/jam.ft.0F
Minyak
0,073 1,50 0,58
Ringan
Nafta 0,079 0,54 0,56

a. Hitunglah jumlah pipa (N1)


b. Apakah fungsi dari baffle pada proses tersebut, dan apa pula pengaruh dari
jumlah pass / lintasan dalam shell dan tube?

3. Suatu reaktor pengolah limbah berbentuk bola awalnya disimpan di dalam tanah, k
tanah 1,42 BTU/j.ft.0F. Suhu permukaan luar reaktor 900 0F dan suhu udara luar 800F.
Diameter luar reaktor 8 ft sedangkan jarak antara sumbu bola dan permukaan tanah
10 ft.
a. Menurut anda, alasan apakah yang mendasari penyimpanan reaktor di dalam
tanah?
b. Bila reaktor di atas kemudian tidak dipendam lagi di dalam tanah melainkan
diletakkan di udara terbuka (suhu tetap 800F) tanpa diisolasi, hitunglah panas
yang hilang seara konveksi bebas.

4. Dua plat memiliki temperatur 12000F dan 8000F dengan emisivitas masing-masing
0,8 dan 0,6.
a. Hitunglah dan jelaskan besarnya rugi kalor yang terjadi antara kedua plat
tersebut.
b. Dapatkah anda menjelaskan mekanisme fisis dari perpindahan kalor yang
terjadi pada dua plat tersebut dan beberapa faktor yang mempengaruhi proses
perpindahan kalornya?
c. Bagaimana pengaruh dari sifat bahan dan susunan geometri benda terhadap
perpindahan kalor di atas?

145 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERPINDAHAN KALOR

Asisten Dosen :-
Jurusan, Angkatan :-

1. Suatu unit HE

a. Pada kasus tersebut, terjadi penurunan efektivitas HE. Jika diasumsikan aliran
fluida panas dan fluida dingin steady, maka faktor utama yang memungkinkan
terjadinya penurunan efektivitas HE ini adalah adanya Fouling Factor.

Fouling Factor yang mungkin terjadi adalah:


1) Pengendapan di sekitar dinding pipa akibat partikel pengotor dalam
aliran fluida.
2) Korosi permukaan pipa oleh aliran fluida sehingga permukaan pipa
menjadi kasar.
3) Stagnasi aliran fluida panas pada daerah sudut pipa lingkaran pada
gambar.

Fouling Factor ini menyebabkan aliran kalor dari fluida panas ke fluida
dingin terhambat (lebih lambat) sehingga suhu aliran keluaran cairan hangat
tidak lagi dapat mencapai suhu keluaran yang diinginkan.

b. Oleh karena masalah yang terjadi adalah penurunan efektivitas kinerja HE,
maka saya kurang sepakat dengan instruki penggantian unit HE dengan yang

146 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
lebih besar karena bukan merupakan solusi yang efektif, efisien, dan
ekonomis.

c. Menurut saya, akan lebih baik jika dilaksanakan solusi:


1) Membersihkan pipa dari segala endapan.
2) Melapisi permukaan pipa yang dialiri fluida dengan bahan anti korosi.
3) Membalikkan arah aliran fluida dingin sehingga akan didapatkan HE
counter current, di mana suhu keluaran fluida panas yang didapatkan
dapat lebih rendah dari suhu masukan fluida dingin. Dengan kata lain,
Th1 pada HE counter current < Th1 pada HEco-current. Dampak
lainnya adalah efisiensi penggunaan feed fluida dingin sehingga lebih
efisien dan ekonomis.

d. Suatu unit HE dapat dikatakan masih memiliki kinerja yang baik jika
memenuhi karakteristik sebagai berikut:
1) Fouling Factor (Fk) kecil
2) Efektivitas (e) besar
3) NTU besar

2.
a. Diketahui:
Fluida panas (minyak Fluida dingin (nafta)
ringan) Tube Shell
Laju alir massa mh = 32000 lb/hr
Suhu masukan Th1 = 3400°F Tc1 = 2000°F
Suhu keluaran Th2 = 2400°F Tc2 = 2300°F
OD 0.75 inch
ID 0.62 inch * 15.25 inch
PT 1 inch
Pass 4 2
L 18 ft
B 3.5 inch
UD 69.3 Btu/hr.ft2.0F

147 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
* Tabel 10 hal.843 buku Kern

Basis: 1 jam
Asumsi: Aliran counter current

𝑞 = 𝑚ℎ . 𝑐ℎ . ∆𝑇ℎ
= 𝑚𝑐 . 𝑐𝑐 . ∆𝑇𝑐
𝑙𝑏 𝐵𝑡𝑢
= 32000 . 0,58 . ℉. 100℉
ℎ𝑟 𝑙𝑏
= 1856 𝑘𝐵𝑡𝑢

𝐿𝑀𝑇𝐷 = ∆𝑇𝑚
(𝑇ℎ1 − 𝑇𝑐2) − (𝑇ℎ2 − 𝑇𝑐1)
=
𝑇ℎ1 − 𝑇𝑐2
𝑙𝑛 [ ]
𝑇ℎ2 − 𝑇𝑐1
(340 − 230) − (240 − 200)
=
340 − 230
𝑙𝑛 [240 − 200]

= 69,2℉

(𝑇𝑐2 − 𝑇𝑐1) (230 − 200)


𝑃= = = 0,2143
(𝑇ℎ2 − 𝑇𝑐1) 340 − 200)
(𝑇ℎ1 − 𝑇ℎ2) (340 − 240)
𝑅= = = 3,3333
(𝑇𝑐2 − 𝑇𝑐1) 230 − 200)
𝑞 1856 𝑘𝐵𝑡𝑢
𝐴= = = 387,025 𝑓𝑡 2
𝑈. 𝐹. ∆𝑇𝑚 𝐵𝑡𝑢
69,3
ℎ𝑟. ℉. 𝑓𝑡 2 (1. 69,2 ℉)

148 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝐴 387.025 𝑓𝑡 2 12 𝑖𝑛𝑐ℎ
𝑁𝑇 = = . = 132,534 𝑡𝑢𝑏𝑒 → 133 𝑡𝑢𝑏𝑒
𝜋𝐷𝐿 𝜋. (0,62 𝑖𝑛𝑐ℎ). 18 𝑓𝑡 𝑓𝑡

b. Pada HE, baffle befungsi untuk menahan strell dari guncangan akibat
turbulensi aliran fluida. Dengan adanya buffle, jarak antarshell dapat
dipertahankan dan shell tidak mudah rusak akibat kekuatan aliran fluida pada
tube. Peningkatan nilai jumlah lintasan / pass akan memunculkan suatu
variabel koreksi (F) sehingga nilai LMTD akan mengalami penurunan. Nilai F
didapatkan melalui parameter P dan R (gambar 10-9 buku Holman).

3.
a. Diketahui bahwa k tanah= 1.42 Btu/hr.ft. 0F dan k udara=0.0223 Btu/hr.ft. 0F.
Oleh karena itu, menurut saya reaktor tersebut dipendam di dalam tanah untuk
mempercepat proses perpindahan kalor secara konduksi. Hal ini bertujuan
untuk mempercepat pelepasan kalor dari permukaan reaktor agar suhu reaktor
turun dan reaksi berlangsung pada suhu yang tidak terlalu tinggi sehingga
mengurangi resiko ledakan reaktor dan bahaya lainnya.

b. Diketahui:
• Tw = 9000F = 755.22 K
• T∞ = 800F = 299.67 K
• D = 8 ft

𝑇𝑤+𝑇∞ 755,22 𝐾+299,67 𝐾


Evaluasi suhu film 𝑇𝑓 = = = 527,445 K
2 2

Daftar A-5 hal 589 buku Holman, untuk T = 527,445 K, didapatkan:

149 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
1 1
𝛽= = = 0,001896/ 𝐾
𝑇𝑓 527,445 K

v = 41,435 x 10-6 m3/s


k = 0,04215 W/m0C
P1 = 0,68

𝑔. 𝛽. ∆𝑇. 𝛿 3
𝐺𝑟𝑃𝑟 = 𝑃
𝑣2
0,001896 𝑚
9,8 𝑚/𝑠 2 . ( ) . (775,22 𝐾 − 299,67 𝐾)(8 𝑓𝑡
𝐾 3,3 𝑓𝑡
= 2
(0,68)
10−6 𝑚3
(41,435 × 𝑠 )
= 4,776 × 1010

𝑁𝑢𝑓 = 2 + 0,5(𝐺𝑟𝑃𝑟)0,25 = 2 + 0,5(4,776 × 1010 )0,25 = 235,75


𝑊
𝑁𝑢𝑓 . 𝑘 235,75 (04215 𝑚 ℃) 3,3 𝑓𝑡 4,1𝑊
ℎ̅ = = . = 2
𝐷 8 𝑓𝑡 𝑚 𝑚 ℃

𝑞 = ℎ̅. 𝐴. (𝑇𝑤 − 𝑇∞)


2
4,1𝑊 8𝑓𝑡 𝑚
= 2 . [4𝜋. ( . )] (755,22 𝐾 − 299,67 𝐾)
𝑚 ℃ 2 3,3𝑓𝑡
= 34,457 𝑘𝑊

4. Diketahui:
• T1 = 1200°F = 922 K
• T2 = 8000°F = 700 K
• є1 = 0.8
• є2 = 0.6
• σ = 5.669 x 10-8 W/m2.K4 ( yang paling sering digunakan untuk soal plat)

a. Asumsi untuk bidang sejajar tak berhingga:


F12 = F21 = 1 dan A1 = A2 karena sangat luas.

150 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Karena luasan plat tidak diketahui secara pasti dan dianggap tak berhingga,
maka rugi kalor yang terjadi dinyatakan untuk tiap satuan luas.
𝑞 𝜎(𝑇14 − 𝑇24 )
=
𝐴 1 1
(∈ 1 + ∈ 2 − 1)
𝑊
5,668 × 10−8 2 4 [(922 𝐾)4 − (700𝐾)4 ]
= 𝑚 𝐾
1 1
0,8 + 0,6 − 1
= 14,27 𝑘𝑊/𝑚2

b. Kalor yang dimiliki oleh plat 1 akan terpancar dari seluruh permukaannya dan
terjadi perpindahan kalor secara radiasi menuju permukaan plat 2. Oleh
karena luasan plat yang saling berhadapan (plat l dan plat 2) dianggap tak
berhingga, maka diasumsikan seluruh kalor yang dilepaskan oleh permukaan
plat 1 akan mencapai permukaan plat 2 (F12 = 1). Mekanisme yang sama juga
terjadi pada perpindahan kalor dari plat 2 ke plat 1 (F21 = 1). Peristiwa
perpindahan kalor secara radiasi ini sangat dipengaruhi oleh beberapa fakfor,
antara lain:
• Jenis bahan (sifat, warna, struktur, dan permukaan bahan)
mempengaruhi nilai emisivitas.
• Temperatur bahan.
• Luas dan bentuk bahan.
• Faktor bentuk antarbahan (susunan geometri).

c. Sifat bahan akan mempengaruhi banyaknya (%) kalor yang dapat diradiasikan
(emisivitas) oleh bahan tersebut. Sementara susunan geometri akan
mempengaruhi cepatnya dan banyaknya jumlah kalor radiasi yang dapat
diterima atau sampai ke permukaan bahan lainnya.

151 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2007

Hari, Tanggal : 6 Juni 2007


Waktu : 100 Menit
Sifat Ujian : Buku (masing-masing) Terbuka
Dosen :

1. Diketahui sebuah selongsong bola lowong yang rnempunyai jari-jari dalam r, dan jari-
jari luar rₒ, serta konduktivitas termal k.
a. Bagaimana anda menentukan persamaan untuk tahanan termal benda tersebut? (20%)
b. Apa yang anda ketahui tentang tahanan termal? (10%)

2. Sebuah pipa horizontal diarneter 7,5 cm dan suhu permukaan 240°C, ditempatkan di
dalam ruang dengan suhu udara 20°C.
a. Bagaimana anda menghitung besarnya rugi kalor konveksi bebas per meter panjang
pipa, dengan menggunakan formulast empiris yang sesuai pada Daftar 7.1 Holman?
(25 %)
b. Dapatkah sistem di atas diselesaikan dengan menggunakan formulasi empiris yang
dikemukakan olch Churchill-Chu? Apa komentar anda mengenai hal ini? (15%)

3. a. Apa yang anda ketahui tentang faktor bentuk radiasi? Bilamana faktor bentuk
tersebut
digunakan? (10%)
b.Tentukan faktor bentuk radiasi F1,2 untuk benda di bawah ini. (20%)

152 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS PERPINDAHAN KALOR 2011

Hari, Tanggal : Kamis, 26 Mei 2011


Waktu : 90 Menit
Sifat Ujian : Buka Buku Masing-masing
Dosen :-

Soal 1 (50%)

Kita ingin memanaskan 230 kg/h air dari suhu 35°C menjadi 93°C dengan menggunakan

minyak (CP = 2,1 kJ/kg.°C). Suhu awal minyak 175°C dengan aliran massa 230 kg/h.

Untuk keperluan ini tersedia dua buah alat penukar kalor pipa ganda:

Penukar kalor #1: U : 570 W/m2.°C A = 0,47 m2

Penukar kalor #2: U : 370 W/m2.°C A = 0,94 m2

a. Setelah melakukan perhitungan di atas, dapatkah anda menentukan penukar kalor


manakah yang seharusnya digunakan? Berikan alasan yang jelas.
b. Jika penukar kalor yang dipilih tidak tepat, apakah yang terjadi dengan proses
pemanasan?
c. Bagaimana anda mengindikasikan penurunan kinerja alat penukar kalor sebagai
akibat dari adanya pengotoran (fouling)?

Soal 2 (50%)

Sebuah pipa uap horizontal tanpa insulasi melintasi suatu ruangan yang luas. Suhu udara

dan dinding ruang tersebut 300 K. Pipa uap memiliki diameter 150 mm, suhu permukaan

luar pipa 400 K, dan emisiviitas 0,85.

a. Perkirakan besarnya laju perpindahan kalor secara konveksi bebas per satuan panjang
pipa.

153 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
b. Berapakah besarnya total kalor yang hilang dari permukaan pipa?
c. Sarankan hal-hal apa saja yang dapat dilakukan untuk meminimalisasi kehilangan
kalor pada pipa tersebut.

154 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS PERPINDAHAN KALOR 2012 (1)

Hari, Tanggal : -
Waktu :-
Sifat Ujian :-
Dosen :-

1. Larutan garam dapur (NaCl) dipanaskan dengan cara mengalirkannya di dalam


sebuah pipa yang suhunya dijaga tetap 150°F. Diameter pipa 1 in dengan panjang 12
ft. Larutan garam masuk pipa dengan kecepatan 5 ft/detik pada suhu 50°F. Sifat-sifat
fisis larutan garam dapat dianggap konstan terhadap suhu:
Ρ=62,4 lb/ft ; μ=4,0 lb/ft ; CP = 0,98 BTU/lb.°F ; k=0,15 BTU/jam.°F

Persamaan berikut dapat digunakan untuk menentukan koefisien perpindahan kalor


konveksi yang terjadi pada sistem tersebut di atas: (Nilai 35%)
ℎ𝐷 𝜌𝑣𝐷 0,8 𝐶𝑝𝜇 0,4
= 0,023 ( ) ( )
𝑘 𝜇 𝑘
a. Tentukan jenis aliran dari larutan garam.
b. Hitunglah suhu larutan garam ketika keluar dari pipa.

2. Dari suatu percobaan HE dengan menggunakan steam dan air sebagai fluida,
diperoleh data grafik sebagai berikut: (Nilai 30%)

155 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Dari gambar tersebut, dapatkan anda menentukan:
a. Pola aliran apakah yang digunakan pada HE?
b. Profil apa yang ditunjukkan oleh [A] dan [B]?
c. Bagaimana pengaruh perubahan laju air yang digunakan terhadap profil [A]
dan [B] tersebut? (Asumsi: Laju steam yang digunakan konstan)

3. Gas hasil pembakaran terdiri atas 10,3% H2O, 11,4% CO2 dan sisanya inert (% mol).
Tekanan total = 1 atm. Gas tersebut mengalir melalui pipa yang berdiameter 6 in dan
mengalami perpindahan kalor radiasi dengan udara luar. Suhu gas masuk 2000°F dan
suhu permukaan ujung pipa 800°F. Suhu gas keluar 1000°F dan suhu permukaan
ujung pipa (lainnya) 600°F. (Nilai 35%)
a. Faktor-faktor apa sajakah yang mempengaruhi besarnya perpindahan kalor
radiasi dari campuran gas tersebut?
b. Jika diketahui emisivitas campuran gas = 0,11; absorptivitas = 0,92; dan
diasumsikan (m.CP) gas dianggap tetap sebesar 90 BTU/J.°F. Hitunglah
panjang pipa yang dibutuhkan agar perpindahan kalor terjadi sesuai yang
diinginkan.

156 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS PERPINDAHAN KALOR 2012 (1)

Asisten Dosen :-
Jurusan, Angkatan :-

1. Konveksi

Larutan NaCl
V = 5 ft/s
To = 50°F
Ρ = 62,4 lb/ft3
𝜇 = 4,0 lb/ft.jam
CP = 0,9 Btu/lb.°F
k = 0,15 Btu/jam.°F
Persamaan yang digunakan:
ℎ𝐷 𝜌𝑣𝐷 0,8 𝐶𝑝𝜇 0,4
= 0,023 ( ) ( )
𝑘 𝜇 𝑘

a. Tentukan jenis aliran dari larutan garam.


➔ Ditentukan oleh nilai Re dari larutan garam.
𝑙𝑏 𝑓𝑡 1𝑓𝑡
𝜌𝑣𝐷 62,4 3 . 5 𝑠 . 1 𝑖𝑛. 12𝑖𝑛
𝑅𝑒 = = ft = 23400
𝜇 𝑙𝑏 1 𝑗𝑎𝑚
4,0 .
𝑓𝑡. 𝑗𝑎𝑚 3600 𝑠
Oleh karena nilai Reynold aliran = 23400 > 4200, maka alirannya turbulen.

b. Hitunglah suhu larutan garam ketika keluar dari pipa.

157 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
➔ Cari nilai konstanta perpindahan panas konveksinya terlebih dahulu.
ℎ𝐷 𝜌𝑣𝐷 0,8 𝐶𝑝 𝜇 0,4
= 0,023 ( ) ( )
𝑘 𝜇 𝑘

1 𝑙𝑏 𝑓𝑡 1
0,8
𝐵𝑡𝑢 4 𝑙𝑏 0,4
ℎ. 2 𝑓𝑡 62,4 3 . 5 𝑠 . 2 𝑓𝑡 0,9 . 3600 .
ft lb. ℉ 𝑓𝑡. 𝑠
= 0,023 [ ] [ ]
𝐵𝑡𝑢 1 𝑗𝑎𝑚 4 𝑙𝑏 𝐵𝑡𝑢 1 𝑗𝑎𝑚
0,15 𝑗𝑎𝑚. ℉ 3600 𝑠 . 0,15 𝑗𝑎𝑚. ℉ 3600 𝑠
3600 𝑓𝑡. 𝑠
1
ℎ. 2 𝑓𝑡
= 0,023 [23400]0,8 [24]0,4
0,15 𝐵𝑡𝑢
3600 𝑠. ℉
𝐵𝑡𝑢
ℎ = 256,56 . 0,15 . 12𝑓𝑡 −1
𝑠. ℉
𝐵𝑡𝑢
ℎ = 0,1283 .
𝑓𝑡. 𝑠. ℉

➔ Q = m.c.∆𝑇 = mlarutan Cp larutan. (Takhir- Tawal)larutan

Q = hlarutan . A pipa ∆𝑇 = hlarutan . A pipa (Takhir- Tawal)

➔ Cari nilai m larutan terlebih dahulu


2
1
𝜋𝐷 3,14 . (12 𝑓𝑡)
2
𝑓𝑡 𝑓𝑡 3
𝑚 = 𝜌𝑉 → 𝑄 = 𝐴𝑣 = 𝑣= . 5 = 0,027
4 4 𝑠 𝑠
Dengan basis 1 sekon maka V = 0,027 ft.
𝑙𝑏
𝑚 = 6,24 . 0,027𝑓𝑡 3
𝑓𝑡 3
𝑚 = 1,7 𝑙𝑏

➔ Maka nilai Takhir larutan keluar pipa adalah:


𝑄=𝑄
𝑚. 𝑐. ∆𝑇 = ℎ. 𝐴. ∆𝑇
𝐵𝑡𝑢 𝐵𝑡𝑢 1
1,7𝑙𝑏. 0,9 . (𝑇𝑎𝑘ℎ𝑖𝑟 − 50℉) = 0,1283 . 3,14. 𝑓𝑡. 12 𝑓𝑡. (150 − 50)℉
𝑙𝑏. ℉ 𝑓𝑡. 𝑠. ℉ 2
1,53 (𝑇𝑎𝑘ℎ𝑖𝑟 − 50℉) = 40,28
(𝑇𝑎𝑘ℎ𝑖𝑟 − 50℉) = 26,31
𝑇𝑎𝑘ℎ𝑖𝑟 = 76,31℉

158 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
2. Alat Penukar Kalor
a. Yang digunakan adalah pola aliran paralel flow → Analisis sendiri ya,
bandingkan juga dengan profil aliran counter flow.

b. Profil [A] untuk fluida panas dan profil [B] untuk fluida dingin.

c. Semakin besar laju air, maka panas yang diserap oleh air dari steam semakin
besar, terbukti dari suhu steam semakin rendah [lihat gambar a]. Sedangkan
semakin besar air pada steam tetap maka jumlah panas yang diserap dari
steam persatuan massa air semakin kecil, terbukti dari suhu air keluar yang
semakin kecil [lihat gambar 2].

3. Radiasi
Gas pembakaran 10,3 % H2O, 11,4% CO2, dan sisanya inert. Ttotal =1 atm. Dpipa = 6
in. Tgas masuk = 2000°F, Tgas keluar = 1000°F; Twall1 = 800°F dan Twall2 = 600°F.

a. Faktor yang mempengaruhi perpindahan radiasi campuran gas adalah


komposisi, emisivitas, absorpsivitas, Tgas , dll → Jelaskan masing-masing.

b. Menghitung panjang pipa yang dibutuhkan (e = 0,11 dan α = 0,92 serta (mCP)
gas tetap sebesar 90 Btu/J.°F).
𝑞
= 𝑒𝑔 𝑇𝑔 𝛾𝑇𝑔 4 − 𝛼𝑔 𝑇𝑤 𝛾(𝑇𝑤1
4 4
+ 𝑇𝑤2 )
𝐴
(𝑚𝐶𝑝)𝑔𝑎𝑠. ∆𝑇𝑔𝑎𝑠 4 4 4 4 )
= 𝑒𝑔 𝑇𝑔 𝛾(𝑇𝑔1 + 𝑇𝑔2 ) − 𝛼𝑔 𝑇𝑤 𝛾(𝑇𝑤1 + 𝑇𝑤2
𝜋𝐷𝐿
𝐵𝑡𝑢
90 𝐽. ℉ (2000 − 1000)
6
3,14. 𝑓𝑡. 𝐿
12
= 0,11. 5,67. 10−8 (22734 + 12734 ) − 0,92. 5,67. 10−8 (10734 + 8734 )
57324,84 = 83400 𝐿
𝐿 = 6,87 𝑓𝑡 ≅ 20 𝑐𝑚

159 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2012 (2)

Hari, Tanggal : Selasa, 5 Juni 2012


Waktu : 90 Menit
Sifat Ujian : Buka Buku Milik Sendiri
Dosen :-

1. Diketahui udara atmosfer pada T∞ = 250 K dengan kecepatan aliran sebesar U∞ = 30


m/detik mengalir melintas silinder yang berdiameter 2,5 cm. permukaan silinder
dijaga pada temperatur seragam 350 K.
a. Bagaimana anda menentukan laju perpindahan kalor per meter parxjang
silinder.
b. Jika fluida di atas diganti dengan air raksa, bagaimana laju perpindahan kalor
yang
dihasilkan?
c. Apa yang dapat anda simpulkan tentang pengaruh jenis fluida terhadap laju
perpindahan
kalor di atas?
d. Jika kondisi di atas kecepatan fluida mengalami peningkatan, apa yang dapat
anda simpulkan
tentang laju perpindahan kalor yang terjadi?

2. Diketahui sebuah tabung berdiameter 3,6 cm dan panjangnya 0,4 m dan dijaga pada
temperature seragam Tw = 600 K. Tabung tersebut diletakkan secara vertikal dalam
udara diam pada tekanan atmosferik dan T∞ = 300 K.
a. Bagaimana anda menentukan kerugian kalor yang terjadi kc udara?
b. Jika kemudian udara tersebut mengalir dengan kecepatan U∞ = 40 m/detik,
bagaimana
pengaruhnya terhadap rugi kalor yang dihasilkan?
c. Dapatkah anda menentukan besarnya suhu lingkungan pada jarak 15 cm dari

160 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
tabung?

3. Dari suatu kegiatan penelitian diperoleh hasil:


Tabel 1. Nilai Emsivitas normal pada tiap-tiap temperatur
Temperatur Stainless Seng Kuningan Alumunium Tembaga
(K) steel
398 0,227 0,1766 0,115 0,071 0,042
423 0,230 0,1401 0,097 0,073 0,044
473 0,221 0,1627 0,074 0,075 0,048
523 0,201 0,1422 0,075 0,078 0,056
573 0,209 0,1698 0,081 0,080 0,060
623 0,218 0,1790 0,070 0,083 0,062
673 0,202 0,1820 0,067 0,086 0,064

Tabel 2. Nilai Konduktivitas material pada tiap-tiap temperatur

Temperatur Stainless Seng Kuningan Alumunium Tembaga


(K) steel (W/m°C) (W/m°C) (W/m°C) (W/m°C)
(W/m°C)
398 16,57 111,08 136,88 240,11 393,14
423 16,95 110,08 138,38 238,74 391,45
473 17,69 108,08 141,38 235,99 338,07
523 18,45 106,08 144,38 233,24 384,69
573 19,19 104,08 147,38 230,49 381,32
623 20,69 102,08 150,38 227,74 377,95
673 21,07 100,08 153,38 224,98 372,89
Apa yang dapat anda simpulkan dari kedua hasil pada table di atas?

161 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2014

Hari, Tanggal : Jumat, 13 Juni 2014


Waktu : 90 Menit
Sifat Ujian : Open Book
Dosen :-

1. Soal Konveksi
Dalam sebuah penukar kalor aliran silang tabung bersirip, digunakan gas buang panas
untuk memanaskan 2,5 kg/St air dari 35oC dan menjadi 85oC. Gas panas tersebut
dengan Cp = 1,09 kJ/Kg.K masuk pada suhu 2000C dan keluar pada 930C. Koefisien
perpindahan kalor menyeluruh ialah 180W/m2.
a. Hitunglah luas penukar kalor dengan menggunakan metodis NTU-efektivitas.
b. Dapatkan metode LMTD digunakan untuk menentukan luas permukaan pada
soal di atas?
c. Jika jenis penukar kalor yang dipilih tidak tepat, apakah yang terjadi dengan
proses pemanasan?
d. Bagaimana anda mengindikasikan penurunan kinerja alat penukar kalor
sebagai akibat dari adanya pengotoran (fouling)?

2. Soal Radiasi
Gambar skema dinding termos

162 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Diketahui suhu air panas di dalam termos 1000°C, suhu udara 200 dan evisivitas
dinding berwarna perak = 0,02.
a. Hitunglah besarnya kalor yang dipancarkan dari dinding termos bagian dalam
ke bagian luar.
b. Apakah skema dinding termos seperti gambar tersebut dapat berfungsi baik
sebagai insulator?
c. Jika dari satu kegiatan penelitian diperoleh hasil:

Tabel 1. Nilai Emisivitas normal pada tiap-tiap temperatur


Temperatur (K) Stainless Steel Seng Kuningan Alumunium Tembaga
398 0,227 0,1766 0,115 0,071 0,042
423 0,230 0,1401 0,097 0,073 0,044
473 0,211 0,1627 0,074 0,075 0,048
523 0,201 0,1422 0,075 0,078 0,056

Tabel 2. Nilai Konduktivitas material pada tiap-tiap temperatur


Stainless Steel Seng Kuningan Alumunium Tembaga
Temperatur (K)
(W/moC) (W/moC) (W/moC) (W/moC) (W/moC)
398 16,57 111,08 136,88 240,11 393,14
423 16,95 110,08 138,38 238,74 391,45
473 17,69 108,08 141,38 235,99 338,07
523 18,45 106,08 144,38 233,24 384,69

Apa yang dapat anda simpulkan dari kedua hasil pada tabel di atas?

163 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2015 (1)

Hari, Tanggal : -
Waktu : 45 Menit
Sifat Ujian : Buku Tertutup
Dosen :-

1. Alat penukar kalor (APK) yang dipergunakan di berbagai instalasi proses produksi pada
dasarnya merupakan tempat pertukaran energi dalam bentuk panas atau kalor dari
sebuah sumber atau fluida ke sumber yang lain. Komponen ini merupakan peralatan
yang vital karena tanpa menggunakan komponen ini kebanyakan proses industri tidak
dapat dipoerasikan. (Nilai 35%)
a. Faktor pengotoran menjadi bagian penting untuk diperhitungkan dalam
mengukur dalam mengukur kinerja alat penukar kalor. Mengapa demikian?
b. APK pipa ganda berlawanan arah digunakan untuk memanaskan minyak
mesin (Cp = 2100 J/Kg.oC) dari suhu 20oC ke suhu 60oC pada laju aliran
massa 0,3 kg/s dalam pipa tembaga berdiameter 2 cm. Fluida panas yang
digunakan adalah uap kondensasi berada pada sisi luar pipa pada temperatur
masuk 130oC. Jika koefisien perpindahan kalor menyeluruh adalah 650
W/m2.oC, tentukan laju aliran panas dan panjang pipa yang diinginkan.

2. Diketahui suhu air panas di dalam termos 100oC, suhu udara 20oC, dan emivisitas
dinding berwarna perak = 0,02.
a. Bagaimana anda menentukan besarnya kalor yang dipancarkan dari dinding
termos bagian dalam ke bagian luar?
b. Jika dari suatu kegiatan penelitian terhadap material bahan diperoleh hasil:

Tabel 1. Nilai emisivitas normal pada tiap-tiap temperatur

164 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Temperatur Stainless
Seng Kuningan Aluminium Tembaga
(K) steel
398 0,227 0,1766 0,115 0,071 0,042
423 0,230 0,1401 0,097 0,073 0,044
473 0,211 0,1627 0,074 0,075 0,048
523 0,201 0,1422 0,075 0,078 0,056

Tabel 2. Nilai konduktivitas material pada tiap-tiap temperatur


Stainless
Temperatur Seng Kuningan Aluminium Tembaga
steel
(K) (W/moC) (W/moC) (W/moC) (W/moC)
(W/moC)
398 16,57 111,08 136,88 240,11 393,14
423 16,95 110,08 138,38 238,74 391,45
473 17,69 108,08 141,38 235,99 338,07
523 18,45 106.08 144,38 233,24 384,69

Apa yang dapat anda simpulkan dari kedua hasil pada tabel di atas? Manfaat apa yang
bisa anda peroleh dari hasil penelitian di atas? (Nilai 35%)

3. Sari buah akan dikentalkan dari 12% menjadi 28% menggunakan evaporator dengan
luas permukaan 0,38 m2. Suhu maksimum proses yang diperkenankan untuk sari buah
adalah 57oC. Sari buah dialirkan ke dalam evaporator pada suhu tersebut dengan kalor
laten penguapan sebesar 2366 kJ/kg.

Steam digunakan sebagai media pemanas dalam jaket di sekeliling evaporator pada
tekanan 170 k Pada suhu 115oC. Jika koefisien perpindahan kalor menyeluruh adalah
6000 J/m2.detik.oC, berapakah laju evaporasi per-jam? Berikut neraca massa dengan
basis 100 kg umpan: (Nilai 30%)

Solid Liquid Total


Umpan 12 88 100
Produk 12 31 43
Evaporasi 57

165 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERPINDAHAN KALOR 2015 (1)

Asisten Dosen : Kelly Amelinda


Jurusan, Angkatan : Teknik Kimia 2013

1.
a. Karena seiring dengan waktu operasi HE, akan terdapat zat pengotor dalam
pipa yang akan berperan sebagai resistansi pada perpindahan panas. Oleh
karena itu, faktor pengotor perlu dipertimbangkan untuk menghitung
koefiseien perpindahan panas keseluruhan ketika terdapat zat pengotor.

b. Diketahui:
• Cp = 2100 J/Kg.oC
• Th1 = 130 oC
• Tc2 = 20 oC
• Tc1 = 60 oC
• m = 0,3 kg/s
• U = 650 W/m2.oC
• D = 2cm

Ditanya: q?, L?

Asumsi: Fluida panas keluar pada T saturated = 100 oC

Jawab:
q = 𝒎̇ 𝑪 ∆𝑻
= 0,3 kg/s 2100 J/Kg.oC (60-40) = 12600 J/s = 12600 W
∆𝑇
(𝑇ℎ2 − 𝑇𝑐2 ) − (𝑇ℎ1 − 𝑇𝑐1 )
𝑚=
(𝑇 − 𝑇𝑐2 )
ln [ ℎ2 ]
(𝑇ℎ1 − 𝑇𝑐1 )

166 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
(100 − 20) − (130 − 60)
∆𝑇𝑚 = = 74,89 ℃
(100 − 20)
ln [ ]
(130 − 60)

𝒒 = 𝑼 𝑨 ∆𝑻𝒎
𝑞 12600
𝐴= = = 0,2588 𝑚2 = 2588 𝑐𝑚2
𝑈 ∆𝑇𝑚 650 (74,89)

𝑨= 𝝅dL
𝐴 2588
𝐿= = = 412,1 𝑐𝑚 = 4,12 𝑚
𝜋𝑑 3,14 (2)

2.
a. Asumsi: Bagian luar termos merupakan lingkungan dengan luas permukaan
tak hingga, sehingga emisivitas bagian luar = 1.
𝑞 𝜎(𝑇14 − 𝑇24 ) 5,669𝑥10 − 8 (1004 − 204 )
= = = 0,1131
𝐴 1 1 1 1
𝜖1 + 𝜖2 − 1 1 + 0,02 − 1

3. Basis = 100 kg umpan


Jumlah air yang diuapkan = 88 – 31 = 57 kg
Q = 57 kg (2366 kJ/kg) + 6000 J/m2.detik.oC (0,38) (115-57) / 3600 = 134898,733
kJ/hr
Kalor laten steam pada suhu 115oC = 952.2 Btu/lb = 22148,172 kJ/kg
Laju penguapan = 134898,733 kJ/hr / 22148,172 kJ/kg = 6.09 kg/hr

167 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2015 (2)

Mata Kuliah : Perpindahan Kalor


Dosen :-
Sifat Ujian :-
Waktu Ujian : 100 menit

1. Alat penukar kalor (APK) yang dipergunakan di berbagai instalasi proses produksi pada
dasarnya merupakan tempat pertukaran energi dalam bentuk panas atau kalor dari
sebuah sumber atau fluida ke sumber yang lain. Komponen ini merupakan peralatan
yang vital karena tanpa menggunakan komponen ini kebanyakan proses industri tidak
dapat dipoerasikan. (Nilai 35%)
c. Faktor pengotoran menjadi bagian penting untuk diperhitungkan dalam
mengukur dalam mengukur kinerja alat penukar kalor. Mengapa demikian?
d. APK pipa ganda berlawanan arah digunakan untuk memanaskan minyak
mesin (Cp = 2100 J/Kg.oC) dari suhu 20oC ke suhu 60oC pada laju aliran
massa 0,3 kg/s dalam pipa tembaga berdiameter 2 cm. Fluida panas yang
digunakan adalah uap kondensasi berada pada sisi luar pipa pada temperatur
masuk 130oC. Jika koefisien perpindahan kalor menyeluruh adalah 650
W/m2.oC, tentukan laju aliran panas dan panjang pipa yang diinginkan.

2. Diketahui suhu air panas di dalam termos 100oC, suhu udara 20oC, dan emivisitas
dinding berwarna perak = 0,02.
a. Bagaimana anda menentukan besarnya kalor yang dipancarkan dari dinding
termos bagian dalam ke bagian luar?
b. Jika dari suatu kegiatan penelitian terhadap material bahan diperoleh hasil:

Tabel 1. Nilai emisivitas normal pada tiap-tiap temperatur


Temperatur Stainless
Seng Kuningan Aluminium Tembaga
(K) steel

398 0,227 0,1766 0,115 0,071 0,042


423 0,230 0,1401 0,097 0,073 0,044

168 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
473 0,211 0,1627 0,074 0,075 0,048
523 0,201 0,1422 0,075 0,078 0,056

Tabel 2. Nilai konduktivitas material pada tiap-tiap temperatur


Stainless
Temperatur Seng Kuningan Aluminium Tembaga
steel
(K) (W/moC) (W/moC) (W/moC) (W/moC)
(W/moC)
398 16,57 111,08 136,88 240,11 393,14
423 16,95 110,08 138,38 238,74 391,45
473 17,69 108,08 141,38 235,99 338,07
523 18,45 106.08 144,38 233,24 384,69

Apa yang dapat anda simpulkan dari kedua hasil pada tabel di atas? Manfaat apa yang
bisa anda peroleh dari hasil penelitian di atas? (Nilai 35%)

3. Sari buah akan dikentalkan dari 12% menjadi 28% menggunakan evaporator dengan
luas permukaan 0,38 m2. Suhu maksimum proses yang diperkenankan untuk sari buah
adalah 57oC. Sari buah dialirkan ke dalam evaporator pada suhu tersebut dengan kalor
laten penguapan sebesar 2366 kJ/kg.

Steam digunakan sebagai media pemanas dalam jaket di sekeliling evaporator pada
tekanan 170 k Pada suhu 115oC. Jika koefisien perpindahan kalor menyeluruh adalah
6000 J/m2.detik.oC, berapakah laju evaporasi per-jam? Berikut neraca massa dengan
basis 100 kg umpan: (Nilai 30%)

Solid Liquid Total


Umpan 12 88 100
Produk 12 31 43
Evaporasi 57

169 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERPINDAHAN KALOR 2015 (2)

Mata Kuliah : Perpindahan Kalor


Dosen :-
Asisten Dosen : Kelly Amelinda (Teknik Kimia 2013)
ID Line :-

1.
a. Karena seiring dengan waktu operasi HE, akan terdapat zat pengotor dalam
pipa yang akan berperan sebagai resistansi pada perpindahan panas. Oleh
karena itu, faktor pengotor perlu dipertimbangkan untuk menghitung
koefiseien perpindahan panas keseluruhan ketika terdapat zat pengotor.

c. Diketahui:
• Cp = 2100 J/Kg.oC
• Th1 = 130 oC
• Tc2 = 20 oC
• Tc1 = 60 oC
• m = 0,3 kg/s
• U = 650 W/m2.oC
• D = 2cm

Ditanya: q?, L?

Asumsi: Fluida panas keluar pada T saturated = 100 oC

Jawab:
q = 𝒎̇ 𝑪 ∆𝑻
= 0,3 kg/s 2100 J/Kg.oC (60-40) = 12600 J/s = 12600 W
∆𝑇
(𝑇ℎ2 − 𝑇𝑐2 ) − (𝑇ℎ1 − 𝑇𝑐1 )
𝑚=
(𝑇 − 𝑇𝑐2 )
ln [ ℎ2 ]
(𝑇ℎ1 − 𝑇𝑐1 )

170 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
(100 − 20) − (130 − 60)
∆𝑇𝑚 = = 74,89 ℃
(100 − 20)
ln [ ]
(130 − 60)

𝒒 = 𝑼 𝑨 ∆𝑻𝒎
𝑞 12600
𝐴= = = 0,2588 𝑚2 = 2588 𝑐𝑚2
𝑈 ∆𝑇𝑚 650 (74,89)

𝑨= 𝝅dL
𝐴 2588
𝐿= = = 412,1 𝑐𝑚 = 4,12 𝑚
𝜋𝑑 3,14 (2)

2.
a. Asumsi: Bagian luar termos merupakan lingkungan dengan luas permukaan
tak hingga, sehingga emisivitas bagian luar = 1.
𝑞 𝜎(𝑇14 − 𝑇24 ) 5,669𝑥10 − 8 (1004 − 204 )
= = = 0,1131
𝐴 1 1 1 1
𝜖1 + 𝜖2 − 1 1 + 0,02 − 1

3. Basis = 100 kg umpan


Jumlah air yang diuapkan = 88 – 31 = 57 kg
Q = 57 kg (2366 kJ/kg) + 6000 J/m2.detik.oC (0,38) (115-57) / 3600 = 134898,733
kJ/hr
Kalor laten steam pada suhu 115oC = 952.2 Btu/lb = 22148,172 kJ/kg
Laju penguapan = 134898,733 kJ/hr / 22148,172 kJ/kg = 6.09 kg/hr

171 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2016 (1)

Mata Kuliah : Perpindahan Kalor


Dosen :-
Sifat Ujian :-
Waktu Ujian : 120 menit

1. Sebuah termokopel diletakkan di dalam aliran udara bersuhu tinggi yang mengalir di
dalam pipa berukuran 4 inchi. Termokopel menunjukan suhu 550 F, sedangkan suhu
dinding pipa 200 F.
a. Tentukan suhu aktual gas, jika diketahui emisivitas termokopel 0.9 dan h = 12
Btu/jam.ft2.F.
b. Bagaimana nilai emisivitas tersebut berpengaruh pada penunjukan suhu pada alat
termokopel?
2. Alat penukar kalor aliran silang dengan 2 fluida tak campur digunakan dalam proses
pemanasan 0.1 lb/s air dari suhu 50 F ke suhu 180 F. Untuk keperluan ini dipakai gas
buang panas pada suhu 430 F yang kemudian mengalami penurunan suhu 220 F.

a) Jika U dari alat penukar kalor = 20 Btu/jamft2F. Berapakah luas area yang diperlukan
untuk proses tersebut ?
b) Dapatkah anda menjelaskan arti penting nilai U pada alat penukar kalor?

Asumsikan bahwa aliran counter current atau berlawanan, tipe heat exchanger yang
digunakan yaitu HE 1-2, dan gas berada pada shell dan air berada pada tube.

3. Sebuah modul komponen elektronik berbentuk silinder vertikal dengan diameter 4 inchi,
tinggi 10 inchi, dan berada pada suhu 120Of. Diketahui Gb/v2 = 2,09 x 106 ft-3R-1, Kf =
0,01516 Btu/jam.ft.F, Pr = 0,709.

a. Hitunglah energi yang keluar dari modul tersebut jika suhu lingkungan 40oF dengan
tekanan 1 atm.

b. Jelaskan dasar pemilihan persamaan empiris yang digunakan.

172 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS PERPINDAHAN KALOR 2016 (1)

Mata Kuliah : Perpindahan Kalor


Dosen :-
Asisten Dosen : Angelina dan Meylin
ID Line :-

1. a.

b. Emitivitas menentukan kemampuan suatu bahan untuk memancarkan radiasi,


sehingga semakin besar nilainya akan semakin banyak kalor yang dipancarkan bahan
melalui radiasi. Kalau kalor yang dipancarkan termokopel banyak (karena e tinggi),
maka suhu yang ditunjukkan termokopel makin rendah. Galat suhu yang ditunjukan
ini disebut pengaruh radiasi, dimana kesalahan pengukuran terjadi akibat hilangnya
kalor dari alat ukut karena radiasi yang dipancarkan alat ukur.

173 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Asumsi:
• tunak
• aliran udara laminar
• tekanan atmosferik
• perpindahan kalor konduksi antara dinding dan termokopel diabaikan
• radiasi terjadi dari termokopel ke dinding pipa
• konveksi tenjadi dari udara ke termokopel
• luas permukaan pipa >> termokopel
• perpindahan kalor konveksi bebas pada termokopel
• A yang melakukan konveksi = A yang melakukan radiasi karena terjadi pada A
termokopel yang sama
• Suhu merata di seluruh bagian
• Fluida dalam gas hanya udara

2. a. Diketahui :

Tin water = 50 F
Tout water 180 F
T in gas buang = 430
T out gas buang = 220
U = 20 Btu/hr ft2 °F

Konversi semua ke Satuan Internasional , maka


0,1 lb/s = 0.0454 kg/s
T in air = 10° C
T out air = 82,2 °C
T in gas buang = 221,11° C
T out gas buang = 104,44°C
U = 113,565 W//m2C
Ditanyakan Luas Area ?

Jawab :

174 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Perpindahan kalor total dapat ditentukan dari energi yang diserap air oleh karena itu
maka mencari nilai Q = m cp ∆T
= 0.0454 kg/s x 4180 J/kgC x (82.2 – 10) ° C
= 13701,53 J/s = 13701,53 Watt
Mencari LMTD
Aliran Berlawanan maka
∆ T1 = T in gas buang – T out water
= 221,11 C – 82,2 = 138,91° C
∆ T2 = T out gas buang – T in water
= 104,44 – 10 = 94,44 ° C
∆ T1−∆ T2
LMTD = ln ∆ T1 /∆ T2

= 115.24 ° C
Mencari Faktor Koreksi dari Holman halaman 492 ( STHE 1-2)

Definisi indeks pada buku holman


T1 = Suhu fluida masuk sheel
t1= suhu fluida masuk tube

𝑡2−𝑡1
Maka P = 𝑇1−𝑡1
82.2−10
=221.11−10

= 0,34
𝑇1−𝑇2
Maka R = 𝑡2−𝑡1
221.11−104.44
= 82.2−10

= 1,61
Maka dari grafik gambar 10-8 pada halaman 492 Holman didapatkan nilai faktor
koreksi yaitu 0,9

Mencari luas perpindahan kalor

Q = U A F LMTD
𝑄
A = 𝐹 𝑋 𝑇 (𝐿𝑀𝑇𝐷)𝑋 𝑈

175 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
13701,53
= 0,9 𝑋 115,24 𝑋 113,565

= 1,16 m 2

b. Nilai U pada alat penukar nilai kalor adalah koefisien perpindahan kalor menyeluruh
Dimana sebagai nilai koefisien hambatan termal total menuju perpindahan
panas diantara dua fluida.
Koefisien perpindahan panas total juga didefinisikan sebagai hasil gabungan proses
konduksi dan konveksi dengan memperhitungkan hambatan diantara fluida yang
dipisahkan oleh lapisan komposit dan dinding silinder.

176 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
3.

177 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2016 (2)

Hari, Tanggal : 2 Juni 2016


Waktu : 100 Menit
Sifat Ujian : Buka Buku
Dosen :

Kerjakan hanya 3 (tiga) dari 4 (empat) soal di bawah ini, flap soal yang dikerjakan
berbobot sama. Pada tiap soal, ilustrasikan sistem dan tuliskan asumsi yang digunakan dalam
perhitungan.

1.Sebuah modul komponen elektronik berbentuk silinder vertikal dengan diameter 4 inchi,
𝑔𝛽
tinggi 10 inchi, dan berada pada suhu 120F. Diketahui kf = 0,01516 Btu/jam.ft.F, ( 𝑣2 )𝑓 =

2,09.106 ft-3.R-1, Pr = 0,709.

a. Hitunglah energi yang keluar dari modul tersebut jika suhu lingkungan 40 F dengan
tekanan 1 atm.
b.Jelaskan dasar pemilihan persamaan empiris yang digunakan.

2. Sebuah termokopel diletakkan di dalam aliran udara bersuhu tinggi yang mengalir di dalam
pipa berukuran 4 inchi. Termokopel menunjukkan suhu 550 F, sedangkan suhu dinding pipa
200 F.
a. Tentukan suhu aktual gas, jika diketahui emisivitas termokopel 0,9 dan h = 12
Btu/jam.ft2.F.
b. Bagaimana nilai emisivitas tersebut berpengaruh pada penunjukkan suhu pada alat
termokopel?

3. Hitunglah besarnya kalor yang diradiasikan terhadap dinding ruang pembakaran dari mesin
ro ket berbahan bakar oksigen cair - hidrogen cair, yang beroperasi pada tekanan 500 psia
dengan perbandingan campuran yang stoikiometris. Suhu gas 4540 F dan suhu dinding ruang
pembakaran 700 F. Ruang pembakaran dapat diasumsikan sebagai sebuah kubus dengan

178 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
panjang sisi 1 ft dan emisivitas permukaan 0,8.

4. AIat penukar kalor aliran silang dengan 2 fluida tak campur digunakan dalam proses
pemanasan 0,1 lb/detik air dari suhu 50 F ke suhu 180 F. Untuk keperluan ini dipakai gas
buang panas pada suhu 430 F yang kemudian mengalami penurunan suhu menjadi 220 F.
a. Jika U dari alat penukar kalor = 20 Btu/jam,ft2.F, berapakah luas area yang diperlukan
untuk proses tersebut?
b.Dapatkah anda menjelaskan arti penting nilai U pada alat penukar kalor?

179 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS PERPINDAHAN KALOR 2017

Hari, Tanggal : 17 Mei 2017


Waktu : 110 Menit
Sifat Ujian : Buka Buku
Dosen :-

1. Sebuah pipa horizontal air panas bertekanan yang panjang, dengan diameter 15 cm
melewati sebuah ruangan dimana temperatur udaranya adalah 24°C. Temperatur
permukaan pipa adalah 130°C dan emsivitas permukaan 0,95.
a. Dengan megabaikan rugi radiasi dari pipa, berapakah besarnya laju
perpindahan kalor ke udara per meter per panjang pipa?
b. Asumsi apa sajakahh yang digunakan untuk menyelesaikan soal ini?
c. Jelaskan tentang bilangan-bilangan tak berdimensi yang terlihat pada
perhitungan ini.

2. Minyak panas digunakan untuk memanaskan air yang mengalir dengan laju 0,1 kg/s
dari 40°C ke 80°C di dalam sebuah alat penukar kalor selongsong tabung aliran
kontra. Diketahi koefisien perpindahan kalor keseluruhan adalah 300 W/m2.K. Pada
aliran ini air melewati 1 lintasan selongsong dan minyak melewati 2 lintasan tabung.
a. Bagaimana anda menentukan luas perpindahan kalor jika minyak masuk pada
suhu 105°C dan keluar pada 70°C?
b. Jika digunakan jenis alat penukar kalor yang berbeda, yaitu pipa ganda, untuk
semua kondisi-kondisi yang sama pada soal ini, apakah akan dihasilkan luas
perpindahan kalor yang lebih besar atau lebih kecil? Jelaskan jawaban anda.

3. Dua bidang hitam paralel infinit dijaga pada 500°C dan 300°C. Bagaimana anda
menentukan besarrnya laju perpindahan kalor radiasi netto per satuan luas? Jika

180 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
kemudian kedua temperatur masing-masing diturunkan sebesar 50°C, bagaimana
rasio perpindahan kalor dari pengurangan temperatur yang terjadi?

181 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS PERPINDAHAN KALOR 2017

Mata Kuliah : Perpindahan Kalor


Dosen :-
Asisten Dosen : Jessica Farah, Gibranadhi, Rizka Diva Pratiwi
ID Line :-

Jawab:
1. Diketahui:
- 𝑇𝑤 = 130 ℃ = 403 𝐾
- 𝑇∞ = 24 ℃ = 297 𝐾
Ilustrasi sistem:

D = 0,15 m

a)
Langkah 1: Menentukan Persamaan Perpindahan Kalor per Satuan Panjang
𝑞 = ℎ𝐴∆𝑇 = ℎ. 2𝜋𝑟𝐿. ∆𝑇
𝒒
= 𝒉. 𝟐𝝅𝒓. ∆𝑻
𝑳

Langkah 2: Mencari Nilai Suhu Film


𝑇𝑤 + 𝑇∞ 403 + 297
𝑇𝑓 = = = 𝟑𝟓𝟎 𝑲
2 2

Langkah 3: Mendata Physical Properties dari Appendix Holman


𝜇 = 2,075 x 10-5 kg/m.s
𝜌 = 0,9980 kg/m3
Pr = 0,697
K = 0,03003 W/m.oC
1 1
𝛽= = = 2,857 × 10−3
𝑇𝑓 350

Langkah 4: Menghitung Bilangan Rayleigh


𝑔. 𝛽(𝑇𝑤 − 𝑇∞ )𝑑3
𝐺𝑟𝑑 𝑃𝑟 = 𝑃𝑟
𝜇 2
(𝜌)
9,8(2,857 × 10−3 )(403 − 297)(0,15)3
𝐺𝑟𝑑 𝑃𝑟 = 0,697
(20,76 × 10−6 )2
𝐺𝑟𝑑 𝑃𝑟 = 1,62 × 107

182 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Langkah 5: Menghitung Bilangan Nusselt
Menggunakan persamaan untuk 10-5 < GrPr < 1012
1
6

𝐺𝑟𝑃𝑟
̅̅̅̅0,5 = 0,60 + 0,387
𝑁𝑢 16
9 9
0,559 16
[1 + ( Pr ) ]
{ }
1
6

1,62 × 107
̅̅̅̅0,5 = 0,60 + 0,387
𝑁𝑢 16
9 9
0,559 16
[1 + (0,697) ]
{ }
1
1,62 × 107 6
̅̅̅̅0,5 = 0,60 + 0,387 {
𝑁𝑢 }
3,08133
𝑁𝑢 = 32,526

Langkah 6: Menghitung Nilai h


ℎ𝑑
𝑁𝑢 =
𝑘
𝑁𝑢. 𝑘
ℎ=
𝑑
32,526(0,03003)
ℎ= = 𝟔, 𝟓𝟏𝟏𝟕
0,15

Langkah 7: Menghitung Laju Perpindahan Kalor per Satuan Panjang


𝑞
= ℎ. 2𝜋𝑟. ∆𝑇
𝐿
𝑞
= 6,5117 × 2𝜋 × 0,075 × 106 = 𝟑𝟐𝟓, 𝟐𝟔𝟖 𝑾/𝒎
𝐿

b) Asumsi yang digunakan:


o Steady state
o Fluida inkompresibel (densitas dan volume tidak berpengaruh pada
tekanan)
o Suhu di semua titik pada permukaan pipa sama
o Pipa berukuran infinite (sangat panjang) sehingga yang berpengaruh hanya
luas permukaan selimut dari pipa
o Permukaan pipa halus

c) Mintalah LTM teman kalian yang membahas tentang bagian ini!

183 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
2. Diketahui:
- Hot Fluid: Minyak Panas
- Cold Fluid: Air
- 𝑇ℎ1 = 105 ℃ = 378 𝐾
- 𝑇ℎ2 = 70 ℃ = 343 𝐾
- 𝑇𝑐1 = 80 ℃ = 353 𝐾
- 𝑇𝑐2 = 40 ℃ = 313 𝐾
- U = 300 W/m2.K
- 𝑚̇𝑐 = 0,1 𝑘𝑔/𝑠

Asumsi:
- Adiabatis
- Steady-state
- Kalor Spesifik Sama

a) Langkah 1: Mencari Nilai Perbedaan Suhu dengan Metode LMTD


(𝑇ℎ2 − 𝑇𝑐2 ) − (𝑇ℎ1 − 𝑇𝑐1 )
∆𝑇𝑚 =
(𝑇 − 𝑇𝑐2 )
ln [ ℎ2 ]
(𝑇ℎ1 − 𝑇𝑐1 )
(70 − 40) − (105 − 80)
∆𝑇𝑚 =
(70 − 40)
ln [ ]
(105 − 80)
5
∆𝑇𝑚 = = 27,424
ln 1,2

Langkah 2: Mencari Nilai Faktor Koreksi dengan Menggunakan Grafik 10-8


Holman
𝑡2 − 𝑡1 70 − 105
𝑃= = = 0,538
𝑇1 − 𝑡1 40 − 105
𝑇1 − 𝑇2 40 − 80
𝑅= = = 1,143
𝑡2 − 𝑡1 70 − 105
𝐹 = 0,78

Langkah 3: Mencari nilai q


𝑇𝑐1 + 𝑇𝑐2 80 + 40
= = 60 ℃ → 𝐶𝑝 = 4179 𝐽/𝐾𝑔℃
2 2
𝑞
𝑚̇𝑐 𝐶𝑝 =
𝑇𝑐2 − 𝑇𝑐1
𝑞
0,1 × 4179 =
(40 − 80)
𝑱
𝟏𝟔𝟕𝟏𝟔 = 𝒒
𝒔

Langkah 4: Perhitungan Luas dengan qair


𝑚̇𝑐 𝑐𝑎𝑖𝑟 ∆𝑇 = 𝐹. 𝐴. 𝑈. ∆𝑇𝑚
0,1 × 4179 × (80 − 40) = 0,78 × 𝐴 × 300

184 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
16716 = 6417,216𝐴
𝑨 = 𝟐, 𝟔𝟎𝟓 𝒎𝟐

b) 𝑞 = 𝑈𝐴∆𝑇𝑚
16716
𝐴=
300(27,474)
𝑨 = 𝟐, 𝟎𝟑𝟐 𝒎𝟐

b < a karena tidak menggunakan factor koreksi

3. Asumsi:
- Bidang benda berwarna hitam sempurna
- Perpindahan kalor

Diketahui:
Kondisi 1
𝑇1 = 500 ℃ = 773 𝐾
𝑇2 = 300 ℃ = 573 𝐾
Kondisi 2
𝑇1 = 450 ℃ = 723 𝐾
𝑇2 = 250 ℃ = 553 𝐾
Karena benda hitam sempurna, 𝐹12 = 1.0

𝑞 𝜎(𝑇1 4 − 𝑇2 4 ) 5,67 × 10−8 (7734 − 5734 )


= = = 14131,96
𝐴 1 1 1
𝑡1 + 𝑡2 − 1

𝑞 𝜎(𝑇1 4 − 𝑇2 4 ) 5,67 × 10−8 (7234 − 5534 )


= = = 10190,49
𝐴 1 1 1
𝑡1 + 𝑡2 − 1

185 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
TERMODINAMIKA

186 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS TERMODINAMIKA 2010

Hari, Tanggal : Kamis, 30 Desember 2010


Waktu :-
Sifat Ujian :-
Dosen : Kamarza Mulia Ph.D

1. An equimolar mixture of propane (1) and n-butane (2) present as a compressed liquid
mixture is pumped into a flash tank where the mixture is in equilibrium at 30OC.
Determine the equilibrium pressure range that the mixture in the flash tank is present as
a mixture of saturated liquid and saturated vapor. Assume that the mixture behaves
ideally.

2. Suatu campuran biner yang berada pada fasa cair terkompresi dialirkan ke dalam tangki
penyimpanan yang berada pada suhu 50OC dan tekanan 25 kPa. Kelompok perancangan
yang akan menentukan spesifikasi tangki penyimpanan tersebut telah meminta bantuan
anda untuk mengestimasi apakah campuran tersebut setelah masuk ke dalam tangki
akan berupa campuran uap jenuh dan cairan jenuh, seluruhnya cair atau seluruhnya uap.
Kalau berupa campuran uap dan cairan anda juga diminta menentukan fraksi masing-
masing fasa. Komponen campuran adalah kloroform (1) dan 1,4-dioksan (2) dengan
komposisi ekimolar (z1=z2=0,5). Tekanan uap jenuh dapat diperkirakan dari gambar
11.9 (S&vN ed.4) atau gambar 11.8 (S,vN&A ed.5). Data kesetimbangan fasa cair-uap
campuran kloroform (1) dan 1,4-dioksan (2) bersifat tak ideal dapat dikorelasikan
dengan persamaan Margules sebagai berikut:

Ln y1=x22[A12 + 2(A21-A12).X1] dan Ln y2=x12[A21 + 2(A12-A21).X2] dengan A12 = -


0,72 dan A21 = -1,27

187 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS TERMODINAMIKA 2010

Asisten Dosen : Vanessa Geraldine


Jurusan, Angkatan : Teknik Kimia 2013

1. Diketahui :
Ekimolar → x1 = x2 = 0.5

Ditanya :
Range Pressure agar berupa campuran liquid dan vapor.

Jawab :
Berikut ini adalah algoritma yang telah disusun sedemikian rupa untuk menyelesaikan
permasalahan ini.

c. Menentukan keadaan akhir dari campuran yang keluar dari campuran dengan
menghitung nilai dew point dan buble point dari campuran.
1
𝑃𝑏𝑢𝑏𝑏𝑙𝑒 = ∑ 𝑥𝑖𝑃𝑠𝑎𝑡 ...(1) dan 𝑃𝑑𝑒𝑤 = ∑ 𝑦𝑖 ...(2)
𝑖
𝑃𝑠𝑎𝑡
𝑖

d. Menggunakan persamaan Antoine untuk mencari nilai Psat masing-masing


komponen.
𝐵
𝑙𝑛(𝑃 𝑠𝑎𝑡 ) = 𝐴 −
𝐶+𝑇
Nilai A, B, C, dan T untuk masing-masing komponen bisa dicari dari literatur.
Dengan persamaan antoine akan didapatkan nilai Psat dari masing-masing
komponen dalam campuran pada suhu 30oC.

e. Mendapatkan nilai 𝑃𝑏𝑢𝑏𝑏𝑙𝑒 dan 𝑃𝑑𝑒𝑤 dengan menggunakan persamaan (1) dan
(2) dengan x1 = x2 = 0.5 (ekimolar).

188 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
f. Menentukan range P sistem kondenser dengan membandingkan 𝑃𝑏𝑢𝑏𝑏𝑙𝑒 dan
𝑃𝑑𝑒𝑤 dengan ketentuan :
1) Bila 𝑃𝑏𝑢𝑏𝑏𝑙𝑒 < P sistem kondenser <𝑃𝑑𝑒𝑤 → campuran akhir berupa
cair-uap

Oleh karena itu, maka range suhu untuk mendapatkan keadaan akhir sistem cair-uap
dapat dicari dengan menentukan P dew dan P bubble.

2. Dalam buku Smith dan Van Ness terdapat tabel sebelum gambar. Dapat dilihat pada
tekanan 75kPa maka x1 = ±0.3615 dan y1 = ±0.6184. Sehingga campuran berupa
cairan dengan fraksi 36.15% dan uap dengan fraksi 61.84%.

189 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS TERMODINAMIKA 2012

Hari, Tanggal : Selasa, 29 Mei 2012


Waktu : 150 Menit
Sifat Ujian :-
Dosen : Kamarza Mulia Ph.D

1. A tank with 0,1 m3 capacity contains 10 kg of pure refrigerant R-12 at a pressure of


10 bar. The vessel is connected to a feed line that can supply saturated R-12 vapor at
15 bar. The valve is opened to jet R-12 flows into the tank until pressure in the tank is
reaches 12 bar. Determine the final quality of R-12 inside the tank. Use the attached
R-12 table in your calculation.
Hint: Draw and define the system; write down and combine mass/energy balances;
determine initial properties x(1), u(1), and h(in) using saturated properties of R-12 ;
write down formula for final properties m(2), u(2), and final equation in terms of
x(2). Estimate the value of x(2), is it close to 0,6? (Nilai 35)

2. You have been charged with the construction of a new power plant to supply 100MW
of baseload power. The Ecoawe river is really not much more than a stream, and
during times of dry weather, its flow can decline to as low as 50,000 lbs/sec.
However, it’s the only source of cooling available for your power plant, so a site on
the river has been selected and approved by the town council. Your job is to construct
a vapor power cycle. The best turbine available has a shaft power of 100 MW, a
maximum inlet temperature of 1000o F and maximum inlet pressure of 1200 psi.
The Ecoawe is fed by mountain runoff, so it never rise above 59 o F, which makes it
an ideal habitat for the rare back-flipping trout. A downstream temperature rise of
o o
more than 4.0 F (i.e. a temperature over 63 F) will endanger this trout, and the
citizens of Ecoawe will be swift to demand your head on a platter. The water at the
turbine outlet must be at least 80% vapor to avoid turbine damage.
Set up a simple vapor cycle that uses a heat-exchanger as its condenser. Model the
river using a source and a sink and use a splitter and direct half of the river’s flow rate

190 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
as cooling water to the heat-exchanger. Estimate the highest cycle efficiency you can
achieve given the above constraints. (Nilai 40)

3. Elpiji adalah nama dagang yang digunakan oleh PERTAMINA untuk Liquified
Petroleum Gases (LPG). Diketahui komposisi cairan yang berada pada
kesetimbangan dengan uap cair Elpiji di dalam tabung adalah 30 %-mol C3H8 dan 70
%-mol n-C4H10 pada suhu 25oC. Pada kondisi ini, tentukanlah tekanan gas Elpiji di
dalam tabung daam kPa. Sistem propana (1)/n-butana (2) mengikuti hukum Raoult.
Tekanan uap jenuh masing-masing komponen diberikan oleh persamaan Antoine
sebagai berikut: (Nilai 15)
0,05223𝑎
Log10 psat = b – , dengan satuan p dalam mmHg dan t dalam oC
(𝑡+273.1

Fluida a b
Propana 19037 7.217
n-Butana 23450 7.395

4. Diantara campuran biner N2 + CH4 dan CO2 + C2H6, mana yang kesetimbangan fasa
cair-uapnya yang lebih sesuai dengan hukum Raoult (lihat diagram fasa berikut)?
Jelaskanlah mengapa demikian. (Nilai 10)

191 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS TERMODINAMIKA 2012

Asisten Dosen : Vanessa Geraldine


Jurusan, Angkatan : Teknik Kimia 2013

1. Diketahui :

Asumsi :
g. Gas ideal (R=8,314 J/mol.K)
h. Cp = (7/2)R = 29,099 J/mol.K
i. Cv = (5/2)R = 20,7855 J/mol.K
Tidak ada tabelnya, coba dicari dulu untuk tahu nilai hitungannya untuk konversi dan
suhu.
Asumsi T1 = T2 (proses isothermal)
Neraca massa:
𝑚𝑖𝑛 − 𝑚𝑜𝑢𝑡 + 𝑚𝑔𝑒𝑛 = 𝑚𝑎𝑐𝑐
Neraca energi:
𝑚𝑎𝑐𝑐 (𝐸𝑘 + 𝐸𝑝 + ℎ) = 𝑚𝑖𝑛 (𝐸𝑘 + 𝐸𝑝 + ℎ) − 𝑚𝑜𝑢𝑡 (𝐸𝑘 + 𝐸𝑝 + ℎ) + 𝑄 − 𝑊
Ek dan Ep = 0 sehingga:
𝑚2 𝑢2 − 𝑚1 𝑢1 = 𝑚𝑖𝑛 ℎ𝑖𝑛 − 𝑚𝑜𝑢𝑡 ℎ𝑜𝑢𝑡 + 𝑄 − 𝑊
𝑚2 𝑢2 − 𝑚1 𝑢1 = 𝑚𝑖𝑛 ℎ𝑖𝑛 + 𝑄
Maka nilai h(in) bisa dicari dengan asumsi isotermal, u1 = u2
Silahkan diselesaikan sendiri ☺

2. Kerjakan sendiri ya ☺

192 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
3. Algoritma Penyelesaian

a. Tentukan gas elpiji di dalam tabung (satuan kPa).


Menggunakan program Peng-Robinson dengan menggunakan alat bantu
program Fortran maka diharuskan memasukkan data-data yaitu Tc, Pc, 𝜔, xi,
tebakan Psat dan tebakan yi.
Diketahui dari soal :
x1 (C3H8) = 0,3
x2 (n-C4H10) = 0,7
Suhu sistem = 298˚K
Data Tc dan Pc (Sumber: Himmelblau, David M. Basic Principles and
Calculations in Chemical Engineering 6th edition)
Formula Tc (˚K) Pc (atm)
C3H8 369,9 42,0
n-C4H10 425,17 37,47
Data 𝜔 (Sumber : appendix B buku Van Ness)

𝜔 C3H8 = 0,152
𝜔n-C4H10 = 0,2
Setelah menggunakan program didapat hasil sebagai berikut :

193 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Sesuai hasil yang didapat pada program maka Psat sebesar 4,32 bar atau 432
kPa. Sehingga tekanan gas elpiji didalam tabung adalah sebesar 432 kPa.

b. Tentukan tekanan uap jenuh masing-masing komponen.


Dengan menggunakan alat bantu program Fortran dapat ditentukan tekanan
uap jenuh masing-masing komponen dengan input nilai Tc, Pc, 𝜔, Psat, Vl,
dan Vv.
Nilai Psat telah didapat pada program sebelumnya sebesar 4,32 bar
Nilai Vl telah didapat pada program sebelumnya sebesar 94,00 cm3/mol
Nilai Vv telah didapat pada program sebelumnya sebesar 5176,5 cm3/mol
Setelah menggunakan program akan didapat hasil sebagai berikut:
Pada C3H8:

194 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
Didapat Psat propane sebesar 9,366 bar
Untuk n-C4H10 :

Didapat Psat n-butana sebesar 2,384 bar


Menghitung tekanan uap jenuh masing-masing komponen secara manual
menggunakan hukum Raoult

yi pi = xi Psati

yi
P sat i = P
xi

• Untuk C3H8

195 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Nilai y1 didapat dari program pertama sebesar 0,588
0.588
P sat i = 432
0.3
𝐏 𝐬𝐚𝐭 𝐢 = 𝟖𝟒𝟔, 𝟕𝟐kPa
• Untuk n-C4H10
Nilai y2 adalah 1 – y1 yaitu 0,412
0.412
P sat i = 432
0.7
𝐏 𝐬𝐚𝐭 𝐢 = 𝟐𝟓𝟒, 𝟐𝟔kPa

4. Kesetimbangan fasa cair uap yang lebih sesuai jelas terjadi pada campuran biner N2
dan CH4 karena pada CO2 dan C2H6 terjadi keadaan azeotrop, yaitu campuran dari 2
atau lebih komponen yang saling terikat sangat kuat dan sulit untuk dipisahkan
dengan distilasi biasa (lihat lagi penjelasannya di dalam Van Ness).

196 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS TERMODIMAIKA 2013

Hari, Tanggal : Rabu, 22 Mei 2013


Waktu : 75 Menit
Sifat Ujian : Buku Terbuka
Dosen :-

1. Sebuah proses baru untuk pembuatan asetilena telah diusulkan. Proses ini melibatkan
hidrogenasi etana pada katalis yang tepat. Etana murni akan diumpankan ke reaktor
dan campuran asetilena, hidrogen, dan etana yang tidak bereaksi akan ditarik. Reaksi
yang terjadi:
C2H6 → C2H2 + 2H2

Data panas pembentukan etana dan asetilena tersedia pada tabel berikut. Data entropi
mutlak hidrokarbon pada 298oK juga tersedia.

Keadaan standar bahan-bahan yang diambil sebagai komponen murni pada 298 K dan
tekanan 101,3 kPa.
a. Jika etana murni disediakan pada 827oC dan tekanan 101,3 kPa ke reaktor
tersebut dan kesetimbangan reaksi diperoleh. Tentukanlah komposisi produk.
Reaktor dapat diasumsikan beroperasi isotermal pada tekanan total 101,3 kPa.
Abaikan setiap reaksi lainnya yang mungkin terjadi.
b. Apakah konstanta kesetimbangan untuk reaksi pada 25oC dan 101,3 kPa lebih
besar dari, sama dengan, atau kurang dari konstanta kesetimbangan yang
dihitung pada keadaan setimbang dalam bagian (a)? Jelaskan alasan Anda.
c. Berapakah entropi mutlak gas hidrogen pada 25oC dan tekanan 101,3 kPa?

197 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Gunakan hanya data di atas dalam mengevaluasi harga ini.
d. Apakah reaksi katalisis ini lebih baik dilakukan pada tekanan di bawah 101,3
kPa?
e. Apakah reaksi katalisis ini lebih baik dilakukan pada suhu di atas 827oC?
f. Berdasarkan analisis termodinamika diketahui bahwa harga tetapan
kesetimbangan reaksi naik atau turun dengan perubahan suhu. Apakah Anda
akan mempergunakan informasi dalam mengoperasikan reaktor?. Jika ya, apa
yang menjadi pembatas rentang suhu operasi reaktor?

198 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
JAWABAN UAS TERMODINAMIKA 2013

Asisten Dosen :-
Jurusan, Angkatan :-

1. Jawaban disajikan dalam bentuk perpoin.

a. Diketahui :
To = 298 K
To operasi = 827oC = 1100 K
P operasi = 101,3 kPa

Ditanya : Komposisi produk?

Jawab :
Untuk menyelesaikan soal ini, dibagi menjadi beberapa langkah agar lebih
mudah, terarah, dan sistematis.

Langkah Pertama : Meninjau Sistem Reaksi


C2H6 → C2H2 + 2H2
Kondisi awal reaksi soal pada proporsi stoikiometrik adalah:
C2H6 → C2H2 + 2H2
1 mol
Fraksi mol untuk tiap komponen dalam sistem ditentukan oleh persamaan 15.5
buku SVA.
𝑛𝑖 𝑛𝑖𝑜 + 𝑣𝑖 𝜀
𝑦𝑖 = =
𝑛 𝑛𝑜 + 𝜀
Di mana:

𝑣 = ∑ 𝑣𝑖

𝑛𝑜 = ∑ 𝑛𝑖𝑜

199 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
Sistem pada soal:
𝑣𝐶2 𝐻6 = −1
𝑣𝐶2 𝐻2 = 1
𝑣𝐻2 = 2
𝑣 = −1 + 1 + 2 = 2
𝑛𝑜 = 1
Terdapat masukan (umpan) 1 mol ke dalam reaktor sehingga untuk masing-
masing spesies didapatkan:
1−𝜀
𝑦𝐶2 𝐻6 =
1 + 2𝜀
𝜀
𝑦𝐶2 𝐻2 =
1 + 2𝜀
2𝜀
𝑦𝐻2 =
1 + 2𝜀

Langkah Kedua : Menghitung ∆H0298 Dan ∆G0298 Berdasarkan Data Entalpi


Dan Energi Standar Gibbs
∆H0298 / ∆G0298 = C2H2 + 2H2 → C2H6
∆H0298 = 226,899 + ½ .0 – (-84,724) = 311,623 kJ/mol
∆G0298 = 209,340 + ½ .0 – (- 32,908) = 242,248 kJ/mol

Langkah Ketiga : Menghitung Konstanta Kesetimbangan


Persamaan umum untuk menghitung konstanta kesetimbangan reaksi adalah:

-RT Ln K=   i ΔG0i = ΔG0

Di mana ΔG0 merupakan perubahan energi standar Gibbs.


∆𝐺 0 298 242,248 242,248
ln 𝐾 = = = = 0,0978
𝑅𝑇1 (8,314)(298) 2477,572
𝐾 = 1,103

Langkah Keempat : Menghitung Konstanta Kesetimbangan pada saat T =


1100 K
𝐾1 ∆𝐻 0 298 1 1
𝑙𝑛 = ( − )
𝐾2 𝑅 𝑇1 𝑇2

200 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
1,103 311,623 1 1
𝑙𝑛 = ( − )
𝐾2 8,314 298 1100
1,103
𝑙𝑛 = 0,0917
𝐾2
𝐾2 = 1,069

Langkah Kelima : Menghitung Nilai Fraksi Mol Masing – Masing Komponen


(𝑦𝐶2𝐻2 )(𝑦𝐻2 )2
𝐾2 =
𝑦𝐶2 𝐻6
𝜀 2𝜀 2
(1 + 2𝜀 ) (1 + 2𝜀 )
𝐾2 =
1−𝜀
(1 + 2𝜀 )

4𝜀 3
1,069 =
−4𝜀 3 + 4𝜀 3 − 𝜀 + 1
1,069(−4𝜀 3 + 4𝜀 3 − 𝜀 + 1) = 4𝜀 3
−4,276𝜀 3 + 4,276𝜀 3 − 1,069𝜀 + 1,069 = 4𝜀 3
8,276𝜀 3 − 4,276𝜀 3 + 1,069𝜀 − 1,069 = 0
𝜀 = 0,634
Sehingga didapatkan:
1−𝜀 1 − 0,634
𝑦𝐶2 𝐻6 = = = 0,161
1 + 2𝜀 1 + 2(0,634)
𝜀 0,634
𝑦𝐶2 𝐻2 = = = 0,280
1 + 2𝜀 1 + 2(0,634)
2𝜀 2(0,634)
𝑦𝐻2 = = = 0,559
1 + 2𝜀 1 + 2(0,634)

b. Konstanta Kesetimbangan Reaksi pada 25oC (298 K) dan 101,3 kPa


∆𝐺 0 298 242,248 242,248
ln 𝐾 = = = = 0,0978
𝑅𝑇1 (8,314)(298) 2477,572
𝐾 = 1,103
Konstanta Kesetimbangan Reaksi pada 827oC (1100 K) dan 101,3 kPa
𝐾1 ∆𝐻 0 298 1 1
𝑙𝑛 = ( − )
𝐾2 𝑅 𝑇1 𝑇2
1,103 311,623 1 1
𝑙𝑛 = ( − )
𝐾2 8,314 298 1100

201 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
1,103
𝑙𝑛 = 0,0917
𝐾2
𝐾2 = 1,069
Kesimpulan:
Nilai konstanta kesetimbangan reaksi pada suhu 827oC (1100 K) = 1,069 jauh
lebih besar dibandingkan dengan nilai konstanta kesetimbangan reaksi pada
suhu 25oC (298 K) = 1,103. Konstanta kesetimbangan untuk reaksi pada 25oC
dan 101,3 kPa lebih kecil dari konstanta kesetimbangan yang dihitung pada
keadaan setimbang dalam bagian (a). Hal tersebut sesuai dengan teori yang
berlaku, jika reaksi yang terjadi adalah reaksi endoterm, maka tetapan
kesetimbangan akan menjadi lebih besar apabila temperature dinaikkan.

c. Untuk menghitung nilai entropi mutlak dari gas hidrogen pada 25°C dan
tekanan 101,3 kPa dapat memanfaatkan rumus yang menghubungkan
perubahan energi bebas Gibbs terhadap temperatur dan perubahan entalpi dan
entropi dalam suatu reaksi, yaitu:
∆𝐺 = ∆𝐻 − 𝑇. ∆𝑆
∆𝐻 − ∆𝐺
∆𝑆 =
𝑇

∆H0298 / ∆G0298 = C2H2 + 2H2 → C2H6


∆H0298 = 226,899 + ½ .0 – (-84,724) = 311,623 kJ/mol
∆G0298 = 209,340 + ½ .0 – (- 32,908) = 242,248 kJ/mol

311,623 − 242,248
∆𝑆 = = 0,233 𝑘𝐽/𝑚𝑜𝑙 . 𝐾
298

d. Penambahan tekanan dengan cara memperkecil volume akan memperbesar


konsentrasi semua komponen. Sesuai dengan asas Le Chatelier, maka sistem
akan bereaksi dengan mengurangi tekanan. Sebagaimana telah diketahui jika
tekanan gas bergantung pada jumlah molekul dan tidak bergantung pada jenis
gas. Oleh karena itu, untuk mengurangi tekanan, maka reaksi kesetimbangan
akan bergeser ke arah yang jumlah koefisiennya lebih kecil. Sebaliknya, jika
tekanan dikurangi dengan cara memperbesar volume, maka sistem akan

202 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
bereaksi dengan menambah tekanan dengan cara menambah jumlah molekul.
Reaksi akan bergeser ke jumlah yang koefisiennya lebih besar. Berdasarkan
teori di atas, maka dapat disimpulkan jika dampak penambahan tekanan dapat
ditinjau dari nilai bilangan stoikiometri reaksi tersebut. Berdasarkan
perhitungan yang telah dilakukan, total bilangan stoikiometri reaksi tersebut
bernilai positif. Sehingga apabila tekanan reaksi di bawah 101,3 kPa
(pengurangan tekanan), maka akan menyebabkan reaksi bergeser ke arah kiri,
sesuai dengan teori. Akibatnya, komposisi dari reaktan pada kesetimbangan
jauh lebih besar dibandingkan komposisi produknya. Dengan demikian,
perlakuan ini tidak baik untuk dilakukan.

e. Pengaruh perubahan temperatur terhadap tetapan kesetimbangan ditentukan


oleh pihak endoterm dan eksotermnya sistem kesetimbangan. Jika temperatur
dinaikkan, maka kesetimbangan akan bergeser ke pihak endoterm dan
sebaliknya jika temperatur diturunkan, maka kesetimbangan akan bergeser ke
pihak eksoterm. Berdasarkan teori yang telah disebutkan di atas, dapat
disimpulkan jika dampak penambahan suhu dapat ditinjau dari nilai ΔHo
reaksi tersebut. Berdasarkan perhitungan yang telah dilakukan, nilai ΔHo
reaksi tersebut bernilai positif. Sehingga dapat diartikan jika reaksi
hidrogenasi etana ini merupakan reaksi endoterm (membutuhkan kalor).
Sehingga apabila suhu reaksi di atas 827oC, maka nilai K pasti bertambah.
Penambahan nilai K ini mengandung arti bahwa komposisi reaktan akan
berkurang dari semula sebelum suhu dinaikkan dalam kesetimbangannya.
Dengan demikian, perlakuan ini baik untuk dilakukan.

f. Harga tetapan kesetimbangan reaksi sangat bergantung pada temperatur.


Perubahan temperatur dapat menyebabkan terjadinya kenaikan atau penurunan
harga tetapan kesetimbangan. Oleh karena itu, temperatur menjadi salah satu
faktor yang esensial dan perlu mendapatkan perhatian penting dalam
mengoperasikan reaktor. Beberapa hal yang menjadi pembatas rentang suhu
dalam mengoperasikan reactor adalah dengan mempertimbangkan faktor-
faktor yang mempengaruhi dampak temperatur terhadap reaksi yang
berlangsung, yaitu sebagai berikut:

203 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
1) Temperatur maksimum
Temperatur maksimum dapat dicapai pada Tmax tertentu. Di mana Tmax
tersebut dapat menyebabkan ∆H0 sistem bernilai positif dan
memberikan harga Ԑ mendekati satu. Sedangkan, temperatur minimum
adalah temperatur pada Tmin tertentu. Di mana Tmin tersebut
menyebabkan ∆H0 sistem bernilai negatif dan memberikan harga Ԑ
mendekati nol.

2) Ketahanan termal bahan konstruksi reaktor


Setiap bahan terutama logam untuk membuat reaktor memiliki
karakteristik kimia dan fisika yang berbeda – beda, termasuk dalam hal
ketahanan terhadap panas. Setiap bahan belum tentu mampu tahan
terhadap temperatur maksimum dari sistem reaksi. Jadi, perlu ada
penyesuaian antara karakter reaksi sistem dan karakter dari bahan
(pembuat reaktor), yang bisa berarti temperatur maksimum sistem
reaksi tidak dapat dicapai karena keterbatasan kemampuan dari bahan.

3) Sifat natural bahan-bahan yang digunakan dalam reaksi


Beberapa senyawa kimia terutama senyawa organik, sangat peka
terhadap suhu atau dapat dikatakan terdapat beberapa senyawa yang
sangat mudah rusak pada temperatur yang tinggi. Sehingga, penentuan
temperatur operasi juga perlu mempertimbangkan hal tersebut. Oleh
karena itu, perlu diketahui sifat-sifat alamiah reaktan.

204 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS TERMODINAMIKA 2014 (1)

Hari, Tanggal : Selasa, 3 Juni 2014


Waktu : 120 Menit
Sifat Ujian : Open Book
Dosen :-

1. Suatu proses baru dari industri asetilen telah diusulkan. Proses akan melibatkan
dehidrogenasi etana dengan menggunakan katalis yang cocok (sampai saat ini belum
ditemukan). Etana murni akan diumpankan ke dalam reaktor dan menghasilkan
campuran asetilen, hidrogen dan etana yang tidak bereaksi. Reaktor akan beroperasi
pada tekanan tc 101,3 kPa dan pada beberapa suhu yang belum ditentukan. Reaksi
yang terjadi dalam reaktor diasumsikan :
C2H6 → C2H2 + 2 H2
Data berikut menyediakan panas pembentukan etana dan asetilen :
Komponen Δ Gof 298 (kJ/mol) Δ Hof 298 (kJ/mol)
Etana -32.908 -84.724
Asetilen 209.340 226.899
a. Jika suplai etana murni terjadi pada suhu 8270 C dan Tekanan reaktor 101,3
kPa dan jika kesetimbangan tercapai untuk reaksi di atas, tentukan komposisi
effluent. Reaktor diasumsikan beropereasi secara isotermal pada tekanan 101,3
kPa. Abaikan reaksi samping yang mungin terjadi
b. Jika reaksi samping C2H2 + 2 H2→ C2H6 dipertimbangkan maka susunlah
tabel mol kesetimbangan yang menunjukkan jumlah mol berbagai spesi yang
ada dalam keadaan setimbang
c. Bagaimana anda menentukan komposisi effluent pada keadaan setimbang jika
diminta penyelesaian menggunakan fugacity coefficient chart ?
d. Bagaimana pengaruh suhu terhadap konversi reaktan jika kesetimbangan
reaksi tercapai?
e. Bagaimana pengaruh tekanan terhadap konversi reaktan jika kesetimbangan
reaksi tercapai?

205 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
f. Berdasarkan analisis termodinamika diketahui bahwa harga teteapan
kesetimbangan reaksi naik atau turun dengan perubahan suhu. Apakah anda
akan memepergunakan intormasi dalam mengoperasikan reaktor? Jika ya, apa
yang menjadi pembatas rentang suhu operasi reaktor?
2. Jelaskan dengan singkat gambar di bawah ini !

206 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL LATIHAN UAS TERMODINAMIKA 2016

Hari, Tanggal : -
Waktu :-
Sifat Ujian :-
Dosen : Ir. Praswasti PDK Wulan M.T.

Soal ini dibuat langsung oleh Ir. Praswasti PDK Wulan M.T. dan Nurania Saubryani.

1. Aliran dari sumur gas merupakan campuran dengan 50-mol-% methane, 10-mol-%
ethane, 20-mol-% propane, and 20-mol-% n-butane. Aliran ini menjadi umpan dalam
kondensor parsial pada tekanan 17.24 bar, di mana temperatur berada pada 300.15° K
(27°C). Hitunglah fraksi molar dari gas yang terkondensasi dan komposisi dari liquid
dan vapor yang meninggalkan kondensor!
2. Sistem biner dengan senyawa 1 dan 2 terdiri dari fasa uap dan cair pada
kesetimbangan dengan temperatur T, dengan:
• ln γ1 = 1.8 x22
• P1sat = 1.24 bar
• ln γ2 = 1.8 x12
• P2sat = 0.89 bar
Tentukanlah:
a. Tentukanlah range dari nilai zi agar sistem 2 fasa tercapai dengan fraksi cair x1
= 0.65?
b. Berapa nilai tekanan (P) dan fraksi uap yi?
𝐺𝐸
c. Tentukanlah nilai dari 𝑅𝑇 !

3. Air pada kondisi 300°C dan memiliki tekanan sampai 10.000 kPa, berada pada
kondisi kesetimbangan cair-uap dari air murni. Tentukanlah:
a. Nilai koefisien fugasitas?
b. Nilai fugasitas Φ?

Gunakanlah EOS - Vaan Der Wals untuk mendapatkan nilai fugasitas pada tekanan 8000 kPa.

207 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN LATIHAN UAS TERMODINAMIKA 2016

Asisten Dosen : Nurania Saubryani


Jurusan, Angkatan : Teknik Kimia 2013

1. Diketahui:
• 50% methane → Z1
• 10% ethane → Z2
• 20% propane → Z3
• 20& n-butane → Z4
• T = 300,15 K (27°C) = 80,6°F
• P = 17,24 bar = 250 psia

Ditanya:
• Xi
• Yi
• L
• V

Jawab:
1) Mencari nilai K dari grafik 10.14 (k-value for systems of light hydrocarbons),
di mana pada P = 250 psia dan T = 80°F.
K1 (methane) = 10
K2 (ethane) = 2,1
K3 (propane) = 0,68
K4 (n-butane) =0,21

2) Mencari Pisat saat P = 250 psia.


Pisat = Ki . P
P1sat = 10 . 250 = 2500 psia

208 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
P2sat = 2,1 . 250 = 525 psia
P3sat = 0,68 . 250 = 170 psia
P4sat = 0,21 . 250 = 52,5 psia

3) Mencari PBUBBLE, di mana Xi = Zi.


PBUB = X1P1sat + X2P2sat + X3P3sat + X4P4sat
= 0,5 . 2500 + 0,1 . 525 + 0,2 . 170 + 0,2 . 52,5
= 1347 psia

4) Mencari PDEW, di mana Yi = Zi.


1 1 1 1
𝑃𝐷𝐸𝑊 = + + +
𝑌1 𝑌2 𝑌3 𝑌4
𝑃1𝑠𝑎𝑡 𝑃2𝑠𝑎𝑡 𝑃3𝑠𝑎𝑡 𝑃4𝑠𝑎𝑡
1 1 1 1
= + + +
0,5 0,1 0,2 0,2
2500 525 170 52,5
= 185,9 𝑝𝑠𝑖𝑎

5) Mengecek apakah bisa menggunakan Flash Calculation.


Syarat Flash Calculation: PDEW < P < PBUBBLE, di mana:
PDEW = 185,9 psia
Pgiven = 250 psia
PBUB = 1347 psia
Syarat untuk Flash Calculation terpenuhi.

6) Mencari nilai V (komposisi fase uap).


𝑍𝑖 𝐾𝑖
∑ =1
1 + 𝑉(𝐾𝑖 − 1)
0,5.10 0,1.2,1 0,2.0,68 0,2.0,21
+ + + =1
1 + 𝑉(10 − 1) 1 + 𝑉(2,1 − 1) 1 + 𝑉(0,68 − 1) 1 + 𝑉(0,21 − 1)

7) Nilai V dicari dengan trial error.


0,8 → 1,018
? → 1,000
0,9 → 0,991

209 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
𝑉 − 0,8 1,000 − 1,018
=
0,9 − 0,8 0,991 − 1,018
𝑉 = 0,85

8) Mencari nilai L.
L +V = 1
L = 1 – 0,85 = 0,15

9) Mencari molar fraction (Xi & Yi).


𝑍𝑖
Rumus: 𝑋𝑖 = 1+𝑉(𝐾𝑖−1)
0,85
• 𝑋1 = 1+0,85(10−1) = 0,058
0,1
• 𝑋2 = 1+0,85(2,1−1) = 0,052
0,2
• 𝑋3 = 1+0,85(0,68−1) = 0,275
𝑍𝑖
• 𝑋4 = 1+0,85(0,21−1) = 0,609

Rumus: 𝑌𝑖 = 𝑋𝑖 . 𝐾𝑖
• Y1 = 0,058 . 10 = 0,58
• Y2 = 0,052 . 2,1 = 0,109
• Y3 = 0,275 . 0,68 = 0,187
• Y4 = 0,609 . 0,21 = 0,128

2. Diketahui:
• ln γ1 = 1.8 x22
• P1sat = 1.24 bar
• ln γ2 = 1.8 x12
• P2sat = 0.89 bar

Ditanya:
a. Zi, jika Xi = 0,65
b. P dan Yi
c. P dan komposisi saat azerotrop

210 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
𝐺𝐸
d. Nilai dari 𝑅𝑇

Jawab:
a. Mencari range Zi
X1 = 0,65
X2 = 1 – 0,65 = 0,35

𝑙𝑛𝛾1 = 1,8𝑋22 𝑙𝑛𝛾2 = 1,8𝑋12


2 2
𝛾1 = 𝑒 1,8.(0,35) = 1,25 𝛾2 = 𝑒 1,8.(0,65) = 2,14

𝑍𝑖
𝑋𝑖 =
1 + 𝑉(𝐾𝑖 − 1)
𝑋𝑖 + 𝑋𝑖 𝑉 (𝐾𝑖 − 1) = 𝑍𝑖
𝑋𝑖 + 𝑋𝑖 𝑉 𝐾𝑖 − 𝑋𝑖𝑉 = 𝑍𝑖
𝑋𝑖 𝑉 𝐾𝑖 − 𝑋𝑖 𝑉 = 𝑍𝑖 − 𝑋𝑖
𝑉(𝑋𝑖 𝐾𝑖 − 𝑋𝑖) = 𝑍𝑖 − 𝑋𝑖, 𝑑𝑖 𝑚𝑎𝑛𝑎 𝑋𝑖 𝐾𝑖 = 𝑌𝑖
𝑍𝑖−𝑋𝑖
Jadi, 𝑉 = 𝑌𝑖−𝑋𝑖 range untuk V = 0 ≤ V ≤ 1.

Agar sistem dua fase bisa terjadi, maka nilai Z dicari untuk kondisi V = 1 dan
V = 0 (kondisi pada hanya ada satu fase).
• Saat V = 1
𝑍𝑖 − 𝑋𝑖
𝑉=
𝑌𝑖 − 𝑋𝑖
𝑍𝑖 − 0,65
1=
0,6 − 0,65
𝑍𝑖 = 0,6
• Saat V = 0
𝑍𝑖 − 𝑋𝑖
𝑉=
𝑌𝑖 − 𝑋𝑖
𝑍𝑖 − 0,65
0=
0,6 − 0,65
𝑍𝑖 = 0,65
Maka, range Z = 0,6 < Z < 0,65 agar 0 < V < 1.

211 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
b. Jika ΣYi = 1, maka:
P = X1γ1P1sat + X2γ2P2sat
= 0,65 . 1,25 . 1,24 + 0,35 . 2,14 . 0,89
= 1,67 bar

𝑌𝑖 𝑃 = 𝑋𝑖 𝛾𝑖 𝑃𝑖 𝑠𝑎𝑡
𝑋1 𝛾1 𝑃1𝑠𝑎𝑡 0,65 . 1,25 . 1,24
𝑌1 = = = 0,60
𝑃 1,67
𝑋2 𝛾2 𝑃2𝑠𝑎𝑡 0,35 . 2,14 . 0,89
𝑌2 = = = 0,40
𝑃 1,67

c. Menentukan nilai azerotrop


X1 tebakan = 0,6 → syarat azerotrop: Xi = Yi
2
𝛾1(𝑋1 ) = 𝑒 1,8.(1−𝑋1) = 1,33
2
𝛾2(𝑋2 ) = 𝑒 1,8.(𝑋1) = 1,91

Dengan menggunakan iterasi pada excel, didapatkan:


• P = X1γ1(X1)P1sat + (1–X1)γ2(X2)P2sat
= 1,67 bar
𝑋1 𝛾1(𝑋1 ) 𝑃1𝑠𝑎𝑡
• 𝑌1 = = 0,592
𝑃

• X1 = 0,592

𝐺𝐸
d. Nilai dari 𝑅𝑇

• Mencari:
𝑙𝑛𝑌1 = 𝑋22 [𝐴12 + 2(𝐴21 − 𝐴12 )𝑋1 ]
𝑙𝑛𝑌2 = 𝑋12 [𝐴21 + 2(𝐴12 − 𝐴21 )𝑋2 ]
Kemudian mendapat nilai A21 dan A12.
• Express in:
𝐺𝐸
= (𝐴21 𝑋1 + 𝐴12 𝑋2 )𝑋1 𝑋2
𝑅𝑇
𝐺𝐸
Kemudian mencari nilai 𝑅𝑇 .

212 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
3. Kerjakan sendiri.

213 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS TERMODINAMIKA 2016

Mata Kuliah : Termodinamika Teknik Kimia


Dosen : Kamarza Mulia, Ph.D.
Sifat Ujian : Open Book
Waktu Ujian : 120 menit

1. Reaksi Boudouard adalah reaksi redoks berupa disproporsionasi karbon monoksida


menjadi karbon dioksida dan grafit: 2 CO = CO2 + C(s). Jika grafit terbentuk dan
terdeposisi di permukaan katalis, maka katalis akan terdeaktifasi. Berdasarkan analisis
termodinamika, apakah yang dapat anda usulkan utk menghindari hal ini?
2. Jelaskanlah titik temu atau hubungan antara kinetika dengan kesetimbangan kimia. Anda
bisa menggunakan gambar berikut dalam memberikan penjelasan.

3. Diantara campuran biner N2+CH4 dan CO2+C2H6, mana yang kesetimbangan fasa cair-
uapnya yang lebih sesuai dengan hukum Raoult (lihat diagram fasa berikut)?. Jelaskanlah
mengapa demikian.

214 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
4. Write the subroutine ROOTV to calculate saturated vapor root of the van der Waals
equation of state IMPLICIT DOUBLE PRECISION (A-H,O-Z)
R=0.0831441 TC=416.3 PC=33.688
A=27*(R**2)*(TC**2)/(64*PC)
B=R*TC/PC/8
T=333.0
P=13.76
RT=R*T
VGUES=R*TP
CALL ROOTV (P,A,B,RT,VGUES,VCALC)


5. LPG consisting of equimolar propane and n-butane is flashed into a tank maintained at
20OC and 4 bar. Determine if the phase of the product is liquid only, vapor only, or
mixture of liquid and vapor? Assume LPG to be an ideal mixture. Data: at 20OC, vapor
pressure of propane and n-butane are 8.36 and 2.05 bar, respectively.

215 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
MENGGAMBAR TEKNIK
PROSES

216 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
SOAL UAS MENGGAMBAR TEKNIK PROSES 2007

Hari, Tanggal : 2007

Waktu : 60 Menit

Sifat Ujian : Close Book

Dosen : Dr. Ir. Asep Handaya Saputra, M.Eng.

1. Gambarkan block process flow diagram dari fasilitas pemurnian awal gas alam di suatu
lapangan gas. Gas alam mengalir dari lima buah sumur. Sebelum diproses lebih lanjut,
semua aliran tersebut dikumpulkan di gathering station. Semua gas alam yang mengalir
dari sumur tersebut masih mengandung air, CO2 dan H2S. Dari gathering station, pertama
kali dipisahkan airnya. Tahap selanjutnya, proses pemisahan CO2 dan H2S bersamaan. Gas
yang dihasilkan akhirnya dikomprosi untuk dikirim ke pembangkit listrik. (20)
2. Gambarkan simbol yang biasa digunakan dalam gambar P&ID dan sebutkan nama dari
simbol tersebut: (20)
a. Lima simbol alat
b. Lima simbol valve
c. Lima simbol instrumen
3. Jelaskan apa yang membedakan gambar process flow diagram (PFD) dengan gambar
piping dan instrumentation diagram (P&ID). (20)
4. Jelaskan apa yang kamu ketahui tentang gambar isometric. (20)
5. Apa perbedaan antara gambar isometric dengan gambar spool (20)

217 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
SOAL UAS MENGGAMBAR TEKNIK PROSES 2015

Mata Kuliah : Menggambar Teknik Proses


Dosen :-
Sifat Ujian : Closed Book
Waktu Ujian : 45 Menit

1. Untuk gambar di bawah ini:


a. Lengkapi arah aliran (di aliran utama dan instrumentasi), penomoran aliran dan
penomoran peralatan
b. Tuliskan pada gambar untuk tagging (penamaan pada lingkaran instrumentasi yang
kosong)
c. Tuliskan jenis-jenis valve yang ada di dalam gambar
d. Tentukan Controlled Variable (CV) dan Manipulated Variable (MV) serta alasan
pengendaliannya berdasarkan kriteria 7 objektif pengendalian

218 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
2. Untuk gambar di bawah ini:
a. Isi kepanjangan dari singkatan dan penomoran yang diberikan di bagian kanan
gambar
b. Tuliskan jenis-jenis valve yang ada di dalam gambar
c. Tentukan Controlled Variable (CV) dan Manipulated Variable (MV) serta alasan
pengendaliannya berdasarkan kriteria 7 objektif pengendalian

FIC
TIC
YIC
TY
FY
TT
1
2
3

219 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
JAWABAN UAS MENGGAMBAR TEKNIK PROSES 2015

Mata Kuliah : Menggambar Teknik Proses


Dosen :-
Asisten Dosen : Adinda Sofura Azhariyah (Teknik Kimia 2013)
ID Line :-

1. a. Perhatikan gambar di b yaaaa ☺ ....

b
.

220 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M
c. Valves
Gambar valve Keterangan
Flanged closed valve

V-6

Pneumatic/Control valve

V-2

Pneumatic globe valve

V-3
V-2

Relief valve
V-4

Gate valve
V-1

Normally closed globe valve

V-5

Flanged valve
V-6

Normally closed gate valve

V-1

d. 7 Objek Pengendalian
7 Objek Pengendalian CV MV
Safety Pressure Control valve pada
→ Apabila tekanan dalam separator vapour outlet
terlalu tinggi maka valve akan

221 | D I K T A T T E K N I K K I M I A S E M E S T E R 4
terbuka agar tidak terjadi ledakan
Peralatan Level (liquid) Control valve pada
→ Apabila level air terlalu sedikit water outlet
maka valve akan tertutup untuk
mengurangi aliran keluar, apabila
hanya fasa uap yang ada di dalam
separator maka akan merusak
pompa pada aliran water outlet.
Jika level air terlalu tinggi, maka
valve akan terbuka.
Lanjutkan sendiri yaa…

2.
a. Kepanjangan dari singkatan:
• FIC = Flow Indicating Controller
• TIC = Temperature Indicating Controller
• YIC = PLC Indicating Controller
• TY = Temperature Computer Output
• FT = Flow Transmitter
• TT = Temperature Transmitter

b. Valves
• Control Valve
• Cylinder Operated Valve

c. 7 Objek Pengendalian
7 Objek Pengendalian CV MV
Temperatur
Lanjutkan sendiri yaa…

222 | D I K T A T U A S 2 0 1 8 S E M E S T E R 4 T E K K I M