SKRIPSI

PATOFISIOLOGI HIPERGLIKEMI PASCA PENYUNTIKAN

STREPTOZOTOCIN

DWI NABILA PUSPITASARI

NIM 60117036

PROGRAM STUDI KEDOKTERAN

FAKULTAS KEDOKTERAN
UNIVERSITAS CIPUTRA
SURABAYA
2020
 SKRIPSI

PATOFISIOLOGI HIPERGLIKEMI PASCA PENYUNTIKAN

STREPTOZOTOCIN

DWI NABILA PUSPITASARI

NIM 60117036

PROGRAM STUDI KEDOKTERAN

FAKULTAS KEDOKTERAN
UNIVERSITAS CIPUTRA
SURABAYA
2020
 PERSETUJUAN DOSEN PEMBIMBING SKRIPSI

PATOFISIOLOGI HIPERGLIKEMI PASCA PENYUNTIKAN

STREPTOZOTOCIN

Oleh:
Nama : DWI NABILA PUSPITASARI
Nomor Induk Mahasiswa : 60117036
Program Studi : Kedokteran

Telah diperiksa dan disetujui untuk diajukan dan dipertahankan dalam ujian
Skripsi guna mencapai gelar Sarjana Kedokteran (S.Ked) pada Fakultas
Kedokteran Universitas Ciputra Surabaya.

Surabaya, 20 November 2020

Menyetujui,
Pembimbing Utama

(Dr. William Sayogo, dr., M. Imun)

Ketua Program Studi Dekan

(Florence Pribadi, dr., M.Si) (Dr. Hudi Winarso, dr., M.Kes., Sp.And)

i
 PERSETUJUAN TIM PENGUJI SKRIPSI

Pada Hari Selasa, 8 Desember 2020 telah diselenggarakan ujian skripsi, atas nama

Nama : DWI NABILA PUSPITASARI

Nomor Induk Mahasiswa : 60117036
Program Studi : Kedokteran

Dengan judul naskah Skripsi :

PATOFISIOLOGI HIPERGLIKEMI PASCA PENYUNTIKAN
STREPTOZOTOCIN

Nama Status Tanda tangan

1. Imelda Ritunga, dr., M.Med Ed. Ketua penguji _______________

2. Anna Lewi Santoso, dr., M.Si Anggota penguji _______________

3. Dr. William Sayogo, dr., M. Imun Anggota penguji _______________

ii
 PERNYATAAN KEASLIAN SKRIPSI

Saya mahasiswa program studi Kedoktoren Fakultas Kedokteran Universitas

Ciputra Surabaya,

Nama : DWI NABILA PUSPITASARI

Nomor Induk Mahasiswa : 60117036
Program Studi : Kedokteran

Dengan ini menyatakan bahwa, karya Skripsi yang saya buat dengan judul :
“PATOFISIOLOGI HIPERGLIKEMI PASCA PENYUNTIKAN
STREPTOZOTOCIN”

Adalah
a. Dibuat dan diselesaikan sendiri, dengan menggunakan tinjauan lapangan,
tinjauan pustaka, dan jurnal acuan lainnya, seperti yang tertera dalam daftar
pustaka pada Skripsi saya.
b. Skripsi yang saya buat ini, bukan merupakan karya duplikasi (baik sebagian
maupun seluruhnya) dari karya tulis lain yang sudah pernah dipublikasikan
atau yang sudah pernah dipakai untuk mendapatkan gelar di universitas lain,
kecuali pada bagian-bagian sumber informasi yang dicantumkan (sitasi)
dengan cara yang semestinya.
c. Skripsi yang saya buat ini, bukan merupakan karya terjemahan dari buku atau
jurnal acuan yang tertera pada Skripsi saya.

Apabila saya terbukti tidak memenuhi apa yang telah saya nyatakan di atas, maka
Skripsi saya ini dinyatakan BATAL.

Surabaya, 20 November 2020

Yang membuat pernyataan,

Dwi Nabila Puspitasari

iii
 PEDOMAN PENGGUNAAN SKRIPSI

Skripsi ini tidak dipublikasikan, namun tersedia di perpustakaan dalam

lingkungan Universitas Ciputra, diperkenankan sebagai referensi kepustakaan,
tetapi pengutipan harus menyebutkan sumbernya sesuai kebiasaan ilmiah.
Dokumen skripsi ini merupakan hak milik Universitas Ciputra.

iv
 KATA PENGANTAR

Ucapan syukur penulis panjatkan kepada Allah SWT yang telah

memberikan rahmat, kekuatan, dan kesabaran sehingga penulis dapat
menyelesaikan karya tulis atau tugas akhir berupa skripsi. Pada kesempatan ini
penulis ingin mengucapkan penghargaan dan terima kasih yang sebesar-besarnya
kepada :
1. Allah SWT, yang telah memberikan petunjuk, kekuatan, kesabaran serta
keteguhan kepada penulis sehingga dapat menyelesaikan tugas penelitian ini
dengan baik tanpa melalaikan perintah-NYA.
2. Dr. Hudi Winarso, dr., M.Kes., Sp.And, selaku Dekan dan Florence Pribadi,
dr., M.Si, selaku Kepala Program Studi Kedokteran di Universitas Ciputra
yang telah mendukung terus perkembangan saya selama perkuliahan.
3. Imelda Ritunga, dr., M.Med Ed. dan Anna Lewi Santoso, dr., M.Si selaku
penguji.
4. Dr. William Sayogo, dr., M. Imun, selaku Dosen pembimbing yang telah
mengorbakan waktu, tenaga dan semuanya dalam membantu saya untuk
menyelesaikan skripsi.
5. Kedua orang tua, yang tak henti-henti nya memberikan support, doa, dan
kebutuhan materi juga non materinya sehingga penulis tetap termotivasi
dalam proses skripsi.
6. Keluarga yang selalu memberikan dukungan kepada saya.
7. Semua pihak yang tidak dapat disebutkan satu persatu yang telah membantu
hingga terselesainya skripsi ini.
Semoga skripsi yang dibuat ini bisa bermanfaat bagi kita sekalian baik
penulis maupun bagi pembaca. Dengan segala kekurangan dan keterbatasan yang
ada pada penulis, oleh karena itu segala kritik dan saran yang membangun akan
penulis terima demi perbaikan penelitian ini. Atas perhatian dari pembaca, penulis
ucapkan terima kasih.
Surabaya, 20 November 2020

Dwi Nabila Puspitasari

v
 ABSTRAK

Hiperglikemia kronis dan glukotoksisitas merupakan patofisiologi utama model

hewan coba hiperglikemi yang diinduksi streptozotocin (STZ). Patofisiologi
hiperglikemi pasca penyuntikan STZ menjadi model yang berguna untuk
memahami glukotoksisitas sel β pada diabetes. Hiperglikemi yang disebabkan
oleh suntikan STZ dosis tunggal sering disebut sebagai diabetes tipe 1
dikarenakan terjadinya kerusakan sebagian pankreas oleh STZ. Pertanyaan yang
sering muncul adalah apakah model hewan diabetes tipe 1 yang disebabkan STZ
dapat menjadi model yang baik untuk mempelajari mekanisme glukotoksisitas
mitokondria dari sel β. Melalui tinjauan pustaka ini disajikan penjelasan dari
beberapa literatur mengenai proses masuknya STZ ke dalam pulau-pulau
Langerhans dan patofisiologi hiperglikemi kronis, ketidakseimbangan redoks dan
glukotoksisitas mitokondria sel β sehingga terjadi diabetes tipe 1 pasca
penyuntikan STZ dosis tunggal. Penjelasan yang disajikan meliputi: 1) Gangguan
sel β yang berlanjut karena hiperglikemia kronis setelah STZ sepenuhnya
dieliminasi dari tubuh; 2) Diabetes karena STZ dapat dipulihkan dengan
pengobatan insulin, yang menunjukkan bahwa sel β masih merespon pengobatan
dan menunjukkan kemampuan untuk beregenerasi; dan 3) Diabetes karena STZ
dapat diperbaiki atau dikurangi dengan pemberian fitokimia.

Kata kunci: hiperglikemi, sel β, glukotoksisitas, mitokondria, ketidakseimbangan

redoks, streptozotocin

vi
 ABSTRACT

Chronic hyperglycemia and glucotoxicity are the main pathophysiology of

hyperglycemic animal models induced by streptozotocin (STZ). The
pathophysiology of hyperglycemia after STZ injection is a useful platform for
understanding β cell glucotoxicity in diabetes. Hyperglycemia caused by a single
dose of STZ injection is often referred to as type 1 diabetes due to damage to part
of the pancreas by STZ. The question that often arises is whether an animal model
of type 1 diabetes caused by STZ can be a good model for studying the
mitochondrial glucotoxicity mechanism of β cells. This literature review provides
an explanation from several literatures regarding the process of STZ entry into
Langerhans islands and the pathophysiology of chronic hyperglycemia, redox
imbalance and β-cell mitochondrial glucotoxicity resulting in type 1 diabetes after
single dose STZ injection. The descriptions presented include: 1) Continued β cell
disorders due to chronic hyperglycemia after STZ is completely eliminated from
the body; 2) Diabetes due to STZ can be reversed with insulin treatment, which
shows that β cells still respond to treatment and show the ability to regenerate;
and 3) Diabetes due to STZ can be improved or reduced by giving
phytochemicals.

Keywords: hyperglycemia, β cell, glucotoxicity, mitochondria, redox imbalance,

streptozotocin

vii
 DAFTAR ISI

PERSETUJUAN DOSEN PEMBIMBING SKRIPSI ......................................... i

PERSETUJUAN TIM PENGUJI SKRIPSI ....................................................... ii
PERNYATAAN KEASLIAN SKRIPSI ............................................................. iii
PEDOMAN PENGGUNAAN SKRIPSI ............................................................ iv
KATA PENGANTAR ........................................................................................... v
ABSTRAK ............................................................................................................ vi
ABSTRACT ......................................................................................................... vii
DAFTAR ISI ....................................................................................................... viii
DAFTAR TABEL ................................................................................................. x
DAFTAR GAMBAR ............................................................................................ xi
DAFTAR LAMPIRAN ....................................................................................... xii
DAFTAR SINGKATAN .................................................................................... xiii
BAB I PENDAHULUAN ...................................................................................... 1
1.1 Latar Belakang Masalah .................................................................................1
1.2 Tujuan Penulisan ............................................................................................5
1.3 Manfaat Penulisan ..........................................................................................5
1.3.1 Manfaat teoritis ....................................................................................... 5
1.3.2 Manfaat praktis ....................................................................................... 5
BAB II TINJAUAN PUSTAKA........................................................................... 7
2.1 Struktur dan Fungsi Pulau-pulau Pankreas ....................................................7
2.2 Metabolisme Glukosa, Pembentukan ATP Mitokondria, Sekresi
Insulin Oleh Sel β ...........................................................................................8
2.3 Patofisiologi Penyakit Diabetes ......................................................................9
2.4 Mekanisme Glukotoksisitas Pada Sel β........................................................10
2.5 Ketidakseimbangan Reduksi-Oksidasi Dan Gangguan Mitokondria
Pada Sel β yang rusak ...................................................................................11
2.6 Streptozotocin Dan Cara Penyerapan Ke Dalam Organ Target ..................12
2.7 Patofisiologi Streptozotocin Menyebabkan Diabetes Melitus ....................15
2.8 Jenis Diabetes Yang Diinduksi Streptozotocin Melalui Mekanisme
Glukotoksisitas Sel β ....................................................................................19
BAB III KESIMPULAN DAN SARAN ............................................................ 22

viii
 3.1 Kesimpulan ...................................................................................................22
3.2 Saran .............................................................................................................24
DAFTAR PUSTAKA .......................................................................................... 25
LAMPIRAN ......................................................................................................... 28

ix
 DAFTAR TABEL

Halaman

2.1 Karakteristik kimiawi streptozotocin (Lenzen, 2008). .................................... 14

x
 DAFTAR GAMBAR

Halaman
2.1 Jalur metabolisme glukosa dan produksi ATP di mitokondria. ........................ 9
2.2 Mechanisme hiperglikemia yang menyebabkan glukotoksisitas .................... 11
2.3 Ketidakseimbangan redoks antara NADH dan NAD + pada .......................... 13
2.4 Struktur kimia streptozotocin .......................................................................... 14
2.5 Skema patofisiologi efek toksik streptozotocin pada sel β ............................. 17
3.1 Perusakan parsial sel β oleh STZ dan berkurangnya jumlah sel β yang
menyebabkan insufisiensi insulin dan hiperglikemi kronis. ...........................24

xi
 DAFTAR LAMPIRAN
Halaman
Lampiran 1. Tabel Identifkasi Jurnal .................................................................... 28

xii
 DAFTAR SINGKATAN

DM : Diabetes Meletus
GDM : Diabetes Gestasional Mellitus
OGT : Oral Glucose Tolerance Test
IADPSG : International Association of Diabetes and Pregnancy Study
STZ : Streptozotocin
HFD : High Fat Diet
ATP : Adenosine Trifosfat
NADH : Nicotinamide Adenine Dinucleotide Hydrogen
FADH2 : Flavin Adenine Dinucleotide Hydrogen
ROS : Reactive Oxygen Specie
MNU : N-methyl-N-nitrosourea
DNA : Deoxyribonucleic Acid
PARP : Polimerase
NO : Nitrat Oksida
GLUT2 : Glukosa Transporter 2

xiii
 BAB I
PENDAHULUAN

1.1 Latar Belakang Masalah

Dalam dunia pendidikan terutama di bidang ilmu kedokteran, penelitian

menjadi prioritas utama dalam kurikulum pendidikan. Baik mahasiswa, dosen

sampai tenaga kesehatan profesional diwajibkan melakukan penelitian untuk

persyaratan kelulusan maupun untuk kenaikan jabatan. Penelitian juga diperlukan

oleh dunia kedokteran untuk menemukan suatu obat, metode pengobatan sampai

vaksin. Penelitian di bidang ilmu kedokteran dibagi menjadi peneltian di bidang

ilmu kesehatan masyarakat dan di bidang ilmu kedokteran terapan atau secara

klinis. Penelitian di bidang ilmu kedokteran ada beberapa tahapan yaitu uji pre

klinik dan uji klinik. Uji pre klinik meliputi uji pada laboratorium (invitro) dan uji

pada hewan coba (in vivo). Uji klinik meliputi uji klinis fase 1, uji klinis fase 2,

uji klinis fase 3 dan uji setelah dilakukan distribusi masal (Ferrari, 2015).

Penelitian di bidang kesehatan telah meningkatkan kualitas perawatan

medis, mempengaruhi kebijakan kesehatan dan memastikan keamanan

pengobatan pasien. Hasil dari suatu penelitian adalah alat penting yang

memberikan manfaat klinis bagi peneliti untuk membangun pengetahuan dan

menerapkan hasil. Hasil penelitian mencakup dua hal yaitu pertama penerapan

penemuan yang dihasilkan selama penelitian di laboratorium dan dalam studi

praklinis ke pengembangan uji coba lanjut pada manusia. Hal kedua menyangkut

penelitian yang bertujuan untuk meningkatkan penerapan klinis di komunitas.

Efektivitas biaya, strategi pencegahan dan pengobatan menjadi bagian penting

1
dari hasil penelitian. Hasil penelitian merupakan rangkaian proses yang menyatu

di mana temuan penelitian bergerak dari bangku peneliti menuju tempat tidur

pasien sampai komunitas. Rangkaian penelitian meliputi pemindahan pengetahuan

dari penelitian dasar ke penelitian klinis, tahap berikutnya mentransfer temuan

dari studi klinis atau uji klinis untuk penerapan pada komunitas di mana temuan

bertujuan meningkatkan kesehatan. Adanya masalah etika pada penelitian yang

melibatkan manusia terutama yang bersifat invasif dan banyaknya variabel yang

tidak terkontrol yang dapat mempengaruhi studi klinis maka diperlukan model

hewan coba (Burgat, 2015)

Uji pre klinik in vivo menggunakan model hewan coba. Pembuatan model

hewan coba diperlukan agar bisa mewakili kondisi penyakit pada manusia yang

ingin ditemukan obat atau metode pengobatan atau vaksin. Pembuatan model

hewan coba dapat dilakukan dengan berbagai cara antara lain penyuntikan obat

atau senyawa tertentu, tindakan invasif, radiasi, di buat kondisi mati suri.

Pembuatan model hewan coba dengan pemberian obat atau senyawa tertentu ada

beberapa syarat antara lain: pemilihan obat / senyawa tertentu harus sesuai, dosis

pemberian, cara pemberian, rentang waktu pemberian, umur dan berat badan

hewan coba, ketahanan hewan coba terhadap obat atau senyawa tertentu tersebut.

Bila syarat ini tidak terpenuhi, model hewan coba tidak berhasil dan penelitian

diragukan kesahihannya (Kabitzke, et al., 2020).

Tinjauan pustaka ini juga membahas pembuatan model hewan coba kondisi

hiperglikemi. Pemilihan kondisi hiperglikemi dikarenakan diabetes masih menjadi

penyakit metabolik yang masih tinggi penderitanya di Indonesia dengan salah satu

kondisi klinisnya berupa hiperglikemi. Berbagai penelitian dilakukan baik di

2
Indonesia maupun seluruh dunia untuk menemukan obat, metode pengobatan

maupun vaksin untuk mencegah atau mengobati penyakit diabetes. Sudah banyak

publikasi hasil penelitian mengenai diabetes baik mengenai komplikasi, obat,

metode pengobatan sampai pengembangan vaksin mencegah diabetes.

Diabetes melitus (DM) merupakan penyakit kronis yang ditandai dengan

kondisi hiperglikemia yang diakibatkan resistensi insulin dan atau defisiensi

insulin yang disebabkan oleh kegagalan sel beta (𝛽) pankreas memproduksi

hormon insulin. Diabetes dapat diklasifikasikan menjadi empat kategori, diabetes

tipe 1 disebabkan kerusakan autoimun sel 𝛽, biasanya menyebabkan defisiensi

insulin absolut, diabetes tipe 2 disebabkan defek pada reseptor insulin yang

progresif yang melatar belakangi resistensi insulin, Diabetes gestasional mellitus

(GDM) adalah diabetes yang didiagnosis selama kehamilan dan masih belum jelas

penyebabnya, diabetes karena penyebab lain, misalnya cacat genetik pada fungsi

sel 𝛽 atau kerja insulin, diakibatkan obat atau bahan kimia seperti dalam

pengobatan HIV / AIDS atau setelahnya transplantasi organ, dan penyakit lain

pada kelenjar eksokrin pankreas yang ditandai dengan proses trauma difus pada

pankreas dapat menyebabkan diabetes. Diabetes biasanya didiagnosis berdasarkan

kriteria glukosa plasma, baik glukosa plasma puasa atau glukosa plasma 2 jam (2

jam PG) setelah tes toleransi glukosa oral (OGTT) 75 g. Komite Ahli

Internasional menambahkan A1C (ambang batas ≥ 6,5%) sebagai pilihan untuk

mendiagnosis diabetes. Pada diabetes tipe 1, pasien sering menunjukkan gejala

diabetes akut dan kadar glukosa meningkat tajam dan dalam beberapa kasus

timbul ketoasidosis. Diabetes tipe 2 seringkali tidak terdiagnosis sampai

komplikasi muncul. American Diabetes Association (ADA) untuk pertama

3
kalinya merekomendasi bahwa semua wanita hamil yang tidak diketahui

menderita diabetes sebelumnya harus dilakukan OGT 75 g pada usia kehamilan

24-28 minggu, rekomendasi ini berdasarkan konsensus pertemuan International

Association of Diabetes and Pregnancy Study (IADPSG). Di AS kira-kira

seperempat populasi mungkin memiliki diabetes yang tidak terdiagnosis. Diabetes

sekunder meliputi pankreatitis, trauma, infeksi, pankreatektomi, dan karsinoma

pankreas (seperti kistik fibrosis). Bagi klinisi dan pasien, jenis diabetes penting

untuk memahami patogenesis hiperglikemia dan pengobatannya secara efektif

(Powers, 2015).

Untuk lebih memahami patofisiologi diabetes diperlukan pembuatan model

hewan coba kondisi hiperglikemi. Ada beberapa obat atau senyawa yang sering

digunakan dalam pembuatan model hewan coba kondisi hiperglikemi, salah

satunya streptozotocin. Streptozotocin (STZ) adalah bahan kimia yang banyak

digunakan untuk menginduksi eksperimen diabetes pada hewan coba terutama

hewan pengerat. Pada tahun 1963, STZ telah digunakan untuk penelitian baik

penggunaan sendiri atau dikombinasikan dengan bahan kimia lain atau dengan

kombinasi manipulasi makanan untuk induksi diabetes tipe 1 atau tipe 2. Diabetes

tipe 1 diinduksi pada hewan pengerat dengan suntikan STZ tunggal, sedangkan

diabetes tipe 2 diinduksi setidaknya dengan tiga pendekatan, yang meliputi

injeksi STZ setelah pemberian nikotinamid, makanan diet tinggi lemak (high fat

diet / HFD) diikuti dengan injeksi STZ dosis rendah, dan injeksi STZ selama

periode neonatal. Semua model hewan coba diabetes yang terlibat dengan STZ ini

sangat berguna dalam menjelaskan mekanisme atau patogenesis diabetes dan

membantu menguji efektivitas bahan kimia buatan, produk alami, dan agen

4
farmakologis yang berpotensi mampu menurunkan kadar glukosa darah

(Abdollahi & Hosseini, 2014).

Berdasarkan latar belakang diatas yang menunjukkan model hewan coba

sangat penting bagi penelitian. Tinjauan pustaka ini akan membahas penggunaan

STZ untuk membuat model hewan coba kondisi hiperglikemi, selanjutnya akan

dibahas dan dipelajari bagaimana mekanisme aksi streptozotocin dapat membuat

kerusakan sel beta pankreas dan membahas patofisiologi hiperglikemi yang

disebabkan oleh streptozotocin.

1.2 Tujuan Penulisan

Adapun tujuan penulisan skripsi ini adalah memahami jenis diabetes yang

diinduksi streptozotocin melalui mekanisme glukotoksisitas sel β.

1.3 Manfaat Penulisan

1.3.1 Manfaat teoritis

1. Tinjauan pustaka tentang patofisiologi hiperglikemi pasca penyuntikan STZ,

diharapkan dapat memberikan informasi ilmiah bagi para peneliti untuk

lebih memahami cara kerja, dosis dan lama efektivitas STZ sehingga dapat

membuat model hewan coba kondisi hiperglikemi.

2. Tinjauan pustaka ini dapat menjadi dasar teori untuk penelitian lebih lanjut

mengenai mekanisme aksi STZ yang lain yang belum tereksplorasi.

1.3.2 Manfaat praktis

Tinjauan pustaka ini diharapkan bisa membantu para peneliti membuat

model hewan coba kondisi hiperglikemi menggunakan STZ, yang diperlukan

5
untuk meneliti berbagai metode pencegahan, alat dan obat yang tepat yang

diperlukan untuk mencegah dan mengobati diabetes dan komplikasinya.

6
 BAB II
TINJAUAN PUSTAKA

2.1 Struktur dan Fungsi Pulau-pulau Pankreas

Pankreas adalah organ kompleks yang terdiri dari dua kumpulan sel yang

dibentuk dari endoderm yang berbeda secara fungsional dan morfologis. Bagian

eksokrin pankreas terdiri dari sel asinar yang mensekresikan enzim pencernaan,

seperti amilase, lipase, protease, dan nuklease, yang dikeluarkan dari duktus

pankreatikus melalui jaringan tubulus yang mempunyai banyak cabang yang

terdiri dari sel-sel epitel. Sel asinar juga menghasilkan ion bikarbonat dan

elektrolit, yang bersama dengan enzim eksokrin, diangkut melalui duktus utama

menuju ke duodenum, yang berfungsi pada proses pengolahan makanan

(Damasceno, et al., 2014).

Kelompok sel endokrin yang disebut juga pulau Langerhans mewakili

bagian endokrin, yang hanya menyusun kira-kira 2% dari pankreas. Setiap pulau

setidaknya terdiri dari lima jenis sel, yaitu sel β penghasil insulin (65-80%), sel 𝛼

melepaskan glukagon (15-20%), sel 𝛿 penghasil somatostatin (3-10%), sel PP

yang mengandung polipeptida (1%) dan sel 𝜀 mengandung ghrelin. Semua

hormon ini terlibat dalam regulasi metabolisme nutrisi dan homeostasis glukosa.

Bentukan sitoplasma pulau Langerhans hewan pengerat dan manusia

menunjukkan adanya perbedaan. Pulau-pulau Langerhans mencit dan hewan

pengerat lainnya, sel 𝛽 sebagian besar terletak di inti pusat dengan sel 𝛼 dan 𝛿

terlokalisasi di sekeliling sel β membentuk mantel. Pada manusia dan monyet, sel

7
𝛼 tidak terlokalisasi di sekeliling sel β tetapi tersebar di seluruh pulau-pulau

Langerhans (Howarth, et al., 2017).

Interaksi antara sel-sel yang berbeda dalam pulau-pulau Langerhans

diperlukan dalam pengendalian metabolik. Pada kondisi normal, glukagon

berfungsi untuk meningkatkan kadar glukosa darah sedang insulin maupun

somatostatin memberikan efek hambatan terhadap kerja glukagon. Komunikasi

antar hormon ini penting untuk menjaga keseimbangan fisiologis, dan bila terjadi

gangguan pada hormon-hormon ini akan mengakibatkan kadar glukosa darah

yang berlebihan (Powers, 2015).

2.2 Metabolisme Glukosa, Pembentukan ATP Mitokondria, Sekresi Insulin

Oleh Sel β

Sekresi insulin distimulasi glukosa dan berhubungan erat dengan produksi

ATP oleh mitokondria sel β. Sel β memiliki kadar enzim lactate dehydrogenase

yang rendah sehingga sebagian besar piruvat dihasilkan oleh jalur glikolisis dan

diangkut ke mitokondria untuk menghasilkan senyawa pereduksi NADH dan

FADH2, bersama dengan pembakaran sempurna piruvat menjadi CO2. Proses ini

dicapai tidak hanya dari pembentukan asetil-KoA yang dimasukkan ke dalam

siklus Krebs tetapi juga dengan pembentukan oksaloasetat yang berperan sebagai

perantara dalam siklus Krebs. Ketika kadar glukosa darah meningkat setelah

makan, produksi ATP dalam mitokondria sel β juga semakin tinggi (tampak pada

gambar 3). Hal ini menyebabkan peningkatan rasio ATP dalam sitoplasma dan

akibatnya terjadi penutupan saluran kATP pada membran sel. Penutupan saluran

kATP kemudian mendepolarisasi membran dan membuka saluran kalsium,

8
mengakibatkan masuknya kalsium yang memicu eksositosis granul insulin dan

pelepasan insulin. Pada diabetes, proses sekresi insulin yang distimulasi glukosa

secara episodik ini diyakini terganggu (Brashers, et al., 2014).

Gambar 2.1 Jalur metabolisme glukosa dan produksi ATP di mitokondria.

Glukosa diangkut ke dalam sel β melalui transporter GLUT2, diikuti oleh
glikolisis, siklus Krebs, dan fosforilasi oksidatif yang akhirnya membuat ATP dari
pembakaran glukosa. Peningkatan rasio ATP / ADP, dipicu oleh glukosa darah
tinggi, menutup saluran KATP dan membuka saluran kalsium pada membran sel.
Masuknya kalsium memicu eksositosis granul insulin dan pelepasan insulin
selanjutnya. Singkatan: TCA, tricarboxylic acid.
Sumber: (McCance, 2014)

2.3 Patofisiologi Penyakit Diabetes

Hiperglikemia pada diabetes menyebabkan gangguan dan kerusakan

beberapa organ, terutama mata, ginjal, saraf, jantung, dan pembuluh darah.

Diabetes melitus tipe 1 proses autoimun terhadap sel-sel pankreas. Penanda

kerusakan sel 𝛽 adanya autoantibodi pada sel-sel pulau Langerhans, autoantibodi

terhadap insulin, autoantibodi terhadap GAD (GAD65), dan autoantibodi terhadap

9
tyrosine phosphatases IA-2 dan IA-2b. Autoimun yang menghancurkan sel β

memiliki kelainan genetik dan diduga faktor lingkungan memperburuk kondisi

diabetes. Diabetes melitus tipe 2 disebabkan resistensi insulin dan defisiensi

insulin bersifat relatif. Meski etiologi spesifik masih belum diketahui dengan

pasti, kerusakan sel- sel pankreas akibat autoimun tidak terjadi. Kebanyakan

penderita diabetes tipe ini mengalami obesitas, dan obesitas itu sendiri

menyebabkan beberapa derajat resistensi insulin. Peningkatan glukosa plasma dan

asam lemak bebas meningkatkan spesies oksigen reaktif (ROS), yang

mengaktifkan sinyal jalur peradangan seperti protein kinase yang diaktifkan

mitogen dan faktor transkripsi nuclear factor-kappa B (NF-κB). Aktivasi kaskade

inflamasi menyebabkan resistensi insulin (Damasceno, et al., 2014).

2.4 Mekanisme Glukotoksisitas Pada Sel β

Ketika terjadi hiperglikemia persisten kebalikan dari hiperglikemia

episodik, sistem metabolisme seluler berada di bawah tekanan konstan karena

kelebihan glukosa. Kelebihan glukosa ini dapat mengaktifkan banyak jalur

metabolisme atau pensinyalan yang tidak hanya mencoba membuang glukosa

berlebihan tetapi juga menghasilkan lebih banyak ROS, yang menyebabkan stres

oksidatif dan kegagalan sel β. Seperti yang ditunjukkan pada gambar 1, jalur yang

distimulasi hiperglikemia ini mencakup peningkatan rasio NADH / NAD + yang

berkaitan dengan pseudohipoksia dan stres reduktif, jalur heksosamin yang

bertanggung jawab terjadinya perubahan protein O-GlcNAc, aktivasi protein

kinase C, aktivasi jalur poliol yang menghasilkan akumulasi sorbitol dan fruktosa,

pembentukan produk metilglioksal dan glikasi lanjutan, pembentukan enediol, dan

10
stres retikulum endoplasma. Semua jalur ini berujung pada pembentukan ROS

diikuti dengan menurunnya kapasitas antioksidan dalam sel β, kondisi ini

dianggap sebagai penyebab kerusakan sekunder sel β (Hall, 2016) .

Hiperglikemi pada
diabetes

Gangguan NADH/NAD+ (pseudohipoksia, stres reduktif)

Aktivasi protein kinase C
Jalur heksosamin
Akumulasi sorbitol dan fruktosa (aktivasi jalur poliol)
Pembentukan methylglyoxal dan advanced glycation end products
(AGEs)
Pembentukan Enediol
Stres retikulum endoplasmik

ROS dan stres

oksidatif

Kerusakan
sel β

Gambar 2.2 Mechanisme hiperglikemia yang menyebabkan glukotoksisitas

(Hall, 2016).

2.5 Ketidakseimbangan Reduksi-Oksidasi Dan Gangguan Mitokondria Pada

Sel β yang rusak

Sel β pankreas berfungsi jika ada suplai glukosa atau metabolisme nutrisi,

selanjutnya bergabung dengan insulin yang disekresikan. Stimulasi pada sel β

yang terus-menerus oleh kadar glukosa yang tinggi dapat menyebabkan kelelahan

sel β dan kematian sel. Glukotoksisitas diakibatkan dari ketidakseimbangan

redoks antara NADH dan NAD +. Di satu sisi, NADH diproduksi berlebihan oleh

11
kondisi hiperglikemia dan mengaktifkan jalur poliol yang membuat NADH dari

NADPH. Di sisi lain, NAD + dihabiskan oleh enzim seperti poli ADP-ribosilase,

sirtuin, dan CD38 yang menggunakan NAD + sebagai substratnya. Oleh karena

itu, akumulasi NADH yang berlebihan dan potensi menurunnya ketersediaan

NAD + menunjukkan masalah berat dalam daur ulang NADH / NAD + dalam

kondisi diabetes. Mitokondria merupakan bagian penting dalam sel untuk menjaga

keseimbangan redoks dengan mengoksidasi NADH melalui kompleks I dan

FADH2 melalui kompleks II. Pemilihan rantai transpor pada mitokondria

memainkan peran penting berfungsi atau tidaknya sel β, Namun peran setiap

komponen rantai transpor elektron, seperti kompleks I (Gambar 3), dalam

timbulnya glukotoksisitas sel β masih belum diketahui dengan jelas. Termasuk

juga peran mitochondrial dehydrogenases dalam membuat NADH dari NAD +

(Gambar 3) juga masih belum diketahui. Masih banyak hal yang belum dipahami

dalam pembuatan model hewan coba kondisi hiperglikemi yang menggunakan

STZ diperlukan penelitian lebih banyak untuk mengeksplorasi mekanisme

glukotoksisitas di mitokondria, yang melibatkan setiap komponen rantai transpor

elektron (Wu, et al., 2017).

2.6 Streptozotocin Dan Cara Penyerapan Ke Dalam Organ Target

Streptozotocin adalah senyawa antimikroba dan juga digunakan sebagai

senyawa alkilasi kemoterapi, Streptozotocin juga merupakan bahan kimia

diabetogenik yang paling sering digunakan dalam penelitian diabetes.

Streptozotocin bersifat sitotoksik analog glukosa. Sitotoksisitas streptozotocin

12
dibandingkan aloxan, tercapai melalui jalur yang berbeda, mekanisme aksinya

sama-sama selektif pada sel β (Abdollahi & Hosseini, 2014).

Pada tahun 1963, Rakieten dan kawan-kawan melaporkan bahwa

streptozotocin bersifat diabetogenik. Sindrom insulinopenia ini disebut 'Diabetes

streptozotocin' disebabkan oleh nekrosis spesifik pada sel beta pankreas dan

streptozotocin menjadi senyawa pilihan untuk induksi diabetes melitus pada

hewan coba sejak saat itu (Eleazu, et al., 2013).

Setelah beberapa dekade penelitian, penjelasan untuk toksisitas selektif dari

senyawa streptozotocin dapat dipahami. Pemahaman reaktivitas kimiawi senyawa

ini sangat penting untuk memahami diabetogenisitas streptozotocin, ulasan ini

akan memberikan pandangan terintegrasi dari sifat kimia streptozotocin dan efek

biologis (Bulc, et al., 2020).

Gambar 2.3 Ketidakseimbangan redoks antara NADH dan NAD + pada

gangguan sek β

13
Dalam kondisi euglikemik, keseimbangan antara NADH dan NAD + terjaga
dengan baik. Namun, dalam kondisi hiperglikemik, keseimbangan antara NADH
dan NAD + terganggu oleh beberapa mekanisme seperti produksi berlebih NADH
melalui jalur glikolisis dan poliol dan penipisan NAD + oleh poli ADP-ribosilase,
sirtuins, dan CD38 (Wu, et al., 2017).

Gambar 2.4 Struktur kimia streptozotocin

(Lenzen, 2008).

Tabel 2.1 Karakteristik kimiawi streptozotocin (Lenzen, 2008).

Karakteristik kimiawi Streptozotocin

Nama kimia 2-Deoxy-
2([(methylnitrosoamino)carbonyl]amino)D-
glucopyranose

Struktur kimia Cytotoxic methylnitrosourea moiety

(Nmethyl-N-nitrosourea)
attached to the
glucose
(2-deoxyglucose) molecule; glucosamine
derivative
Sifat kimiawi Hydrophilic, beta cell-toxic glucose
Analogue; relatif stabil pada pH 7,4 dan
370C (kurang lebih 1 jam);
DNA alkylating agent; Protein alkylating
agent; NO donor

Bentuk keracunan pada sel β DNA alkylation

14
Untuk penelitian in vivo, larutan pekat dalam 0,01 mol / l HCl, disimpan dalam
es, harus cepat digunakan dan ditambahkan ke media uji sesaat sebelum
percobaan dimulai untuk mendapatkan konsentrasi akhir. Untuk injeksi, larutan
stok harus diencerkan dengan larutan salin yang dingin (NaCl 0,9%) segera
sebelum injeksi.
Untuk percobaan in vitro, larutan stok pekat dalam 0,01 mol / l HCl, disimpan di
atas es, harus cepat digunakan dan ditambahkan ke media uji sesaat sebelum
percobaan dimulai untuk mendapatkan hasil akhir konsentrasi. Untuk injeksi,
paling sesuai digunakan larutan stabil dalam buffer sitrat (pH 4,5).

Streptozotocin menghambat sekresi insulin sehingga menyebabkan keadaan

diabetes melitus yang bergantung pada insulin. Efek tersebut dikaitkan dengan

sifat kimianya yang spesifik, yaitu potensi alkilasinya (tabel 1). Streptozotocin

merupakan analog nitrosourea di mana bagian N-metil-N-nitrosourea (MNU)

(gambar 4) dihubungkan karbon-2 dari heksosa. Efek toksik streptozotocin dan

senyawa alkilasi yang terhubung secara kimiawi membutuhkan penyerapannya ke

dalam sel. Nitrosurea bersifat lipofilik dan penyerapan ke jaringan melalui

membran plasma berlangsung cepat. Bila terjadi substitusi heksosa, streptozotocin

menjadi kurang lipofilik. Streptozotocin terakumulasi secara selektif ke dalam sel

beta pankreas melalui ikatan lemah dengan GLUT2 yang merupakan transporter

glukosa ke dalam membran plasma. Toksisitas streptozotocin lebih besar pada sel

yang mengekspresikan GLUT2 karena terjadi akumulasi N-methyl-N-nitrosourea

(MNU), yang mengalkilasi DNA sel. Streptozotocin juga merusak organ lain yang

mengekspresikan transporter GLUT2, seperti ginjal dan hati (Lee, et al., 2003).

2.7 Patofisiologi Streptozotocin Menyebabkan Diabetes Melitus

Toksisitas streptozotocin bergantung pada aktivitas alkilasi DNA dari

bagian metilnitrosourea, terutama di posisi O6-guanine. Transfer gugus metil dari

streptozotocin ke molekul DNA menyebabkan kerusakan, yang menghasilkan

15
fragmentasi DNA. Glikosilasi protein menjadi faktor perusak tambahan. Dalam

upaya untuk memperbaiki DNA, enzim poli (ADP-ribosa) polimerase (PARP)

terstimulasi secara berlebihan. Kondisi ini berakibat pengurangan NAD+ dalam

sel, dan selanjutnya diikuti penurunan ATP. Menipisnya simpanan energi dalam

sel menyebabkan nekrosis sel beta. Metilasi DNA yang diakibatkan oleh

streptozotocin berkontribusi pada cacat fungsional dan kematian dari sel beta

(Graham, et al., 2011).

Penghambat poli ADP-ribosilasi menekan proses metilasi DNA.

Penghambat poli ADP-ribosilasi yaitu injeksi nikotinamida dan lainnya yang

diberikan sebelum atau saat pemberian streptozotocin dapat melindungi sel beta

terhadap efek toksik dari streptozotocin dan mencegah perkembangan keadaan

diabetes (Rodwell, 2018).

Peran alkilasi dalam kerusakan sel beta memberi efek toksik lebih ringan

dibandingkan proses metilasi, karena O etilguanin kurang toksik dibandingkan O6

–methylguanine. N-ethyl-N-nitrosourea dan ethyl methanesulphonate tidak

bersifat toksik terhadap sel produksi insulin. Mekanisme toksik streptozotocin

terjadi karena alkilasi, dengan dasar metilasi DNA yang lebih beracun

dibandingkan etilasi (Yin, et al., 2006).

Efek diabetogenik dari streptozotocin bukan hanya akibat alkilasi tetapi

potensinya untuk bertindak sebagai donor nitrat oksida (NO) intraselular. Baik

streptozotocin dan MNU mengandung gugus nitroso (gambar 4) dan dapat

membebaskan NO. Streptozotocin telah terbukti meningkatkan aktivitas guanylyl

cyclase dan pembentukan cGMP, yang merupakan efek karakteristik dari NO.

Efek toksik streptozotocin yaitu pembentukan ROS termasuk superoksida dan

16
radikal hidroksil yang berasal dari pelepasan hidrogen peroksida selama

metabolisme hipoksantin, ROS ini mungkin menyertai efek streptozotocin dan

mempercepat proses penghancuran sel beta tetapi ROS bukan penyebab utama

kematian sel β (Lenzen, 2008).

Streptozotocin

Sel beta selektif mengambil streptozotocin melalui transporter glukosa

GLUT2
Toksisitas sel β melalui

alkilasi
Kematian sel β melalui nekrosis

Insulin-dependent diabetes mellitus

Streptozotocin menginduksi diabetes

Gambar 2.5 Skema patofisiologi efek toksik streptozotocin pada sel β

(Howarth, et al., 2017).

Streptozotocin awalnya adalah agen antimikroba yang juga digunakan

sebagai senyawa alkilasi pada kemoterapi. Streptozotocin (STZ) untuk pembuatan

model hewan coba diabetes, dilarutkan terlebih dulu dalam buffer sitrat dan

diberikan parenteral intraperitoneal atau intravena. Begitu berada dalam sirkulasi

darah, STZ bergerak menuju pankreas di mana secara selektif terakumulasi di sel

beta pankreas melalui transporter glukosa GLUT2 yang sifat afinitasnya rendah di

membran plasma. STZ juga mampu merusak organ lain yang mengekspresikan

17
GLUT2 termasuk ginjal dan hati. Toksisitas STZ tergantung pada aktivitas

alkilasi DNA-nya bagian methylnitrosourea dan metilasi molekul DNA. Transfer

gugus metil dari STZ ke molekul DNA menyebabkan kerusakan dan fragmentasi

DNA. Toksisitas sel beta juga ditimbulkan dari aksi ROS. Apapun mekanisme

aksinya, konsekuensi dari STZ pengobatan adalah kerusakan pada sel-sel beta

pulau pankreas dan penurunan kemampuan sel-sel ini untuk memproduksi insulin

(Gambar 5). Efek patofisiologis STZ bergantung pada dosis dan durasi pemberian

(Sayogo, et al., 2018).

Karakteristik umum diabetes pada hewan coba yang diinduksi STZ berupa

hipoinsulinemia, hiperglikemia, poliuria, menurunnya berat badan, polidipsia dan

polifagia. Berdasarkan penelitian oleh William Sayogo dan kawan-kawan dosis

STZ yang diberikan pada tikus putih jenis Wistar dengan berat badan antara 150 –

250 gram adalah 45 - 60 mg / kg berat badan tikus putih dengan injeksi dosis

tunggal ssintraperitoneal. Dengan dosis STZ sebesar itu kadar glukosa darah

meningkat menjadi rata-rata 400 mg / dl dibandingkan dengan kelompok kontrol

yang tidak diberi STZ dengan rata-rata kadar glukosa darah 100 mg / dl,

peningkatan ini mampu bertahan selama 1-2 bulan. Glukosa dalam urin juga

meningkat juga terjadi glikosilasi hemoglobin, sehingga hemoglobin terglikosilasi

banyak digunakan sebagai kriteria diagnostik untuk DM. Hemoglobin

terglikosilasi dapat meningkat menjadi rata-rata 8,5% pada tikus yang diberi STZ

dibandingkan kelompok kontrol. Terjadi juga perubahan profil lipid termasuk

peningkatan kolesterol, peningkatan asam lemak bebas. peningkatan peptida

natriuretik pada atrium dan otak, peningkatan kreatinin (Sayogo, et al., 2020).

18
2.8 Jenis Diabetes Yang Diinduksi Streptozotocin Melalui Mekanisme

Glukotoksisitas Sel β

Beberapa penelitian menunjukkan mekanisme glukotoksisitas mitokondria

sel β pada model hewan diabetes yang diinduksi oleh injeksi STZ intraperitoneal

tunggal. Model diabetes tipe 2 dapat dibuat menggunakan STZ karena efek

glukotoksisitas mitokondria dalam sel β menimbulkan kerusakan reseptor

transporter glukosa pada membran plasma sel, akibatnya glukosa tidak dapat

masuk ke dalam sel dan menyebabkan kondisi kadar glukosa lebih tinggi dalam

darah dibandingkan dalam sel (kelaparan sel). Kerusakan reseptor pada membaran

sel ini merupakan ciri dari diabetes tipe 2, ini menjawab pertanyaan apakah STZ

yang biasa digunakan untuk membuat model diabetes tipe 1 dapat juga membuat

model diabetes tipe 2. Untuk injeksi intraperitoneal, STZ dapat dihilangkan

dalam waktu 48 jam setelah pemberian dan efek metilasi DNA-nya dengan cepat

berkurang karena tidak ada peningkatan lebih lanjut dalam metilasi DNA yang

dapat dideteksi setelah 24 jam terpapar STZ. Beberapa penelitian menunjukkan

bahwa toksisitas (Mishra, et al., 2018).

Hiperglikemi yang disebabkan STZ dapat diturunkan dengan pengobatan

insulin. Penelitian Grossman dan kawan-kawan menunjukkan bahwa kadar

glukosa darah pada tikus dengan kondisi hiperglikemi yang menggunakan STZ

dapat dikendalikan oleh insulin dengan meningkatkan regenerasi sel β di

pankreas. Efek pasca penyuntikan STZ menunjukkan bahwa tidak berfungsinya

sel β tetap terjadi meskipun STZ dalam darah sudah tidak ada sehingga terjadi

hiperglikemia. Kondisi hiperglikemik dapat diubah menjadi euglikemia dengan

suplemen insulin, yang meningkatkan fungsi sel β melalui regenerasi sel β.

19
Penelitian oleh William Sayogo menunjukkan hewan coba yang disuntik STZ

akan kekurangan insulin dan mampu bertahan hidup cukup lama dengan kondisi

hiperglikemi. Banyak hewan coba diabetes dapat hidup lebih dari 24 minggu

tanpa intervensi apapun setelah injeksi STZ dosis tunggal, hal ini menunjukkan

bahwa dosis STZ yang diberikan sebagai injeksi tunggal hanya menghancurkan

sebagian pulau Langerhans dan sel β dan diabetes yang terjadi disebabkan oleh

glukotoksisitas sel β bukan dikarenakan keracunan akut STZ. Hasil penelitian

Grossman sangat sesuai dengan penelitian William Sayogo bahwa fungsi sel β

merespon pengobatan dan mungkin memiliki kemampuan regenerasi yang

terbatas setelah kerusakan pankreas parsial oleh STZ. Di sisi lain, penggunaan

dosis STZ tinggi (misalnya 100 mg / kg untuk tikus) dapat menyebabkan

kerusakan hampir total dari sel β, yang menyebabkan kematian cepat pada

hewan.coba. Penggunaan dosis STZ yang sangat tinggi tidak pernah dipakai uji

coba untuk penelitian seleksi obat, patofisiologi glukotoksisitas pada diabetes dan

komplikasi diabetes (Ozdemir, et al., 2009).

Tidak berfungsinya sel β pada diabetes yang diakibatkan STZ kebanyakan

dapat diatasi dengan ekstrak alami tumbuhan atau fitokimia. Keadaan inilah

menjadi dasar menggunakan model hewan coba kondisi hiperglikemi

menggunakan STZ untuk skrining obat atau senyawa yang direncanakan sebagai

obat diabetes. Selain alkilasi DNA yang diduga terlibat dalam toksisitas sel β,

kerusakan oksidatif oleh spesies oksigen reaktif atau nitrogen reaktif juga terlibat

dalam perusakan sel β oleh STZ. Oleh karena itu, banyak penelitian telah

menunjukkan bahwa ekstrak tumbuhan atau fitokimia yang memiliki sifat

antioksidan. Ekstrak proanthocyanidins pada biji anggur, kurkumin, resveratrol,

20
dan pycnogenol semuanya telah diteliti ternyata mampu meningkatkan fungsi sel

β pada hewan coba diabetes akibat STZ. Mekanisme yang mendasari fitokimia ini

kemungkinan besar karena kemampuannya untuk mencegah glukotoksisitas

hiperglikemi dengan menurunkan kadar glukosa darah dan / atau memfasilitasi

pembakaran glukosa, yang pada akhirnya menyeimbangkan reaksi redoks antara

NADH dan NAD +, membuat lingkungan mikro yang kondusif untuk proliferasi

sel β yang belum rusak atau regenerasi sel β dari sel jenis lain seperti sel asinar

dan sel duktal. Jadi sel β yang mengalami gangguan tidak akan menjadi target

langsung untuk diperbaiki oleh fitokimia ini atau senyawa penurun glukosa

lainnya (Liu, et al., 2018).

21
 BAB III
KESIMPULAN DAN SARAN

3.1 Kesimpulan

Efek awal toksisitas STZ terhadap sel β bersifat jangka pendek dan efek

selanjutnya berupa kematian sel β dan gangguan fungsional dari sel β yang

disebabkan toksisitas hiperglikemik, mekanisme glukotoksisitas dalam

mitokondria sel β pada sel β yang tidak rusak dirangkum pada gambar 6. Sel-sel β

yang dihancurkan STZ selanjutnya akan mengalami nekrosis dan dibersihkan

oleh makrofag. Pada sel-sel β yang dirusak STZ tidak ditemukan mitokondria

utuh sebaliknya sel-sel β yang terpapar STZ yang masih hidup atau terganggu

fungsi sel β-nya berupa hiperglikemi masih ditemukan mitokondria utuh.

Berdasarkan temuan ini, model hewan kondisi hiperglikemi yang diinduksi

dengan injeksi STZ dosis tunggal dapat berfungsi sebagai model untuk

mempelajari mekanisme glukotoksisitas dalam mitokondria sel β. Isolasi

mitokondria dan analisis fungsional sel β jangan dilakukan segera setelah injeksi

STZ untuk menghindari efek toksik akut STZ pada mitokondria. Sebaliknya,

mitokondria baru dapat diisolasi ketika kondisi hiperglikemi telah terbentuk

setelah STZ benar-benar dihilangkan dari tubuh. Prinsipnya adalah harus

dibedakan antara keadaan toksisitas akut STZ dan glukotoksisitas diabetik ketika

diperlukan untuk pembuatan kondisi hiperglikemi menggunakan STZ tertentu.

Diabetes tipe 1 yang diinduksi STZ pada hewan pengerat sudah

merupakan bentuk pasti dan diterima seluruh jurnal penelitian sebagai model

untuk penelitian yang mempelajari patogenesis diabetes dan komplikasinya.

22
Model hiperglikemi oleh STZ memiliki kelebihan dan kekurangan dibandingkan

model eksperimen lainnya yang menggunakan STZ seperti STZ yang diinjeksikan

pada periode neonatal (STZ-neonatal) dan kombinasi antara STZ dengan diet

tinggi lemak (STZ-HFD). Dibandingkan model STZ-neonatal dan kombinasi

STZ-HFD yang digunakan untuk mempelajari mekanisme glukotoksisitas dalam

mitokondria sel β, model injeksi STZ dosis tunggal jauh lebih murah dan lebih

sedikit memakan waktu. Pada model STZ-HFD, pemberian HFD biasanya

memakan waktu beberapa minggu atau beberapa bulan diikuti dengan suntikan

STZ dosis rendah. Begitu juga model STZ-neonatal juga membutuhkan waktu

yang lebih lama untuk berkembangnya diabetes, yaitu merawat dan memanipulasi

hewan yang masih neonatal. Di sisi lain, kelemahan model injeksi STZ dosis

tunggal adalah tidak menciptakan patofisiologi resistensi insulin, yang dapat

diamati pada model STZ-neonatal dan STZ-HFD. Kelemahan lain, belum adanya

protokol standar untuk persiapan dan metode penyuntikan STZ, kondisi

hiperglikemi sangat bervariasi karena faktor-faktor seperti usia hewan, jenis

kelamin, berat badan, spesies, dan strain. Selain itu, model hewan coba diabetes

tipe 1 menggunakan STZ belum tentu mencerminkan keadaan penyakit sama

pada manusia. Walaupun ada banyak kelemahan, model injeksi STZ dosis tunggal

sangat baik untuk membuat model hewan coba hiperglikemi yang hemat biaya,

hemat waktu, nyaman untuk penelitian mengenai patofisiologis gangguan sel β

yang disebabkan oleh glukotoksisitas diabetik.

23
 Populasi sel β

Pengurangan jumlah sel Nekrosis dan

dieliminasi oleh
β makrofag

Insufisiensi insulin

Hiperglikemi kronis

Sisa sel β yang masih

hidup

Sel β yang sehat

Sel β yang dirusak STZ
Sel β yang terganggu fungsinya menimbulkan hiperglikemi

Gambar 6 Perusakan parsial sel β oleh STZ dan berkurangnya jumlah sel β yang
menyebabkan insufisiensi insulin dan hiperglikemi kronis.
Sel β yang dirusak oleh STZ mengalami nekrosis dan dieliminasi oleh makrofag,
sisa sel β yang bertahan hidup yang terpapar STZ menjadi hiperglikemi yang
menetap yang dapat mengganggu fungsi mitokondria pada sel β yang tersisa.

3.2 Saran

Berdasarkan tinjauan pustaka diatas menunjukkan model hewan coba yang

menggunakan STZ menunjukkan DM tipe 1. Untuk menjawab pertanyaan apakah

STZ juga bisa membuat model hewan coba DM tipe 2 masih perlu dilakukan

banyak penelitian untuk mengetahui mekanismenya.

24
 DAFTAR PUSTAKA

Abdollahi, M. & Hosseini, A., 2014. Streptozotocin. Dalam: P. Wexler, penyunt.

Encyclopedia of Toxicology. 3rd penyunt. London: Elsevier, pp. 4/ 402-404.

Brashers, V. L., Jones, R. E. & Huether, S. E., 2014. Mechanisms of Hormonal

Regulation. Dalam: K. L. McCance & S. E. Huether, penyunt.
PATHOPHYSIOLOGY: THE BIOLOGIC BASIS FOR DISEASE IN
ADULTS. 7th penyunt. Missouri: Elsevier Inc, pp. 689-711.

Bulc, M., Całka, J. & Palus, K., 2020. Effect of Streptozotocin-Inducted Diabetes
on the Pathophysiology of Enteric Neurons in the Small Intestine Based on
the Porcine Diabetes Model. International Journal of Molecular Sciences,
21(2047), pp. 1-25.

Burgat, F., 2015. Improving Animals, Improving Humans: Transpositions and

Comparisons. Dalam: S. Bateman, et al. penyunt. Inquiring into Animal
Enhancement: Model or Countermodel of Human Enhancement?. 1st
penyunt. New York: PALGRAVE MACMILLAN, pp. 34-48.

Damasceno, D. C. et al., 2014. Streptozotocin-Induced Diabetes Models:

Pathophysiological. BioMed Research International, 2014(Article ID
819065), pp. 1-11.

Eleazu, C. O., Eleazu, K. C., Chukwuma, S. & Essien, U. N., 2013. Review of the
mechanism of cell death resulting from streptozotocin challenge in
experimental animals, its practical use and potential risk to humans. Journal
of Diabetes & Metabolic Disorders, 12(60), pp. 1-7.

Ferrari, A., 2015. Animal Enhancement: Technovisionary Paternalism and the

Colonisation of Nature. Dalam: S. Bateman, et al. penyunt. Inquiring into
Animal Enhancement: Model or Countermodel of Human Enhancement?.
1st penyunt. New York: PALGRAVE MACMILLAN, pp. 13-33.

Graham, M. L. et al., 2011. The Streptozotocin-Induced Diabetic Nude Mouse

Model: Differences between Animals from Different Sources. Comparative
Medicine, 61(4), pp. 356-360.

Hall, J. E., 2016. Guyton and Hall Textbook of Medical. 13th penyunt.
Philadelphia: Elsevier, Inc.

Howarth, F. C. et al., 2017. Effect of Streptozotocin-Induced Type 1 Diabetes

Mellitus on Contraction and Calcium Transport in the Rat Heart. JSM
Diabetology and Management, 2(1), pp. 1-18.

Kabitzke, P., Cheng, K. M. & Altevogt, B., 2020. Guidelines and Initiatives for
Good Research Practice. Dalam: A. Bespalov, T. Steckler & M. C. Michel,

25
 penyunt. Good Research Practice in Non-Clinical Pharmacology and
Biomedicine. Cham: Springer Open, pp. 19-34.

Lee, J.-J.et al., 2003. Characterization of Streptozotocin-induced Diabetic Rats

and Pharmacodynamics of Insulin Formulations. Bioscience, Biotechnology,
Biochemistry, 67(11), pp. 2396-2401.

Lenzen, S., 2008. The mechanisms of alloxan- and streptozotocin-induced.

Diabetologia, Volume 51, pp. 216-226.

Liu, G. et al., 2018. Streptozotocin-induced diabetic mice exhibit reduced

experimental choroidal neovascularization but not corneal
neovascularization. MOLECULAR MEDICINE REPORTS, Volume 18, pp.
4388-4398.

McCance, K. L., 2014. Cellular Biology. Dalam: K. L. McCance & S. E. Huether,

penyunt. Pathophysiology: the biologic basis for disease in adults and
children. 7th penyunt. Missouri: Elsevier Inc, pp. 31-37.

Mishra, A. P., Yedella, K., Lakshm, J. B. & Siva, A. B., 2018. Wdr13 and
streptozotocin-induced diabetes. Nutrition and Diabetes, 8(57), pp. 1-5.

Ozdemir, O., Akalin, P. P., Baspinar, N. & Hatipoglu, F., 2009.

PATHOLOGICAL CHANGES IN THE ACUTE PHASE. Bull Vet Inst
Pulawy, Volume 53, pp. 783-790.

Powers, A. C., 2015. Diabetes Mellitus: Diagnosis， Classification，. Dalam: D.

L. Kasper, et al. penyunt. Harrison's Principles of Internal Medicine. 19th
penyunt. New York: McGraw-Hi11 Education, pp. 2399-2406.

Rodwell, V. W., 2018. Metabolism of Purine & Pyrimidine Nucleotides. Dalam:

V. W. Rodwell, et al. penyunt. Harper's Illustrated Biochemistry. New
York: McGraw-Hill Education, pp. 801-820.

Sayogo, W. et al., 2020. Immune Stimulation by Electroacupuncture at High

Frequency ST36 Acupoint through. THE INDIAN VETERINARY
JOURNAL, 97(02), pp. 12-14.

Sayogo, W., Nugraha, J. & Wartiningsih, M., 2018. Acupuncture Potential as An

Alternative Treatment of Preventing Diabetes Hyperglycemia Through The
Reduction of Inflammation and Apoptosis Process in Beta Pancreas Cells.
Surabaya, Doctoral Program Study Program of Public Health, Faculty of
Public Health, Universitas Airlangga, pp. 419-426.

Wu, J., Jin, Z. & Yan, L.-J., 2017. Redox imbalance and mitochondrial
abnormalities in the diabetic lung. Redox Biology, 11(2017), pp. 51-59.

26
Yin, D. et al., 2006. Recovery of Islet Beta-Cell Function in Streptozotocin
Induced Diabetic Mice: An Indirect Role for the Spleen. DIABETES,
Volume 55, pp. 3256-3263.

27
LAMPIRAN
Lampiran 1. Tabel Identifkasi Jurnal

Nama Nama Jurnal Volume Nomor

No. Hasil Kaji
Penulis (tahun) (nomor) Halaman
1 D.C. BioMed ArticleID 1-11 Untuk memahami
Damascemo, Research 819065 mekanisme
A.O Netto, I.L. Internasional patofisiologis dan
Iessi, F.Q. (2014) faktor-faktor yang
Gallego, S.B. terlibat dalam
Corvino, B. diabetes,
Dallaqua, Y.K. penggunaan studi
Sinzato, A. regenerasi pankreas
Bueno, I.M.P. semakin meningkat
Calderon, & dalam upaya untuk
M.V.C. Rudge memahami perilaku
sel beta pankreas.
Selain itu, studi ini
menyarankan
konsep pencegahan
baru sebagai dasar
pengobatan untuk
diabetes,
memperkenalkan
upaya terapeutik
untuk
meminimalkan atau
mencegah stres
oksidatif akibat
diabetes, kerusakan
DNA, dan
teratogenesis.
2 Melanie L Comparative 61(4) 356-360 Sebagai
Graham, Jody Medicine perbandingan, tikus
L Janecek, (2011) TAC dan JAX lebih
Jessica A sensitif terhadap
Kittredge, STZ, yang
Bernhard J dibuktikan dengan
Hering, & perkembangan
Henk-Jan diabetes yang lebih
Schuurman cepat (bahkan pada
dosis STZ yang
lebih rendah),
kebutuhan insulin
yang lebih besar
setelah STZ,
penurunan berat

28
 badan yang lebih
besar, dan moralitas
yang lebih besar.
Kami
merekomendasikan
melakukan
penilaian keamanan
eksplorasi saat
memilih sumber
tikus telanjang,
dengan tujuan
membatasi
morbiditas dan
mortalitas hingga
kurang dari 10%
3 S. Lenzen Diabetologin 5(1) 216-226 Setelah
(2008) penyerapannya ke
dalam sel beta,
streaptozotocin
dipecah menjadi
glukosa dan
metylnitrosoures
memodifikasi
makromolekul
biologis, memecah
DNA dan
menghancurkan sel
beta, menyebabkan
keadaan diabetes
yang bergantung
pada insulin.
Penargetan DNA
mitokondria pf,
sehingga
mengganggu fungsi
pensinyalan
bagaimana
streptozotocin
mampu
menghambat
sekresi insulin yang
diinduksi glukosa.
4 Dengping Yin, Original 55 3256- Pemulihan fungsi
Jing Tao, Article 3263 sel pulau difasilitasi
David D. Lee, (2006) dengan adanya
Jikun Shen, limpa; Namun,
Manami Hara, fasilitasi itu bukan
James Lopez, karena diferensiasi

29
 Andrey langsung sel yang
Kuznetsov, diturunkan dari
Louis H. limpa menjadi sel
Philipson, & β. Studi ini
Anita S. Chong mendukung
kemungkinan
pemulihan fungsi
sel β pada individu
diabetes dan
menunjukkan peran
limpa dalam
memfasilitasi
proses ini.
5 Gaoqin Liu, Molecular 18 4388- nfiltrasi
Lei Chen, Medicine 4398 insttachoroidal
Qinhua Cai, Reports yang diinduksi lase
Hongya Wu, (2018) dari sel c-Kit +
Zhigang Chen, progenitor
Xueguang mengalami
Zhang, & gangguan pada
Peirong Lu. tikus diabetes yang
mengalami cedera
laser dibandingkan
dengan tikus
kontrol yang
mengalami cedera
laser. Secara
keseluruhan,
diabetes tidak
memberikan
pengaruh yang
signifikan terhadap
pembentukan
CrNV
eksperimental.
Namun, diabetes
mengurangi ChNV
yang diinduksi lase
melalui
downregulasi
indiltrasi sel
progenitor
instrachoroidal dan
ekspresi faktor
angiogenik.
6 Arun Prakash Nutrition & 8(57) 1-5 Hasil penelitian
Mishra, Diabetes menunjukkan
Komala (2018) bahwa tikus

30
 Yedella, Jyothi Wdr13- / 0
B. LAksmi , menunjukkan kadar
Archana B. insulin serum yang
Siva lebih tinggi,
pembersihan
glukosa yang lebih
baik dan jumlah sel
β yang berkembang
biak secara
signifikan lebih
tinggi; mengulangi
temuan bahwa
tidak adanya
WDR13 membantu
dalam
hiperproliferasi sel
β dan pemulihan
dari diabetes; lebih
lanjut
menggarisbawahi
WDR13 sebagai
molekul target
kunci untuk
pengobatan /
perbaikan diabetes.
7 Jae-Jeong Biosci. 67(11) 2398- Hasil ini
LEE, Ho- Biotechnol. 2401 menunjukkan
Young YI, Jae- Biochem. bahwa pemberian
Won YANG, (2003) formulasi insulin
Jun-Seop pada kelompok
SHIN, Jai- puasa
Hyun KWON, meningkatkan efek
& Chan-Wha hipoglikemik berat
dari aksi insulin
lebih dari pada
tikus diabetes yang
tidak puasa. Tikus
diabetes yang
menjalani puasa
memiliki gangguan
regulasi dalam
menjaga kadar
glukosa darah.
Dengan demikian,
validitas
ketersediaan
farmakologis
sebagai pemodelan

31
 optimal formulasi
insulin paling baik
pada tikus diabetes
yang diinduksi STZ
tanpa puasa.
8 Frank SciMedCentral 2(1) 1-18 Ketidakmampuan
Christopher (2017) sel jantung untuk
Howarth1 , mengatur Ca2 +
Lina AlKury , yang merupakan
Manal Smail1 , inisiator dan
Muhammad pengatur kontraksi
Anwar Qureshi otot jantung.
, Vadym Akibatnya, jantung
Sydorenko , membutuhkan
Anatoliy waktu lebih lama
Shmygol , untuk berkontraksi
Murat Oz , & dan rileks yang
Jaipaul Singh menyebabkan DC,
gagal jantung
progresif, dan
akhirnya kematian
jantung mendadak.
Tujuan dari
tinjauan ini adalah
untuk mengevaluasi
pemahaman kita
saat ini tentang
disfungsi kontraktil
dan gangguan
transportasi Ca2 +
di jantung tikus
diabetes yang
diinduksi STZ.
9 E. Weinberg , Daibetes 103 35-41 Pemberian insulin
T. Maymon , Research and pada tikus
O. Moses , & Clinical hiperglikemik
M. Weinre Practice menormalkan
glikemia dan
membatalkan
sebagian besar
penurunan
pembentukan nodul
termineralisasi ex
vivo. Sel apoptosis
pada sumsum
tulang tibialis lebih
banyak pada tikus
hiperglikemik.

32
 Juga, tingkat
malondialdehida
(indikator stres
oksidatif) secara
signifikan
meningkat di
sumsum tulang
hewan penderita
diabetes.
10 Ozgur Bull Vet Inst 53 783-790 Ada perbedaan
Ozdemir, Pinar Pulawy yang signifikan
Peker Akalin , (20090 antara D1 dan D2
Nuri Baspinar1 dalam hal jumlah
, & Fatih sel apoptosis di
Hatipoglu limpa dan ada
peningkatan
apoptosis.
Disimpulkan bahwa
peningkatan lebar
ruang Bowman
pada fase akut
diabetes tipe-I, dan
perubahan yang
diamati pada organ
lain, akan berguna
untuk studi lebih
lanjut tentang
diabetes.
11 Andrea P. The Journal of 178 4623- Peran M3 dalam
Martin,Jennifer Immunology 4631 blokade kemokin
M. Alexander- (2020) selama insulitis
Brett, Claudia selanjutnya
Canasto- didukung oleh
Chibuque, percobaan in vitro
Alexandre yang menunjukkan
Garin,Jonathan bahwa beberapa
S. Bromberg, kemokin yang
Daved H. diatur ke atas
Fremont, & selama inflamasi
Sergio A. Lira pulau merupakan
ligan M3
berafinitas tinggi
yang dapat
diasingkan secara
bersamaan. Hasil
ini
mengimplikasikan
kemokin sebagai

33
 mediator kunci dari
insulitis dan
menunjukkan
bahwa blokade
mereka mungkin
merupakan strategi
baru untuk
mencegah insulitis
dan kerusakan
pulau.
12 Jason D. Am J Physiol 29(1) H2660- Hasil penelitian
Huber, Reyna Heart Circ H2668 menunjukkan
L. VanGilder, Physiol bahwa pengobatan
& Kimberly A. (2006) insulin pada
Houser diabetes
melemahkan
gangguan sawar
darah-otak,
terutama selama
beberapa minggu
pertama; Namun,
seiring
perkembangan
diabetes, terbukti
bahwa kerusakan
mikrovaskuler
terjadi bahkan
ketika
hiperglikemia
dikendalikan.
Secara keseluruhan,
hasil penelitian ini
menunjukkan
bahwa gangguan
yang diinduksi
diabetes pada
pembuluh mikro
otak dapat
mengganggu
homeostasis dan
berkontribusi pada
defisit kognitif dan
fungsional jangka
panjang dari sistem
saraf pusat.
13 Michał Bulc , Internasional 21, 2047 1-25 Hasil yang
Jarosław Całka Journalof diperoleh
& Katarzyna Mulecular menunjukkan

34
 Palus Sciences bahwa fungsi
(2020) neuropeptida yang
dipelajari dalam
percobaan ini
bergantung pada
lokalisasinya di
struktur ENS, serta
bagian dari saluran
GI. Diabetes
menyebabkan
perubahan fenotipe
neurokimia dari
neuron enterik usus
halus.
14 Jinzi Wu, Zhen Redox 11 51-59 Hasil ini, bersama
Jin, & Liang- Biology dengan temuan
Jun Yan (2017) bahwa kandungan
protein DLDH,
sirt3, dan NQO1
semuanya menurun
di paru-paru
diabetes,
menunjukkan
bahwa
ketidakseimbangan
redoks, kelainan
mitokondria, dan
stres oksidatif
berkontribusi pada
cedera paru pada
diabetes.
15 Chinedum Journal of 12(60) 1-7 ajian ini
Ogbonnaya Diabetes & mengidentifikasi
Eleazu, Kate Metabolic empat bidang
Chinedum Disorders utama yang
Eleazu, Sonia (2013) menjelaskan
Chukwuma & mekanisme
Udeme Nelson sitotoksisitas STZ
Essien dalam garis sel
mamalia,
menyelidiki aspek
praktis penggunaan
STZ pada hewan
percobaan dan
potensi risiko
paparannya
terhadap kesehatan
manusia.

35
36
Hindawi Publishing Corporation
BioMed Research International
Volume 2014, Article ID 819065, 11 pages
http://dx.doi.org/10.1155/2014/819065

Review Article
Streptozotocin-Induced Diabetes Models: Pathophysiological
Mechanisms and Fetal Outcomes

D. C. Damasceno,1,2 A. O. Netto,1 I. L. Iessi,1 F. Q. Gallego,1 S. B. Corvino,1 B. Dallaqua,1

Y. K. Sinzato,1 A. Bueno,1 I. M. P. Calderon,1 and M. V. C. Rudge1
1
Laboratory of Experimental Research on Gynecology and Obstetrics, Graduate Program in Gynecology, Obstetrics and Mastology,
Botucatu Medical School, UNESP-Universidade Estadual Paulista, Distrito de Rubião Júnior S/N, 18618-970 Botucatu, SP, Brazil
2
Department of Gynecology and Obstetrics, Botucatu Medical School, UNESP-Univsidade Estadual Paulista,
Distrito de Rubião Júnior S/N, 18618-970 Botucatu, SP, Brazil

Correspondence should be addressed to D. C. Damasceno; damascenofmb@gmail.com

Received 14 March 2014; Revised 30 April 2014; Accepted 14 May 2014; Published 27 May 2014

Academic Editor: Luis Sobrevia

Copyright © 2014 D. C. Damasceno et al. This is an open access article distributed under the Creative Commons Attribution
License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly
cited.

Glucose homeostasis is controlled by endocrine pancreatic cells, and any pancreatic disturbance can result in diabetes. Because
8% to 12% of diabetic pregnant women present with malformed fetuses, there is great interest in understanding the etiology,
pathophysiological mechanisms, and treatment of gestational diabetes. Hyperglycemia enhances the production of reactive oxygen
species, leading to oxidative stress, which is involved in diabetic teratogenesis. It has also been suggested that maternal diabetes alters
embryonic gene expression, which might cause malformations. Due to ethical issues involving human studies that sometimes have
invasive aspects and the multiplicity of uncontrolled variables that can alter the uterine environment during clinical studies, it is
necessary to use animal models to better understand diabetic pathophysiology. This review aimed to gather information about
pathophysiological mechanisms and fetal outcomes in streptozotocin-induced diabetic rats. To understand the pathophysiological
mechanisms and factors involved in diabetes, the use of pancreatic regeneration studies is increasing in an attempt to understand
the behavior of pancreatic beta cells. In addition, these studies suggest a new preventive concept as a treatment basis for diabetes,
introducing therapeutic efforts to minimize or prevent diabetes-induced oxidative stress, DNA damage, and teratogenesis.

1. Introduction pancreas characterized by a process that diffusely injures the

Diabetes mellitus (DM) is a chronic disease characterized by
hyperglycemia resulting in insulin resistance and/or insulin
secondary deficiency caused by the failure of beta- (𝛽-)
pancreatic cells. Diabetes can be classified into four clinical
categories, type 1 diabetes (due to autoimmune destruction
of the 𝛽 cells, usually leading to absolute insulin deficiency),
type 2 diabetes (due to a progressive insulin secretory defect
in the background of insulin resistance), gestational Diabetes
mellitus (GDM) (diabetes diagnosed during pregnancy that
is not clearly overt diabetes), and other specific types of
diabetes due to other causes, for example, genetic defects in
𝛽 cell function or insulin action, drug- or chemical-induced
alterations (such as in the treatment of HIV/AIDS or after
organ transplantation), and any diseases of the exocrine
pancreas can cause diabetes. Diabetes is usually diagnosed
based on plasma glucose criteria, either the fasting plasma
glucose (FPG) or the 2 h plasma glucose (2 h PG) value after
a 75 g oral glucose tolerance test (OGTT). Besides, recently,
an International Expert Committee added the A1C (threshold
≥ 6.5%) as a third option to diagnose diabetes. In type 1
diabetes, patients often present acute symptoms of diabetes
and markedly increased glucose levels and in some cases
ketoacidosis. Type 2 diabetes is frequently not diagnosed until
complications appear. ADA for the first time recommended
that all pregnant women not known to have prior diabetes
undergo a 75 g OGTT at 24–28 weeks of gestation based on an
International Association of Diabetes and Pregnancy Study
Groups (IADPSG) consensus meeting. In U.S. approximately
one-fourth of the population may have undiagnosed diabetes.
2 BioMed Research International
Acquired processes include pancreatitis, trauma, infection,
pancreatectomy, and pancreatic carcinoma (such as cystic
fibrosis). However, for the clinician and patient, it is less
important to label the particular type of diabetes than it is
to understand the pathogenesis of hyperglycemia and to treat
it effectively [1].
Research in health has been improving the quality of
medical care, influencing health policies and ensuring patient
safety. Translational research is an important tool that allows
researchers in clinical practices to establish knowledge and
implement the results [2]. Translational research covers two
areas. One is the process of applying discoveries generated
during research in the laboratory and in preclinical studies to
the development of trials and studies in humans. The second
area of translation concerns research aimed at enhancing
the adoption of best practices in the community. The cost-
effectiveness of prevention and treatment strategies is also
an important part of translational science [3]. According to
this definition, translational research is part of a unidirec-
tional continuum in which research findings move from the
researcher’s bench to the patient’s bedside and the commu-
nity. In the continuum, the first stage of translational research
(T1) transfers knowledge from basic research to clinical
research, while the second stage (T2) transfers findings from
clinical studies or clinical trials to practice settings and
communities where the findings improve health [4]. Due
to ethical issues involving human studies that can require
invasive aspects and the multiplicity of uncontrolled variables
that can alter the uterine environment during clinical studies
[5], it is necessary to use animal models to better understand
diabetic pathophysiology [6]. Thus, this review aimed to
gather information about pathophysiological mechanisms
and fetal outcomes in streptozotocin-induced diabetic rats.
2. Pancreatic Islets: Structure and Function
The pancreas is a complex organ that consists of two
functionally and morphologically distinct cell populations
derived from the endoderm. The exocrine pancreas consists
of acinar cells that secret digestive enzymes, such as amylases,
lipases, proteases, and nucleases, which are emptied into the
pancreatic duct through an elaborately branched network
of tubules composed of epithelial cells. Acinar cells also
produce bicarbonate ions and electrolytes, which, together
with exocrine enzymes, are transported through the main
duct into the duodenum, where they contribute to food
processing [7, 8].
Groups of endocrine cells called pancreatic islets repre-
sent the endocrine portion, which composes only approx-
imately 2% of the pancreas. Each islet is composed of
at least five types of cells, including insulin-producing 𝛽
cells (65–80%) [9], glucagon-releasing 𝛼 cells (15–20%)
[10], somatostatin-producing 𝛿 cells (3–10%) [11], pancre-
atic polypeptide-containing PP cells (1%) [12], and ghrelin-
containing 𝜀 cells [13]. All of these hormones are involved
in the regulation of nutrient metabolism and glucose home-
ostasis [14]. The cytoarchitecture of rodent and human islets
presents notable differences [15, 16]. In islets from mice and
other rodents, the 𝛽 cells are predominately located in the
central core with 𝛼 and 𝛿 cells localized in the periphery
forming a mantle [17–21]. In human and monkey islets, 𝛼 cells
are not localized in the periphery but rather are dispersed
throughout the islet [15, 16, 19, 21, 22].
There are several lines of evidence that pancreatic islets
cannot be considered aggregates of cells. It was well estab-
lished more than 20 years ago that the integrated secretory
responses of isolated islets are greater than those of dispersed
islet cells, suggesting that cell-to-cell interactions are nec-
essary for the normal secretory function of the endocrine
pancreas [23–27].
However, there are no reports regarding the effect
endocrine hormones in the diabetic environment. Several
studies have emphasized the importance of interactions
among the different cells [28, 29] and between cells of the
same type [29, 30] in metabolic control. In normal islets,
the insulin-producing cells are under the influence of other
hormone-secreting islet cells. Glucagon is known to enhance
both insulin and somatostatin secretion, while somatostatin
exerts an inhibitory effect on insulin and glucagon secretion
[31, 32]. Communication among these hormones is important
to maintain physiological balance, and any disorder in this
system would result in excessive blood glucose levels, for
example, damaging the organism.
Hyperglycemia during pregnancy impairs the intrauter-
ine environment, affecting normal fetal development and
resulting in long-term effects on the function and structure
of fetal pancreatic islets [33, 34]. This status increases the
offspring’s risk of obesity/adiposity, glucose intolerance, and
type 2 diabetes later in life [1, 35–37]. Animal studies have
shown that the offspring of diabetic rats can be insulin resis-
tant [38, 39] and diabetic [39, 40]. Studies support the concept
that developing organs have critical periods of intense struc-
tural and functional reorganization. In the case of the pan-
creas, this circumstance may render it vulnerable to environ-
mental stimuli [41, 42], which may lead to consequences for
the next generation [43] and future studies should consider
the hormone interactions involved for this glucose control.
The literature shows that the administration of pancreatic
hormones analogs (insulin, glucagon, and somatostatin) in in
vitro studies is important to investigate the mechanisms of
hormonal synthesis and secretion in an isolated manner [44–
46]. In addition, insulin is the most studied hormone in the
maternal and fetal organism in an attempt to understand the
repercussions of hyperglycemia [47–54]. In our laboratory,
we hypothesized that glucoregulatory hormones such as
glucagon and somatostatin, in addition to insulin, are relevant
for embryo-fetal development and diabetes-derived alter-
ations. We performed an experimental study in rats to eval-
uate the importance of the endocrine pancreatic hormonal
triad in maternal, fetal, and neonatal organisms exposed to
a hyperglycemic intrauterine environment. According to our
results, somatostatin levels were altered in all developmental
points studied, showing that pancreatic alteration in maternal
and fetal organisms persisted in the neonatal period. These
results suggest that somatostatin might be a predictor of
adverse effects in adulthood. In fact, our data show the impor-
tance of studying hormonal interactions in the endocrine
pancreas to understand the pathophysiological mechanisms
BioMed Research International
related to glycemic control in maternal and fetal organisms
[55].
3. Pathophysiological Mechanisms of
Diabetic Disease
The chronic hyperglycemia of diabetes is associated with
long-term damage, dysfunction, and failure of different
organs, especially the eyes, kidneys, nerves, heart, and blood
vessels [1]. Type 1 Diabetes mellitus results from the cell-
mediated autoimmune destruction of the 𝛽-cells of the
pancreas. Markers of the immune destruction of the 𝛽-cell
include islet cell autoantibodies, autoantibodies to insulin,
autoantibodies to GAD (GAD65), and autoantibodies to
the tyrosine phosphatases IA-2 and IA-2b [1]. Autoimmune
destruction of 𝛽-cells has multiple genetic predispositions
and is also related to environmental factors that are still
poorly defined. Individuals who present Type 2 Diabetes
mellitus have insulin resistance and usually develop relative
(rather than absolute) insulin deficiency. Although the spe-
cific etiologies are not known, autoimmune destruction of 𝛽-
cells does not occur. Most patients with this form of diabetes
are obese, and obesity itself causes some degree of insulin
resistance [1]. Elevations in plasma glucose and free fatty
acids are thought to increase reactive oxygen species (ROS)
levels [56, 57], which in turn activate inflammation signaling
pathways such as mitogen-activated protein kinases [58] and
nuclear factor-kB [59]. The activation of these inflammation
cascades is thought to cause insulin resistance [60].
Gestational Diabetes mellitus (GDM) has been defined
as any degree of glucose intolerance with onset or first
recognition during pregnancy (ADA). Glucose intolerance
was first introduced in 1979 to replace “borderline” diabetes
and other categories of hyperglycemia that did not appear
to carry a risk of microvascular complications [61, 62]. It
was only in the most recent reports that the category of
nondiabetic fasting hyperglycemia was defined and given the
name impaired fasting glycemia (IFG) [63, 64]. This indicates
glucose concentrations that are clearly above normal but fall
short of the diagnostic value for diabetes [65].
4. Diabetes and Pregnancy:
Experimental Models
Experimentally induced diabetes through the administration
of 𝛽-cytotoxic drugs such as streptozotocin (STZ) is well
characterized [66]. Streptozotocin is an antimicrobial agent
and has also been used as a chemotherapeutic alkylating agent
[67]. “Streptozotocin diabetes” [68] is caused by the specific
necrosis of the pancreatic 𝛽-cells, and this agent is the first
choice for diabetes induction in animals [69, 70]. Depending
on the animal strain, dose, route of drug administration, and
the life period in which STZ is administered in rats, severe
diabetes (blood glucose superior to 200/300 mg/dL) [71–77]
or mild diabetes (glycemia between 120 and 200/300 mg/dL)
are generated [68, 78–81]. For severe diabetes induction, STZ
is administered at 40–50 mg/kg body weight intravenously
or intraperitoneally during adulthood. After approximately
3
three days, these animals present blood glucose levels greater
than 300 mg/dL [79, 82–86]. In our laboratory, to induce mild
diabetes, which is characterized by low glycemic intensity, the
rats received a STZ injection (dose of 100 mg/kg body weight)
subcutaneously at birth. Approximately three days after
STZ administration, these animals developed hyperglycemia
(>300 mg/dL) and presented low blood glucose levels (120–
200 mg/dL) at adulthood [83, 85–93]. This fact might be
explained by the high regenerative capacity of 𝛽-cell during
the neonatal period [94, 95].
The literature has shown that several organs are able to
undergo catch up growth when necessary [96]. In case of
severe cell loss or physiological conditions, the pancreatic 𝛽-
cells of rodents can regenerate in the early life period [97].
Cell regeneration can occur through different mechanisms
such as neogenesis, proliferation [98, 99], and transdiffer-
entiation [100]. Scaglia et al. [101] showed that during the
neonatal period, the pancreas suffers physiological changes,
events that can also be identified in other organs, for example,
liver, kidneys, and central nervous system [102–105]. This
pancreatic remodeling is due to increased replication and
apoptosis rates of 𝛽-cells between days 13 and 17. These data
show that in physiological conditions the organism has a
dynamic 𝛽-cell mass, maintaining glucose homeostasis [95,
106].
Because 𝛽-cells are able to regenerate in physiological
conditions, the next step was to develop an experimental
model to induce islet injury to study the mechanisms involved
in cell regeneration process. Bonner-Weir et al. [97] published
some of the first data about pancreatic islet regeneration,
administrating STZ on the second postnatal day. Two days
after the induction of diabetes, the animals presented high
blood glucose levels (>300 mg/dL) and reduced 𝛽-cell num-
bers compared to the control group. At postnatal day 10,
the animals became euglycemic, and partial regeneration
of pancreatic 𝛽-cells was evidenced. The authors suggested
cellular proliferation as the mechanism of cell regeneration.
After STZ administration, cells that were not affected by STZ-
induced necrosis showed increased mitotic characteristics.
Bonner-Weir et al. [107] showed increased mitosis, apoptosis,
and hypertrophic cells and suggested that hypertrophy might
be related to increased 𝛽-cell mass given that cell death is a
mechanism of regulation related to the rate of mitosis, which
could maintain an appropriate number of islet cells. There-
fore, according to these authors, the increased 𝛽-cell mass
could be due to replication, individual cell hypertrophy, or
islet neogenesis by ductal cell differentiation [108]. Regarding
the regeneration mechanisms of 𝛽-cells, some authors also
suggest cell transdifferentiation from non-𝛽-cells to insulin-
producing cells. In contrast, Scaglia et al. [101] concluded that,
once cells do not present hormonal co-expression, there is
no transdifferentiation, suggesting that non-𝛽-cells are not
differentiating into 𝛽-cells.
In contrast, other authors defend the idea that 𝛼-cells
are able to differentiate into 𝛽-cells by direct conversion of
transcription factors [100, 109–112]. Some of the essential
transcription factors involved in pancreatic regeneration have
been investigated, such as neurogenin 3 (Ngn3), paired
domain homeobox gene 4 (Pax4), and homeobox-containing
4 BioMed Research International
gene (Arx). Ngn3 is expressed by precursors of the endocrine
pancreas, Pax4 has selective expression throughout the pan-
creatic islet during its development and is then restricted to
𝛽-cells [113, 114], and Arx is expressed by pancreatic 𝛼-cells
[100].
Liang et al. [95] found that 𝛽-cells were damaged four
days after neonatal STZ induction. At day 8, these authors
verified that there was 𝛽-cell recuperation, but 20 days
after STZ injection the 𝛽-cell mass was still reduced, even
though blood glucose levels reverted to normal. This study
focused on transcription factors, and the authors used double
immunofluorescence to stain Ngn3 and insulin or glucagon.
By analyzing the coexpression of Ngn3 and glucagon, they
observed abundant expression of Ngn3 in the 𝛼-cells of STZ-
treated rats 8 and 12 days after STZ injection. However, in
the control rats, few 𝛼-cells expressed Ngn3. The results of
the diabetic group indicated that 𝛼-cells dedifferentiated into
precursor cells and may be candidates for 𝛽-cell formation.
The coexpression of Pax4 and insulin or glucagon was also
studied and indicated a relationship between insulin and
Pax4 in both the control and STZ groups. However, the
coexpression of Pax4 and glucagon was verified 12 and 20
days after STZ administration. Ngn3 expression is necessary
for transdifferentiation from 𝛼- to 𝛽-cells. In addition, Pax4
is an important transcription factor that specifies the 𝛽-cell
lineage. The same authors observed Pax4 expression in 𝛼-cells
of both control and STZ-treated rats, but this coexpression
increased in the 𝛼-cells at day 20. These results demon-
strate that 𝛼-cells are sources of 𝛽-cell regeneration and
can undergo transdifferentiation. Another study using STZ
showed that Arx inactivation in 𝛼-cells results in pancreatic
islet hypertrophy and increased number of cells that are
phenotypically 𝛽-cells. The authors suggest that when 𝛼-cells
are subjected to Arx inactivation, they undergo transdiffer-
entiation to 𝛽-cells. These results show that strategies aiming
at inhibiting the expression of Arx may offer new avenues for
diabetes treatment [115].
Therefore, the literature includes several mechanisms to
explain 𝛽-cell regeneration, and most studies suggest that
the proliferation of the remaining 𝛽-cells is the primary
source of regeneration. Nevertheless, current studies have
demonstrated the direct participation of 𝛼-cells in 𝛽-cell
regeneration. Thus, we conclude that the regeneration of
pancreatic 𝛽-cells may be due to different mechanisms,
but further studies are needed to precisely elucidate each
mechanism and its contribution to the regeneration as a
whole.
5. Diabetes-Induced Teratogenesis
Diabetes has been recognized as a disease that increases the
risk of birth defects in offspring by 3 to 5 times [116]. A sig-
nificant improvement has been observed in the evolution of
the diabetic pregnancy after the discovery of insulin, reducing
the incidence of ketoacidosis, spontaneous abortions, still-
births, and congenital malformations [117]. A total of 25% of
offspring have been reported presenting these complications,
and early detection and subsequent strict metabolic control of
pregnant women with diabetes should decrease the frequency
and severity of some of these complications in offspring
[118]. Studies have shown that spontaneous abortions can
result from the malformation of structures required for fetal
viability, such as the cardiovascular system or the placenta,
but could also be attributable to maternal effects, such as
endocrinopathies or vascular complications affecting uterine
perfusion [119].
The following are the two principal advances that have
improved the offspring survival rate during diabetic preg-
nancy: (1) a good maternal glycemic control to reduce
the morbidity and mortality of both the mother and
fetus/neonate [120]; (2) availability of surfactant to reduce
perinatal mortality from respiratory distress syndrome (RDS)
[121]. Uncontrolled diabetic status throughout the pregnancy
has been associated with a spectrum of disorders involving
neural tube defects (NTDs), including spina bifida, anen-
cephaly, encephalocele, holoprosencephaly, and cardiovascu-
lar [122–124] kidney, and skeletal system defects in addition
to growth delay and miscarriage [116]. In fact, any organ
can be affected, and 8% to 12% of diabetic pregnant women
presented malformed fetuses [125].
Experimental studies have also been performed to under-
stand diabetic teratogenesis. Damasceno et al. [126] and Vol-
pato et al. [75] administered STZ (40 mg/kg) to adult virgin
female Wistar rats before mating. During pregnancy, these
rats presented hyperglycemic levels higher than 200 mg/dL.
At term, the fetuses from diabetic dams presented skeletal
(nonossified sternebrae and cleft palate) and visceral malfor-
mations (microphthalmia and hydronephrosis). Gäreskog et
al. [127], using a similar diabetes model, recovered embryos
from diabetic rats at day 10 or 11 of pregnancy. These embryos
were cultured within their intact visceral yolk sac for 24
or 48 h and presented decreased Bcl-2 levels and increased
Bax levels and increased activation of caspase 3. Thus,
exposure to diabetes during organogenesis increased cellular
apoptosis and embryonic dysmorphogenesis. However, some
skeletal defects that can occur in human diabetic pregnancy,
particularly caudal regression syndrome, are rarely observed
in animal models, making it difficult to study their molecular
etiology [119].
Several studies have tried to identify biochemical dis-
turbances associated with malformations in animal models
of diabetic pregnancy. Teratogenic processes in embryonic
tissues include alterations of metabolic and signaling systems
[118] such as metabolism of inositol [128], the polyol pathway
[129], arachidonic acid/prostaglandins [130, 131], and reactive
oxygen species (ROS) [132]. In the polyol pathway, the
aldose reductase enzyme is responsible for catalyzing excess
glucose into sorbitol. Sorbitol accumulation has been demon-
strated to negatively affect cell function in glucose-permeable
tissues. However, aldose reductase inhibitors (ARIs) can
diminish some diabetes-related changes in affected tissues
without modifying the hyperglycemia. It has been proposed
that polyol pathway overactivity is responsible for diabetic
nephropathy, neuropathy, and retinopathy due to the deple-
tion of myoinositol, and this could be applied to diabetic
congenital malformations [118].
Another theory centers on linoleic acid. It is the pre-
cursor of arachidonic acid, an essential fatty acid required
BioMed Research International
throughout gestation [133]. The literature shows that arachi-
donic acid release from plasma membranes by phospho-
lipase A2 is lower in diabetic rodents. The formation of
the palate, the neural tube, the heart, and external geni-
talia involve the folding and fusion of opposing layers and
require phosphatidylinositol turnover and arachidonic acid
signaling [131]. Several studies have identified PGE2 as a
prostaglandin (PG) derived from arachidonic acid involved
in the prevention of malformations in experimental diabetic
models [134, 135]. Supporting this idea, one study showed
that the concentration of PGE2 decreased during neurula-
tion in embryos from a diabetic mouse [136]. In vitro as
well as in vivo results demonstrated that a high glucose
concentration causes decreased cyclooxygenase (enzyme cat-
alyzing the synthesis of PGE2 from arachidonic acid) gene
expression [137], suggesting that diabetes causes decreased
prostaglandin biosynthesis and that the inhibition of the
arachidonic cascade may be a cause of diabetic embryopathy
[138].
Another hypothesis is that increased glucose metabolism
enhances the production of ROS, causing oxidative stress
[139]. In the embryo, the energy metabolism is characterized
by a high rate of glycolysis and lactic acid production
(anaerobic glycolysis) with minimal activity of the Krebs
cycle-electron transport system [138]. In accordance with
the low activity of the mitochondrial oxidative pathway,
scavenging enzymes such as superoxide dismutase (SOD),
catalase, and glutathione peroxidase (GPx) seem to be imma-
ture during the period of early organogenesis [140]. A study
performed on cultured rat embryos in high glucose (25 and
50 mM glucose) showed increased activity of the free radical
scavenging enzyme superoxide dismutase (SOD) providing
evidence of enhanced ROS production in a hyperglycemic
environment [141]. Kinalski et al. [142] verified an increase
in malondialdehyde (MDA) levels and reduced glutathione
(GSH) and decreased activity of cytoplasmic Cu/Zn super-
oxide dismutase (Cu/Zn SOD) in the infants of mothers
with pregestational and gestational diabetes. These data show
increased oxidative stress and lipid peroxidation in these
fetuses, which serve as indicators of fetal distress caused by
maternal hyperglycemia [143].
Wentzel and Eriksson [144] evaluated embryoneural crest
cells recovered from inbred Sprague-Dawley rat exposed to
5.5 or 30 mmol/L glucose for 48 hr on gestational day 10. Cells
exposed to 30 mmol glucose/L presented decreased mRNA
levels of catalase, Cu/Zn SOD, manganese superoxide dis-
mutase, and extracellular superoxide dismutase. This altered
gene expression induced by glucose may be the etiology of
malformations in diabetic pregnancy.
6. Diabetes-Induced Oxidative Stress and
DNA Damage
In addition to reactive oxygen and nitrogen species, the
products of free radicals, which are dependent on fatty
acid oxidation, can induce chromosome breaks [145, 146].
Therefore, these products can interact with the embryo
chromatin, resulting in congenital malformations [147]. Free
5
radicals can also react with DNA bases, impairing their
structure [148, 149] and potentially leading to mutations [148–
150]. DNA oxidation is the most common type of damage
[151], although the methods used to assess this damage
are still controversial. One marker used to study oxidative
DNA damage [152, 153] is 8-OHdG or 8-oxo-7,8-dihydro-2-
deoxyguanosine (8-oxodGuo or 8-oxoGua). It is a product
of the deoxyguanosine nucleoside oxidation that is directly
excreted in urine. Qiu et al. [154] demonstrated that the 8-
OHdG urine concentration might be related to increased risk
for gestational diabetes mellitus.
To evaluate DNA damage levels, the comet assay presents
advantages compared to other methods to detect genotoxic
substances. This test is not useful for detecting mutations but
can detect genomic lesions, which can result in mutation.
In contrast to mutations, the genomic lesions detected by
the comet assay can be repaired. The comet assay is fast
and sensitive; moreover, it can detect oxidized DNA bases
using endonucleases such as endonuclease III (Endo III) and
formamidopyrimidine DNA glycosidase (Fpg). Use of Fpg
and Endo III allows the identification of both oxidized purine
and pyrimidine bases, respectively [155, 156].
Although streptozotocin is an alkylating agent, it is also
useful in genotoxicity studies. Some authors have suggested
that STZ can irreversibly damage 𝛽-cell DNA. To investigate
this hypothesis, Mossman et al. [157] performed an in vitro
study showing that STZ induces single-strand DNA breaks
in rodent cells (RINr 38), and these lesions are repaired 24
hours after STZ exposition. Studying the same cell lineage,
Pettepher et al. [158] demonstrated that STZ also induces
alkali-labile site breaks in mitochondrial DNA, and even
though the formation of this lesion is dose-dependent, it can
be repaired as well. After 8 hours of STZ exposition, 55%
of the mitochondrial DNA lesions were repaired, rising to
70% in 24 hours. These data confirm that STZ by itself is not
responsible for the high levels of DNA damage.
In regard to experimental studies with mild and severe
diabetes, Lima et al. [86] evaluated oxidative damage in
the lymphocytes of pregnant diabetic rats and whole blood
samples of their offspring by the comet assay using repair
enzymes (Endo III and Fpg). These authors found that mildly
diabetic rats and their offspring presented more sensitive sites
to Fpg, reflecting damage related to hyperglycemia. Tats with
severe diabetes and their offspring showed oxidative DNA
damage detected by Fpg as well as by Endo III, typical general
diabetes outcomes. The enzymatic indication of DNA damage
suggests that the repercussions of maternal diabetes are
associated with oxidative lesions in maternal and fetal DNA.
Damasceno et al. [159] demonstrated that severely diabetic
rats presented higher DNA damage levels at term pregnancy
compared to control rats. In addition, their offspring also
showed higher DNA damage levels and increased rate of
congenital malformations at term, confirming the interaction
between hyperglycemia-induced genotoxicity and teratoge-
nesis. These studies show the relationship among diabetes,
oxidative stress, and oxidative DNA damage.
Although many studies have been performed to under-
stand the congenital malformations induced by diabetes,
additional research is necessary to identify new markers
6 BioMed Research International
involved in the regulation of embryogenesis and occurrence
of congenital malformations. It is necessary to comprehend
DNA damage trigger factors in diabetes to reduce the impair-
ment of gene expression, avoid fetal congenital malformation,
and contribute to the normal development of organs during
organogenesis.
7. Conclusion
Pancreatic islet loss and reduction of insulin-producing beta
cell mass are relevant aspects to diabetic pathogenesis. It is
important to study the regeneration of pancreatic beta cells
not only to understand the mechanisms and factors involved
in this process but also to provide new preventive concepts as
a basis for the treatment of diabetes. Thus, these therapeutic
efforts might minimize or prevent diabetes-induced oxidative
stress, DNA damage, and teratogenesis.
Conflict of Interests
The authors declare that there is no conflict of interests
regarding the publication of this paper.
Acknowledgment
The authors are grateful to FAPESP (Fundação de Amparo à
Pesquisa do Estado de São Paulo, Brazil) for financial support
of the projects developed in their laboratory.
References
[1] American Diabetes Association (ADA), “Standards of medical
care in diabetes—2014,” Diabetes Care, vol. 37, supplement 1, pp.
S14–S80, 2014.
[2] S. Bakken and D. A. Jones, “Contributions to translational
research for quality health outcomes,” Nursing Research, vol. 55,
no. 2, pp. S1–S2, 2006.
[3] National Institutes of Health, “Definitions under Subsection 1
(Research Objectives), Section I, (Funding Opportunity
Description), Part II, (Full Text of Announcement), of RFA-
RM-07-007,” Institutional Clinical and Translational Science
Award (U54), 2007, http://grants.nih.gov/grants/guide/rfa-
files/RFA-RM-07-007.html.
[4] D. M. Rubio, E. E. Schoenbaum, L. S. Lee et al., “Defining
translational research: implications for training,” Academic
Medicine, vol. 85, no. 3, pp. 470–475, 2010.
[5] I. López-Soldado and E. Herrera, “Different diabetogenic
response to moderate doses of streptozotocin in pregnant rats,
and its long-term consequences in the offspring,” Experimental
Diabesity Research, vol. 4, no. 2, pp. 107–118, 2003.
[6] M. V. Rudge, F. Piculo, G. Marini, D. C. Damasceno, I. M.
Calderon, and A. P. Barbosa, “Translational research in ges-
tational diabetes mellitus and mild gestational hyperglycemia:
current knowledge and our experience,” Arquivos Brasileiros de
Endocrinologia & Metabologia, vol. 57, no. 7, pp. 497–508, 2013.
[7] J. M. W. Slack, “Developmental biology of the pancreas,”
Development, vol. 121, no. 6, pp. 1569–1580, 1995.
[8] F. C. Pan and C. Wright, “Pancreas organogenesis: from bud to
plexus to gland,” Developmental Dynamics, vol. 240, no. 3, pp.
530–565, 2011.
[9] P. E. Lacy, “Electron microscopy of the beta cell of the pancreas,”
The American Journal of Medicine, vol. 31, no. 6, pp. 851–859,
1961.
[10] T. J. Kieffer and J. F. Habener, “The glucagon-like peptides,”
Endocrine Reviews, vol. 20, no. 6, pp. 876–913, 1999.
[11] R. Luft, S. Efendic, T. Hokfelt, O. Johansson, and A. Arimura,
“Immunohistochemical evidence for the localization of
somatostatin—like immunoreactivity in a cell population
of the pancreatic islets,” Medical Biology, vol. 52, no. 6, pp.
428–430, 1974.
[12] E. Ekblad and F. Sundler, “Distribution of pancreatic polypep-
tide and peptide YY,” Peptides, vol. 23, no. 2, pp. 251–261, 2002.
[13] C. L. Prado, A. E. Pugh-Bernard, L. Elghazi, B. Sosa-Pineda,
and L. Sussel, “Ghrelin cells replace insulin-producing 𝛽 cells
in two mouse models of pancreas development,” Proceedings of
the National Academy of Sciences of the United States of America,
vol. 101, no. 9, pp. 2924–2929, 2004.
[14] A. Assmann, C. Hinault, and R. N. Kulkarni, “Growth factor
control of pancreatic islet regeneration and function,” Pediatric
Diabetes, vol. 10, no. 1, pp. 14–32, 2009.
[15] M. Brissova, M. J. Fowler, W. E. Nicholson et al., “Assessment
of human pancreatic islet architecture and composition by laser
scanning confocal microscopy,” Journal of Histochemistry and
Cytochemistry, vol. 53, no. 9, pp. 1087–1097, 2005.
[16] O. Cabrera, D. M. Berman, N. S. Kenyon, C. Ricordi, P.
Berggren, and A. Caicedo, “The unique cytoarchitecture of
human pancreatic islets has implications for islet cell function,”
Proceedings of the National Academy of Sciences of the United
States of America, vol. 103, no. 7, pp. 2334–2339, 2006.
[17] L. Orci and R. H. Unger, “Functional subdivision of islets of
Langerhans and possible role of D cells,” The Lancet, vol. 2, no.
7947, pp. 1243–1244, 1975.
[18] E. Samols, S. Bonner-Weir, and G. C. Weir, “Intra-islet insulin-
glucagon-somatostatin relationships,” Clinics in Endocrinology
and Metabolism, vol. 15, no. 1, pp. 33–58, 1986.
[19] G. Wieczorek, A. Pospischil, and E. Perentes, “A comparative
immunohistochemical study of pancreatic islets in laboratory
animals (rats, dogs, minipigs, nonhuman primates),” Experi-
mental and Toxicologic Pathology, vol. 50, no. 3, pp. 151–172,
1998.
[20] M. Yukawa, T. Takeuchi, T. Watanabe, and S. Kitamura, “Pro-
portions of various endocrine cells in the pancreatic islets
of wood mice (Apodemus speciosus),” Anatomia, Histologia,
Embryologia, vol. 28, no. 1, pp. 13–16, 1999.
[21] S. R. Sujatha, A. Pulimood, and S. Gunasekaran, “Comparative
immunocytochemistry of isolated rat & monkey pancreatic islet
cell types,” Indian Journal of Medical Research, vol. 119, no. 1, pp.
38–44, 2004.
[22] A. Sánchez, S. Cenani, and I. von Lawzewitsch, “Pancreatic islets
in Platyrrhini monkeys: Callithrix jacchus, Saimiri boliviensis,
Aotus azarae, and Cebus apella. A cytological and immunocy-
tochemical study,” Primates, vol. 32, no. 1, pp. 93–103, 1991.
[23] D. Pipeleers, P. In’t Veld, E. Maes, and M. van de Winkel,
“Glucose-induced insulin release depends on functional coop-
eration between islet cells,” Proceedings of the National Academy
of Sciences of the United States of America, vol. 79, no. 23 I, pp.
7322–7325, 1982.
[24] D. W. Hopcroft, D. R. Mason, and R. S. Scott, “Structure-
function relationships in pancreatic islets: support for intraislet
modulation of insulin secretion,” Endocrinology, vol. 117, no. 5,
pp. 2073–2080, 1985.
 BioMed Research International
[25] P. A. Halban, S. L. Powers, K. L. George, and S. Bonner-Weir,
“Spontaneous reassociation of dispersed adult rat pancreatic
islet cells into aggregates with three-dimensional architecture
typical of native islets,” Diabetes, vol. 36, no. 7, pp. 783–790, 1987.
[26] D. Bosco, L. Orci, and P. Meda, “Homologous but not het-
erologous contact increases the insulin secretion of individual
pancreatic B-cells,” Experimental Cell Research, vol. 184, no. 1,
pp. 72–80, 1989.
[27] I. Baca, G. E. Feurle, I. Klempa, A. Ziegler, and V. Schusdziarra,
“Morphometry and function of islet cells after different forms
of drainage at pancreatic transplantation in rats,” European
Surgical Research, vol. 22, no. 3, pp. 151–159, 1990.
[28] E. R. Trimble, P. A. Halban, C. B. Wollheim, and A. E. Renold,
“Functional differences between rat islets of ventral and dorsal
pancreatic origin,” Journal of Clinical Investigation, vol. 69, no.
2, pp. 405–413, 1982.
[29] A. Jorns, “Immunocytochemical and ultrastructural hetero-
geneities of normal and glibenclamide stimulated pancreatic
beta cells in the rat,” Virchows Archiv, vol. 425, no. 3, pp. 305–313,
1994.
[30] P. Meda, J. F. Denef, A. Perrelet, and L. Orci, “Nonrandom
distribution of gap junctions between pancreatic beta-cells,” The
American Journal of Physiology, vol. 238, no. 3, pp. C114–C119,
1980.
[31] A. Wojtusciszyn, M. Armanet, P. Morel, T. Berney, and D. Bosco,
“Insulin secretion from human beta cells is heterogeneous and
dependent on cell-to-cell contacts,” Diabetologia, vol. 51, no. 10,
pp. 1843–1852, 2008.
[32] R. Jain and E. Lammert, “Cell-cell interactions in the endocrine
pancreas,” Diabetes, Obesity and Metabolism, vol. 11, supplement
4, pp. 159–167, 2009.
[33] A. Edvell and P. Lindström, “Development of insulin secretory
function in young obese hyperglycemic mice (Umeå ob/ob),”
Metabolism: Clinical and Experimental, vol. 44, no. 7, pp. 906–
913, 1995.
[34] A. L. Fowden and D. J. Hill, “Intra-uterine programming of the
endocrine pancreas,” The British Medical Bulletin, vol. 60, pp.
123–142, 2001.
[35] D. J. Pettitt, P. H. Bennett, M. F. Saad, M. A. Charles, R.
G. Nelson, and W. C. Knowler, “Abnormal glucose tolerance
during pregnancy in Pima Indian women: long-term effects on
offspring,” Diabetes, vol. 40, no. 2, pp. 126–130, 1991.
[36] G. V. Krishnaveni, S. R. Veena, J. C. Hill, S. Kehoe, S. C. Karat,
and C. H. D. Fall, “Intrauterine exposure to maternal diabetes
is associated with higher adiposity and insulin resistance and
clustering of cardiovascular risk markers in Indian children,”
Diabetes Care, vol. 33, no. 2, pp. 402–404, 2010.
[37] B. Portha, A. Chavey, and J. Movassat, “Early-life origins of
type 2 diabetes: fetal programming of the beta-cell mass,”
Experimental Diabetes Research, vol. 2011, Article ID 105076, 16
pages, 2011.
[38] V. Grill, B. Johansson, P. Jalkanen, and U. J. Eriksson, “Influence
of severe diabetes mellitus early in pregnancy in the rat: effects
on insulin sensitivity and insulin secretion in the offspring,”
Diabetologia, vol. 34, no. 6, pp. 373–378, 1991.
[39] J. Boloker, S. J. Gertz, and R. A. Simmons, “Gestational diabetes
leads to the development of diabetes in adulthood in the rat,”
Diabetes, vol. 51, no. 5, pp. 1499–1506, 2002.
[40] F. A. Van Assche, L. Aerts, and K. Holemans, “The effects of
maternal diabetes on the offspring,” Bailliere’s Clinical Obstetrics
and Gynaecology, vol. 5, no. 2, pp. 485–492, 1991.
7
[41] A. Lucas, “Programming by early nutrition: an experimental
approach,” Journal of Nutrition, vol. 128, no. 2, supplement, pp.
401S–406S, 1998.
[42] C. Aguayo-Mazzucato, C. Sanchez-Soto, V. Godinez-Puig, G.
Gutiérrez-Ospina, and M. Hiriart, “Restructuring of pancreatic
islets and insulin secretion in a postnatal critical window,” PLoS
ONE, vol. 1, no. 1, article e35, 2006.
[43] A. L. Fowden, J. W. Ward, F. P. B. Wooding, A. J. Forhead,
and M. Constancia, “Programming placental nutrient transport
capacity,” Journal of Physiology, vol. 572, part 1, pp. 5–15, 2006.
[44] S. W. J. Lamberts, J. W. Koper, and J. C. Reubi, “Potential role
of somatostatin analogues in the treatment of cancer,” European
Journal of Clinical Investigation, vol. 17, no. 4, pp. 281–287, 1987.
[45] B. Setyono-Han, M. S. Henkelman, J. A. Foekens, and J. G. M.
Klijn, “Direct inhibitory effects of somatostatin (analogues) on
the growth of human breast cancer cells,” Cancer Research, vol.
47, no. 6, pp. 1566–1570, 1987.
[46] T. Nobuhiko, N. Miho, F. Mitsuko et al., “Octreotide-treated
diabetes accompanied by endogenous hyperinsulinemic hypo-
glycemia and protein-losing gastroenteropathy,” Case Reports in
Medicine, vol. 2011, Article ID 381203, 8 pages, 2011.
[47] L. Aerts and F. A. van Assche, “Islet transplantation in dia-
betic pregnant rats normalizes glucose homeostasis in their
offspring,” Journal of Developmental Physiology, vol. 17, no. 6, pp.
283–287, 1992.
[48] M. de Gasparo and R. D. G. Milner, “The timing of fetal B cell
hyperplasia in diabetic rat pregnancy,” Diabetologia, vol. 19, no.
1, pp. 54–57, 1980.
[49] E. A. Ryan, D. Liu, R. C. Bell, D. T. Finegood, and J. Crawford,
“Long term consequences in offspring of diabetes in preg-
nancy: studies with syngeneic islet-transplanted streptozotocin-
diabetic rats,” Endocrinology, vol. 136, no. 12, pp. 5587–5592,
1995.
[50] J. Han, J. Xu, Y. S. Long, P. N. Epstein, and Y. Q. Liu, “Rat
maternal diabetes impairs pancreatic 𝛽-cell function in the
offspring,” The American Journal of Physiology—Endocrinology
and Metabolism, vol. 293, no. 1, pp. E228–E236, 2007.
[51] C. J. Zeng, L. Zhang, and H. X. Yang, “Effects of severe
hyperglycaemia in pregnancy and early overfeeding on islet
development and insulin resistance,” Zhonghua Fu Chan Ke Za
Zhi, vol. 45, no. 9, pp. 658–663, 2010.
[52] K. C. Marchand, E. J. Arany, and D. J. Hill, “Effects of
atorvastatin on the regeneration of pancreatic 𝛽-cells after
streptozotocin treatment in the neonatal rodent,” The American
Journal of Physiology—Endocrinology and Metabolism, vol. 299,
no. 1, pp. E92–E100, 2010.
[53] R. C. S. Branco, J. C. de Oliveira, S. Grassiolli et al., “Maternal
protein malnutrition does not impair insulin secretion from
pancreatic islets of offspring after transplantation into diabetic
rats,” PLoS ONE, vol. 7, no. 2, Article ID e30685, 2012.
[54] A. B. Aref, O. M. Ahmed, L. A. Ali, and M. Semmler, “Maternal
rat diabetes mellitus deleteriously affects insulin sensitivity and
beta-cell function in the offspring,” Journal of Diabetes Research,
vol. 2013, Article ID 429154, 10 pages, 2013.
[55] I. L. Iessi, Y. K. Sinzato, I. M. P. Calderon, M. V. C. Rudge, and
D. C. Damasceno, “Pancreatic islet hormonal triad in diabetic
pregnant rats and their offspring,” PLoS ONE. In press.
[56] J. L. Evans, B. A. Maddux, and I. D. Goldfine, “The molecular
basis for oxidative stress-induced insulin resistance,” Antioxi-
dants and Redox Signaling, vol. 7, no. 7-8, pp. 1040–1052, 2005.
8 BioMed Research International
[57] F. Folli, D. Corradi, P. Fanti et al., “The role of oxidative
stress in the pathogenesis of type 2 diabetes mellitus micro-and
macrovascular complications: avenues for a mechanistic-based
therapeutic approach,” Current Diabetes Reviews, vol. 7, no. 5,
pp. 313–324, 2011.
[58] E. K. Kim and E. J. Choi, “Pathological roles of MAPK signaling
pathways in human diseases,” Biochimica et Biophysica Acta—
Molecular Basis of Disease, vol. 1802, no. 4, pp. 396–405, 2010.
[59] I. Sigala, P. Zacharatos, D. Toumpanakis et al., “MAPKs and NF-
𝜅B differentially regulate cytokine expression in the diaphragm
in response to resistive breathing: the role of oxidative stress,”
The American Journal of Physiology—Regulatory Integrative and
Comparative Physiology, vol. 300, no. 5, pp. R1152–R1162, 2011.
[60] G. Muscogiuri, A. B. Salmon, C. Aguayo-Mazzucato et al.,
“Genetic disruption of SOD1 gene causes glucose intolerance
and impairs 𝛽-cell function,” Diabetes, vol. 62, no. 12, pp. 4201–
4207, 2013.
[61] National Diabetes Data Group, “Classification and diagnosis of
diabetes and other categories of glucose intolerance,” Diabetes,
vol. 28, no. 12, pp. 1039–1057, 1979.
[62] WHO Expert Committee on Diabetes Mellitus, Technical
Report Series 646, Second Report, World Health Organisation,
Geneva, Switzerland, 1980.
[63] R. Kahn, “Report of the expert committee on the diagnosis and
classification of diabetes mellitus,” Diabetes Care, vol. 20, no. 7,
pp. 1183–1197, 1997.
[64] World Health Organisation, Definition, Diagnosis, and Classi-
fication of Diabetes Mellitus and Its Complications. Report of
a WHO Consultation—Part 1: Diagnosis and Classification of
Diabetes Mellitus, World Health Organisation, Geneva, Switzer-
land, 1999.
[65] N. Unwin, J. Shaw, P. Zimmet, and K. G. M. M. Alberti,
“Impaired glucose tolerance and impaired fasting glycaemia:
the current status on definition and intervention,” Diabetic
Medicine, vol. 19, no. 9, pp. 708–723, 2002.
[66] D. T. Ward, S. K. Yau, A. P. Mee et al., “Functional, molecular,
and biochemical characterization of streptozotocin-induced
diabetes,” Journal of the American Society of Nephrology, vol. 12,
no. 4, pp. 779–790, 2001.
[67] S. Lenzen, “The mechanisms of alloxan- and streptozotocin-
induced diabetes,” Diabetologia, vol. 51, no. 2, pp. 216–226, 2008.
[68] B. Portha, C. Levacher, L. Picon, and G. Rosselin, “Diabetogenic
effect of streptozotocin in the rat during the perinatal period,”
Diabetes, vol. 23, no. 11, pp. 889–895, 1974.
[69] S. Lenzen, M. Tiedge, A. Jörns, and R. Munday, “Alloxan
derivatives as a tool for the elucidation of the mechanism of
the diabetogenic action of alloxan,” in Lessons from Animal
Diabetes, E. Shafrir, Ed., pp. 113–122, Birkhäuser, Boston, Mass,
USA, 1996.
[70] R. N. Arison, E. I. Ciaccio, M. S. Glitzer, J. A. Cassaro, and
M. P. Pruss, “Light and electron microscopy of lesions in rats
rendered diabetic with streptozotocin,” Diabetes, vol. 16, no. 1,
pp. 51–56, 1967.
[71] U. J. Eriksson, L. A. H. Borg, J. Cederberg et al., “Pathogenesis
of diabetes-induced congenital malformations,” Upsala Journal
of Medical Sciences, vol. 105, no. 2, pp. 53–84, 2000.
[72] U. J. Eriksson, J. Cederberg, and P. Wentzel, “Congenital
malformations in offspring of diabetic mothers—animal and
human studies,” Reviews in Endocrine and Metabolic Disorders,
vol. 4, no. 1, pp. 79–93, 2003.
[73] D. C. Damasceno, G. T. Volpato, M. C. Ide, R. Aguilar, and M.
V. C. Rudge, “Effect of Bauhinia forficata extract in diabetic
pregnant rats: maternal repercussions,” Phytomedicine, vol. 11,
no. 2-3, pp. 196–201, 2004.
[74] M. V. C. Rudge, D. C. Damasceno, G. T. Volpato, F. C. G.
Almeida, I. M. P. Calderon, and I. P. Lemonica, “Effect of
Ginkgo biloba on the reproductive outcome and oxidative stress
biomarkers of streptozotocin-induced diabetic rats,” Brazilian
Journal of Medical and Biological Research, vol. 40, no. 8, pp.
1095–1099, 2007.
[75] G. T. Volpato, D. C. Damasceno, M. V. C. Rudge, C. R. Padovani,
and I. M. P. Calderon, “Effect of Bauhinia forficata aqueous
extract on the maternal-fetal outcome and oxidative stress
biomarkers of streptozotocin-induced diabetic rats,” Journal of
Ethnopharmacology, vol. 116, no. 1, pp. 131–137, 2008.
[76] S. de Souza Mda, P. H. O. Lima, Y. K. Sinzato, M. V. C. Rudge, O.
C. M. Pereira, and D. C. Damasceno, “Effects of cigarette smoke
exposure on pregnancy outcome and offspring of diabetic rats,”
Reproductive BioMedicine Online, vol. 18, no. 4, pp. 562–567,
2009.
[77] S. de Souza Mda, Y. K. Sinzato, P. H. O. Lima, I. M. P. Calderon,
M. V. C. Rudge, and D. C. Damasceno, “Oxidative stress status
and lipid profiles of diabetic pregnant rats exposed to cigarette
smoke,” Reproductive BioMedicine Online, vol. 20, no. 4, pp.
547–552, 2010.
[78] K. Tsuji, T. Taminato, M. Usami et al., “Characteristic features
of insulin secretion in the streptozotocin-induced NIDDM rat
model,” Metabolism: Clinical and Experimental, vol. 37, no. 11,
pp. 1040–1044, 1988.
[79] H. Merzouk, S. Madani, D. C. Sari, J. Prost, M. Bouchenak, and
J. Belleville, “Time course of changes in serum glucose, insulin,
lipids and tissue lipase activities in macrosomic offspring of rats
with streptozotocin-induced diabetes,” Clinical Science, vol. 98,
no. 1, pp. 21–30, 2000.
[80] Y. K. Sinzato, P. H. Lima, K. E. de Campos, A. C. I. Kiss, M. V.
C. Rudge, and D. C. Damascene, “Neonatally-induced diabetes:
lipid profile outcomes and oxidative stress status in adult rats,”
Revista da Associacao Medica Brasileira, vol. 55, no. 4, pp. 384–
388, 2009.
[81] D. C. Damasceno, A. C. I. Kiss, Y. K. Sinzato et al., “Maternal-
fetal outcome, lipid profile and oxidative stress of diabetic
rats neonatally exposed to streptozotocin,” Experimental and
Clinical Endocrinology and Diabetes, vol. 119, no. 7, pp. 408–413,
2011.
[82] J. Y. Uriu-Hare, C. L. Keen, E. A. Applegate, and J. S. Stern,
“The influence of moderate exercise in diabetic and normal
pregnancy on maternal and fetal outcome in the rat,” Life
Sciences, vol. 45, no. 7, pp. 647–654, 1989.
[83] A. Bueno, Y. K. Sinzato, M. J. Sudano et al., “Short and long-
term repercussions of the experimental diabetes in embryofetal
development,” Diabetes/Metabolism Research and Reviews, 2014.
[84] D. C. Damasceno, H. P. Silva, G. F. Vaz et al., “Diabetic rats
exercised prior to and during pregnancy: maternal reproductive
outcome, biochemical profile, and frequency of fetal anomalies,”
Reproductive Sciences, vol. 20, no. 7, pp. 730–738, 2013.
[85] F. H. Saito, D. C. Damasceno, B. Dallaqua et al., “Heat shock pro-
tein production and immunity and altered fetal development in
diabetic pregnant rats,” Cell Stress and Chaperones, vol. 18, no. 1,
pp. 25–33, 2013.
[86] P. H. O. Lima, Y. K. Sinzato, R. B. Gelaleti, I. M. P. Calderon, M.
V. C. Rudge, and D. C. Damasceno, “Genotoxicity evaluation
in severe or mild diabetic pregnancy in laboratory animals,”
 BioMed Research International
Experimental and Clinical Endocrinology and Diabetes, vol. 120,
no. 5, pp. 303–307, 2012.
[87] F. Piculo, G. Marini, A. M. Barbosa et al., “Urethral striated
muscle and extracellular matrix morphological characteristics
among mildly diabetic pregnant rats: translational approach,”
International Urogynecology Journal, vol. 25, no. 3, pp. 403–415,
2014.
[88] A. C. I. Kiss, B. Woodside, Y. K. Sinzato et al., “Neonatally
induced mild diabetes: influence on development, behavior and
reproductive function of female Wistar rats,” Diabetology and
Metabolic Syndrome, vol. 5, no. 1, article 61, 2013.
[89] A. P. Spada, D. C. Damasceno, Y. K. Sinzato et al., “Oxidative
stress in maternal blood and placenta from mild diabetic rats,”
Reproductive Sciences, 2014.
[90] B. Dallaqua, F. H. Saito, T. Rodrigues et al., “Azadirachta indica
treatment on the congenital malformations of fetuses from rats,”
Journal of Ethnopharmacology, vol. 150, no. 3, pp. 1109–1113,
2013.
[91] B. Dallaqua, F. H. Saito, T. Rodrigues et al., “Treatment with
Azadirachta indica in diabetic pregnant rats: negative effects on
maternal outcome,” Journal of Ethnopharmacology, vol. 143, no.
3, pp. 805–811, 2012.
[92] A. C. I. Kiss, B. Woodside, L. F. Felı́cio, J. Anselmo-Franci,
and D. C. Damasceno, “Impact of maternal mild hyperglycemia
on maternal care and offspring development and behavior of
Wistar rats,” Physiology and Behavior, vol. 107, no. 3, pp. 292–
300, 2012.
[93] Y. K. Sinzato, G. T. Volpato, I. L. Iessi et al., “Neonatally induced
mild diabetes in rats and its effect on maternal, placental, and
fetal parameters,” Experimental Diabetes Research, vol. 2012,
Article ID 108163, 7 pages, 2012.
[94] S. Georgia and A. Bhushan, “𝛽 cell replication is the primary
mechanism for maintaining postnatal 𝛽 cell mass,” Journal of
Clinical Investigation, vol. 114, no. 7, pp. 963–968, 2004.
[95] X. D. Liang, Y. Y. Guo, M. Sun et al., “Streptozotocin-induced
expression of Ngn3 and Pax4 in neonatal rat pancreatic 𝛼-cells,”
World Journal of Gastroenterology, vol. 17, no. 23, pp. 2812–2820,
2011.
[96] R. J. Goss, “Modes of growth and regeneration: mechanisms,
regulation, distribution,” in Human Growth: A Comprehensive
Treatise, F. Falkner and J. M. Tanner, Eds., vol. 1, pp. 3–26,
Plenum Press, New York, NY, USA, 2nd edition, 1986.
[97] S. Bonner-Weir, D. F. Trent, R. N. Honey, and G. C. Weir,
“Responses of neonatal rat islets to streptozotocin: limited B-
cell regeneration and hyperglycemia,” Diabetes, vol. 30, no. 1, pp.
64–69, 1981.
[98] S. Bonner-Weir and G. C. Weir, “New sources of pancreatic 𝛽-
cells,” Nature Biotechnology, vol. 23, no. 7, pp. 857–861, 2005.
[99] K. Minami and S. Seino, “Regeneration of the pancreas,” Nippon
Rinsho, vol. 66, no. 5, pp. 926–931, 2008.
[100] P. Collombat, A. Mansouri, J. Hecksher-Sørensen et al., “Oppos-
ing actions of Arx and Pax4 in endocrine pancreas develop-
ment,” Genes and Development, vol. 17, no. 20, pp. 2591–2603,
2003.
[101] L. Scaglia, C. J. Cahill, D. T. Finegood, and S. Bonner-Weir,
“Apoptosis participates in the remodeling of the endocrine
pancreas in the neonatal rat,” Endocrinology, vol. 138, no. 4, pp.
1736–1741, 1997.
[102] R. W. Oppenheim, “Cell death during development of the
nervous system,” Annual Review of Neuroscience, vol. 14, pp.
453–501, 1991.
9
[103] H. S. R. Coles, J. F. Burne, and M. C. Raff, “Large-scale normal
cell death in the developing rat kidney and its reduction by
epidermal growth factor,” Development, vol. 118, no. 3, pp. 777–
784, 1993.
[104] T. Terada and Y. Nakanuma, “Detection of apoptosis and
expression of apoptosis-related proteins during human intra-
hepatic bile duct development,” The American Journal of Pathol-
ogy, vol. 146, no. 1, pp. 67–74, 1995.
[105] A. J. Blaschke, K. Staley, and J. Chun, “Widespread programmed
cell death in proliferative and postmitotic regions of the fetal
cerebral cortex,” Development, vol. 122, no. 4, pp. 1165–1174,
1996.
[106] B. Portha, O. Blondel, P. Serradas et al., “The rat models of
non-insulin dependent diabetes induced by neonatal strepto-
zotocin,” Diabete et Metabolisme, vol. 15, no. 2, pp. 61–75, 1989.
[107] S. Bonner-Weir, D. Deery, J. L. Leahy, and G. C. Weir, “Compen-
satory growth of pancreatic 𝛽-cells in adult rats after short-term
glucose infusion,” Diabetes, vol. 38, no. 1, pp. 49–53, 1989.
[108] S. Bonner-Weir, “Regulation of pancreatic 𝛽-cell mass in vivo,”
Recent Progress in Hormone Research, vol. 49, no. 1, pp. 91–104,
1994.
[109] G. Gradwohl, A. Dierich, M. LeMeur, and F. Guillemot, “Neuro-
genin3 is required for the development of the four endocrine cell
lineages of the pancreas,” Proceedings of the National Academy of
Sciences of the United States of America, vol. 97, no. 4, pp. 1607–
1611, 2000.
[110] M. Jenny, C. Uhl, C. Roche et al., “Neurogenin3 is differentially
required for endocrine cell fate specification in the intestinal
and gastric epithelium,” The EMBO Journal, vol. 21, no. 23, pp.
6338–6347, 2002.
[111] G. Gu, J. R. Brown, and D. A. Melton, “Direct lineage tracing
reveals the ontogeny of pancreatic cell fates during mouse
embryogenesis,” Mechanisms of Development, vol. 120, no. 1, pp.
35–43, 2003.
[112] S. W. Li, V. Koya, Y. Li et al., “Pancreatic duodenal homeobox 1
protein is a novel Β-cell-specific autoantigen for type I diabetes,”
Laboratory Investigation, vol. 90, no. 1, pp. 31–39, 2010.
[113] S. B. Smith, H. C. Ee, J. R. Conners, and M. S. German, “Paired-
homeodomain transcription factor PAX4 acts as a transcrip-
tional repressor in early pancreatic development,” Molecular
and Cellular Biology, vol. 19, no. 12, pp. 8272–8280, 1999.
[114] C. Dohrmann, P. Gruss, and L. Lemaire, “Pax genes and the
differentiation of hormone-producing endocrine cells in the
pancreas,” Mechanisms of Development, vol. 92, no. 1, pp. 47–54,
2000.
[115] M. Courtney, E. Gjernes, N. Druelle et al., “The inactivation
of Arx in pancreatic 𝛼-cells triggers their neogenesis and
conversion into functional 𝛽-like cells,” PLoS Genetics, vol. 9,
no. 10, Article ID e1003934, 2013.
[116] D. G. Garcı́a and D. R. Garcı́a, “Avances en la patogénesis de la
embriopatı́a diabética,” Revista Médica de Chile, vol. 137, no. 12,
pp. 1627–1635, 2009.
[117] T. R. Moore, “Diabetes in pregnancy,” in Maternal Fetal
Medicine: Principles and Practice, R. K. Creasy and R. Resnik,
Eds., pp. 964–995, W.B. Saunders, Philadelphia, Pa, USA, 4th
edition, 1999.
[118] U. J. Eriksson, “Congenital anomalies in diabetic pregnancy,”
Seminars in Fetal and Neonatal Medicine, vol. 14, no. 2, pp. 85–
93, 2009.
[119] S. Zabihi and M. R. Loeken, “Understanding diabetic teratoge-
nesis: where are we now and where are we going?” Birth Defects
 10
Research A: Clinical and Molecular Teratology, vol. 88, no. 10, pp.
779–790, 2010.
[120] P. White, “Pregnancy complicating diabetes,” The American
Journal of Medicine, vol. 7, no. 5, pp. 609–616, 1949.
[121] N. Freinkel, E. Ogata, and B. E. Metzger, “The offspring of the
mother with diabetes,” in Diabetes Mellitus: Theory and Practice,
H. Rifkin and D. Porte Jr., Eds., pp. 651–660, Elsevier Science,
New York, NY, USA, 1990.
[122] K. Fuhrmann, H. Reiher, K. Semmler, and E. Glöckner, “The
effect of intensified conventional insulin therapy before and
during pregnancy on the malformation rate in offspring of
diabetic mothers,” Experimental and Clinical Endocrinology, vol.
83, no. 2, pp. 173–177, 1984.
[123] M. M. Cohen Jr. and K. Shiota, “Teratogenesis of holoprosen-
cephaly,” The American Journal of Medical Genetics, vol. 109, no.
1, pp. 1–15, 2002.
[124] A. Correa, S. M. Gilboa, L. M. Besser et al., “Diabetes mellitus
and birth defects,” The American Journal of Obstetrics and
Gynecology, vol. 199, no. 3, pp. 237.e1–237.e9, 2008.
[125] C. Calciu, S. Kubow, and H. M. Chan, “Interactive dysmor-
phogenic effects of toxaphene or toxaphene congeners and
hyperglycemia on cultured whole rat embryos during organo-
genesis,” Toxicology, vol. 175, no. 1–3, pp. 153–165, 2002.
[126] D. C. Damasceno, G. T. Volpato, I. M. P. Calderon, and M. V. C.
Rudge, “Oxidative stress and diabetes in pregnant rats,” Animal
Reproduction Science, vol. 72, no. 3-4, pp. 235–244, 2002.
[127] M. Gäreskog, J. Cederberg, U. J. Eriksson, and P. Wentzel,
“Maternal diabetes in vivo and high glucose concentration
in vitro increases apoptosis in rat embryos,” Reproductive
Toxicology, vol. 23, no. 1, pp. 63–74, 2007.
[128] M. Hod, S. Star, J. Passonneau, T. G. Unterman, and N. Freinkel,
“Glucose-induced dysmorphogenesis in the cultured rat con-
ceptus: prevention by supplementation with myo-inositol,”
Israel Journal of Medical Sciences, vol. 26, no. 10, pp. 541–544,
1990.
[129] U. J. Eriksson, P. Naeser, and S. E. Brolin, “Increased accumula-
tion of sorbitol in offspring of manifest diabetic rats,” Diabetes,
vol. 35, no. 12, pp. 1356–1363, 1986.
[130] E. Pinter, E. A. Reece, C. Z. Leranth et al., “Yolk sac failure
in embryopathy due to hyperglycemia: ultrastructural analysis
of yolk sac differentiation associated with embryopathy in rat
conceptuses under hyperglycemic conditions,” Teratology, vol.
33, no. 1, pp. 73–84, 1986.
[131] A. S. Goldman and M. P. Goto, “Biochemical basis of the
diabetic embryopathy,” Israel Journal of Medical Sciences, vol. 27,
no. 8-9, pp. 469–477, 1991.
[132] Z. J. Hagay, Y. Weiss, I. Zusman et al., “Prevention of diabetes-
associated embryopathy by overexpression of the free radical
scavenger copper zinc superoxide dismutase in transgenic
mouse embryos,” The American Journal of Obstetrics and Gyne-
cology, vol. 173, no. 4, pp. 1036–1041, 1995.
[133] E. Herrera, “Implications of dietary fatty acids during preg-
nancy on placental, fetal and postnatal development—a review,”
Placenta, vol. 23, supplement A, no. 1, pp. S9–S19, 2002.
[134] E. A. Reece, Y. K. Wu, Z. Zhao, and D. Dhanasekaran,
“Dietary vitamin and lipid therapy rescues aberrant signaling
and apoptosis and prevents hyperglycemia-induced diabetic
embryopathy in rats,” The American Journal of Obstetrics and
Gynecology, vol. 194, no. 2, pp. 580–585, 2006.
[135] Y. I. Cha, L. Solnica-Krezel, and R. N. DuBois, “Fishing
for prostanoids: deciphering the developmental functions of
BioMed Research International
cyclooxygenase-derived prostaglandins,” Developmental Biol-
ogy, vol. 289, no. 2, pp. 263–272, 2006.
[136] R. Piddington, J. Joyce, P. Dhanasekaran, and L. Baker, “Dia-
betes mellitus affects prostaglandin E2 levels in mouse embryos
during neurulation,” Diabetologia, vol. 39, no. 8, pp. 915–920,
1996.
[137] P. Wentzel, N. Welsh, and U. J. Eriksson, “Developmental dam-
age, increased lipid peroxidation, diminished cyclooxygenase-
2 gene expression, and lowered prostaglandin E2 levels in rat
embryos exposed to a diabetic environment,” Diabetes, vol. 48,
no. 4, pp. 813–820, 1999.
[138] S. Akazawa, “Diabetic embryopathy: studies using a rat embryo
culture system and an animal model,” Congenital Anomalies,
vol. 45, no. 3, pp. 73–79, 2005.
[139] M. Brownlee, “Biochemistry and molecular cell biology of
diabetic complications,” Nature, vol. 414, no. 6865, pp. 813–820,
2001.
[140] S. El-Hage and S. M. Singh, “Temporal expression of genes
encoding free radical-metabolizing enzymes is associated with
higher mRNA levels during in utero development in mice,”
Developmental Genetics, vol. 11, no. 2, pp. 149–159, 1990.
[141] U. J. Eriksson and L. A. H. Borg, “Diabetes and embryonic
malformations: role of substrate-induced free-oxygen radical
production for dysmorphogenesis in cultured rat embryos,”
Diabetes, vol. 42, no. 3, pp. 411–419, 1993.
[142] M. Kinalski, A. Sledziewski, B. Telejko, I. Kowalska, A. Kre-
towski, and I. Kinalska, “Evaluation of lipid peroxidation and
acid-base status in cord blood of newborns after diabetes in
pregnancy,” Przeglad Lekarski, vol. 58, no. 3, pp. 120–123, 2001.
[143] A. Ornoy, “Biomarkers of maternal diabetes and its complica-
tion in pregnancy,” Reproductive Toxicology, vol. 34, no. 2, pp.
174–179, 2012.
[144] P. Wentzel and U. J. Eriksson, “Altered gene expression in rat
cranial neural crest cells exposed to a teratogenic glucose con-
centration in vitro-paradoxical downregulation of antioxidative
defense genes,” Birth Defects Research B—Developmental and
Reproductive Toxicology, vol. 92, no. 5, pp. 487–497, 2011.
[145] I. Emerit, “Reactive oxygen species, chromosome mutation, and
cancer: possible role of clastogenic factors in carcinogenesis,”
Free Radical Biology and Medicine, vol. 16, no. 1, pp. 99–109,
1994.
[146] I. Emerit, “Clastogenic factors: detection and assay,” Methods in
Enzymology, vol. 186, pp. 555–564, 1990.
[147] I. D. Young, “Congenital malformations: incidence and genetics
of congenital malformations,” in Prenatal Diagnosis and Screen-
ing, D. J. H. Brock, C. H. Rodeck, and M. A. Ferguson-Smith,
Eds., pp. 171–188, Churchill Livingstone, London, UK, 1992.
[148] A. P. Breen and J. A. Murphy, “Reactions of oxyl radicals with
DNA,” Free Radical Biology and Medicine, vol. 18, no. 6, pp. 1033–
1077, 1995.
[149] L. J. Marnett, “Oxyradicals and DNA damage,” Carcinogenesis,
vol. 21, no. 3, pp. 361–370, 2000.
[150] T. G. Newcombe and L. A. Loeb, “Mechanism of mutagenicity
of oxidatively-modified bases,” in Molecular Biology of Free
Radicals in Human Disease, O. I. Aruoma and B. Halliwell, Eds.,
pp. 139–166, OICA International, Paris, France, 1998.
[151] A. Azqueta, S. Shaposhnikov, and A. R. Collins, “DNA oxida-
tion: investigating its key role in environmental mutagenesis
with the comet assay,” Mutation Research—Genetic Toxicology
and Environmental Mutagenesis, vol. 674, no. 1-2, pp. 101–108,
2009.
 BioMed Research International 11

[152] S. Loft, K. Vistisen, M. Ewertz, A. Tjonneland, K. Overvad,

and H. E. Poulsen, “Oxidative DNA damage estimated by
8-hydroxydeoxyguanosine excretion in humans: influence of
smoking, gender and body mass index,” Carcinogenesis, vol. 13,
no. 12, pp. 2241–2247, 1992.
[153] M. Erhola, S. Toyokuni, K. Okada et al., “Biomarker evidence
of DNA oxidation in lung cancer patients: association of uri-
nary 8-hydroxy-2󸀠 -deoxyguanosine excretion with radiother-
apy, chemotherapy, and response to treatment,” FEBS Letters,
vol. 409, no. 2, pp. 287–291, 1997.
[154] C. Qiu, K. Hevner, D. Abetew, D. A. Enquobahrie, and M.
A. Williams, “Oxidative DNA damage in early pregnancy and
risk of gestational diabetes mellitus: a pilot study,” Clinical
Biochemistry, vol. 44, no. 10-11, pp. 804–808, 2011.
[155] A. R. Collins, S. J. Duthie, and V. L. Dobson, “Direct enzymic
detection of endogenous oxidative base damage in human
lymphocyte DNA,” Carcinogenesis, vol. 14, no. 9, pp. 1733–1735,
1993.
[156] A. R. Collins, M. Dušinská, C. M. Gedik, and R. Štětina,
“Oxidative damage to DNA: do we have a reliable biomarker?”
Environmental Health Perspectives, vol. 104, supplement 3, pp.
465–469, 1996.
[157] B. T. Mossman, C. M. Ireland, M. Filipak, S. LeDoux, and G. L.
Wilso, “Comparative interactions of streptozotocin and chloro-
zotocin with DNA of an insulin-secreting cell line (RINr),”
Diabetologia, vol. 29, no. 3, pp. 186–191, 1986.
[158] C. C. Pettepher, S. P. LeDoux, V. A. Bohr, and G. L. Wilson,
“Repair of alkali-labile sites within the mitochondrial DNA of
RINr 38 cells after exposure to the nitrosourea streptozotocin,”
The Journal of Biological Chemistry, vol. 266, no. 5, pp. 3113–3117,
1991.
[159] D. C. Damasceno, G. T. Volpato, Y. K. Sinzato et al., “Genotox-
icity and fetal abnormality in streptozotocin-induced diabetic
rats exposed to cigarette smoke prior to and during pregnancy,”
Experimental and Clinical Endocrinology and Diabetes, vol. 119,
no. 9, pp. 549–553, 2011.
 Comparative Medicine Vol 61, No 4
Copyright 2011 August 2011
by the American Association for Laboratory Animal Science Pages 356–360

The Streptozotocin-Induced Diabetic Nude

Mouse Model: Differences between Animals
from Different Sources

Melanie L Graham,* Jody L Janecek, Jessica A Kittredge, Bernhard J Hering, and Henk-Jan Schuurman

Diabetes is induced in mice by using streptozotocin (STZ), a compound that has a preferential toxicity toward pancreatic β cells.
We evaluated nude male mice from various sources for their sensitivity to a single high dose (160 to 240 mg/kg) of STZ. Diabetes
was induced in male mice (age: median, 12 wk; interquartile range, 11 to 14 wk; body weight, about 30 g) from Taconic Farms (TAC),
Jackson Laboratories (JAX), and Charles River Laboratories (CRL). Mice were monitored for 30 d for adverse side effects, blood
glucose, and insulin requirements. In CRL mice given 240 mg/kg STZ, more than 95% developed diabetes within 4 to 5 d, and loss
of body weight was relatively low (mean, 0.4 g). In comparison, both TAC and JAX mice were more sensitive to STZ, as evidenced
by faster development of diabetes (even at a lower STZ dose), greater need for insulin after STZ, greater body weight loss (mean:
TAC, 3.5 g; JAX, 3.7 g), and greater mortality. We recommend conducting exploratory safety assessments when selecting a nude
mouse source, with the aim of limiting morbidity and mortality to less than 10%.

Abbreviations: CRL, Charles River Laboratories; JAX, Jackson Laboratories; STZ, streptozotocin; TAC, Taconic Farms.

Rodent models commonly are used to study immunologic
mechanisms and metabolic function in diabetes.19 In our institu-
tion, the mouse diabetes model is used to test islet cell prepara-
tions for their activity in diabetes reversal. We use congenitally
athymic nude mice to avoid any interference of immune rejection
on the outcome of results.
Diabetes is induced by streptozotocin (STZ), a glucosamine–ni-
trosourea compound derived from Streptomyces achromogenes that
is used clinically as a chemotherapeutic agent in the treatment of
pancreatic β cell carcinoma. STZ damages pancreatic β cells, re-
sulting in hypoinsulinemia and hyperglycemia.10 STZ can induce
a diabetic state in 2 ways, depending on the dose. The selectiv-
ity for β cells is associated with preferential accumulation of the
chemical in β cells after entry through the GLUT2 glucose trans-
porter receptor: chemical structural similarity with glucose allows
STZ to bind to this receptor. The mode of action has best been
demonstrated in mouse studies. At high doses, typically given
singly, STZ targets β cells by its alkylating property correspond-
ing to that of cytotoxic nitrosourea compounds.4 At low doses,
generally given in multiple exposures, STZ elicits an immune and
inflammatory reaction, presumably related with the release of
glutamic acid decarboxylase autoantigens. Under this condition,
the destruction of β cells and induction of the hyperglycemic state
is associated with inflammatory infiltrates including lymphocytes
in the pancreatic islets.12 STZ has well-known adverse side effects,
which include hepatotoxicity and nephrotoxicity.4,13-15,17
Nude mice (Fox1nu/Fox1nu homozygotes) are available from a
variety of vendors.2,8,18 Although all nude mice ultimately have
Received: 08 Dec 2010. Revision requested: 09 Jan 2010. Accepted: 20 Feb 2011.
Schulze Diabetes Institute, Department of Surgery, University of Minnesota, Minneapolis,
Minnesota.
*
Corresponding author. Email: graha066@umn.edu
the same origin (a mutant in a colony at the NIH), each vendor
provides a unique subline. The development of sublines occurs
as each population of mice becomes generationally distant from
a common ancestor. Individual populations will develop identifi-
able genotype and phenotypic responses based on the accumula-
tion and maintenance of normal random genetic mutations.6,16
We used nude mice from 3 vendors (Charles River Laboratories
[CRL], Taconic Farms [TAC], and Jackson Laboratories [JAX]) in
establishing the mouse STZ-induced diabetes model. In using
mice from these vendors, we observed remarkable differences in
their mice’s sensitivity to STZ induction of diabetes and in mor-
bidity and mortality after STZ treatment. Differences in sensitivity
to STZ between mouse strains have been described anecdotally,
but we are unaware reports of differences among mice of essen-
tially the same strain provided by different vendors. Because
these differences include adverse events and mortality, the pres-
ent evaluation has relevance to animal loss and wellbeing and
adaptations to currently accepted generalized dose practices.
Materials and Methods
Animals. The nomenclature used to describe the strains below is
based on the recommendations of the International Committee on
Standardized Genetic Nomenclature for Mice.11 This standardized
nomenclature reflects both the genotype and the original source
of the strain from a distinct supplier. SPF male congenitally athy-
mic nude mice with a median age of 12 wk (interquartile range,
11 to 14 wk) and weighing approximately 30 g were obtained
from 3 commercial suppliers (CRL, TAC, and JAX); the following
background information was published on the vendors’ respec-
tive websites.2,8,18
CRL mice are Crl:NU-Foxn1nu mice from Charles River Labo-
ratories (Wilmington, MA). These animals originated from NIH

356

cm10000132.indd 356 8/1/2011 2:25:23 PM


and were originally thought to be BALB/c congenics. It was
later determined that they were not inbred; therefore they were
maintained as outbred and were not associated with any stock or
strain.2 TAC mice are CrTac:NCr-Foxn1nu animals from Taconic
Farms (Germantown, NY). These mice have both BALB/c inbred
and NIH(S) outbred stock in their genetic background. The out-
bred background originated from an accidental cross between the
BALB/c inbred nude and NIH(S) outbred nude mice. The com-
pany received the NCr nude spontaneous mutant model from the
National Cancer Institute in 1993 after several years of random
breeding.18 JAX mice are NU/J animals from Jackson Laboratories
(Bar Harbor, ME). The company imported the nude mutation
from the NIH on an outbred stock in 1975. As of 2008, the strain
has been inbred for at least 100 generations. The strain is on a
BALB/c background.8
The mice were kept under SPF conditions by using cages
equipped with filter tops and absorbent bedding (7092 Teklad
Corn Cob Bedding, Harlan Laboratories, Madison, WI) in a
temperature-controlled environment (22 to 25 °C) on a 12:12-h
light:dark photoperiod. Mice were housed in groups of 2 to 4 per
cage. Water was provided as libitum, and animals were fed irra-
diated rodent diet (Diet 2919 Teklad Global 19% Protein Rodent
Diet, Harlan Laboratories). This diet was selected preferentially
over standard chow because of its slightly higher energy den-
sity compared with that of conventional mouse diet (3.3 kcal/g
and 2.9 kcal/g, respectively). This higher energy level is advanta-
geous in support of the diabetic state. Studies using these mice
for assessment of islet cell preparations were approved by the
University of Minnesota Institutional Animal Care and Use Com-
mittee, conducted in compliance with the Animal Welfare Act,1
and adhered to principles stated in the Guide for Care and Use of
Laboratory Animals.7
Diabetes induction and animal monitoring. The mice were injected
intraperitoneally with a single high dose of 160 to 240 mg/kg
STZ. We used a pharmaceutical-grade formulation of STZ
(Zanosar Teva Pharmaceuticals, Irvine, CA) to avoid impurities
that may have harmful biologic activities. STZ is administered at
a higher dose level in nude mice than in immunocompetent mice
because the destruction of β cells in nude mice must result from
direct drug action with no assistance from the immune-mediated
response.10 We followed the dose-range recommendations of the
Clinical Islet Transplant (CIT) consortium regarding procedures
for the mouse bioassay in testing human islet cell preparations
to be used in clinical trials (150 to 240 mg/kg).3 Historically we
used a dose of 240 mg/kg to achieve consistently a diabetic state
with limited morbidity and mortality. However, when mice were
obtained from alternate suppliers, unacceptable toxicity was ob-
served, and dose corrections within the range recommended by
the consortium were attempted immediately. The dose adjust-
ments were made based on the severity of adverse events and in
a prospective and stepwise fashion: first reducing to 200 mg/kg,
then 180 mg/kg, and finally 160 mg/kg. The average dose
and range of each cohort is presented in Table 1. The mice sub-
sequently were hydrated with 1.0 mL normal physiologic saline
administered subcutaneously. Blood was obtained by lancet prick
in the tail. Body weight or blood glucose concentration (or both)
was monitored once before and daily after STZ injection until a
diabetic state was confirmed by the glucose dehydrogenase meth-
od (AlphaTRAK, Abbot Laboratories, Chicago, IL). Mice with
a glucose concentration exceeding 300 mg/dL were considered
cm10000132.indd 357
STZ-induced diabetes nude mouse model
diabetic. Insulin therapy (glargine; Lantus, Sanofi-Aventis US,
Bridgewater, NJ) was initiated at a dose of 0.5 U every other day
after 3 consecutive glucose measurements exceeding 300 mg/
dL. The dose and frequency of insulin administration (range, 0.1
to 1.2 U/kg daily) was increased or decreased in response to a
combination of measured glucose and body weight. For example,
when the blood glucose was greater than 600 mg/dL in combina-
tion with a weight loss greater than 3% with respect to the previ-
ous value, the insulin dose was increased. In cases of dehydration
or progressive weight loss, the frequency of dosing was increased.
Mice were inspected daily for signs of pain or distress, includ-
ing changes in respiration, appetite, urine output, excessive thirst,
dehydration, activity (for example, lethargy or hyperactivity),
weight loss exceeding 10% of the initial value, unkempt appear-
ance, abnormal posture, and twitching or trembling. The mea-
surement of body weight and observation of body condition (for
example, thin, normal, overweight) acted as a surrogate marker of
appetite. The measurement of skin turgor and observation of cage
bedding for urine output acted as a surrogate marker of thirst.
These complications were documented, and mice received rou-
tine medical management appropriate to presenting symptoms
(for example, warming pads for hypothermia, warm physiologic
saline for dehydration, dextrose or insulin for metabolic correc-
tion, analgesics for management of pain or distress). Mice that
manifested complications that did not respond quickly to medi-
cal treatment were euthanized promptly with an overdose of
carbon dioxide. The follow-up period was kept at 30 d after
STZ injection.
Mice with a successful course after diabetes induction subse-
quently were allocated to islet transplantation studies.
Statistics. The data for various demographic and biochemical
parameters are expressed as mean ± 1 SD and were compared
by using one-way ANOVA followed by a Bonferroni–Dunn test
for multiple comparisons. The nonparametric Wilcoxon–Mann–
Whitney test was used to compare median values. Proportions
were compared by using the Fisher exact test. Kaplan–Meier plots
were evaluated by using the log-rank test. All analyses were run by
using Prism and Instat software (GraphPad Software, San Diego,
CA). Values were considered statistically significant when P < 0.05.
Results
Nude mice from all 3 sources were similar in regard to age,
body weight, and glucose level before STZ injection (Table 1). Sta-
tistical analysis showed significance (P < 0.05) for the lower body
weight and lower glucose level in JAX mice when compared with
CRL mice, but the actual values were considered within the ex-
pected normal range according to supplier growth curves.
A single high dose (160 to 240 mg/kg) of STZ effectively in-
duced diabetes: 96.5% of mice were diabetic by day 5 after STZ
administration (Figure 1 A).
The time to reach the diabetic state and the average glucose
level after STZ differed significantly between the 3 groups of mice
(Table 1, Figure 1 A). In all cases, JAX mice developed diabetes
within 1 d after treatment, whereas achieving this state took (on
average) 1.6 d in TAC mice and 2.3 d in CRL mice. The average
glucose level after STZ was highest in JAX mice (554 mg/dL)
and lowest in CRL mice (502 mg/dL). The dose of insulin was
on average highest in the TAC group (0.70 ± 0.33 U daily) and
lowest in the CRL group (0.32 ± 0.12 U daily), P < 0.001. The level
of hyperglycemia was not related to the insulin dose (Figure 2),
357
8/1/2011 2:25:23 PM
 Vol 61, No 4
Comparative Medicine
August 2011

Table 1. Demographic variables and the effect of STZ on metabolic function in nude mice from 3 sources
CRL (n = 60) TAC (n = 23) JAX (n = 58)
Age at induction (d) 89 ± 17 90 ± 12 85 ± 12
Body weight before STZ(g) 31.3 ± 2.3 30.2 ± 1.4 29.6 ± 0.8c
Average body weight after STZ (g)a 30.3 ± 2.2 27.1 ± 1.8c 26.3 ± 1.3c
Body weight loss (g) a
0.37 ± 2.3 3.5 ± 3.4 c
3.7 ± 2.3c
STZ dose (mg/kg) 240 ± 0 223 ± 26 181 ± 5c,d
STZ dose range (mg/kg) 240 160–240 180–200
Days to blood glucose > 300 (mg/dL) 2.3 ± 0.8 1.6 ± 0.7b 1.0 ± 0.1c,d
Average insulin requirement (U/d)a 0.32 ± 0.12 0.70 ± 0.33c 0.49 ± 0.07c
Random blood glucose before STZ (mg/dL) 157 ± 25 144 ± 29 134 ± 21c
Average random blood glucose after STZ (mg/dL) a
502 ± 63 503 ± 73 554 ± 44b,d
Data are presented as arithmetic mean ± 1 SD.
a
Averages calculated in animals developing diabetes and surviving at least 7 d after injection (CRL, n = 55; TAC, n = 11; JAX, n = 56).
b
P < 0.01 compared with CRL
c
P < 0.001 compared with CRL
d
P < 0.001 compared with TAC

Figure 1. (A) Diabetes induction and (B) survival after diabetes induction in male nude mice from Charles River Laboratories (CRL), Jackson Labora-
tories (JAX), and Taconic Farms (TAC). (A) The development of diabetes (glucose greater than or equal to 300 mg/dL) is presented as Kaplan–Meier
estimates plotted over time after STZ infusion. 100% of JAX and TAC mice rapidly developed diabetes by day 2 after STZ injection, whereas CRL mice
needed 5 d to achieve a diabetic state in 92% of mice (P < 0.001). (B) Death or euthanasia is presented as Kaplan–Meier estimates plotted over time after
STZ infusion. CRL mice demonstrated significantly better survival (P < 0.001), compared with JAX and TAC mice.

Adverse effects of STZ injection included weight loss, respira-
tory distress, rapid glycemic shifts resulting in life-threatening
hypoglycemia, and a generalized poor body condition (Table 2)
that manifested with higher frequency in JAX and TAC mice
(P < 0.001). The STZ dose was decreased in the cohorts with these
complications (JAX, TAC). In JAX and TAC mice, the dose re-
ductions significantly (P < 0.0001) increased the number of days
that mice survived after STZ administration. Median survival
was 23 d (interquartile range, 15 to 30 d) in mice given less than
200 mg/kg STZ, whereas it was 7 d (interquartile range, 2 to 14 d)
in mice receiving 200 mg/kg or more. However, the time to
development of diabetes, average insulin requirement after STZ,
random glucose level after STZ, and overall complication rates
were not affected by dose reduction. This effect might be related
to the rather high dose range that was used relative to published
recommendations,3 so that within this dose range, only a relation-
ship with severe toxicity at doses exceeding 200 mg/kg became
evident. Overall, CRL mice received the highest dose (240 mg/kg)
and experienced the lowest rate of complications. Even at
lower average doses (223 mg/kg in TAC mice and 181 mg/kg in
JAX mice), TAC and JAX mice experienced significantly (P < 0.05)
more weight loss despite receiving more insulin (Table 1, Figure
2). Using a 10% weight loss as a threshold value for animal health
status, the incidence of weight loss exceeding this threshold was
lowest in CRL mice (5%), higher in TAC mice (35%), and highest
in JAX mice (55%).
The proportions of mice that survived with no complications
were 17% for TAC mice, 13% for JAX mice, and 92% for CRL mice
(Table 2). Survival is illustrated in Figure 1 B: 50% survival
after STZ treatment was 7 d for TAC mice, 25 d for JAX mice, and
greater than 30 d for CRL mice. The occurrence of complications,
either separately or in combination, was highest in JAX mice

358

cm10000132.indd 358 8/1/2011 2:25:23 PM

 STZ-induced diabetes nude mouse model

Figure 2. Blood glucose values (top row) and body weight (bottom row) in response to insulin (glargine) treatment (U/kg daily) after diabetes induc-
tion by using STZ in male nude mice from Charles River Laboratories (CRL), Jackson Laboratories (JAX), and Taconic Farms (TAC). Data are presented
as mean ± 1 SD. Dashed lines indicate average blood glucose value after STZ (top row) and average baseline weight (bottom row).

Table 2. Complications (%) in animals from various sources during a to the dose range criteria for centers participating in Clinical Islet
30-d follow-up after diabetes induction Transplant (CIT) consortium studies (namely, 150 to 240 mg/kg),
CRL TAC JAX we used the 240-mg/kg dose initially and adapted the dose level
(n = 60) (n = 23) (n = 58) to 160, 180, 200, or 240 mg/kg on the basis of the severity of ad-
verse events.3 Because the approach to dose reduction was es-
Overall complicationa rate 8 83b 71b
sentially a pragmatic one in response to observed adverse events
(see Materials and Methods), the present study was not powered
By category to assess the specific influence of specific dosages on achievement
  Respiratory distress 0 35b,c 2 of diabetic state. However, the doses used in each of the cohorts
  Life-threatening hypoglycemia 2 26d 64b,e were sufficient to induce a diabetic state (Figure 1 A). In using
  Generalized poor body 8 44b 45b the model, we were confronted with variable but sometimes se-
   condition vere and frequent adverse side effects in our mice, resulting in a
  At least 10% loss in average 5 35d 55b small window between effective diabetes induction and compli-
cations of STZ treatment. This difficulty was apparent even when
   body weight after STZ
we used pharmaceutical-grade STZ (Streptozocin, Zanosar), for
a
Complications were defined as an adverse effect from STZ treatment which chemical impurities and lot variability are limited. The
resulting in death or euthanasia.
b
P < 0.001 compared with CRL
present comparative evaluation of 3 sources of nude mice shows
c
P < 0.001 compared with JAX remarkable variation within this STZ dose range for effectiveness
d
P < 0.01 compared with CRL and complication rate.
e
P < 0.05 compared with TAC TAC mice, and to a lesser extent JAX mice, showed a rather
small STZ dose window in contrast to that of CRL mice. This
difference was already evident in the variable sensitivity to STZ
and lowest in CRL mice. Severe complications that either caused during diabetes induction, which occurred more rapidly and re-
death or required euthanasia occurred in 83% of TAC mice, 71% quired a lower dose in TAC and particularly JAX mice, which
of JAX mice, and 8% of CRL mice. subsequently had the highest blood glucose level after STZ
(Table 1). In addition, the requirement for insulin was highest in
Discussion TAC and JAX mice. This greater sensitivity to STZ was further
At our institution, we use STZ-induced diabetes in congeni- apparent in the complication rates. After STZ, both TAC and JAX
tally athymic nude mice to evaluate the in vivo potency of islet mice showed substantial weight loss, which was often accompa-
cell preparations. Diabetes induction is accomplished by using nied by death or the need for euthanasia.
a single high STZ dose, to achieve optimal toxicity to pancreatic In contrast to the results in TAC and JAX animals, diabetes in-
β cells without the possibility of remaining endogenous insulin- duction by using STZ was easily achieved in CRL mice without
synthesizing capacity that would confound the results. Adhering emergence of complications. The lower sensitivity to STZ in CRL

359

cm10000132.indd 359 8/1/2011 2:25:23 PM

 Vol 61, No 4
Comparative Medicine
August 2011
mice was reflected by a longer average period to achieve a diabet-
ic state and a lower rate of complications. The loss of mice due to
complications was 8%, and only 5% of mice passed the threshold
of 10% loss in body weight. This threshold is considered relevant,
because it might affect the outcome of studies conducted with
the mice.
The reason for this difference between mice from the 3 sources
remains to be established. Genotypic analysis such as nucleotide
polymorphism assays would be required to determine the degree
of genetic variation between the CRL mice and those provided by
JAX and TAC. The accumulation of genetic variation in discrete
populations could underlie small but possibly significant changes
in phenotypic responses between these sublines, because both
the origin (NIH) and background strain (BALB/c) were the same
among the 3 sources.5,6,9,16
Hepatotoxicity and nephrotoxicity are both well-documented
effects of STZ.4,13-15 In addition to causing acidosis that can result
from renal tubular damage in the kidney, STZ is one of the ni-
trosourea drugs or toxins known to cause type B lactic acidosis.17
Analysis of blood gases and chemistries is used to confirm and
characterize acidosis, but blood volume requirements might un-
necessarily compromise mice in an already weakened state. In
the current study, adverse events commonly presented as respira-
tory distress, weight loss, and a generalized poor body condition
(Table 2)—all conditions that are consistent with acidosis. This
observation demonstrates the need in future studies to establish
species appropriate test methods for monitoring acidosis sever-
ity and response to treatment strategies. In addition to manifest-
ing these phenomena, JAX and TAC mice required significantly
more insulin, as might be expected with acidosis-induced glucose
intolerance and insulin resistance. We also noted severe hypo-
glycemia, which together with lactic acidosis suggests that the
liver was injured to the extent that errors of metabolism involving
exaggerated glycolysis resulted.
In conclusion, this comparative evaluation of 3 sources of con-
genitally athymic nude mice showed that CRL animals demon-
strate a window between effective diabetes induction by STZ
and complication rate that most easily supports generation of the
diabetic nude mouse model. This window appears small for TAC
and JAX nude mice. Investigations performed in the nude mouse
bioassay constitute a necessary component of the quality assess-
ment in administration of manufactured islet cell products to pa-
tients. We recommend performing exploratory safety assessments
when selecting a nude mice source if the mice are to be used in
the STZ-induced diabetes model. In this assessment, the type and
frequency of adverse events should be characterized, with the
aim of limiting morbidity and mortality to less than 10% in com-
bination with successful induction of a diabetic state in at least
90% of animals. In a well-characterized model, the adverse events
associated with the model are defined and subsequently unlike-
ly to be inadvertently attributed to the investigational product.
This characterization in combination with selection of an optimal
source enhances animal wellbeing and reduces experimental data
variability, presenting an opportunity for refinement.
Acknowledgments
We acknowledge with gratitude the excellent care of the animals by
Elisabeth Steger, Theresa DuFour, James Munson, and Angela Craig. In
particular, we thank Sandra Wagner and the Mouse Genetics Laboratory
360
cm10000132.indd 360
(Masonic Cancer Center, University of Minnesota) who provided
valuable input and insight into supplier differences. Our study was
supported by the Schulze Family Foundation, the National Institutes of
Health, and the Juvenile Diabetes Research Foundation.
References
1. Animal Welfare Act as Amended. 2007.7 USC §2131-2159.
2. Charles River Laboratories. [Internet]. 2011. Immunodeficient
animal models. [Cited 16 February 2011]. Available at: http://
www.criver.com/sitecollectiondocuments/rm_rm_d_immunode-
ficient_models.pdf
3. DAIT, NIAID, NIH. [Internet]. 2008. Purified human pancreatic
islets, in vivo islets function. Document no. 3104, A04, effective date
07 July 2008. [Cited 16 February 2011]. Available at: http://www.
isletstudy.org/CITDocs/3104,%20A04%20In%20Vivo%20Islets%20
Function.pdf
4. Dufrane D, van Steenberghe M, Guiot Y, Goebbels RM, Saliez A,
Gianello P. 2006. Streptozotocin-induced diabetes in large animals
(pigs, primates): role of GLUT2 transporter and β-cell plasticity.
Transplantation 81:36–45.
5. Gonzalez C, Cuvellier S, Hue-Beauvais C, Lévi-Strauss M. 2003.
Genetic control of nonobese diabetic mice susceptibility to high-dose
streptozotocin-induced diabetes. Diabetologia 46:1291–1295.
6. Hughes ED, Qu YY, Genik SJ, Lyons RH, Pacheco CD, Lieberman
AP, Samuelson LC, Nasonkin IO, Camper SA, Van Keuren ML,
Saunders TL. 2007. Genetic variation in C57BL/6 ES cell lines and
genetic instability in the Bruce4 C57BL/6 ES cell line. Mamm Genome
18:549–558.
7. Institute for Laboratory Animal Research. 1996. Guide for the care
and use of laboratory animals. Washington (DC): National Acad-
emies Press.
8. The Jackson Laboratory. [Internet]. 2011. JAX mice database.
[Cited 16 February 2011]. Available at: http://jaxmice.jax.org/
strain/002019.html
9. Leiter EH. 1982. Multiple low-dose streptozotocin-induced hyperg-
lycemia and insulitis in C57BL mice: Influence of inbred background,
sex, and thymus. Proc Natl Acad Sci USA 79:630–634.
10. Lenzen S. 2008. The mechanisms of alloxan- and streptozotocin-
induced diabetes. Diabetologia 51:216–226.
11. Mouse Genome Informatics. [Internet]. 2010. Guidelines for
nomenclature of mouse and rat strains. [Cited 16 February 2011].
Available at: http://www.informatics.jax.org/mgihome/nomen/
strains.shtml
12. Paik SG, Fleischer N, Shin SI. 1980. Insulin-dependent diabetes
mellitus induced by subdiabetogenic doses of streptozotocin: obliga-
tory role of cell-mediated autoimmune processes. Proc Natl Acad
Sci USA 77:6129–6133.
13. Palm F, Ortsäter H, Hansell P, Liss P, Carlsson PO. 2004. Differ-
entiating between effects of streptozotocin per se and subsequent
hyperglycemia on renal function and metabolism in the streptozo-
tocin-diabetic rat model. Diabetes Metab Res Rev 20:452–459.
14. Schacht RG, Feiner HD, Gallo GR, Lieberman A, Baldwin DS.
1981. Nephrotoxicity of nitrosoureas. Cancer 48:1328–1334.
15. Schein PS, Loftus S. 1968. Streptozotocin: depression of mouse liver
pyridine nucleotides. Cancer Res 28:1501–1506.
16. Simpson EM, Linder C, Sargent E, Davisson M, Mobraaten L, Sharp
J. 1997. Genetic variation among 129 substrains and its importance
for targeted mutagenesis in mice. Nat Genet 16:19–27.
17. Szerlip HM. 2009. Metabolic acidosis, p 78. In: Greenberg A, Ch-
eung AK, editors. Primer on kidney diseases. Philadelphia (PA):
Saunders.
18. Taconic Farms. [Internet]. 2011. Animal models. [Cited 16 Feb-
ruary 2011]. Available at: http://www.taconic.com/wmspage.
cfm?parm1=873
19. Van Belle TL, Taylor P, von Herrath MG. 2009. Mouse models for
type 1 diabetes. Drug Discov Today Dis Models 6:41–45.
8/1/2011 2:25:23 PM
Diabetologia (2008) 51:216–226
DOI 10.1007/s00125-007-0886-7
REVIEW
The mechanisms of alloxan- and streptozotocin-induced
diabetes
S. Lenzen
Received: 12 September 2007 / Accepted: 8 October 2007 / Published online: 18 December 2007
# Springer-Verlag 2007
Abstract Alloxan and streptozotocin are toxic glucose
analogues that preferentially accumulate in pancreatic
beta cells via the GLUT2 glucose transporter. In the
presence of intracellular thiols, especially glutathione,
alloxan generates reactive oxygen species (ROS) in a
cyclic redox reaction with its reduction product, dialuric
acid. Autoxidation of dialuric acid generates superoxide
radicals, hydrogen peroxide and, in a final iron-catalysed
reaction step, hydroxyl radicals. These hydroxyl radicals
are ultimately responsible for the death of the beta cells,
which have a particularly low antioxidative defence
capacity, and the ensuing state of insulin-dependent
‘alloxan diabetes’. As a thiol reagent, alloxan also
selectively inhibits glucose-induced insulin secretion
through its ability to inhibit the beta cell glucose sensor
glucokinase. Following its uptake into the beta cells,
streptozotocin is split into its glucose and methylnitro-
sourea moiety. Owing to its alkylating properties, the
latter modifies biological macromolecules, fragments
DNA and destroys the beta cells, causing a state of
insulin-dependent diabetes. The targeting of mitochon-
drial DNA, thereby impairing the signalling function of
beta cell mitochondrial metabolism, also explains how
streptozotocin is able to inhibit glucose-induced insulin
secretion.
S. Lenzen (*)
Institute of Clinical Biochemistry, Hannover Medical School,
30623 Hannover, Germany
URL: http://www.mh-hannover.de/klinische_biochemie.html
Keywords Alkylation . Alloxan diabetes .
Cytotoxic glucose analogues . Pancreatic beta cell toxicity .
Reactive oxygen species . Streptozotocin diabetes
Abbreviations
GSH glutathione
MNU N-methyl-N-nitrosourea
NO nitric oxide
PARP poly(ADP-ribose) polymerase
ROS reactive oxygen species
SOD superoxide dismutase
Introduction
Alloxan and streptozotocin are the most prominent diabe-
togenic chemicals in diabetes research. Both are cytotoxic
glucose analogues. Although their cytotoxicity is achieved
via different pathways, their mechanisms of beta cell
selective action are identical.
In 1838, Wöhler and Liebig [1] synthesised a pyrimidine
derivative, which they later called alloxan [2, 3]. In 1943,
alloxan became of interest in diabetes research when Dunn
and McLetchie reported that it could induce diabetes in
animals [4] as a result of the specific necrosis of the
pancreatic beta cells [5–7]. The resulting insulinopenia
causes a state of experimental diabetes mellitus called
‘alloxan diabetes’ [4, 8, 9]. The reduction product of
alloxan, dialuric acid [1], has also been shown to be
diabetogenic in animals [10, 11], and to cause ultrastruc-
tural changes identical to those observed in response to
alloxan [6].
Streptozotocin is an antimicrobial agent and has also
been used as a chemotherapeutic alkylating agent [12–14].
Diabetologia (2008) 51:216–226
In 1963, Rakieten et al. [15] reported that streptozotocin is
diabetogenic. Again, this insulinopenia syndrome, called
‘streptozotocin diabetes’ [13], is caused by the specific
necrosis of the pancreatic beta cells and streptozotocin has
been the agent of choice for the induction of diabetes
mellitus in animals ever since [3, 16].
After decades of research a unifying explanation for the
selective toxicity of these two most prominent diabetogenic
agents [2, 17–22] can be provided. Since an understanding
of the chemical reactivity of these compounds is crucial for
understanding their diabetogenicity, this review will pro-
vide an integrated view of their chemical properties and
biological effects.
Alloxan diabetes and streptozotocin diabetes
Figure 1 shows a schematic diagram of the tetraphasic
and triphasic blood glucose responses induced by alloxan
and streptozotocin, respectively, when injected [22]. The
responses are accompanied by corresponding inverse
changes in plasma insulin and sequential ultrastructural
changes resulting in necrotic beta cell death.
A first transient hypoglycaemic phase of up to
30 min starts within minutes of alloxan injection. This
short-lived hypoglycaemic response is the result of a
transient stimulation of insulin secretion, as documented
by an increase in the plasma insulin concentration. The
underlying mechanism is a temporarily reduced con-
sumption and increased availability of ATP caused by
blockade of glucose phosphorylation through glucoki-
nase inhibition. This initial transient hypoglycaemic
phase is not observed in response to streptozotocin
Fig. 1 Phasic blood glucose response to a diabetogenic dose of
alloxan (tetraphasic; I–IV) or streptozotocin (triphasic; the first phase
does not develop in the case of streptozotocin; II–IV)
217
injection, since streptozotocin does not inhibit glucoki-
nase. Morphological alterations are minimal during this
phase.
The second phase starts with an increase in the
blood glucose concentration, 1 h after administration of
the toxins, and a decrease in plasma insulin. This first
hyperglycaemic phase, which usually lasts 2–4 h, is
caused by inhibition of insulin secretion leading to
hypoinsulinaemia. During this phase the beta cells show
the following morphological characteristics: intracellular
vacuolisation, dilation of the rough endoplasmic retic-
ulum, decreased Golgi area, reduced secretory granules
and insulin content, and swollen mitochondria.
The third phase, again a hypoglycaemic phase,
typically occurs 4–8 h after the injection of the toxins
and lasts several hours. It may be so severe that it
causes convulsions, and may even be fatal without
glucose administration, in particular when liver glyco-
gen stores are depleted through starvation. This severe
transitional hypoglycaemia is produced by the flooding
of the circulation with insulin as a result of toxin-
induced secretory granule and cell membrane rupture.
Pancreatectomy prevents this phase. In addition to the
morphological changes seen in the first phase, the beta
cell nuclei are pyknotic and show no TUNEL-positive
staining; these changes are irreversible.
The fourth phase is the permanent diabetic hyper-
glycaemic phase. Morphologically, complete degranula-
tion and loss of beta cell integrity is seen within 12–
48 h. Non-beta cells remain intact, demonstrating the
beta cell-selective character of the toxic action. Cell
debris originating from the dying beta cells is removed
by non-activated scavenger macrophages.
Thus, injections of alloxan and streptozotocin prin-
cipally induce the same blood glucose and plasma
insulin responses and cause an insulin-dependent type
1-like diabetes syndrome. All of the described morpho-
logical features of beta cell destruction are characteris-
tic of necrotic cell death [22]. This mechanism is clearly
at variance with that which underlies autoimmune type 1
diabetes, both in humans and rodent models of the
disease, where beta cell demise is the result of apoptotic
cell death without leakage of insulin from ruptured
secretory granules [22].
Alloxan: mechanism of action
Alloxan has two distinct pathological effects: it selec-
tively inhibits glucose-induced insulin secretion through
specific inhibition of glucokinase, the glucose sensor of
218 Diabetologia (2008) 51:216–226

the beta cell, and it causes a state of insulin-dependent
diabetes through its ability to induce ROS formation,
resulting in the selective necrosis of beta cells. These
two effects can be assigned to the specific chemical
properties of alloxan, the common denominator being
selective cellular uptake and accumulation of alloxan
by the beta cell.
Beta cell selectivity of alloxan
Alloxan is a very unstable chemical compound [23]
with a molecular shape resembling glucose (Fig. 2) [24,
25]. Both alloxan and glucose are hydrophilic and do not
penetrate the lipid bilayer of the plasma membrane. The
alloxan molecule is structurally so similar to glucose that

Comparison of the chemical properties of alloxan and streptozotocin

Alloxan Streptozotocin
Chemical name 2,4,5,6-Tetraoxypyrimidine; 2-Deoxy-2-
2,4,5,6-pyrimidinetetrone ([(methylnitrosoamino)carbonyl]amino)-
D-glucopyranose
Chemical structure Oxygenated pyrimidine derivative; Cytotoxic methylnitrosourea moiety (N-
barbituric acid derivative (5- methyl-N-nitrosourea) attached to the
ketobarbituric acid) glucose (2-deoxyglucose) molecule;
glucosamine derivative
Chemical properties Very hydrophilic, beta cell-toxic Hydrophilic, beta cell-toxic glucose
glucose analogue (partition analogue
coefficient –1.8); weak acid
Chemically unstable (half-life of Relatively stable at pH 7.4 and 37o C (at
1.5 min at pH 7.4 and 37o C, least for up to 1 h)b
decomposing to alloxanic acid);
a
Stable at acid pH
Chemical reactivities Thiol reagent that is reduced to DNA alkylating agent
dialuric acid in the presence of
GSH and other thiols
A protoxin; intracellular Protein alkylating agent
metabolism of this xenobiotic
generates toxic ROS through
redox cycling with dialuric acid
over a long time period (>1 h)
‘Compound 305’, a non-toxic NO donor
alloxan-GSH adduct of unknown
structure with a characteristic
absorbance at a wavelength of 305
nm; a small amount is formed
during each redox cycle
Mode of toxicity Generation of ROS DNA alkylation
a
For experimentation, concentrated stock solutions in 0.01 mol/l HCl, kept on ice, should be used and
added to the test medium just prior to the start of the experiment to obtain the final concentration. For
injection, the stock solution should be diluted with ice-cold saline (0.9% NaCl) immediately prior to
injection.
b
For in vitro experimentation, concentrated stock solutions in 0.01 mol/l HCl, kept on ice, should be
used and added to the test medium just prior to the start of the experiment to obtain the final
concentration. For injection, a stable solution in citrate buffer (pH 4.5) is most suitable.
Diabetologia (2008) 51:216–226
Fig. 2 Chemical formulas of
alloxan, dialuric acid,
butylalloxan, streptozotocin
and methylnitrosourea
the GLUT2 glucose transporter in the beta cell plasma
membrane accepts this glucomimetic and transports it into the
cytosol [25, 26]. Alloxan does not inhibit the function of the
transporter [27], and can therefore selectively enter beta cells
in an unrestricted manner [28–30]. It is therefore not toxic to
insulin-producing cells that do not express this transporter [27,
31]. The half-life of alloxan is short [23, 32]; in aqueous
solution it spontaneously decomposes into non-diabetogenic
alloxanic acid within minutes [23]. Because of this, it must be
taken up and accumulated quickly in the beta cell [28], and is
therefore ineffective when blood flow to the pancreas is
interrupted for the first few minutes after alloxan injection
[33–35]. N-substituted alloxan derivatives with a long carbon
side chain, such as butylalloxan (Fig. 2), differ chemically
from alloxan in that they are lipophilic [36]. Butylalloxan acts
in a similar manner to alloxan and preferentially damages beta
cells [6, 11]. But since derivatives such as butylalloxan are
lipophilic they can also penetrate plasma membranes that do
not express the GLUT2 transporter [27]. Nephrotoxicity is a
dominating feature of the toxicity of lipophilic derivatives
after systemic administration [11]. This nephrotoxicity is so
severe that it causes fatal renal failure in the animals before
diabetes can develop [11]. The susceptibility of the kidney to
the toxic action of these lipophilic alloxan derivatives is the
result of their preferential accumulation in the tubular cells of
the kidney, which, like the beta cells, express the GLUT2
glucose transporter.
Glucokinase inhibition
Selective inhibition of glucose-induced insulin secretion is the
major pathophysiological effect of the thiol group reactivity of
alloxan [37–39]. Alloxan has a central 5-carbonyl group that
reacts very avidly with thiol groups. Glucokinase (hexoki-
nase IV) is the most sensitive thiol enzyme in the beta cell
219
[2, 40], with a half maximal inhibitory concentration in the
1–10 μmol/l range. At higher concentrations, alloxan can
inhibit many functionally important enzymes, as well as
other proteins and cellular functions [22, 41].
Inhibition of glucokinase reduces glucose oxidation and
ATP generation [42], thereby suppressing the ATP signal
that triggers insulin secretion [2]. Inhibition of glucokinase
is achieved within 1 min of exposure to alloxan.
The inhibition of glucose-induced insulin secretion is
preceded by a very transient (1–2 min) stimulation of insulin
secretion immediately after exposure to alloxan [43]. This ef-
fect can be explained by an initial reduction of ATP consump-
tion resulting from the blockade of glucose phosphorylation
by glucokinase [44], which produces a transient increase in
ATP in the beta cell and triggers a transient release of insulin.
The inhibition of insulin secretion after exposure to alloxan
[43, 45, 46] is restricted to that induced by glucose and its
epimer, mannose, both of which induce insulin secretion
through interaction with glucokinase [44]. Insulin biosynthesis
is also inhibited by alloxan [47, 48], most likely through the
same mechanism. The insulin secretory response to other
nutrient secretagogues, such as 2-ketoisocaproic acid and
leucine, or non-nutrient secretagogues, such as the sulfonyl-
urea drug tolbutamide, remains intact initially because it is not
mediated via glucokinase [49], but is lost after a delay of up to
1 h [50] as a consequence of the gradual deterioration of beta
cell function.
Thiols such as the tripeptide glutathione (GSH), cysteine and
dithiothreitol protect glucokinase against alloxan inhibition
because they reduce alloxan to dialuric acid, which is not thiol
reactive [23, 51, 52]. However, only dithiols such as
dithiothreitol [51, 52] can readily reverse alloxan-induced
glucokinase inhibition. They achieve this by reducing func-
tionally essential cysteine residues of the glucokinase enzyme
[40], which are oxidised through alloxan action [51, 52].
220 Diabetologia (2008) 51:216–226

Likewise, glucose protects against alloxan-induced inhibi- redox cycling reactions between alloxan and dialuric acid,
tion of glucose-induced insulin secretion because its binding and protective actions of cytoprotective enzymes’ (reactions
to the sugar-binding site of glucokinase prevents the oxidation i–ii). In the beta cells the toxic action of alloxan is initiated
of the functionally essential thiol groups. The non-metabolis- by free radicals formed in this redox reaction [53–57].
able seven carbon sugar mannoheptulose protects glucokinase Autoxidation of dialuric acid generates superoxide radicals
through the same mechanism, but this alone is not sufficient to (iii–iv) and hydrogen peroxide (iii–iv), and in the Fenton
prevent alloxan-induced inhibition of insulin secretion. The reaction (v), in the presence of a suitable metal catalyst
glucose analogue 3-O-methylglucose, which is not a sub- (typically iron) (vi), hydroxyl radicals (v–vii). The autox-
strate of glucokinase, does however prevent inhibition. It idation of dialuric acid involves the intermediate formation
does this through competitive blockade of alloxan uptake of the alloxan radical (i–iv) [54–56].
into the beta cell via the GLUT2 glucose transporter. The reduction of alloxan to dialuric acid in the cell
Thus, the inhibition of glucose-induced insulin secretion requires the presence of a suitable thiol, typically the
by alloxan is the result of the exquisite thiol reactivity of tripeptide glutathione (GSH) to generate the redox cycling
the glucose sensor glucokinase. partner, dialuric acid, and oxidised glutathione (viii) [56,
58]. The triketone structure of alloxan is vitally important
Beta cell toxicity and diabetogenicity of alloxan for this two-step reaction with glutathione [59], which
generates the alloxan radical as an intermediate product
Alloxan can generate reactive oxygen species (ROS) in a (ix–x). Other thiols such as cysteine, which are present at
cyclic reaction with its reduction product, dialuric acid lower concentrations in the cell, dithiols and ascorbic acid
(Fig. 3) [53–56], as depicted in the text box ‘Chemical are also suitable reducing agents and may therefore
contribute to alloxan reduction [60]. Alloxan can also
generate ROS by reacting with thiol groups on proteins
Chemical redox cycling reactions between such as enzymes [52, 61] and albumin [62]. During each
alloxan and dialuric acid, and protective typical redox cycle a small amount of ‘Compound 305’, an
actions of cytoprotective enzymes alloxan–GSH adduct [23, 32, 56, 63], is formed. The
. . intracellular concentration of Compound 305 increases in
(i) AH 2 + O 2 AH + O 2− + H + a time-dependent manner, which gradually decreases the
. .− amount of reduced GSH available in the cell for redox
(ii) AH + O 2 A + O2 + H + cycling, thus producing a lower pro-oxidative ratio
.− . between alloxan and GSH, rather than a higher antiox-
(iii) AH 2 + O 2 + H + AH + H 2 O 2
idative ratio [54–56].
. .−
(iv) AH + O 2 + H + A + H 2O 2 Paradoxically the thiols cysteine and GSH have long
been reported to protect rats against the development of
.
(v) H 2 O 2 + e − OH + OH − alloxan diabetes when injected together with alloxan [64,
. 65]. This observation can now be explained in light of the
(vi) Fe 2+ + H 2 O 2 Fe 3+ + OH + OH − established molecular mechanism of alloxan action. When
.− metal . concentrations of reducing agents in the blood stream or in
(vii) Net : O 2 + H 2 O 2 O 2 + OH + OH −
catalyst the extracellular space are significantly increased through
(viii) A + 2GSH AH 2 + GSSG injection of a thiol, more alloxan is reduced extracellularly
. . so that less is available for intracellular accumulation.
(ix) A + GSH AH + GS Normally the capacity for alloxan reduction, redox cycling
. . and the generation of ROS in the circulation [62] is not
(x) AH + GSH AH 2 + GS sufficient to prevent the alloxan molecule from reaching
.− and entering the beta cell.
(xi) 2H + + 2O 2 SOD
H 2O 2 + O 2
The major oxidation pathway of dialuric acid, a chain
(xii) 2H 2O 2 Catalase
O 2 + 2H 2O reaction dependent upon superoxide radicals, is inhibited by
superoxide dismutase (SOD; xi). In the presence of SOD,
(xiii) 2GSH + H 2O 2 GPx
2H 2O + GSSG an autocatalytic process involving the interaction between
. dialuric acid and alloxan becomes important [54], while in
A, alloxan; AH , alloxan radical; AH2, dialuric acid;
. the presence of a transition metal, a third oxidation
GPx, glutathione peroxidase; GS , glutathione radical;
. mechanism, dependent upon hydrogen peroxide, has been
GSSG, oxidised glutathione; OH , hydroxyl radical;
. identified [54]. This latter step is inhibited by the hydrogen
O 2− , superoxide radical
peroxide inactivating enzyme catalase [54] (xii; text box:
Diabetologia (2008) 51:216–226
Fig. 3 Redox cycling reactions between alloxan and dialuric acid. A,
alloxan; AH , alloxan radical; AH2, dialuric acid; GS , glutathione
radical; GSSG, oxidised glutathione; OH , hydroxyl radical; O2 ,
superoxide radical
Chemical redox cycling reactions between alloxan and
dialuric acid, and protective actions of cytoprotective
enzymes). The other hydrogen peroxide inactivating en-
zyme, glutathione peroxidase, can principally act in a
similar manner. But this enzyme requires GSH, which is
oxidised in this reaction (xiii).
When kept in the oxidised form, alloxan does not
generate ROS [60]. Thus, alloxan is not cytotoxic in the
absence of thiols such as GSH or when restricted to the
extracellular space [60]. Thiols in the plasma membrane,
with which alloxan could interact and generate ROS in a
redox cycle, are apparently not present or not accessible to
a sufficient extent to allow the generation of ROS and
damage the cells [60].
The reduction product dialuric acid is also not toxic
when kept in the reduced form [54, 56, 60]. However, in
contrast to alloxan, dialuric acid autoxidises spontaneously
in the presence of O2, thus generating cytotoxic ROS in the
absence of thiols [54, 55]. As a result of subsequent redox
cycling it can also induce diabetes [10, 11] and cause beta
cell lesions as alloxan [6].
The antioxidative enzyme SOD has a cytoprotective
effect against both alloxan and dialuric acid in the presence
of GSH by virtue of its ability to scavenge superoxide
radicals, which are generated in the O2-dependent chain
reaction between dialuric acid and alloxan. The resultant
suppression of dialuric acid autoxidation prevents the
generation of further ROS [54, 56], although increasing
the concentrations of the toxins can reinstate the toxic
action of both compounds. This is due to an autocatalytic
reaction between the oxidised and reduced pyrimidine,
which generates ROS even when the chain reaction is
suppressed by SOD [54, 56].
Apparently, the superoxide radical is not the species
responsible for the cytotoxicity of alloxan and dialuric acid.
221
Several lines of evidence point to hydroxyl radicals as the
principal culprit.
First, the hydrogen peroxide-inactivating enzyme cata-
lase provides significantly better protection against the
toxic effects of alloxan and dialuric acid on insulin-
producing cells than the superoxide radical-inactivating
enzyme SOD, though catalase does not prevent redox
cycling and therefore superoxide radical formation [54, 56].
Second, since intracellular GSH concentrations are in the
same millimolar concentration range in insulin-producing
cells as in liver cells, and since both cell types express the
GLUT2 glucose transporter, a difference in the intracellular
GSH concentration cannot be responsible for the much
greater susceptibility in vivo of insulin-producing cells
compared with liver cells to the toxicity of alloxan [17].
However, liver cells are much better endowed with the
hydrogen peroxide-inactivating enzyme catalase compared
with insulin-producing cells [66, 67]. When the low
intracellular levels of catalase are raised in insulin-producing
cells through overexpression of the gene for this enzyme,
these cells are protected equally well [60].
Third, a multitude of metal chelators, iron chelators in
particular, and hydroxyl scavengers have been tested for
their protective action both in vitro and in vivo, but the
results obtained have not been unequivocal [18, 22, 66, 68–
70]. Given the extremely short half-life and the extraordi-
nary chemical reactivity of the hydroxyl radical, it is not
surprising that complete protection against alloxan toxicity
cannot be achieved. Hydroxyl radicals interact with
biological targets before they can be inactivated through
hydroxyl radical scavengers. In the same way, it is not
surprising that it has been extremely difficult to efficiently
suppress metal-catalysed hydroxyl radical formation
through chelators [69–72], since it is crucial that metal
chelation occurs before hydroxyl radical formation is
initiated. Owing to the chemical properties of the scav-
engers and chelators, this cannot be completely achieved
unless experimental conditions are optimised. In such a
setting the toxicity of alloxan and dialuric acid to insulin-
producing cells in vitro is suppressed by the iron chelator
desferrioxamine [60], which prevents the generation of the
very toxic hydroxyl radicals in the iron-catalysed Fenton
reaction [54, 56] (Fig. 3).
Taken together, these data provide convincing evidence
that the hydroxyl radical [56, 60, 73], rather than the
superoxide radical, is the ultimate toxic ROS species, and
that its formation is prevented by the destruction of
hydrogen peroxide by catalase [54, 56].
Optimal protection against the cytotoxic action of
alloxan and dialuric acid is provided only by a combination
of SOD plus catalase, which completely prevents redox
cycling between alloxan and dialuric acid, and thus the
generation of all ROS species in this reaction pathway.
222
Glucose also provides complete protection against all
toxic effects of alloxan both in vivo and in vitro [2]. This
universal protection is achieved through the prevention of
glucokinase inhibition and the preservation of the antiox-
idative defence mechanisms of the beta cell [22]. The non-
metabolisable glucose analogue 3-O-methylglucose also
provides protection, but does this exclusively through the
prevention of alloxan uptake into the beta cell via the
GLUT2 glucose transporter [22].
Thus, it can be concluded that the pancreatic beta cell
toxicity and the resultant diabetogenicity of alloxan are due
to redox cycling and the generation of toxic ROS.
Streptozotocin: mechanism of action
Streptozotocin (Fig. 2) inhibits insulin secretion and causes
a state of insulin-dependent diabetes mellitus. Both effects
can be attributed to its specific chemical properties, namely
its alkylating potency (see text box: Comparison of the
chemical properties of alloxan and streptozotocin). As with
alloxan, its beta cell specificity is mainly the result of
selective cellular uptake and accumulation.
Beta cell selectivity of streptozotocin
Streptozotocin is a nitrosourea analogue in which the
N-methyl-N-nitrosourea (MNU) moiety (Fig. 2) is linked
to the carbon-2 of a hexose. The toxic action of
streptozotocin and chemically related alkylating compounds
requires their uptake into the cells. Nitrosoureas are usually
lipophilic and tissue uptake through the plasma membrane
is rapid; however, as a result of the hexose substitution,
streptozotocin is less lipophilic. Streptozotocin is selective-
ly accumulated in pancreatic beta cells via the low-affinity
GLUT2 glucose transporter in the plasma membrane [74,
75]. Thus, insulin-producing cells that do not express this
glucose transporter are resistant to streptozotocin [76–78].
This observation also explains the greater toxicity of
streptozotocin compared with N-methyl-N-nitrosourea in
cells that express GLUT2, even though both substances
alkylate DNA to a similar extent [77, 79, 80]. The
importance of the GLUT2 glucose transporter in this
process is also shown by the observation that streptozotocin
damages other organs expressing this transporter, particu-
larly kidney and liver [17, 19].
Beta cell toxicity of streptozotocin
It is generally assumed that the toxicity of streptozotocin is
dependent upon the DNA alkylating activity of its methylni-
Diabetologia (2008) 51:216–226
trosourea moiety [79–83], especially at the O6 position of
guanine [22]. The transfer of the methyl group from
streptozotocin to the DNA molecule causes damage, which
along a defined chain of events [84], results in the
fragmentation of the DNA [85]. Protein glycosylation may
be an additional damaging factor [41]. In the attempt to repair
DNA, poly(ADP-ribose) polymerase (PARP) is overstimu-
lated. This diminishes cellular NAD+, and subsequently ATP,
stores [82, 85–87]. The depletion of the cellular energy stores
ultimately results in beta cell necrosis. Although streptozotocin
also methylates proteins [80, 81], DNA methylation is
ultimately responsible for beta cell death, but it is likely that
protein methylation contributes to the functional defects of the
beta cells after exposure to streptozotocin.
Inhibitors of poly ADP-ribosylation suppress the process
of DNA methylation. Thus, injection of nicotinamide and
other PARP inhibitors in parallel with, or prior to the
administration of streptozotocin is well known to protect
beta cells against the toxic action of streptozotocin and to
prevent the development of a diabetic state [13]. Also, mice
deficient in PARP are resistant to beta cell death mediated
by streptozotocin, in spite of DNA fragmentation. The
absence of PARP prevents the depletion of the cofactor
NAD+ and the subsequent loss of ATP [84, 88–90] and thus
cell death.
The role of alkylation in beta cell damage has also been
examined by the use of ethylating agents, which are less
toxic than their methylating counterparts, on account of O6-
ethylguanine being less toxic than O6-methylguanine [91].
The fact that N-ethyl-N-nitrosourea and ethyl methane-
sulphonate are significantly less toxic to insulin-producing
Beta cell-toxic
glucose analogues Alloxan Streptozotocin
Beta cell-selective Selective beta cell uptake via the
action
GLUT2 glucose transporter
Mechanism of Beta cell toxicity Beta cell toxicity
beta cell death
through ROS through alkylation
Beta cell death
Mode of
beta cell death
through necrosis
Insulin-dependent
Beta cell death result
diabetes mellitus
Chemical diabetes Alloxan Streptozotocin
diabetes diabetes
Fig. 4 Schematic representation of the toxic effects of the glucose
analogues alloxan and streptozotocin in beta cells, which produce
chemical diabetes
Diabetologia (2008) 51:216–226
cells than MNU and methyl methanesulphonate [77, 91]
has been taken as support for the notion that in insulin-
producing cells, as in other cell types, the mechanism of
toxic action is due to alkylation, with methylation of DNA
bases being more toxic than ethylation [22, 81].
An alternative hypothesis proposes that part of the
diabetogenic effect of streptozotocin may relate not to its
alkylating ability but to its potential to act as an intracellular
nitric oxide (NO) donor [92]. Both streptozotocin and
MNU contain a nitroso group (Fig. 2) and can liberate NO.
In fact, streptozotocin has been shown to increase the
activity of guanylyl cyclase and the formation of cGMP,
which are characteristic effects of NO. However, the
alkylating agent methyl methanesulphonate is the most
toxic compound, though unlike MNU, it is not a NO donor
[91], indicating that NO is not an indispensable prerequisite
for the toxic action of the family of alkylating agents that
streptozotocin belongs to.
Finally, some minor generation of ROS, including
superoxide and hydroxyl radicals originating from hydro-
gen peroxide dismutation during hypoxanthine metabolism
[93], may accompany the effect of streptozotocin and
accelerate the process of beta cell destruction but ROS do
not play a crucial role [22].
Inhibition of insulin secretion by streptozotocin
The effects of streptozotocin on glucose and insulin homeo-
stasis reflect the toxin-induced abnormalities in beta cell
function. Initially, insulin biosynthesis, glucose-induced insu-
lin secretion and glucose metabolism (both glucose oxidation
and oxygen consumption) are all affected [93–95]. On the
other hand, streptozotocin has no immediate, direct inhibito-
ry effect upon glucose transport [77] or upon glucose
phosphorylation by glucokinase [39]. However, at later
stages of functional beta cell impairment, deficiencies in
terms of gene expression and protein production lead to the
deterioration of both glucose transport and metabolism [96].
Even before the negative effects of mitochondrial DNA
and protein alkylation and glycosylation become evident,
streptozotocin-induced depletion of NAD+ may result in the
inhibition of insulin biosynthesis and secretion [82, 85, 94].
Later, inhibition of glucose-induced and amino acid-
induced insulin secretion [97] as a result of mitochondrial
enzyme dysfunction [98] and damage to the mitochondrial
genome [99] become apparent. This impairment is more
marked for nutrient- than for non-nutrient-induced insulin
secretion. This interpretation has been confirmed through
studies which have shown that pre-treatment of isolated
pancreatic islets with the poly(ADP-ribose) polymerase
(PARP) inhibitor nicotinamide prevents early inhibition of
beta cell function during the first day after streptozotocin
223
exposure, while long-term inhibition of insulin secretion
6 days after streptozotocin exposure was not counteracted
by nicotinamide [100].
Conclusion
Both alloxan and streptozotocin induce insulin deficiency.
While the mechanisms of beta cell-selective action through
uptake via the GLUT2 glucose transporter and beta cell
death via necrosis are identical, ROS in the case of alloxan
and DNA alkylation in the case of streptozotocin mediate
the toxic action of these glucose analogues (Fig. 4). This
also explains why a lack of significant expression of this
glucose transporter isoform, such as in human beta cells,
provides insensitivity to the toxins [22, 101]. On the other
hand, expression of this glucose transporter in other organs
like in tubular cells and hepatocytes explains why the
toxins can cause damage to kidney and liver [22].
Due to its chemical properties, in particular the greater
stability (see text box: Comparison of the chemical
properties of alloxan and streptozotocin), streptozotocin is
the agent of choice for reproducible induction of a diabetic
metabolic state in experimental animals. Alloxan, on the
other hand, as a model compound of ROS mediated beta
cell toxicity, is the agent with the greater impact upon the
understanding of ROS mediated mechanisms of beta cell
death in type 1 and type 2 diabetes mellitus.
Acknowledgements The author is most grateful to Frits Holleman
for excellent editorial support.
Duality of interest The author states no duality of interest.
References
1. Wöhler F, Liebig J (1838) Untersuchungen über die Natur der
Harnsäure. [Investigations on the nature of uric acid]. Ann
Pharm 26:241–340 (article in German)
2. Lenzen S, Panten U (1988) Alloxan: history and mechanism of
action. Diabetologia 31:337–342
3. Lenzen S, Tiedge M, Jörns A, Munday R (1996) Alloxan
derivatives as a tool for the elucidation of the mechanism of the
diabetogenic action of alloxan. In: Shafrir E (ed) Lessons from
animal diabetes. Birkhäuser, Boston, pp 113–122
4. Dunn JS, McLetchie NGB (1943) Experimental alloxan diabetes
in the rat. Lancet 245:384–387
5. Dunn JS, Sheehan HL, McLetchie NGB (1943) Necrosis of islets
of Langerhans produced experimentally. Lancet 244:484–487
6. Jörns A, Munday R, Tiedge M, Lenzen S (1997) Comparative
toxicity of alloxan, N-alkylalloxans and ninhydrin to isolated
pancreatic islets in vitro. J Endocrinol 155:283–293
7. Peschke E, Ebelt H, Brömme HJ, Peschke D (2000) ‘Classical’
and ‘new’ diabetogens—comparison of their effects on isolated
rat pancreatic islets in vitro. Cell Mol Life Sci 57:158–164
224
8. Goldner MG, Gomori G (1943) Alloxan diabetes in the dog.
Endocrinology 33:297–308
9. McLetchie NGB (1982) Alloxan diabetes: the sorcerer and his
apprentice. Diabetologia 23:72–75
10. Bailey CC, Bailey OT, Leech RS (1946) Diabetes mellitus in rabbits
injected with dialuric acid. Proc Soc Exp Biol Med 63:502–505
11. Brückmann G, Wertheimer E (1947) Alloxan studies: the action
of alloxan homologues and related compounds. J Biol Chem
168:241–256
12. White FR (1963) Streptozotocin. Cancer Chemother Rep 30:49–53
13. Schein PS, Cooney DA, Vernon ML (1967) The use of
nicotinamide to modify the toxicity of streptozotocin diabetes
without loss of antitumor activity. Cancer Res 27:2324–2332
14. Schein PS, O’Connell MJ, Blom J et al (1974) Clinical antitumor
activity and toxicity of streptozotocin (NSC-85998). Cancer
34:993–1000
15. Rakieten N, Rakieten ML, Nadkarni MV (1963) Studies on the
diabetogenic action of streptozotocin (NSC-37917). Cancer
Chemother Rep 29:91–98
16. Arison RN, Ciaccio EI, Glitzer MS, Cassaro JA, Pruss MP
(1967) Light and electron microscopy of lesions in rats rendered
diabetic with streptozotocin. Diabetes 16:51–56
17. Rerup CC (1970) Drugs producing diabetes through damage of
the insulin secreting cells. Pharmacol Rev 22:485–518
18. Cooperstein SJ, Watkins D (1981) Action of toxic drugs on islet
cells. In: Cooperstein SJ, Watkins D (eds) The islet of
Langerhans. Academic, New York, pp 387–425
19. Weiss RB (1982) Streptozocin: a review of its pharmacology,
efficacy, and toxicity. Cancer Treat Rep 66:427–438
20. Preston AM (1985) Modification of streptozotocin-induced
diabetes by protective agents. Nutr Res 5:435–446
21. Szkudelski T (2001) The mechanism of alloxan and streptozotocin
action in B cells of the rat pancreas. Physiol Res 50:537–546
22. Lenzen S (2007) Alloxan and streptozotocin diabetes. In:
Peschke E (ed) Endokrinologie III Vorträge im Rahmen des
Projektes ‘Zeitstrukturen endokriner Systeme’. [Endocrinology
III lectures within the ‘time structures of endocrine systems’
project framework]. Abhandlung der Sächs. Akad. Wiss., Math-
naturwiss Klasse, Verlag der Sächsischen Akademie der Wissen-
schaften, Leipzig, commissioned by S. Hirzel Verlag, Stuttgart/
Leipzig, pp 119–138
23. Lenzen S, Munday R (1991) Thiol-group reactivity, hydro-
philicity and stability of alloxan, its reduction products and its N-
methyl derivatives and a comparison with ninhydrin. Biochem
Pharmacol 42:1385–1391
24. Weaver DC, Barry CD, McDaniel ML, Marshall GR, Lacy PE
(1979) Molecular requirements for recognition at glucoreceptor
for insulin release. Mol Pharmacol 16:361–368
25. Gorus FK, Malaisse WJ, Pipeleers DG (1982) Selective uptake
of alloxan by pancreatic B-cells. Biochem J 208:513–515
26. Weaver DC, McDaniel ML, Lacy PE (1978) Alloxan uptake by
isolated rat islets of Langerhans. Endocrinology 102:1847–1855
27. Elsner M, Tiedge M, Guldbakke B, Munday R, Lenzen S (2002)
Importance of the GLUT2 glucose transporter for pancreatic beta
cell toxicity of alloxan. Diabetologia 45:1542–1549
28. Hammarström L, Hellman B, Ullberg S (1967) On the accumulation
of alloxan in the pancreatic beta-cells. Diabetologia 3:340–344
29. Boquist L, Nelson L, Lorentzon R (1983) Uptake of labeled
alloxan in mouse organs and mitochondria in vivo and in vitro.
Endocrinology 113:943–948
30. Malaisse WJ, Doherty M, Ladriere L, Malaisse-Lagae F (2001)
Pancreatic uptake of [2-14C]alloxan. Int J Mol Med 7:311–315
31. Bloch KO, Zemel R, Bloch OV, Grief H, Vardi P (2000)
Streptozotocin and alloxan-based selection improves toxin
resistance of insulin-producing RINm cells. Int J Exp Diabetes
Res 1:211–219
Diabetologia (2008) 51:216–226
32. Patterson JW, Lazarow A, Levey S (1949) Alloxan and dialuric
acid: their stabilities and ultraviolet absorption spectra. J Biol
Chem 177:187–196
33. Gomori G, Goldner MG (1945) Acute nature of alloxan damage.
Proc Soc Exp Biol (NY) 58:232–233
34. Bailey CC, Collins-Williams J, Le Compte PM (1950) Effect of
alloxan in rabbits with temporary occlusion of the arteries to the
pancreas. Proc Soc Exp Biol 71:580–583
35. Hellman B, Diderholm H (1955) The diabetogenic effect of
alloxan after elimination of extra-pancreatic factors. Acta
Endocrinol (Copenh) 20:81–87
36. Munday R, Ludwig K, Lenzen S (1993) The relationship
between the physicochemical properties and the biological
effects of alloxan and several N-alkyl substituted alloxan
derivatives. J Endocrinol 139:153–163
37. Hara H, Miwa I, Okuda J (1986) Inhibition of rat liver glucokinase
by alloxan and ninhydrin. Chem Pharm Bull (Tokyo) 34:4731–4737
38. Meglasson MD, Burch PT, Berner DK, Najafi H, Matschinsky FM
(1986) Identification of glucokinase as an alloxan-sensitive
glucose sensor of the pancreatic beta-cell. Diabetes 35:1163–1173
39. Lenzen S, Tiedge M, Panten U (1987) Glucokinase in pancreatic
B-cells and its inhibition by alloxan. Acta Endocrinol (Copenh)
115:21–29
40. Tiedge M, Richter T, Lenzen S (2000) Importance of cysteine
residues for the stability and catalytic activity of human
pancreatic beta cell glucokinase. Arch Biochem Biophys
375:251–260
41. Konrad RJ, Kudlow JE (2002) The role of O-linked protein
glycosylation in beta-cell dysfunction. Int J Mol Med 10:535–539
42. Gunnarsson R, Hellerström C (1973) Acute effects of alloxan on
the metabolism and insulin secretion of the pancreatic B-cell.
Horm Metab Res 5:404–409
43. Weaver DC, McDaniel ML, Naber SP, Barry CD, Lacy PE
(1978) Alloxan stimulation and inhibition of insulin release from
isolated rat islets of Langerhans. Diabetes 27:1205–1214
44. Lenzen S, Panten U (1988) Signal recognition by pancreatic B-
cells. Biochem Pharmacol 37:371–378
45. Ishibashi F, Onari K, Sato T, Kawate R (1978) Studies on the
mechanism of alloxan inhibition of glucose-induced insulin
release. Hiroshima J Med Sci 27:211–219
46. Miwa I, Hara H, Okuda J (1986) Parallel inhibition of islet
glucokinase and glucose-stimulated insulin secretion by either
alloxan or ninhydrin. J Clin Biochem Nutr 1:237–245
47. Jain K, Logothetopoulos J (1976) Proinsulin biosynthesis by
pancreatic islets of the rat and the study of alloxan cytotoxicity in
vitro. Biochim Biophys Acta 435:145–151
48. Niki A, Niki H, Miwa I, Lin BJ (1976) Interaction of alloxan and
anomers of d-glucose on glucose-induced insulin secretion and
biosynthesis in vitro. Diabetes 25:574–579
49. Lenzen S, Brand FH, Panten U (1988) Structural requirements of
alloxan and ninhydrin for glucokinase inhibition and of glucose
for protection against inhibition. Br J Pharmacol 95:851–859
50. Borg LA (1981) Effects of alloxan on the islets of Langerhans:
inhibition of leucine metabolism and insulin secretion. Biochim
Biophys Acta 677:257–262
51. Lenzen S, Freytag S, Panten U (1988) Inhibition of glucokinase
by alloxan through interaction with SH groups in the sugar-
binding site of the enzyme. Mol Pharmacol 34:395–400
52. Lenzen S, Mirzaie-Petri M (1991) Inhibition of glucokinase and
hexokinase from pancreatic B-cells and liver by alloxan,
alloxantin, dialuric acid, and t-butylhydroperoxide. Biomed Res
12:297–307
53. Cohen G, Heikkila RE (1974) The generation of hydrogen
peroxide, superoxide radical, and hydroxyl radical by 6-
hydroxydopamine, dialuric acid, and related cytotoxic agents. J
Biol Chem 249:2447–2452
Diabetologia (2008) 51:216–226
54. Munday R (1988) Dialuric acid autoxidation. Effects of
transition metals on the reaction rate and on the generation of
‘active oxygen’ species. Biochem Pharmacol 37:409–413
55. Winterbourn CC, Cowden WB, Sutton HC (1989) Auto-
oxidation of dialuric acid, divicine and isouramil. Superoxide
dependent and independent mechanisms. Biochem Pharmacol
38:611–618
56. Winterbourn CC, Munday R (1989) Glutathione-mediated redox
cycling of alloxan. Mechanisms of superoxide dismutase
inhibition and of metal-catalyzed OH  formation. Biochem
Pharmacol 38:271–277
57. Oberley LW (1988) Free radicals and diabetes. Free Radic Biol
Med 5:113–124
58. Brömme HJ, Mörke W, Peschke D, Ebelt H (2000) Scavenging
effect of melatonin on hydroxyl radicals generated by alloxan. J
Pineal Res 29:201–208
59. Elsner M, Gurgul-Convey E, Lenzen S (2007) Relation between
triketone structure, generation of reactive oxygen species and
selective toxicity of the diabetogenic agent alloxan. Antioxid
Redox Signal (in press)
60. Elsner M, Gurgul-Convey E, Lenzen S (2006) Relative impor-
tance of cellular uptake and reactive oxygen species for the
toxicity of alloxan and dialuric acid to insulin-producing cells.
Free Radic Biol Med 41:825–834
61. Lenzen S, Mirzaie-Petri M (1992) Inhibition of aconitase by
alloxan and the differential modes of protection of glucose, 3-O-
methylglucose, and mannoheptulose. Naunyn Schmiedebergs
Arch Pharmacol 346:532–536
62. Sakurai K, Miura T (1989) Generation of free radicals by alloxan in
the presence of bovine serum albumin: a role of protein sulfhydryl
groups in alloxan cytotoxicity. Biochem Int 19:405–412
63. Brömme HJ, Mörke W, Weinandy R, Peschke D, Peschke E
(2002) Formation of compound 305 requires the simultaneous
generation of both alloxan and GSH radicals. Horm Metab Res
34:62–66
64. Lazarow A, Patterson JW, Levey S (1948) The mechanism of
cysteine and glutathione protection against alloxan diabetes.
Science 108:308–309
65. Sen PB, Bhattacharya G (1952) Reversal of the diabetogenic
action of alloxan by sulfhydryl compounds. Science 115:41–43
66. Grankvist K, Marklund S, Sehlin J, Taljedal IB (1979)
Superoxide dismutase, catalase and scavengers of hydroxyl
radical protect against the toxic action of alloxan on pancreatic
islet cells in vitro. Biochem J 182:17–25
67. Tiedge M, Lortz S, Drinkgern J, Lenzen S (1997) Relation
between antioxidant enzyme gene expression and antioxidative
defense status of insulin-producing cells. Diabetes 46:1733–1742
68. Tibaldi J, Benjamin J, Cabbat FS, Heikkila RE (1979) Protection
against alloxan-induced diabetes by various urea derivatives:
relationship between protective effects and reactivity with the
hydroxyl radical. J Pharmacol Exp Ther 211:415–418
69. Fischer LJ, Harman AW (1982) Oxygen free radicals and the
diabetogenic action of alloxan. In: Autor AP (ed) Pathology of
oxygen. Academic, New York, pp 261–275
70. Jörns A, Tiedge M, Lenzen S, Munday R (1999) Effect of
superoxide dismutase, catalase, chelating agents, and free radical
scavengers on the toxicity of alloxan to isolated pancreatic islets
in vitro. Free Radic Biol Med 26:1300–1304
71. Grankvist K, Marklund S, Täljedal IB (1979) Influence of trace
metals on alloxan cytotoxicity in pancreatic islets. FEBS Lett
105:15–18
72. Heikkila RE, Cabbat FS (1982) The prevention of alloxan-
induced diabetes in mice by the iron-chelator detapac: suggestion
of a role for iron in the cytotoxic process. Experientia 38:
378–379
225
73. Heikkila RE, Winston B, Cohen G (1976) Alloxan-induced
diabetes-evidence for hydroxyl radical as a cytotoxic intermedi-
ate. Biochem Pharmacol 25:1085–1092
74. Tjälve H, Wilander E, Johansson EB (1976) Distribution of
labelled streptozotocin in mice: uptake and retention in pancre-
atic islets. J Endocrinol 69:455–456
75. Karunanayake EH, Baker JR, Christian RA, Hearse DJ, Mellows G
(1976) Autoradiographic study of the distribution and cellular
uptake of (14C)-streptozotocin in the rat. Diabetologia 12:123–128
76. Ledoux SP, Wilson GL (1984) Effects of streptozotocin on a
clonal isolate of rat insulinoma cells. Biochim Biophys Acta
804:387–392
77. Elsner M, Guldbakke B, Tiedge M, Munday R, Lenzen S (2000)
Relative importance of transport and alkylation for pancreatic
beta-cell toxicity of streptozotocin. Diabetologia 43:1528–1533
78. Schnedl WJ, Ferber S, Johnson JH, Newgard CB (1994) STZ
transport and cytotoxicity. Specific enhancement in GLUT2-
expressing cells. Diabetes 43:1326–1333
79. Ledoux SP, Woodley SE, Patton NJ, Wilson GL (1986)
Mechanisms of nitrosourea-induced beta-cell damage. Altera-
tions in DNA. Diabetes 35:866–872
80. Wilson GL, Hartig PC, Patton NJ, LeDoux SP (1988) Mecha-
nisms of nitrosourea-induced beta-cell damage. Activation of
poly(ADP-ribose) synthetase and cellular distribution. Diabetes
37:213–216
81. Bennett RA, Pegg AE (1981) Alkylation of DNA in rat tissues
following administration of streptozotocin. Cancer Res 41:
2786–2790
82. Uchigata Y, Yamamoto H, Kawamura A, Okamoto H (1982)
Protection by superoxide dismutase, catalase, and poly(ADP-
ribose) synthetase inhibitors against alloxan- and streptozotocin-
induced islet DNA strand breaks and against the inhibition of
proinsulin synthesis. J Biol Chem 257:6084–6088
83. Murata M, Takahashi A, Saito I, Kawanishi S (1999) Site-
specific DNA methylation and apoptosis: induction by diabeto-
genic streptozotocin. Biochem Pharmacol 57:881–887
84. Pieper AA, Verma A, Zhang J, Snyder SH (1999) Poly (ADP-
ribose) polymerase, nitric oxide and cell death. Trends Pharmacol
Sci 20:171–181
85. Yamamoto H, Uchigata Y, Okamoto H (1981) Streptozotocin
and alloxan induce DNA strand breaks and poly(ADP-ribose)
synthetase in pancreatic islets. Nature 294:284–286
86. Schein PS, Loftus S (1968) Streptozotocin: depression of mouse
liver pyridine nucleotides. Cancer Res 28:1501–1506
87. Sandler S, Swenne I (1983) Streptozotocin, but not alloxan,
induces DNA repair synthesis in mouse pancreatic islets in vitro.
Diabetologia 25:444–447
88. Pieper AA, Brat DJ, Krug DK et al (1999) Poly(ADP-ribose)
polymerase-deficient mice are protected from streptozotocin-
induced diabetes. Proc Natl Acad Sci U S A 96:3059–3064
89. Burkart V, Wang ZQ, Radons J et al (1999) Mice lacking the
poly(ADP-ribose) polymerase gene are resistant to pancreatic
beta-cell destruction and diabetes development induced by
streptozocin. Nat Med 5:314–319
90. Masutani M, Suzuki H, Kamada N et al (1999) Poly(ADP-ribose)
polymerase gene disruption conferred mice resistant to streptozotocin-
induced diabetes. Proc Natl Acad Sci U S A 96:2301–2304
91. Delaney CA, Dunger A, Di Matteo M, Cunningham JM, Green MH,
Green IC (1995) Comparison of inhibition of glucose-stimulated
insulin secretion in rat islets of Langerhans by streptozotocin and
methyl and ethyl nitrosoureas and methanesulphonates. Lack of
correlation with nitric oxide-releasing or O6-alkylating ability.
Biochem Pharmacol 50:2015–2020
92. Turk J, Corbett JA, Ramanadham S, Bohrer A, McDaniel ML
(1993) Biochemical evidence for nitric oxide formation from
226
streptozotocin in isolated pancreatic islets. Biochem Biophys Res
Commun 197:1458–1464
93. Nukatsuka M, Yoshimura Y, Nishida M, Kawada J (1990)
Allopurinol protects pancreatic beta cells from the cytotoxic
effect of streptozotocin: in vitro study. J Pharmacobiodyn
13:259–262
94. Strandell E, Eizirik DL, Korsgren O, Sandler S (1988)
Functional characteristics of cultured mouse pancreatic islets
following exposure to different streptozotocin concentrations.
Mol Cell Endocrinol 59:83–91
95. Bedoya FJ, Solano F, Lucas M (1996) N-Monomethyl-arginine
and nicotinamide prevent streptozotocin-induced double strand
DNA break formation in pancreatic rat islets. Experientia
52:344–347
96. Wang Z, Gleichmann H (1998) GLUT2 in pancreatic islets:
crucial target molecule in diabetes induced with multiple low
doses of streptozotocin in mice. Diabetes 47:50–56
97. Eizirik DL, Sandler S, Sener A, Malaisse WJ (1988) Defective
catabolism of d-glucose and l-glutamine in mouse pancreatic
Diabetologia (2008) 51:216–226
islets maintained in culture after streptozotocin exposure.
Endocrinology 123:1001–1007
98. Rasschaert J, Eizirik DL, Malaisse WJ (1992) Long term in vitro
effects of streptozotocin, interleukin-1, and high glucose con-
centration on the activity of mitochondrial dehydrogenases and
the secretion of insulin in pancreatic islets. Endocrinology
130:3522–3528
99. Eizirik DL, Sandler S, Ahnström G, Welsh M (1991) Exposure
of pancreatic islets to different alkylating agents decreases
mitochondrial DNA content but only streptozotocin induces
long-lasting functional impairment of B-cells. Biochem Pharma-
col 42:2275–2282
100. Strandell E, Eizirik DL, Sandler S (1989) Survival and B-cell
function of mouse pancreatic islets maintained in culture after
concomitant exposure to streptozotocin and nicotinamide. Exp
Clin Endocrinol 93:219–224
101. Elsner M, Tiedge M, Lenzen S (2003) Mechanism underlying
resistance of human pancreatic beta cells against toxicity of
streptozotocin and alloxan. Diabetologia 46:1713–1714
 Comparative Medicine Vol 61, No 4
Copyright 2011 August 2011
by the American Association for Laboratory Animal Science Pages 356–360

The Streptozotocin-Induced Diabetic Nude

Mouse Model: Differences between Animals
from Different Sources

Melanie L Graham,* Jody L Janecek, Jessica A Kittredge, Bernhard J Hering, and Henk-Jan Schuurman

Diabetes is induced in mice by using streptozotocin (STZ), a compound that has a preferential toxicity toward pancreatic β cells.
We evaluated nude male mice from various sources for their sensitivity to a single high dose (160 to 240 mg/kg) of STZ. Diabetes
was induced in male mice (age: median, 12 wk; interquartile range, 11 to 14 wk; body weight, about 30 g) from Taconic Farms (TAC),
Jackson Laboratories (JAX), and Charles River Laboratories (CRL). Mice were monitored for 30 d for adverse side effects, blood
glucose, and insulin requirements. In CRL mice given 240 mg/kg STZ, more than 95% developed diabetes within 4 to 5 d, and loss
of body weight was relatively low (mean, 0.4 g). In comparison, both TAC and JAX mice were more sensitive to STZ, as evidenced
by faster development of diabetes (even at a lower STZ dose), greater need for insulin after STZ, greater body weight loss (mean:
TAC, 3.5 g; JAX, 3.7 g), and greater mortality. We recommend conducting exploratory safety assessments when selecting a nude
mouse source, with the aim of limiting morbidity and mortality to less than 10%.

Abbreviations: CRL, Charles River Laboratories; JAX, Jackson Laboratories; STZ, streptozotocin; TAC, Taconic Farms.

Rodent models commonly are used to study immunologic
mechanisms and metabolic function in diabetes.19 In our institu-
tion, the mouse diabetes model is used to test islet cell prepara-
tions for their activity in diabetes reversal. We use congenitally
athymic nude mice to avoid any interference of immune rejection
on the outcome of results.
Diabetes is induced by streptozotocin (STZ), a glucosamine–ni-
trosourea compound derived from Streptomyces achromogenes that
is used clinically as a chemotherapeutic agent in the treatment of
pancreatic β cell carcinoma. STZ damages pancreatic β cells, re-
sulting in hypoinsulinemia and hyperglycemia.10 STZ can induce
a diabetic state in 2 ways, depending on the dose. The selectiv-
ity for β cells is associated with preferential accumulation of the
chemical in β cells after entry through the GLUT2 glucose trans-
porter receptor: chemical structural similarity with glucose allows
STZ to bind to this receptor. The mode of action has best been
demonstrated in mouse studies. At high doses, typically given
singly, STZ targets β cells by its alkylating property correspond-
ing to that of cytotoxic nitrosourea compounds.4 At low doses,
generally given in multiple exposures, STZ elicits an immune and
inflammatory reaction, presumably related with the release of
glutamic acid decarboxylase autoantigens. Under this condition,
the destruction of β cells and induction of the hyperglycemic state
is associated with inflammatory infiltrates including lymphocytes
in the pancreatic islets.12 STZ has well-known adverse side effects,
which include hepatotoxicity and nephrotoxicity.4,13-15,17
Nude mice (Fox1nu/Fox1nu homozygotes) are available from a
variety of vendors.2,8,18 Although all nude mice ultimately have
Received: 08 Dec 2010. Revision requested: 09 Jan 2010. Accepted: 20 Feb 2011.
Schulze Diabetes Institute, Department of Surgery, University of Minnesota, Minneapolis,
Minnesota.
*
Corresponding author. Email: graha066@umn.edu
the same origin (a mutant in a colony at the NIH), each vendor
provides a unique subline. The development of sublines occurs
as each population of mice becomes generationally distant from
a common ancestor. Individual populations will develop identifi-
able genotype and phenotypic responses based on the accumula-
tion and maintenance of normal random genetic mutations.6,16
We used nude mice from 3 vendors (Charles River Laboratories
[CRL], Taconic Farms [TAC], and Jackson Laboratories [JAX]) in
establishing the mouse STZ-induced diabetes model. In using
mice from these vendors, we observed remarkable differences in
their mice’s sensitivity to STZ induction of diabetes and in mor-
bidity and mortality after STZ treatment. Differences in sensitivity
to STZ between mouse strains have been described anecdotally,
but we are unaware reports of differences among mice of essen-
tially the same strain provided by different vendors. Because
these differences include adverse events and mortality, the pres-
ent evaluation has relevance to animal loss and wellbeing and
adaptations to currently accepted generalized dose practices.
Materials and Methods
Animals. The nomenclature used to describe the strains below is
based on the recommendations of the International Committee on
Standardized Genetic Nomenclature for Mice.11 This standardized
nomenclature reflects both the genotype and the original source
of the strain from a distinct supplier. SPF male congenitally athy-
mic nude mice with a median age of 12 wk (interquartile range,
11 to 14 wk) and weighing approximately 30 g were obtained
from 3 commercial suppliers (CRL, TAC, and JAX); the following
background information was published on the vendors’ respec-
tive websites.2,8,18
CRL mice are Crl:NU-Foxn1nu mice from Charles River Labo-
ratories (Wilmington, MA). These animals originated from NIH

356

cm10000132.indd 356 8/1/2011 2:25:23 PM


and were originally thought to be BALB/c congenics. It was
later determined that they were not inbred; therefore they were
maintained as outbred and were not associated with any stock or
strain.2 TAC mice are CrTac:NCr-Foxn1nu animals from Taconic
Farms (Germantown, NY). These mice have both BALB/c inbred
and NIH(S) outbred stock in their genetic background. The out-
bred background originated from an accidental cross between the
BALB/c inbred nude and NIH(S) outbred nude mice. The com-
pany received the NCr nude spontaneous mutant model from the
National Cancer Institute in 1993 after several years of random
breeding.18 JAX mice are NU/J animals from Jackson Laboratories
(Bar Harbor, ME). The company imported the nude mutation
from the NIH on an outbred stock in 1975. As of 2008, the strain
has been inbred for at least 100 generations. The strain is on a
BALB/c background.8
The mice were kept under SPF conditions by using cages
equipped with filter tops and absorbent bedding (7092 Teklad
Corn Cob Bedding, Harlan Laboratories, Madison, WI) in a
temperature-controlled environment (22 to 25 °C) on a 12:12-h
light:dark photoperiod. Mice were housed in groups of 2 to 4 per
cage. Water was provided as libitum, and animals were fed irra-
diated rodent diet (Diet 2919 Teklad Global 19% Protein Rodent
Diet, Harlan Laboratories). This diet was selected preferentially
over standard chow because of its slightly higher energy den-
sity compared with that of conventional mouse diet (3.3 kcal/g
and 2.9 kcal/g, respectively). This higher energy level is advanta-
geous in support of the diabetic state. Studies using these mice
for assessment of islet cell preparations were approved by the
University of Minnesota Institutional Animal Care and Use Com-
mittee, conducted in compliance with the Animal Welfare Act,1
and adhered to principles stated in the Guide for Care and Use of
Laboratory Animals.7
Diabetes induction and animal monitoring. The mice were injected
intraperitoneally with a single high dose of 160 to 240 mg/kg
STZ. We used a pharmaceutical-grade formulation of STZ
(Zanosar Teva Pharmaceuticals, Irvine, CA) to avoid impurities
that may have harmful biologic activities. STZ is administered at
a higher dose level in nude mice than in immunocompetent mice
because the destruction of β cells in nude mice must result from
direct drug action with no assistance from the immune-mediated
response.10 We followed the dose-range recommendations of the
Clinical Islet Transplant (CIT) consortium regarding procedures
for the mouse bioassay in testing human islet cell preparations
to be used in clinical trials (150 to 240 mg/kg).3 Historically we
used a dose of 240 mg/kg to achieve consistently a diabetic state
with limited morbidity and mortality. However, when mice were
obtained from alternate suppliers, unacceptable toxicity was ob-
served, and dose corrections within the range recommended by
the consortium were attempted immediately. The dose adjust-
ments were made based on the severity of adverse events and in
a prospective and stepwise fashion: first reducing to 200 mg/kg,
then 180 mg/kg, and finally 160 mg/kg. The average dose
and range of each cohort is presented in Table 1. The mice sub-
sequently were hydrated with 1.0 mL normal physiologic saline
administered subcutaneously. Blood was obtained by lancet prick
in the tail. Body weight or blood glucose concentration (or both)
was monitored once before and daily after STZ injection until a
diabetic state was confirmed by the glucose dehydrogenase meth-
od (AlphaTRAK, Abbot Laboratories, Chicago, IL). Mice with
a glucose concentration exceeding 300 mg/dL were considered
cm10000132.indd 357
STZ-induced diabetes nude mouse model
diabetic. Insulin therapy (glargine; Lantus, Sanofi-Aventis US,
Bridgewater, NJ) was initiated at a dose of 0.5 U every other day
after 3 consecutive glucose measurements exceeding 300 mg/
dL. The dose and frequency of insulin administration (range, 0.1
to 1.2 U/kg daily) was increased or decreased in response to a
combination of measured glucose and body weight. For example,
when the blood glucose was greater than 600 mg/dL in combina-
tion with a weight loss greater than 3% with respect to the previ-
ous value, the insulin dose was increased. In cases of dehydration
or progressive weight loss, the frequency of dosing was increased.
Mice were inspected daily for signs of pain or distress, includ-
ing changes in respiration, appetite, urine output, excessive thirst,
dehydration, activity (for example, lethargy or hyperactivity),
weight loss exceeding 10% of the initial value, unkempt appear-
ance, abnormal posture, and twitching or trembling. The mea-
surement of body weight and observation of body condition (for
example, thin, normal, overweight) acted as a surrogate marker of
appetite. The measurement of skin turgor and observation of cage
bedding for urine output acted as a surrogate marker of thirst.
These complications were documented, and mice received rou-
tine medical management appropriate to presenting symptoms
(for example, warming pads for hypothermia, warm physiologic
saline for dehydration, dextrose or insulin for metabolic correc-
tion, analgesics for management of pain or distress). Mice that
manifested complications that did not respond quickly to medi-
cal treatment were euthanized promptly with an overdose of
carbon dioxide. The follow-up period was kept at 30 d after
STZ injection.
Mice with a successful course after diabetes induction subse-
quently were allocated to islet transplantation studies.
Statistics. The data for various demographic and biochemical
parameters are expressed as mean ± 1 SD and were compared
by using one-way ANOVA followed by a Bonferroni–Dunn test
for multiple comparisons. The nonparametric Wilcoxon–Mann–
Whitney test was used to compare median values. Proportions
were compared by using the Fisher exact test. Kaplan–Meier plots
were evaluated by using the log-rank test. All analyses were run by
using Prism and Instat software (GraphPad Software, San Diego,
CA). Values were considered statistically significant when P < 0.05.
Results
Nude mice from all 3 sources were similar in regard to age,
body weight, and glucose level before STZ injection (Table 1). Sta-
tistical analysis showed significance (P < 0.05) for the lower body
weight and lower glucose level in JAX mice when compared with
CRL mice, but the actual values were considered within the ex-
pected normal range according to supplier growth curves.
A single high dose (160 to 240 mg/kg) of STZ effectively in-
duced diabetes: 96.5% of mice were diabetic by day 5 after STZ
administration (Figure 1 A).
The time to reach the diabetic state and the average glucose
level after STZ differed significantly between the 3 groups of mice
(Table 1, Figure 1 A). In all cases, JAX mice developed diabetes
within 1 d after treatment, whereas achieving this state took (on
average) 1.6 d in TAC mice and 2.3 d in CRL mice. The average
glucose level after STZ was highest in JAX mice (554 mg/dL)
and lowest in CRL mice (502 mg/dL). The dose of insulin was
on average highest in the TAC group (0.70 ± 0.33 U daily) and
lowest in the CRL group (0.32 ± 0.12 U daily), P < 0.001. The level
of hyperglycemia was not related to the insulin dose (Figure 2),
357
8/1/2011 2:25:23 PM
 Vol 61, No 4
Comparative Medicine
August 2011

Table 1. Demographic variables and the effect of STZ on metabolic function in nude mice from 3 sources
CRL (n = 60) TAC (n = 23) JAX (n = 58)
Age at induction (d) 89 ± 17 90 ± 12 85 ± 12
Body weight before STZ(g) 31.3 ± 2.3 30.2 ± 1.4 29.6 ± 0.8c
Average body weight after STZ (g)a 30.3 ± 2.2 27.1 ± 1.8c 26.3 ± 1.3c
Body weight loss (g) a
0.37 ± 2.3 3.5 ± 3.4 c
3.7 ± 2.3c
STZ dose (mg/kg) 240 ± 0 223 ± 26 181 ± 5c,d
STZ dose range (mg/kg) 240 160–240 180–200
Days to blood glucose > 300 (mg/dL) 2.3 ± 0.8 1.6 ± 0.7b 1.0 ± 0.1c,d
Average insulin requirement (U/d)a 0.32 ± 0.12 0.70 ± 0.33c 0.49 ± 0.07c
Random blood glucose before STZ (mg/dL) 157 ± 25 144 ± 29 134 ± 21c
Average random blood glucose after STZ (mg/dL) a
502 ± 63 503 ± 73 554 ± 44b,d
Data are presented as arithmetic mean ± 1 SD.
a
Averages calculated in animals developing diabetes and surviving at least 7 d after injection (CRL, n = 55; TAC, n = 11; JAX, n = 56).
b
P < 0.01 compared with CRL
c
P < 0.001 compared with CRL
d
P < 0.001 compared with TAC

Figure 1. (A) Diabetes induction and (B) survival after diabetes induction in male nude mice from Charles River Laboratories (CRL), Jackson Labora-
tories (JAX), and Taconic Farms (TAC). (A) The development of diabetes (glucose greater than or equal to 300 mg/dL) is presented as Kaplan–Meier
estimates plotted over time after STZ infusion. 100% of JAX and TAC mice rapidly developed diabetes by day 2 after STZ injection, whereas CRL mice
needed 5 d to achieve a diabetic state in 92% of mice (P < 0.001). (B) Death or euthanasia is presented as Kaplan–Meier estimates plotted over time after
STZ infusion. CRL mice demonstrated significantly better survival (P < 0.001), compared with JAX and TAC mice.

Adverse effects of STZ injection included weight loss, respira-
tory distress, rapid glycemic shifts resulting in life-threatening
hypoglycemia, and a generalized poor body condition (Table 2)
that manifested with higher frequency in JAX and TAC mice
(P < 0.001). The STZ dose was decreased in the cohorts with these
complications (JAX, TAC). In JAX and TAC mice, the dose re-
ductions significantly (P < 0.0001) increased the number of days
that mice survived after STZ administration. Median survival
was 23 d (interquartile range, 15 to 30 d) in mice given less than
200 mg/kg STZ, whereas it was 7 d (interquartile range, 2 to 14 d)
in mice receiving 200 mg/kg or more. However, the time to
development of diabetes, average insulin requirement after STZ,
random glucose level after STZ, and overall complication rates
were not affected by dose reduction. This effect might be related
to the rather high dose range that was used relative to published
recommendations,3 so that within this dose range, only a relation-
ship with severe toxicity at doses exceeding 200 mg/kg became
evident. Overall, CRL mice received the highest dose (240 mg/kg)
and experienced the lowest rate of complications. Even at
lower average doses (223 mg/kg in TAC mice and 181 mg/kg in
JAX mice), TAC and JAX mice experienced significantly (P < 0.05)
more weight loss despite receiving more insulin (Table 1, Figure
2). Using a 10% weight loss as a threshold value for animal health
status, the incidence of weight loss exceeding this threshold was
lowest in CRL mice (5%), higher in TAC mice (35%), and highest
in JAX mice (55%).
The proportions of mice that survived with no complications
were 17% for TAC mice, 13% for JAX mice, and 92% for CRL mice
(Table 2). Survival is illustrated in Figure 1 B: 50% survival
after STZ treatment was 7 d for TAC mice, 25 d for JAX mice, and
greater than 30 d for CRL mice. The occurrence of complications,
either separately or in combination, was highest in JAX mice

358

cm10000132.indd 358 8/1/2011 2:25:23 PM

 STZ-induced diabetes nude mouse model

Figure 2. Blood glucose values (top row) and body weight (bottom row) in response to insulin (glargine) treatment (U/kg daily) after diabetes induc-
tion by using STZ in male nude mice from Charles River Laboratories (CRL), Jackson Laboratories (JAX), and Taconic Farms (TAC). Data are presented
as mean ± 1 SD. Dashed lines indicate average blood glucose value after STZ (top row) and average baseline weight (bottom row).

Table 2. Complications (%) in animals from various sources during a to the dose range criteria for centers participating in Clinical Islet
30-d follow-up after diabetes induction Transplant (CIT) consortium studies (namely, 150 to 240 mg/kg),
CRL TAC JAX we used the 240-mg/kg dose initially and adapted the dose level
(n = 60) (n = 23) (n = 58) to 160, 180, 200, or 240 mg/kg on the basis of the severity of ad-
verse events.3 Because the approach to dose reduction was es-
Overall complicationa rate 8 83b 71b
sentially a pragmatic one in response to observed adverse events
(see Materials and Methods), the present study was not powered
By category to assess the specific influence of specific dosages on achievement
  Respiratory distress 0 35b,c 2 of diabetic state. However, the doses used in each of the cohorts
  Life-threatening hypoglycemia 2 26d 64b,e were sufficient to induce a diabetic state (Figure 1 A). In using
  Generalized poor body 8 44b 45b the model, we were confronted with variable but sometimes se-
   condition vere and frequent adverse side effects in our mice, resulting in a
  At least 10% loss in average 5 35d 55b small window between effective diabetes induction and compli-
cations of STZ treatment. This difficulty was apparent even when
   body weight after STZ
we used pharmaceutical-grade STZ (Streptozocin, Zanosar), for
a
Complications were defined as an adverse effect from STZ treatment which chemical impurities and lot variability are limited. The
resulting in death or euthanasia.
b
P < 0.001 compared with CRL
present comparative evaluation of 3 sources of nude mice shows
c
P < 0.001 compared with JAX remarkable variation within this STZ dose range for effectiveness
d
P < 0.01 compared with CRL and complication rate.
e
P < 0.05 compared with TAC TAC mice, and to a lesser extent JAX mice, showed a rather
small STZ dose window in contrast to that of CRL mice. This
difference was already evident in the variable sensitivity to STZ
and lowest in CRL mice. Severe complications that either caused during diabetes induction, which occurred more rapidly and re-
death or required euthanasia occurred in 83% of TAC mice, 71% quired a lower dose in TAC and particularly JAX mice, which
of JAX mice, and 8% of CRL mice. subsequently had the highest blood glucose level after STZ
(Table 1). In addition, the requirement for insulin was highest in
Discussion TAC and JAX mice. This greater sensitivity to STZ was further
At our institution, we use STZ-induced diabetes in congeni- apparent in the complication rates. After STZ, both TAC and JAX
tally athymic nude mice to evaluate the in vivo potency of islet mice showed substantial weight loss, which was often accompa-
cell preparations. Diabetes induction is accomplished by using nied by death or the need for euthanasia.
a single high STZ dose, to achieve optimal toxicity to pancreatic In contrast to the results in TAC and JAX animals, diabetes in-
β cells without the possibility of remaining endogenous insulin- duction by using STZ was easily achieved in CRL mice without
synthesizing capacity that would confound the results. Adhering emergence of complications. The lower sensitivity to STZ in CRL

359

cm10000132.indd 359 8/1/2011 2:25:23 PM

 Vol 61, No 4
Comparative Medicine
August 2011
mice was reflected by a longer average period to achieve a diabet-
ic state and a lower rate of complications. The loss of mice due to
complications was 8%, and only 5% of mice passed the threshold
of 10% loss in body weight. This threshold is considered relevant,
because it might affect the outcome of studies conducted with
the mice.
The reason for this difference between mice from the 3 sources
remains to be established. Genotypic analysis such as nucleotide
polymorphism assays would be required to determine the degree
of genetic variation between the CRL mice and those provided by
JAX and TAC. The accumulation of genetic variation in discrete
populations could underlie small but possibly significant changes
in phenotypic responses between these sublines, because both
the origin (NIH) and background strain (BALB/c) were the same
among the 3 sources.5,6,9,16
Hepatotoxicity and nephrotoxicity are both well-documented
effects of STZ.4,13-15 In addition to causing acidosis that can result
from renal tubular damage in the kidney, STZ is one of the ni-
trosourea drugs or toxins known to cause type B lactic acidosis.17
Analysis of blood gases and chemistries is used to confirm and
characterize acidosis, but blood volume requirements might un-
necessarily compromise mice in an already weakened state. In
the current study, adverse events commonly presented as respira-
tory distress, weight loss, and a generalized poor body condition
(Table 2)—all conditions that are consistent with acidosis. This
observation demonstrates the need in future studies to establish
species appropriate test methods for monitoring acidosis sever-
ity and response to treatment strategies. In addition to manifest-
ing these phenomena, JAX and TAC mice required significantly
more insulin, as might be expected with acidosis-induced glucose
intolerance and insulin resistance. We also noted severe hypo-
glycemia, which together with lactic acidosis suggests that the
liver was injured to the extent that errors of metabolism involving
exaggerated glycolysis resulted.
In conclusion, this comparative evaluation of 3 sources of con-
genitally athymic nude mice showed that CRL animals demon-
strate a window between effective diabetes induction by STZ
and complication rate that most easily supports generation of the
diabetic nude mouse model. This window appears small for TAC
and JAX nude mice. Investigations performed in the nude mouse
bioassay constitute a necessary component of the quality assess-
ment in administration of manufactured islet cell products to pa-
tients. We recommend performing exploratory safety assessments
when selecting a nude mice source if the mice are to be used in
the STZ-induced diabetes model. In this assessment, the type and
frequency of adverse events should be characterized, with the
aim of limiting morbidity and mortality to less than 10% in com-
bination with successful induction of a diabetic state in at least
90% of animals. In a well-characterized model, the adverse events
associated with the model are defined and subsequently unlike-
ly to be inadvertently attributed to the investigational product.
This characterization in combination with selection of an optimal
source enhances animal wellbeing and reduces experimental data
variability, presenting an opportunity for refinement.
Acknowledgments
We acknowledge with gratitude the excellent care of the animals by
Elisabeth Steger, Theresa DuFour, James Munson, and Angela Craig. In
particular, we thank Sandra Wagner and the Mouse Genetics Laboratory
360
cm10000132.indd 360
(Masonic Cancer Center, University of Minnesota) who provided
valuable input and insight into supplier differences. Our study was
supported by the Schulze Family Foundation, the National Institutes of
Health, and the Juvenile Diabetes Research Foundation.
References
1. Animal Welfare Act as Amended. 2007.7 USC §2131-2159.
2. Charles River Laboratories. [Internet]. 2011. Immunodeficient
animal models. [Cited 16 February 2011]. Available at: http://
www.criver.com/sitecollectiondocuments/rm_rm_d_immunode-
ficient_models.pdf
3. DAIT, NIAID, NIH. [Internet]. 2008. Purified human pancreatic
islets, in vivo islets function. Document no. 3104, A04, effective date
07 July 2008. [Cited 16 February 2011]. Available at: http://www.
isletstudy.org/CITDocs/3104,%20A04%20In%20Vivo%20Islets%20
Function.pdf
4. Dufrane D, van Steenberghe M, Guiot Y, Goebbels RM, Saliez A,
Gianello P. 2006. Streptozotocin-induced diabetes in large animals
(pigs, primates): role of GLUT2 transporter and β-cell plasticity.
Transplantation 81:36–45.
5. Gonzalez C, Cuvellier S, Hue-Beauvais C, Lévi-Strauss M. 2003.
Genetic control of nonobese diabetic mice susceptibility to high-dose
streptozotocin-induced diabetes. Diabetologia 46:1291–1295.
6. Hughes ED, Qu YY, Genik SJ, Lyons RH, Pacheco CD, Lieberman
AP, Samuelson LC, Nasonkin IO, Camper SA, Van Keuren ML,
Saunders TL. 2007. Genetic variation in C57BL/6 ES cell lines and
genetic instability in the Bruce4 C57BL/6 ES cell line. Mamm Genome
18:549–558.
7. Institute for Laboratory Animal Research. 1996. Guide for the care
and use of laboratory animals. Washington (DC): National Acad-
emies Press.
8. The Jackson Laboratory. [Internet]. 2011. JAX mice database.
[Cited 16 February 2011]. Available at: http://jaxmice.jax.org/
strain/002019.html
9. Leiter EH. 1982. Multiple low-dose streptozotocin-induced hyperg-
lycemia and insulitis in C57BL mice: Influence of inbred background,
sex, and thymus. Proc Natl Acad Sci USA 79:630–634.
10. Lenzen S. 2008. The mechanisms of alloxan- and streptozotocin-
induced diabetes. Diabetologia 51:216–226.
11. Mouse Genome Informatics. [Internet]. 2010. Guidelines for
nomenclature of mouse and rat strains. [Cited 16 February 2011].
Available at: http://www.informatics.jax.org/mgihome/nomen/
strains.shtml
12. Paik SG, Fleischer N, Shin SI. 1980. Insulin-dependent diabetes
mellitus induced by subdiabetogenic doses of streptozotocin: obliga-
tory role of cell-mediated autoimmune processes. Proc Natl Acad
Sci USA 77:6129–6133.
13. Palm F, Ortsäter H, Hansell P, Liss P, Carlsson PO. 2004. Differ-
entiating between effects of streptozotocin per se and subsequent
hyperglycemia on renal function and metabolism in the streptozo-
tocin-diabetic rat model. Diabetes Metab Res Rev 20:452–459.
14. Schacht RG, Feiner HD, Gallo GR, Lieberman A, Baldwin DS.
1981. Nephrotoxicity of nitrosoureas. Cancer 48:1328–1334.
15. Schein PS, Loftus S. 1968. Streptozotocin: depression of mouse liver
pyridine nucleotides. Cancer Res 28:1501–1506.
16. Simpson EM, Linder C, Sargent E, Davisson M, Mobraaten L, Sharp
J. 1997. Genetic variation among 129 substrains and its importance
for targeted mutagenesis in mice. Nat Genet 16:19–27.
17. Szerlip HM. 2009. Metabolic acidosis, p 78. In: Greenberg A, Ch-
eung AK, editors. Primer on kidney diseases. Philadelphia (PA):
Saunders.
18. Taconic Farms. [Internet]. 2011. Animal models. [Cited 16 Feb-
ruary 2011]. Available at: http://www.taconic.com/wmspage.
cfm?parm1=873
19. Van Belle TL, Taylor P, von Herrath MG. 2009. Mouse models for
type 1 diabetes. Drug Discov Today Dis Models 6:41–45.
8/1/2011 2:25:23 PM
Original Article
Recovery of Islet ␤-Cell Function in Streptozotocin-
Induced Diabetic Mice
An Indirect Role for the Spleen
Dengping Yin,1 Jing Tao,1 David D. Lee,1 Jikun Shen,1 Manami Hara,2 James Lopez,2
Andrey Kuznetsov,2 Louis H. Philipson,2 and Anita S. Chong1
Limitations in islet ␤-cell transplantation as a therapeutic
option for type 1 diabetes have prompted renewed interest
in islet regeneration as a source of new islets. In this study
we tested whether severely diabetic adult C57BL/6 mice
can regenerate ␤-cells. Diabetes was induced in C57BL/6
mice with high-dose streptozotocin (160ⴚ170 mg/kg). In
the absence of islet transplantation, all diabetic mice
remained diabetic (blood glucose >400 mg/dl), and no
spontaneous reversal of diabetes was observed. When syn-
geneic islets (200/mouse) were transplanted into these
diabetic mice under a single kidney capsule, stable resto-
ration of euglycemia for >120 days was achieved. Removal
of the kidney bearing the transplanted islets at 120 days
posttransplantation revealed significant restoration of en-
dogenous ␤-cell function. This restoration of islet function
was associated with increased ␤-cell mass, as well as ␤-cell
hypertrophy and proliferation. The restoration of islet cell
function was facilitated by the presence of a spleen; how-
ever, the facilitation was not due to the direct differentia-
tion of spleen-derived cells into ␤-cells. This study
supports the possibility of restoring ␤-cell function in
diabetic individuals and points to a role for the spleen in
facilitating this process. Diabetes 55:3256 –3263, 2006
A
utoimmune-mediated destruction of ␤-cells is
the predominant cause of type 1 diabetes. Cur-
rent curative therapy for type 1 diabetes is
based on replacement of ␤-cells through pan-
creas or islet transplantation with concomitant immune
suppression. The limited supply of allogeneic pancreata
and complications arising from the need for continued
immunosuppression have prompted renewed investiga-
tions into the natural ability of ␤-cells to regenerate and
restore glucose homeostasis. This line of investigation is
From the 1Section of Transplantation, Department of Surgery, The University
of Chicago, Chicago, Illinois; and 2Section of Endocrinology, Department of
Medicine, The University of Chicago, Chicago, Illinois.
Address correspondence and reprint requests to Anita S. Chong, PhD,
Section of Transplantation, Department of Surgery, The University of Chicago,
Chicago, IL 60637. Tel: 773–702 5521; FAX: 773-702-5517; E-mail: achong@
uchicago.edu.
Received for publication 29 September 2005 and accepted in revised form
13 September 2006.
[Ca2⫹]i, intracellular calcium contration; FISH, fluorescence in situ hybrid-
ization; FITC, fluoroscein isothiocyanate; IPGTT, intraperitoneal glucose
tolerance test; STZ, streptozotocin
DOI: 10.2337/db05-1275
© 2006 by the American Diabetes Association.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked “advertisement” in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
3256
prompted, in part, by observations that 11– 40% of patients
with longstanding type 1 diabetes have detectable C-
peptide levels and residual ␤-cells (1). However, it is
unclear whether such patients have the ability to regener-
ate ␤-cells to levels that can restore normal glycemia.
It is recognized that ␤-cell mass must be actively regu-
lated throughout life (2–5). The essential cellular and
molecular bases for the regulation of ␤-cell mass in adults
are incompletely understood, but they are currently
thought to include three major processes: replication of
differentiated ␤-cells, differentiation and neogenesis of
␤-cells from precursor cells, and the inhibition of ␤-cell
apoptosis (6,7). Earlier studies in rodents favored the
concept that adult ␤-cell regeneration recapitulated devel-
opment, with a prominent role for stem cells of pancreatic
or extrapancreatic origin as the main mechanism for
increasing ␤-cell mass following injury and loss of ␤-cells
(8 –11). Indeed, cells thought to be capable of developing
into insulin-secreting ␤-cells have been located in the
pancreatic duct or elsewhere in the pancreas (12–15), liver
(16 –18), intestine (19; 20), bone marrow (20 –22), or spleen
(23). More recently, studies by Dor et al. (24) challenged
the concept of differentiation/neogenesis and have sug-
gested that proliferation of existing adult ␤-cells is the
predominant basis for adult islet regeneration.
An important issue arising from the observations of Dor
et al. (24) is whether diabetic patients with significant loss
of ␤-cells have the ability to restore sufficient ␤-cell mass
to maintain euglycemia. We have developed a mouse
model to test whether severely diabetic adult mice can
regenerate ␤-cells. In this model, diabetes (blood glucose
⬎400 mg/dl) was induced in adult C57BL/6 mice within 1
week after treatment with high-dose streptozotocin (STZ;
160 –170 mg/kg). In the absence of islet transplantation, all
untreated diabetic mice remained diabetic (blood glucose
⬎400 mg/dl) and no spontaneous reversal of diabetes was
observed. Syngeneic islets (200/mouse) transplanted un-
der a single kidney capsule resulted in the stable restora-
tion of euglycemia for ⱖ120 days. Removal of the kidney
bearing the transplanted islets at 120 days posttransplan-
tation allowed for subsequent interrogation of endogenous
␤-cell function. We observed significant restoration of
␤-cell mass and function in this model. Using splenectomy
and spleen cell transfer approaches, we also observed an
important but indirect role for spleen cells in the restora-
tion of endogenous ␤-cell function.
DIABETES, VOL. 55, DECEMBER 2006

RESEARCH DESIGN AND METHODS
C57BL/6 mice were used as donors and recipients of kidney subcapsular islet
transplantation. The mice were purchased from NCI (Frederick, MD) or
Jackson Laboratory (Bar Harbor, ME). GFP transgenic B/6 mice (backcrossed
10 generations) were used as donors of spleen cells (25). All mice were housed
in pathogen-free conditions at The University of Chicago, following National
Institutes of Health guidelines.
Recipients were made diabetic by a single intraperitoneal injection of STZ
(160 –170 mg/kg, Sigma Chemical, St. Louis, MO). Diabetic mice with non-
fasted blood glucose values ⬎400 mg/dl, measured by a blood glucose monitor
(SureStep; Lifescan, Milpitas, CA), for more than 2 consecutive days were
used as recipients of islet grafts.
Islet isolation and transplantation. Islet isolation used methods previously
reported (26) and involved intraductal collagenase digestion (Collagenase P,
0.3 mg/ml; Roche, Indianapolis, IN) and purification by Ficoll gradient
centrifugation (Sigma, St. Louis, MO). Purified islets were transplanted under
the kidney capsule immediately after purification. In some recipients, BrdU
(Sigma) was administered at a dose of 100 mg/kg i.p., five times a week for 2
weeks.
Splenectomy and nephrectomy. Splenectomy was performed on the day of
islet transplantation. The abdominal cavity was opened with a mid-abdominal
incision, the splenic artery and vein were ligated, and the spleen resected.
At 120 days postislet transplantation, nephrectomy of the islet-containing
kidney was performed. The left renal artery and vein and the ureter were
ligated, and the kidney was resected.
Preparation of spleen cells. Spleen cells were isolated following procedures
established by Kodama et al. (23). Briefly, donor mice were sacrificed by cervical
dislocation and the spleen immediately removed and pressed through a Nylon
cell strainer (BD Falcon) using a 1-ml syringe bottom (Becton Dickinson). The
cells were washed and resuspended in a volume of 300 ␮l PBS (GIBCO). Mice
received the equivalent of half a spleen per injection into the tail vein (⬃4 – 6 ⫻
107cells/spleen) twice a week for 6 weeks posttransplantation.
Intraperitoneal glucose tolerance test. An intraperitoneal glucose toler-
ance test (IPGTT) was performed after the mice were fasted for 4 h. The blood
was sampled from the tail vein before and 30, 60, 90, and 120 min after an
intraperitoneal injection of 2g/kg body wt dextrose. Blood glucose levels were
measured using a blood glucose meter (SureStep).
Pathologic examination. The pancreas was harvested, embedded in Tissue-
Tek OCT (Sakura Finetek, Torrance, CA), and snap-frozen in liquid nitrogen.
Islets were stained with anti-insulin polyclonal antibody (Zymed, South San
Francisco, CA) and rabbit anti-glucagon polyclonal antibody (Dako, Carpin-
teria, CA). A standard avidin-biotin-peroxidase complex method was used to
visualize the immunostaining.
To detect BrdU incorporation, cryosections were fixed in acetone and
endogenous peroxidase was quenched with 0.3% H2O2. After antigen retrieval
with 2⫻ sodium chloride–sodium citrate, the sections were blocked with
2.4G2 monoclonal antibody and 5% goat serum and then serially incubated
with mouse anti-BrdU (Sigma), biotinylated rat anti-mouse IgG1 (BD Pharmi-
gen, San Diego, CA), and horseradish peroxidase–streptavidin (Zymed, South
San Francisco, CA). The immunostaining was visualized by 3,3-diaminoben-
zidine (DAB) and counterstained with Mayer’s hematoxylin.
Fluorescence in situ hybridization (FISH) was used to detect male cells in
the pancreas. Briefly, after tissue fixation with methanol/acetic acid (3:1) and
denaturation with formamide, cryosections were serially incubated with
fluoroscein isothiocyanate (FITC)-conjugated mouse Y chromosome probe
(CONC mouse chromosome Y paint kit; Cambio, Cambridge, U.K.), rabbit
anti-FITC antibody, and FITC-labeled goat anti-rabbit IgG. Finally, cell nuclei
were counterstained with 4⬘,6-diamidino-2-phenylindole (DAPI-1).
Quantification of ␤-cell mass. Quantification of ␤-cell mass was performed
on normal mice, STZ-treated mice that were diabetic for 7 days, and in mice
that remained normoglycemic for ⱖ60 days following the removal of islet
grafts (restored group). Whole pancreata were removed from each mouse and
weighed, and serially step-sectioned. Every 10th section was stained with
anti-insulin polyclonal antibody (⬃10 sections per mouse) and images of each
section were captured on a Zeiss Axiovert 200M microscope. The ␤-cell and
total pancreas area were quantified with Image J (National Institutes of
Health, Bethesda, MD; http://rsb.info.nih.gov/ij/), and the relative ratio of
␤-cell area compared with entire pancreas area determined. Finally the ␤-cell
mass was calculated by multiplying the relative ratio by the total weight of the
pancreas.
Measurement of intracellular calcium concentration. Dual-wavelength
excitation spectrophotometry was used to measure intracellular calcium
concentration ([Ca2⫹]i) as described previously (46). Briefly, isolated pancre-
atic islets were loaded with Fura-2 by a 25-min incubation at 37°C in
Krebs-Ringer buffer containing 2 mmol/l glucose and 5 ␮mol/l Fura 2-AM
(Molecular Probes, Eugene, OR). Fluorescence imaging was performed using
DIABETES, VOL. 55, DECEMBER 2006
D. YIN AND ASSOCIATES
FIG. 1. Experimental model for islet ␤-cell regeneration. bg, blood
glucose; Txp, transplanted.
a charged-coupled device (CCD) camera-based imaging system (Cascade
camera from Photometrics, Tucson, AZ) and MetaFluor software (Universal
Imaging, Downingtown, PA). During imaging experiments, islets were kept at
37°C and perifused with Krebs-Ringer buffer– based solutions containing
glucose or other agonists as indicated, at a flow rate of 2.5 ml/min. [Ca2⫹]i was
expressed as the ratio of fluorescence intensity at excitation wavelengths 340
and 380 nm (F340/F380).
Statistics. All reported values are presented as means ⫾ SEM and evaluated
for statistical significance by ANOVA (SuperANOVA v. 1.11; Abacus Concepts,
Berkeley, CA). A P value of ⬍0.05 was considered to be statistically significant.
RESULTS
Restoration of ␤-cell function in STZ-induced dia-
betic mice. We have developed a mouse model of resto-
ration of ␤-cell function that combines the high-dose STZ
diabetes model with syngeneic islet transplantation under
a single kidney capsule (Fig. 1). A single injection of STZ
(160 –170 mg/kg body wt) induced diabetes in 70 – 80% of
C57BL/6 mice, with ⱕ5% of mice succumbing to STZ
toxicity (defined as early death before the development of
diabetes). Approximately 70% of the STZ-injected mice
had to be killed or died of diabetes by day 20 post–STZ
treatment, and 100% mortality was observed by day 45
(Fig. 2A). Blood glucose levels of ⬎400 mg/dl were ob-
served within 1 week of STZ treatment (Fig. 2B and C),
and no mice recovered spontaneously from STZ-induced
diabetes.
In one group of diabetic STZ-treated mice (blood glu-
cose levels ⬎400 mg/dl for ⱖ2 consecutive days), synge-
neic islets were transplanted under one kidney capsule.
Normal glycemia (99 ⫾ 2 mg/dl, n ⫽ 13) was restored by
1–2 days after transplantation and was maintained for the
entire 120 days of observation. When the kidney bearing
the transplanted islets was removed after 120 days, the
mice were followed for another 45–100 days. The mean
blood glucose postnephrectomy was 206 ⫾ 7 mg/dl (Fig.
2B); this was significantly higher than for normal mice but
significantly improved compared with before islet trans-
plantation (P ⬍ 0.001). The modest hyperglycemia follow-
ing the removal of transplanted islets was stable (Fig. 2C),
and no mice died of diabetes up to 45–100 days postne-
phrectomy (Fig. 2A), consistent with stable endogenous
␤-cell function. We experienced a ⬍5% loss in mice as a
result of the nephrectomy (i.e., death within 7 days of
surgery with no evidence of diabetes); these mice were
excluded from the survival data.
Our findings suggest that the regulation of blood glucose
by the islet grafts facilitated the gradual, but incomplete,
restoration of functional ␤-cells in the pancreas of adult
C57BL/6 mice treated with a single high dose of STZ.
3257
 SPLEEN FACILITATES RESTORATION OF ␤-CELL FUNCTION
FIG. 2. Restoration of ␤-cell function in STZ diabetic mice. The survival
(A) and mean blood glucose (BG) levels (B and C) of STZ-induced
diabetic (Diabetic; E) or restored (Restd; f) mice. Mean BG levels (ⴞ
SEM) were calculated from weekly or biweekly determinations (>60
days) after the removal of the transplanted islets (B and C). IPGTT of
normal (circles; n ⴝ 12) and restored mice (f; n ⴝ 10) are presented
(D). * and ** indicate statistical differences (ANOVA) between the
restored and the normal or diabetic groups, respectively.
Further tests of these mice at 45 days postnephrectomy
revealed abnormal IPGTT responses compared with nor-
mal C57BL/6 mice (n ⫽ 10; P ⬍ 0.001), even after 120 days
of normoglycemia to allow for regeneration (Fig. 2D). We
interpret these collective observations to mean that recov-
ery, albeit partial, of endogenous ␤-cell function had
occurred in the STZ-induced diabetic mice during the
period when normal glycemia was maintained by synge-
neic islet transplantation.
Histology of regenerated ␤-cells. Examination of the
cellular content of islets 7–14 days after STZ treatment
using standard immunohistochemical approaches indi-
cated a reduction in the proportion of insulin-positive
␤-cells and an increase in glucagon-positive ␣-cells com-
pared with normal controls (Fig. 3). These observations
are consistent with previous reports that high-dose STZ
results in diabetes associated with ␤-cell destruction
(17,27). In mice with restored ␤-cell function, the propor-
tion of insulin-positive cells in the islets was increased.
Further morphometric analysis indicated that STZ treat-
ment significantly reduced ␤-cell mass, determined by
anti-insulin staining, by ⬃90% (Fig. 4A). After 120 days of
normoglycemia, a statistically significant 3.7-fold increase
in ␤-cell mass was observed (P ⬍ 0.05). These observa-
tions are consistent with islet ␤-cell regeneration. We
acknowledge the possibility that numerous ␤-cells could
still be present after STZ treatment but remained undetec-
ted because of extensive degranulation, and that the
␤-cells observed at ⱖ160 days post–STZ treatment are due
to restoration of insulin granules in the ␤-cells. However,
this possibility is not supported by numerous findings that
high-dose STZ is toxic to ␤-cells (28 –34) and by our
additional studies in which the ␤-cell mass was deduced
by as the nonstaining portions of islets stained with a
cocktail of anti-glucagon, anti-stomatostatin, and anti–
pancreatic peptide antibodies. These latter studies con-
firmed a reduced islet ␤-cell mass in STZ-induced diabetic
3258
FIG. 3. Pancreatic islets from normal C57BL/6, STZ-treated (day 14)
mice, and mice with restored function (45–100 days postnephrectomy).
Insulin was stained brown (top and middle panels) or green (FITC;
bottom panel) and glucagon was stained red (phycoerythrin; bottom
panel). Magnifications are 100ⴛ, 200ⴛ, and 400ⴛ for the top, middle,
and bottom panels, respectively.
mice and a 1.8-fold increase in ␤-cell mass in mice after
120 days of normoglycemia (data not shown).
A predominant morphologic feature of the restored
insulin-expressing islets was ␤-cell hypertrophy (Figs.
4B–D). Cell hypertrophy was defined as statistically signif-
icant increases in the cell and nuclear sizes of restored
islets (125 and 137%, respectively) compared with normal
controls. Cell and nuclear sizes were defined as means of
the maximal and minimal diameters of ⬎300 islet cells or
nuclei (from 4 – 8 islets randomly selected from the pan-
creas of experimental or control mice [n ⫽ 3 per group]).
To test whether ␤-cell proliferation contributed to the
restoration of ␤-cell function, STZ-diabetic mice received
BrdU (10⫻, i.p.) from days 0 –14 postsyngeneic islet trans-
plantation. The numbers of BrdU-positive cells observed
in the islets was marginally (Fig. 4E and F) but statistically
different, between the two groups (149 of 2,365 [6.2%] vs.
119 of 1,370 [8.7%] for naı̈ve versus restored groups,
respectively, unpaired one-tail t test, P ⫽ 0.036). We
conclude from these observations that the restoration of
␤-cells was associated with cell hypertrophy and modest
levels of ␤-cell proliferation.
In vitro function of restored ␤-cells. We analyzed the
function of the restored islets in vitro by harvesting the
islets from the pancreata of the mice at 45–100 days
postnephrectomy. The number of islets recovered from
these mice was ⬃3–17% of that recovered from normal
C57BL/6 mice (5–20 per restored pancreas vs. 120 –150 per
normal pancreas; n ⫽ 8 per group). The isolated islets
were maintained in culture for 48 –72 h, and Ca2⫹ re-
sponses to glucose were imaged using Fura-2. Two exam-
ples of individual islet responses are shown (Fig. 5) and
were compared with islets from a normal mouse. Similar
results were obtained with 11 restored islets from a total
of five mice. The results indicate that the glucose-induced
calcium responses were perturbed in the restored islets, as
compared with the normal ones, and suggest that this
defect, as well as reduced islet numbers, accounted for the
observed hyperglycemia and abnormal IPGTT responses
in mice with restored ␤-cell function.
DIABETES, VOL. 55, DECEMBER 2006

FIG. 4. ␤-cells in STZ-induced diabetic mice with restored function. A:
The mean ␤-cell mass (mg) ⴞ SEM. B–D: ␤-cell hypertrophy in the
restored islets compared with islets from normal C57BL/6 mice. The
mean diameters ⴞ SEM of 100 ␤-cells or nuclei in islets from naive mice
and mice with restored ␤-cell function (Restd) (n ⴝ 3 per group) are
presented. * and ** indicate statistical differences (P < 0.05) between
the restored and the normal and diabetic groups, respectively (B).
BrdU-positive cells in normal (E) and functionally restored (F) islets,
after 10 days of BrdU administration. Magnifications are 400ⴛ (C and
D) and 200 ⴛ (D and E).
Removal of spleen reduces the restoration of ␤-cell
function. Recent interest in a possible role for the spleen
in ␤-cell restoration came from striking observations by
Kodama et al. (23). We first investigated whether the
presence of the spleen influenced the restoration of blood
glucose regulation in our mouse model. Mice underwent
splenectomy on the day of islet transplantation and were
then subjected to the same protocol as described in Fig. 1
to allow for the restoration of islet ␤-cells (n ⫽ 10). The
blood glucose levels of splenectomized mice after ne-
phrectomy were significantly higher (340 ⫾ 12 mg/dl) than
those of non-splenectomized mice (Fig. 6A and B; P ⬍
0.001), suggesting a role for the spleen in facilitating the
restoration of ␤-cell function.
Spleen cells do not transdifferentiate into ␤-cells.
The studies of Kodama et al. (23) suggested that spleen
cells had the ability to differentiate directly into ␤-cells,
thereby contributing to ␤-cell regeneration. We first tested
whether infusion of spleen cells altered the rate of resto-
ration of ␤-cell function, following the protocol estab-
DIABETES, VOL. 55, DECEMBER 2006
D. YIN AND ASSOCIATES
FIG. 5. Abnormal Ca2ⴙ responses in restored islets. Changes in islet
Ca2ⴙ concentration following application of glucose, tetraethylammo-
nium (TEA), carbachol (CCh), and KCl in islets isolated from control
(upper panel) and restored (middle and lower panels) mice. Traces
represent responses in single intact islets from one mouse. The exper-
iment was repeated with 11 restored islets from a total of five mice,
with comparable results.
lished by Kodama et al. Spleen cells from syngeneic
C57BL/6 mice were injected intravenously (2– 4 ⫻ 107) for
6 weeks (two injections per week), starting on day 1
postislet transplantation (splenectomized ⫹ STZ-treated
recipients; n ⫽ 10). The random blood glucose concentra-
tions in splenectomized mice inoculated with splenocytes,
after nephrectomy, were comparable (218 ⫾ 11 mg/dl) to
those of non-splenectomized mice (Fig. 6B; P ⬎ 0.5) and
significantly improved compared with the splenectomized
mice without spleen cell infusion (P ⬍ 0.001). IPGTT
responses were inferior in the splenectomized compared
with the non-splenectomized (restored) groups (P ⬍
0.001) and significantly improved in the splenectomized
group receiving spleen cells (Fig. 6C; P ⬍ 0.001). These
findings support the hypothesis that spleen cells can
facilitate the restoration of ␤-cell function in this model.
However, we acknowledge that the very large number of
spleen cells used in this study is irrelevant for clinical
studies.
3259
 SPLEEN FACILITATES RESTORATION OF ␤-CELL FUNCTION
FIG. 6. Role for the spleen in the restoration of ␤-cell function. A: Mean
blood glucose (BG, bar) levels in mice with intact spleen (Restd; n ⴝ
14), with no spleen (SplX; n ⴝ 10), or SplX plus splenocytes
(SplXⴙSplnC; n ⴝ 10). B: Time course of BG levels in mice from the
indicated groups (Restd, 䡺; SplX, ‚; SplX ⴙ SplnC, F). * and **
indicate statistical differences (ANOVA; P < 0.05) between the SplX
and the Restd or SplX ⴙ SplnC groups, respectively. C: IPGTT re-
sponses in normal (n ⴝ 12; f), Restd (n ⴝ 10; F), SplnX (n ⴝ 5;
triangles in bold), and SplXⴙSplnC groups (n ⴝ 8; ‚).
To test whether the spleen cell transfer facilitated the
restoration of ␤-cell function by directly converting into
␤-cells, we transferred either syngeneic male spleen cells
(n ⫽ 3) or spleen cells from syngeneic MIP-GFP mice (n ⫽
6) into C57BL/6 recipients. At 45–100 days postnephrec-
tomy, we looked for the presence of male (Y chromosome
by FISH) or MIP-GFP⫹ ␤-cells. We observed Y chromo-
some–positive male cells surrounding the restored islets,
but the locations of the FISH-positive cells were consistent
with peri-islet infiltration and not ␤-cells (Fig. 7A and B).
3260
FIG. 7. Presence of male spleen cells in the peri-islet location from the
native pancreas of a control male (A) or restored female mice (B) by
FISH for the Y chromosome (n ⴝ 3). Presence of lymphocytic infiltrate,
especially CD4ⴙ (C) and CD8ⴙ (D) cells, at 60 days postnephrectomy.
Absence of GFP in the islets of mice with restored ␤-cell function
receiving spleen cells from C57BL/6 MIP-GFP mice (D) (45–100 days
postnephrectomy; n ⴝ 6). Islets from MIP-GFP transgenic mice served
as positive controls (C). Magnifications are 400ⴛ (A and B) and 200ⴛ
(C–F).
Indeed, significant numbers of CD4⫹, and some CD8⫹,
cells were observed around the islets at 45–100 days
postnephrectomy (Fig. 7C and D).
To test more directly the ability of spleen cells to
differentiate into islet ␤-cells, we used spleen cells from
MIP-GFP⫹ mice and probed for the presence of MIP-GFP⫹
␤-cells in pancreas and other organs of the mice with
restored ␤-cell function by fluorescence microscopy or by
immunofluorescence with anti-GFP staining. We were not
able to detect GFP⫹ ␤-cells in any of the restored islets or
any other organ examined (Fig. 7E and F and data not
shown). Our data do not support a conclusion that splenic
stem cells are a source of ␤-cells in our model, but sug-
gest that transfused spleen cells detected in the vicinity of
the restored islets were likely to have been infiltrating
leukocytes.
DISCUSSION
Failure of pancreatic ␤-cells to secrete insulin is the
common physiologic defect in both type 1 and type 2
diabetes, and replacement of ␤-cell mass with islet cell or
pancreas transplantation is considered a viable therapeu-
tic option. Because of the significant limitations of alloge-
neic islet cell and pancreas transplantation, there is
renewed interest in the possibility that islet regeneration
may provide new islets in diabetic patients. In a study of
2,432 patients who were ⱖ18 years of age at onset of
diabetes, ⬃15 and 33% of patients had stimulated C-
peptide levels of ⬎0.5 and 0.2– 0.5 nmol/l, respectively,
within the first 5 years of diagnosis (35). Postmortem
studies demonstrated the presence of insulin-staining cells
in new-onset diabetic patients (35–38). These observa-
DIABETES, VOL. 55, DECEMBER 2006

tions, together with the recent report that preexisting
pancreatic ␤-cells in adult mice were capable of prolifer-
ation and generating new islets (24), have lent support to
the notion that islet regeneration may represent a possible
means of increasing islet ␤-cell mass in type 1 and 2
diabetic patients. However, those studies did not specifi-
cally address the critical issue of whether severely diabetic
adult individuals with depleted ␤-cells can regenerate to
levels that can maintain normal glycemia.
The high-dose STZ-induced diabetes model has been
extensively used to demonstrate the function of trans-
planted islets (28 –30). Those studies were based on the
assumption that mice treated with high-dose STZ are
unable to recover endogenous ␤-cell function. Indeed,
there have been few reports of functional ␤-cell regener-
ation in this high-dose model, despite reports of limited
increases in the numbers of insulin-positive cells shortly
after high-dose STZ treatment (13,39,40). In this study we
report that STZ-induced diabetic adult C57BL/6 mice, with
blood glucose levels of ⬎400 mg/dl, have modest abilities
to recover ␤-cell function and mass in vivo. Thus, these
observations confirm and extend observations of a modest
two- to threefold increase in pancreatic ␤-cells in high-
dose STZ-induced diabetic adult rats (41).
The percent of ␤-cells in the islets and the islet size were
significantly reduced following STZ treatment, as com-
pared with those of normal mice, but increased in STZ-
diabetic mice after 120 days of normal glycemia. We
demonstrated that the recovery of ␤-cell function was the
result of increased ␤-cell mass due to ␤-cell hypertrophy.
A modest but statistically increased level of ␤-cell prolif-
eration was observed following BrdU labeling in the islets
of restored compared with normal controls. Our observa-
tions, albeit at lower rates of BrdU uptake, are therefore
consistent with enhanced ␤-cell proliferation reported in
other models of ␤-cell regeneration (42) (43).
The recovery of ␤-cell function was only observed in
mice in which normal blood glucose levels were main-
tained by the transplanted syngeneic islets, as none of the
diabetic mice recovered from diabetes without islet trans-
plantation. These observations are consistent with the
notion that recovery is dependent on glucose control,
although the possibility exists that the presence of islets
may contribute to the recovery of endogenous ␤-cell
function, independent of effects on glucose control.
Our in vivo and in vitro studies also underscore the
limited nature of ␤-cell regeneration in this STZ model.
Random blood glucose levels remained elevated even after
120 days of normal glycemia, and the IPGTT responses
remained impaired. The restored islets also had abnormal
abilities to flux [Ca2⫹]i in response to high glucose chal-
lenge. The partial recovery of ␤-cell function could be due
to permanent destruction of ␤-cell–to–␤-cell contacts,
alterations in the architecture of the restored islet, or
scarring, leading to defective ␤-cell sensing. Whether these
features are specific to the STZ-induced diabetes model or
reflect a more generalized limitation of regenerated ␤-cells
will have to be elucidated in other more physiologic
models of ␤-cell destruction.
Our observations of limited restoration of ␤-cells in the
STZ model are in contrast to the more robust levels of
regeneration reported for autoimmune diabetic NOD mice
(23,44,45), and they suggest that the rate of ␤-cell regen-
eration may be regulated by multiple factors. In the
RIP-LCMV model of autoimmune diabetes, von Herrath et
al. (46) reported that the ability to resist the development
DIABETES, VOL. 55, DECEMBER 2006
D. YIN AND ASSOCIATES
of diabetes differed drastically between the 129 and the
C57BL/6 strain, and they speculated that this difference
was the result of differences in the abilities of these two
strains of mice to regenerate ␤-cells. It has also been
reported that partial pancreactectomy enhanced resis-
tance to STZ-induced diabetes (11) and that neonatal rats
are able to spontaneously recover from STZ-induced dia-
betes (47). Thus, it appears that multiple factors, including
the genetic background, the age of the diabetic animal, and
the type of injury/inflammation causing ␤-cell destruction,
affect the rate of ␤-cell regeneration in rodents. It is likely
that these same factors will shape the ability of diabetic
human patients to regenerate ␤-cells. We speculate that
␤-cell regeneration in adult humans is likely to be a slow
process, and the significant question of how effectively
diabetic patients with depleted ␤-cell mass can regenerate
remains to be answered.
Understanding how ␤-cell regeneration is normally reg-
ulated could lead to the identification of new approaches
for enhancing ␤-cell regeneration. To this end we tested
the effect of the spleen in the restoration of ␤-cell function
in this model. A role for the spleen in ␤-cell regeneration
was suggested by clinical data showing that the incidence
of diabetes was significantly higher in patients undergoing
partial pancreatectomy and splenectomy than in those
undergoing pancreatectomy alone (48). Further evidence
for a role of the spleen in ␤-cell regeneration came from
the NOD mouse model of autoimmune diabetes (23).
Kodama et al. (23) reported that stem cells residing in the
spleen of NOD mice were capable of differentiating into
␤-cells, thereby restoring ␤-cell mass and curing diabetes.
We here demonstrate that the removal of the spleen
resulted in significantly reduced restoration of ␤-cell func-
tion in this model, consistent with the clinical data. We
also confirmed that the administration of high doses of
spleen cells partially restored the ability to recover ␤-cell
function in the splenectomized mice. We observed a
peri-islet localization of the donor spleen cells, but, con-
trary to the observations by Kodama et al. (25), we were
unable to demonstrate a direct contribution of spleen-
derived cells to the regenerated islets. These data are,
however, consistent with recent reports that spleen cells
do not differentiate into islet ␤-cells (49 –51). It is currently
unclear what role the spleen plays in this model of
restoration of ␤-cell function, but it may resemble the
indirect effects of bone marrow– derived stem cells in
initiating pancreatic ␤-cell regeneration as described by
Hess et al. (52). Indeed, we are currently testing whether
the spleen contributes to the inflammatory process in the
pancreas (and thereby stimulates recovery of the STZ
damaged islet), as well as defining the cell types, namely T,
B, or other cells, involved in this effect. Finally, we are
testing whether an infusion of a more physiologic number
of spleen cells can enhance the recovery of ␤-cell function.
In conclusion, there is recent interest in utilizing the
natural ability of ␤-cells to regenerate as an innovative
approach for the treatment of type 1 diabetes. We have
developed a new mouse model, whereby we demonstrate
a partial restoration of ␤-cell mass and function in adult
mice made diabetic with STZ. While the end goal is to
completely eliminate the need for exogenous insulin, the
benefits of partial recovery of ␤-cell function in severe
diabetic patients cannot be ignored, as patients with
residual ␤-cell function require less insulin, have better
and easier glycemic control, and fewer end-organ compli-
cations compared with patients with no residual function
3261
 SPLEEN FACILITATES RESTORATION OF ␤-CELL FUNCTION
(35). We also observed a significant requirement for the
spleen and spleen cells in islet cell regeneration, and we
demonstrate that this is not due to direct differentiation of
the spleen cells into ␤-cells. This study supports the
possibility of regeneration as a means for generating new
␤-cells even in severely diabetic individuals with signifi-
cantly reduced ␤-cell mass. The rate of normal ␤-cell
regeneration is slow, and it is critical that strategies are
identified to enhance ␤-cell regeneration in severely dia-
betic individuals.
ACKNOWLEDGMENTS
This work was supported by grant support from the JDRF,
National Institutes of Health(DK073529), Chester Founda-
tion, and Lyman Family Fund. We thank Dr. Denise
Faustman for her advice on the spleen cell preparations,
Dr. Ian Boussy for his assistance throughout the study and
Christine Ding for technical assistance.
REFERENCES
1. Rother KI, Harlan DM: Challenges facing islet transplantation for the
treatment of type 1 diabetes mellitus. J Clin Invest 114:877– 883, 2004
2. Burt RK, Oyama Y, Traynor A, Kenyon NS: Hematopoietic stem cell
therapy for type 1 diabetes: induction of tolerance and islet cell neogene-
sis. Autoimmun Rev 1:133–138, 2002
3. Risbud MV, Bhonde RR: Models of pancreatic regeneration in diabetes.
Diabetes Res Clin Pract 58:155–165, 2002
4. Hussain MA, Theise ND: Stem-cell therapy for diabetes mellitus. Lancet
364:203–205, 2004
5. Yamaoka T: Regeneration therapy for diabetes mellitus. Expert Opin Biol
Ther 3:425– 433, 2003
6. Murtaugh LC, Melton DA: Genes, signals, and lineages in pancreas devel-
opment. Annu Rev Cell Dev Biol 19:71– 89, 2003
7. Trucco M: Regeneration of the pancreatic beta cell. J Clin Invest 115:5–12,
2005
8. Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE: A second pathway for
regeneration of adult exocrine and endocrine pancreas: a possible reca-
pitulation of embryonic development. Diabetes 42:1715–1720, 1993
9. Bouwens L: Islet morphogenesis and stem cell markers. Cell Biochem
Biophys 40:81– 88, 2004
10. Gu D, Sarvetnick N: Epithelial cell proliferation and islet neogenesis in
IFN-g transgenic mice. Development 118:33– 46, 1993
11. Hardikar AA, Karandikar MS, Bhonde RR: Effect of partial pancreatectomy
on diabetic status in BALB/c mice. J Endocrinol 162:189 –195, 1999
12. Rosenberg L: In vivo cell transformation: neogenesis of beta cells from
pancreatic ductal cells. Cell Transplant 4:371–383, 1995
13. Fernandes A, King LC, Guz Y, Stein R, Wright CV, Teitelman G: Differen-
tiation of new insulin-producing cells is induced by injury in adult
pancreatic islets. Endocrinology 138:1750 –1762, 1997
14. Wang RN, Kloppel G, Bouwens L: Duct- to islet-cell differentiation and islet
growth in the pancreas of duct-ligated adult rats. Diabetologia 38:1405–
1411, 1995
15. Suzuki A, Nakauchi H, Taniguchi H: Prospective isolation of multipotent
pancreatic progenitors using flow-cytometric cell sorting. Diabetes 53:
2143–2152, 2004
16. Yang L, Li S, Hatch H, Ahrens K, Cornelius JG, Petersen BE, Peck AB: In
vitro trans-differentiation of adult hepatic stem cells into pancreatic
endocrine hormone-producing cells. Proc Natl Acad Sci U S A 99:8078 –
8083, 2002
17. Kojima H, Fujimiya M, Matsumura K, Younan P, Imaeda H, Maeda M, Chan
L: NeuroD-betacellulin gene therapy induces islet neogenesis in the liver
and reverses diabetes in mice. Nat Med 9:596 – 603, 2003
18. Horb ME, Shen CN, Tosh D, Slack JM: Experimental conversion of liver to
pancreas. Curr Biol 13:105–115, 2003
19. Yoshida S, Kajimoto Y, Yasuda T, Watada H, Fujitani Y, Kosaka H, Gotow
T, Miyatsuka T, Umayahara Y, Yamasaki Y, Hori M: PDX-1 induces
differentiation of intestinal epithelioid IEC-6 into insulin-producing cells.
Diabetes 51:2505–2513, 2002
20. Ianus A, Holz GG, Theise ND, Hussain MA: In vivo derivation of glucose-
competent pancreatic endocrine cells from bone marrow without evidence
of cell fusion. J Clin Invest 111:843– 850, 2003
21. Tang DQ, Cao LZ, Burkhardt BR, Xia CQ, Litherland SA, Atkinson MA,
3262
Yang LJ: In vivo and in vitro characterization of insulin-producing cells
obtained from murine bone marrow. Diabetes 53:1721–1732, 2004
22. Oh SH, Muzzonigro TM, Bae SH, LaPlante JM, Hatch HM, Petersen BE:
Adult bone marrow-derived cells trans-differentiating into insulin-produc-
ing cells for the treatment of type I diabetes. Lab Invest 84:607– 617, 2004
23. Kodama S, Kuhtreiber W, Fujimura S, Dale EA, Faustman DL: Islet
regeneration during the reversal of autoimmune diabetes in NOD mice.
Science 302:1223–1227, 2003
24. Dor Y, Brown J, Martinez OI, Melton DA: Adult pancreatic beta-cells are
formed by self-duplication rather than stem-cell differentiation. Nature
429:41– 46, 2004
25. Hara M, Wang X, Kawamura T, Bindokas VP, Dizon RF, Alcoser SY,
Magnuson MA, Bell GI: Transgenic mice with green fluorescent protein-
labeled pancreatic beta-cells. Am J Physiol Endocrinol Metab 284:E177–
183, 2003
26. Guo Z, Chong AS, Shen J, Foster P, Sankary HN, McChesney L, Mital D,
Jensik SC, Williams JW: Prolongation of rat islet allograft survival by the
immunosuppressive agent leflunomide. Transplantation 63:711–716, 1997
27. Cardinal JW, Allan DJ, Cameron DP: Poly(ADP-ribose)polymerase activa-
tion determines strain sensitivity to streptozotocin-induced beta cell death
in inbred mice. J Mol Endocrinol 22:65–70, 1999
28. Lenschow DJ, Zeng Y, Thistlethwaite JR, Montag A, Brady W, Gibson MG,
Linsley PS, Bluestone JA: Long-term survival of xenogeneic pancreatic
islet grafts induced by CTLA4lg. Science 257:789 –792, 1992
29. Li H, Colson YL, Ildstad ST: Mixed allogeneic chimerism achieved by lethal
and nonlethal conditioning approaches induces donor-specific tolerance to
simultaneous islet allografts. Transplantation 60:523–529, 1995
30. Ar’Rajab A, Dawidson IJ, Harris RB, Sentementes JT: Immune privilege of
the testis for islet xenotransplantation (rat to mouse). Cell Transplant
3:493– 498, 1994
31. Weir GC, Laybutt DR, Kaneto H, Bonner-Weir S, Sharma A: Beta-cell
adaptation and decompensation during the progression of diabetes. Dia-
betes 50 (Suppl. 1):S154 –S159, 2001
32. Gleason CE, Gonzalez M, Harmon JS, Robertson RP: Determinants of
glucose toxicity and its reversibility in the pancreatic islet beta-cell line,
HIT-T15. Am J Physiol Endocrinol Metab 279:E997–E1002, 2000
33. Tanaka Y, Tran PO, Harmon J, Robertson RP: A role for glutathione
peroxidase in protecting pancreatic beta cells against oxidative stress in a
model of glucose toxicity. Proc Natl Acad Sci U S A 99:12363–12368, 2002
34. Robertson RP: Chronic oxidative stress as a central mechanism for glucose
toxicity in pancreatic islet beta cells in diabetes. J Biol Chem 279:42351–
42354, 2004
35. Palmer JP, Fleming GA, Greenbaum CJ, Herold KC, Jansa LD, Kolb H,
Lachin JM, Polonsky KS, Pozzilli P, Skyler JS, Steffes MW: C-peptide is the
appropriate outcome measure for type 1 diabetes clinical trials to preserve
beta-cell function: report of an ADA workshop, 21–22 October 2001.
Diabetes 53:250 –264, 2004
36. Nakanishi K, Kobayashi T, Miyashita H, Okubo M, Sugimoto T, Murase T,
Kosaka K, Hara M: Relationships among residual beta cells, exocrine
pancreas, and islet cell antibodies in insulin-dependent diabetes mellitus.
Metabolism 42:196 –203, 1993
37. Lohr M, Kloppel G: Residual insulin positivity and pancreatic atrophy in
relation to duration of chronic type 1 (insulin-dependent) diabetes mellitus
and microangiopathy. Diabetologia 30:757–762, 1987
38. Foulis AK, Stewart JA: The pancreas in recent-onset type 1 (insulin-
dependent) diabetes mellitus: insulin content of islets, insulitis and asso-
ciated changes in the exocrine acinar tissue. Diabetologia 26:456 – 461,
1984
39. Guz Y, Nasir I, Teitelman G: Regeneration of pancreatic beta cells from
intra-islet precursor cells in an experimental model of diabetes. Endocri-
nology 142:4956 – 4968, 2001
40. Teitelman G, Guz Y, Ivkovic S, Ehrlich M: Islet injury induces neurotrophin
expression in pancreatic cells and reactive gliosis of peri-islet Schwann
cells. J Neurobiol 34:304 –318, 1998
41. Jorns A, Klempnauer J, Tiedge M, Lenzen S: Recovery of pancreatic beta
cells in response to long-term normoglycemia after pancreas or islet
transplantation in severely streptozotocin diabetic adult rats. Pancreas
23:186 –196, 2001
42. Sharma A, Zangen DH, Reitz P, Taneja M, Lissauer ME, Miller CP, Weir GC,
Habener JF, Bonner-Weir S: The homeodomain protein IDX-1 increases
after an early burst of proliferation during pancreatic regeneration. Dia-
betes 48:507–513, 1999
43. Teta M, Long SY, Wartschow LM, Rankin MM, Kushner JA: Very slow
turnover of beta-cells in aged adult mice. Diabetes 54:2557–2567, 2005
44. Faustman DL: Reversal of established autoimmune diabetes by in situ
beta-cell regeneration. Ann N Y Acad Sci 961: 40, 2002
45. Zorina TD, Subbotin VM, Bertera S, Alexander AM, Haluszczak C, Gambrell
DIABETES, VOL. 55, DECEMBER 2006

B, Bottino R, Styche AJ, Trucco M: Recovery of the endogenous beta cell
function in the NOD model of autoimmune diabetes. Stem Cells 21:377–
388, 2003
46. von Herrath MG, Wolfe T, Mohrle U, Coon B, Hughes A: Protection from
type 1 diabetes in the face of high levels of activated autoaggressive
lymphocytes in a viral transgenic mouse model crossed to the SV129 strain.
Diabetes 50:2700 –2708, 2001
47. Wang RN, Bouwens L, Kloppel G: Beta-cell proliferation in normal and
streptozotocin-treated newborn rats: site, dynamics and capacity. Diabe-
tologia 37:1088 –1096, 1994
48. Govil S, Imrie CW: Value of splenic preservation during distal pancreate-
ctomy for chronic pancreatitis. Br J Surg 86:895– 898, 1999
DIABETES, VOL. 55, DECEMBER 2006
D. YIN AND ASSOCIATES
49. Suri A, Calderon B, Esparza TJ, Frederick K, Bittner P, Unanue ER:
Immunological reversal of autoimmune diabetes without hematopoietic
replacement of beta cells. Science 311:1778 –1780, 2006
50. Nishio J, Gaglia JL, Turvey SE, Campbell C, Benoist C, Mathis D: Islet
recovery and reversal of murine type 1 diabetes in the absence of any
infused spleen cell contribution. Science 311:1775–1778, 2006
51. Chong AS, Shen J, Tao J, Yin D, Kuznetsov A, Hara M, Philipson LH:
Reversal of diabetes in non-obese diabetic mice without spleen cell-
derived beta cell regeneration. Science 311:1774 –1775, 2006
52. Hess D, Li L, Martin M, Sakano S, Hill D, Strutt B, Thyssen S, Gray DA,
Bhatia M: Bone marrow-derived stem cells initiate pancreatic regenera-
tion. Nat Biotechnol 21:763–770, 2003
3263
4388 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018

Streptozotocin‑induced diabetic mice exhibit

reduced experimental choroidal neovascularization
but not corneal neovascularization
GAOQIN LIU1,2, LEI CHEN1, QINHUA CAI1, HONGYA WU2,3, ZHIGANG CHEN1,
XUEGUANG ZHANG2,3 and PEIRONG LU1,2

1
Department of Ophthalmology; 2Jiangsu Key Laboratory of Clinical Immunology;
3
Jiangsu Key Laboratory of Gastrointestinal Tumor Immunology,
The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215006, P.R. China

Received February 20, 2018; Accepted July 17, 2018

DOI: 10.3892/mmr.2018.9445

Abstract. The present study aimed to investigate the effects
of diabetes mellitus (DM) on the generation of experimental
corneal neovascularization (CrNV) and choroidal neovas-
cularization (ChNV). Diabetes was induced in mice by
intraperitoneal injection of streptozotocin (STZ). Experimental
CrNV and ChNV were induced by alkali injury and laser
photocoagulation, respectively. CrNV and ChNV were
compared between the STZ‑induced diabetic mice and control
mice two weeks after injury. Relative expression of angiogenic
factors was quantified by reverse transcription‑quantitative
polymerase chain reaction, and progenitor cell or macro-
phage accumulation in the early phase following injury was
examined by flow cytometric analysis. Compared with the
alkali‑injured normal mice, the alkali‑injured diabetic mice
(STZ‑induced) exhibited no significant difference in CrNV
occurrence, whereas the laser‑injured diabetic mice exhibited
significantly reduced levels of ChNV compared with those of
the laser‑injured control animals. The laser‑induced intracho-
roidal mRNA expression levels of angiogenic factors, including
vascular endothelial growth factor, hypoxia‑induced factor‑1α,
chemokine (C‑C motif) ligand 3, and stromal cell‑derived
factor‑1α, were reduced in the laser‑injured diabetic mice
when compared with laser‑injured control mice. Furthermore,
the laser‑induced intrachoroidal infiltration of c‑Kit+
progenitor cells was impaired in the laser‑injured diabetic
mice compared with the laser‑injured control mice. Overall,
diabetes did not exert a significant effect on the generation of
experimental CrNV. However, diabetes reduced laser‑induced
Correspondence to: Professor Peirong Lu, Department of
Ophthalmology, The First Affiliated Hospital of Soochow
University, 188 Shizi Street, Suzhou, Jiangsu 215006, P.R. China
E‑mail: lupeirong@suda.edu.cn
Key words: corneal neovascularization, diabetes, choroidal
neovascularization, angiogenesis, chemokine
ChNV through downregulation of intrachoroidal progenitor
cell infiltration and angiogenic factor expression.
Introduction
Diabetes mellitus (DM) is a metabolic disease characterized
by abnormal glucose metabolism (1). The disease can cause
a number of complications that affect the quality of life of
patients (2,3). Patients with diabetes and abnormal glucose
metabolism in their tissues and organs may exhibit enlarged
blood vessels and microvascular dysfunctions (4,5). Diabetes
also causes metabolic cataracts and ocular neovascular
diseases such as advanced diabetic retinopathy (DR), which
can result in serious eye damage and loss of vision.
The normal cornea is characterized by the absence of blood
vessels and hematopoietic cells, including erythrocytes and
leukocytes (6), and corneal avascularity is required for optical
clarity and maintenance of vision. Corneal neovasculariza-
tion (CrNV) results from numerous causes, including corneal
infections, misuse of contact lenses, chemical burns, and inflam-
mation, and can lead to severely impaired vision (7‑9). In most
cases of inflammation‑induced CrNV, bone marrow‑derived
progenitor cells, neutrophils, and macrophages infiltrate the
cornea. Any effects on this infiltration may change the relative
expression of cytokines and chemokines, and thereby affect
the generation of CrNV (10‑13).
Age‑related macular degeneration (AMD) is a type of
macular degeneration disease characterized by loss of central
vision. The incidence rate increases with age. Wet AMD, char-
acterized by choroidal neovascularization (ChNV), can result
in seriously damaged central vision. It is believed that diabetes
can cause DR, which is characterized by retinal neovascu-
larization. However, it remains unclear whether diabetes has
an effect on other types of ocular neovascularization such as
CrNV or ChNV.
In the present study, streptozotocin (STZ)‑induced diabetic
mice were subjected to alkali injury‑induced experimental
CrNV and laser‑induced experimental ChNV, which are
the optional models of CrNV and AMD (10‑15), in order to
examine the effects of diabetes on the development of ocular
 LIU et al: EFFECTS OF DIABETES ON OCULAR NEOVASCULARIZATION
neovascularization. A greater understanding of the effects of
diabetes on ocular neovascularization may not only enable
prevention of various complications of diabetes, but also facili-
tate control of the development of ocular neovascularization
diseases such as wet AMD.
Materials and methods
Reagents and antibodies. Sodium hyaluronate (HA)
(cat. no. S0780000) and Avertin (cat. no. T48402) were
purchased from the Sigma‑Aldrich (Merck KGaA,
Darmstadt, Germany). Alexa Fluor 488 donkey anti‑rat
IgG (H+L) antibody (cat. no. A‑21208) was purchased from
Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA,
USA). Rat anti‑mouse cluster of differentiation (CD) 31
(cat. no. MEC13.3) monoclonal antibodies (mAbs) were
purchased from BD Biosciences (Franklin Lakes, NJ, USA).
FITC‑labeled rat anti‑mouse F4/80 mAb (cat. no. ab105155)
was acquired from Abcam (Cambridge, UK). Goat anti‑mouse
c‑Kit (cat. no. AF1356) antibody, goat anti‑chemokine (C‑C
motif) ligand (CCL) 3 (cat. no. AB‑450‑NA) and horseradish
peroxidase‑conjugated rabbit anti‑goat secondary anti-
body (cat. no. 5160‑2504) were supplied by R&D Systems
(Minneapolis, MN, USA). PE‑labeled rabbit anti‑goat IgG
antibody (cat. no. SA5‑10079) was purchased from Invitrogen
(Thermo Fisher Scientific, Inc.). Goat anti‑stromal cell‑derived
factor (SDF)‑1α (cat. no. sc‑7427), goat anti‑vascular
endothelial growth factor (VEGF; cat. no. sc‑152‑G), goat
anti‑hypoxia‑induced factor (HIF)‑1α (cat. no. sc‑12542) and
goat anti‑GAPDH (cat. no. sc‑48166) antibodies were from
Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).
Animals. All animal experiments followed the Guideline for the
Care and Use of Laboratory Animals of the Chinese Medical
Academy and were approved by the Soochow University
Animal Care Committee (Suzhou, China), and were performed
in accordance with the ARVO Statement for the Use of Animals
in Ophthalmic and Vision Research. Specific pathogen‑free
four‑week‑old male BALB/c (n=90; aged 4‑5 weeks; weighing
10‑15 g) or C57BL/6 mice (n=210; aged 4‑5 weeks; weighing
10‑15 g) were obtained from Shanghai SLAC Laboratory
Animal Co. Ltd. (Shanghai, China), and were kept in our
animal facility under specific pathogen‑free conditions. A 12‑h
day/12‑h night cycle was maintained during the entire course of
the study. Animals were kept in groups of five and fed regular
lab chow and water ad libitum. BALB/c mice were divided into
two groups: An alkali‑injured control group, where citrate‑citric
acid buffer was injected intraperitoneally and alkali was applied
topically onto the cornea; and an alkali‑injured diabetes group,
where STZ was injected intraperitoneally and alkali was applied
topically onto the cornea. C57BL/6 mice were also divided into
two groups: A laser‑injured control group, where citrate‑citric
acid buffer was injected intraperitoneally and laser treatment
was performed on the retina; and a laser‑injured diabetes group,
where STZ was injected intraperitoneally and laser treatment
was performed on the retina. Control animals were those
injected with the vehicle, citrate‑citric acid buffer.
Induction of diabetes in mice. Five‑week‑old male specific
pathogen‑free BALB/c or C57BL/6 mice were injected
4389
intraperitoneally with 50 mg/kg STZ (STZ mixed anomers;
Sigma‑Aldrich; Merck KGaA) diluted to 10 mg/ml with
cold, pH 4.5 citrate‑citric acid buffer (Sigma‑Aldrich; Merck
KGaA), as previously described (16‑18). Briefly, STZ was
reconstituted in 25 mM citrate‑citric acid buffer. Injections
were administered intraperitoneally within 15 min of prepara-
tion. Mice were treated with five consecutive daily injections
(10 mg/kg streptozotocin per day). Blood glucose levels were
measured once a week, following the initial administration
of STZ using a blood glucose monitor (OneTouch® Basic
glucometer; LifeScan, Inc., Milpitas, CA, USA) drawing blood
from the tail vein. Animals were considered diabetic if their
blood glucose levels were >11.1 mmol (200 mg/dl) 4 weeks
after initial MLD (multiple low‑dose)‑STZ injection. Control
animals received an equal amount of citrate‑citric acid buffer
under similar conditions (blood glucose: 5 +/‑ 0.4 mmol).
Alkali injury‑induced CrNV. Specific pathogen‑free
nine‑week‑old BALB/c mice were anesthetized with an intra-
peritoneal injection of 12 g/l Avertin at a dose of 240 mg/kg
body weight four weeks after initial injection of MLD‑STZ
or citrate‑citric acid buffer. A 2‑mm disc of filter paper satu-
rated with 1 N NaOH was placed onto the left cornea of each
mouse for 40 sec, followed by rinsing extensively with 10 ml
phosphate‑buffered saline (PBS). The corneal epithelia were
removed using a corneal knife in a rotary motion parallel
to the limbus by gently scraping over the corneal surface
without injuring the underlying corneal stroma, as previ-
ously described (12). Erythromycin ophthalmic ointment was
instilled immediately following epithelial denudation. At the
indicated time intervals (days 2 and 4 after alkali injury), mice
were sacrificed with an intraperitoneal injection of sodium
pentobarbitone at a dose of 300 mg/kg body weight (Virbac,
Carindale, QLD, Australia) and the corneas were removed
from the experimental eyes. The corneas were placed imme-
diately into RNAlate (Qiagen GmbH, Hilden, Germany) and
stored at ‑86˚C until total RNA extraction. In another series of
experiments, the mice were sacrificed with an intraperitoneal
injection of sodium pentobarbitone at a dose of 300 mg/kg
body weight and the corneas were immediately removed from
the alkali‑treated eyes for measurement of CrNV. Each experi-
ment was repeated at least three times.
Biomicroscopic examination of CrNV. Eyes from afore-
mentioned BALB/c mice were examined under a surgical
microsystem (MZ16; Leica Microsystems GmbH, Wetzlar,
Germany) 14 days after alkali injury, and prior to sacrifice and
removal of corneas. In brief, while the mice were under anes-
thesia with an intraperitoneal injection of Avertin (240 mg/kg
body weight), photographs of the corneas were captured using
a digital camera (Nikon Corporation, Tokyo, Japan) linked
to an operating microscope. Microscopic assessment was
performed by two independent observers with no prior knowl-
edge of the experimental procedures.
Corneal whole mounts and enumeration of CrNV. Corneal
whole mount staining with CD31 was performed and blood
vessels in the corneas of the aforementioned BALB/c mice
were measured according to a previous study (7). The mice
were sacrificed with an intraperitoneal injection of sodium
4390 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018

Table I. Sequences of the primers used for reverse transcription‑polymerase chain reaction.

Primers Sequence (5'‑3') Product size (bp) Annealing temperature (ºC) PCR cycles

VEGF 105 60 40
F AGCTTCCTACAGCACAGCAG
R GCGCTTTCGTTTTTGACCCT
HIF‑1α 198 60 40
F TGCCACTTCCCCACAATGTGAG
R CCATGTCGCCGTCATCTGTTAGCA
CCL‑2 100 60 40
F GGTCCCTGTCATGCTTCTGGGC
R GCAGCAGGTGAGTGGGGCG
CXCL‑2 130 60 40
F TGCTGCTGGCCACCAACCAC
R GGTCCTGGGGGCGTCACACT
CCL‑3 100 60 40
F AGCTGACACCCCGACTGCCT
R TGGCTGGGAGCAAAGGCTGC
SDF‑1α 101 60 40
F CCAAGGTCGTCGCCGTGCTG
R CTCGAAGAACCGGCAGGGGC
TSP‑1 197 60 40
F GGTCGGCCTGCACTGTCACC
R GGGGAAGCTGCTGCACTGGG
MMP‑2 100 60 40
F AACGGTCGGGAATACAGCAG
R GTAAACAAGGCTTCATGGGGG
MMP‑9 122 60 40
F AAACCTCCAACCTCACGGAC
R CTGAAGCATCAGCAAAGCCG
GAPDH 111 60 40
F TTCACCACCATGGAGAAGGC
R CTCGTGGTTCACACCCATCA

All primers used were purchased from Genescript (Nanjing, China). The amplification was performed on iCycler iQ™ Multi‑Color Real Time
PCR Detection System (170‑8740, Bio‑Rad Laboratories, Inc., Hercules, CA, USA). F, forward primer; R, reverse primer; PCR, Polymerase
Chain Reaction; VEGF, vascular endothelial growth factor; HIF, hypoxia inducible factor; CC, Chemokine (C‑C motif) ligand; CXCL, C‑X‑C
motif chemokine ligand; SDF, stromal cell‑derived factor; TSP, Thrombospondin; MMP, matrix metalloproteinase; GAPDH, glyceraldehyde
3‑phosphate dehydrogenase.

pentobarbitone at a dose of 300 mg/kg body weight and the
corneas were rapidly removed from the alkali‑treated eyes;
Three or four relaxing radial incisions of each cornea were
made. The corneal flat mounts were rinsed in PBS, fixed in
acetone, and rinsed in PBS. The mounts were then blocked
in 10% normal donkey serum (cat. no. 36116ES03; Shanghai
Yeasen Biotechnology Co., Ltd., Shanghai, China), stained with
rat anti‑mouse CD31 (1:150; BD Biosciences) at 4˚C overnight,
and washed in PBS. Subsequently, the corneas were incubated
with Alexa Fluor 488 donkey anti‑rat IgG (1:100; Invitrogen;
Thermo Fisher Scientific, Inc.) for 1 h at room temperature in
the dark. Digital photographs of the flat mounts were captured
and the area stained by CD31 was measured morphometrically
using NIH Image software (National Institutes of Health,
Bethesda, MD, USA). The total area of neovascularization was
normalized to the total corneal area, and the percentage of the
cornea covered by vessels was calculated.
Laser‑induced ChNV. Laser treatment was performed on each
C57BL/6 mouse retina as described previously (19). Specific
pathogen‑free nine‑week‑old C57BL/6 mice were anesthe-
tized with an intraperitoneal injection of 12 g/l Avertin at a
dose of 240 mg/kg body weight and the pupils were dilated
with a single drop of 1% tropicamide four weeks after initial
injection of MLD‑STZ or citrate‑citric acid buffer. Krypton
red laser photocoagulation (50 µm spot size, 0.05 sec dura-
tion, 250 mW) was used to generate three laser spots in the
eye surrounding the optic nerve, using a hand‑held coverslip
as a contact lens. A bubble forming at a laser spot indicated
rupture of Bruch's membrane. The laser spots were evaluated
 LIU et al: EFFECTS OF DIABETES ON OCULAR NEOVASCULARIZATION 4391

Figure 1. Effect of STZ‑induced diabetes on alkali induced CrNV. (A) Representative CrNV assessed by CD31 corneal whole mount staining. Original
magnification, x25. (B) The relative neovascular areas were compared between the alkali‑injured diabetic and alkali‑injured control mice. All values represent
mean ± standard error of the mean (n=5 animals). STZ, streptozocin; CrNV, corneal neovascularization; CD, cluster of differentiation.

for the presence of ChNV on day 14 after laser treatment using
fundus fluorescein angiography and CD31 choroidal whole
mount staining (as described below). Laser coagulation was
performed only in the left eye of each mouse, with the right
eye serving as the control. At the indicated time intervals
(days 2 and 4 after laser treatment), mice were sacrificed with
an intraperitoneal injection of sodium pentobarbitone at a dose
of 300 mg/kg body weight and choroids were removed from
the experimental eyes. The choroids were placed immediately
into RNAlate and stored at ‑86˚C until total RNA extraction.
In another series of experiments of choroidal whole mount
staining on day 14 after laser treatment and after fluorescein
angiography, the mice were sacrificed with an intraperitoneal
injection of sodium pentobarbitone at a dose of 300 mg/kg
body weight and the choroids were immediately removed from
the laser‑treated eyes for measurement of ChNV. Each experi-
ment was repeated at least three times.
Fluorescein angiography. Fluorescein angiography was
conducted 14 days after laser treatment. Briefly, the C57BL/6
mice were anesthetized with an intraperitoneal injection of
12 g/l Avertin at a dose of 240 mg/kg body weight. Pupils
from the aforementioned C57BL/6 mice were dilated using
2.5% phenylephrine hydrochloride and 1% tropicamide eye
drops. Subsequently, 10% fluorescein sodium chloride was
injected intraperitoneally into the anesthetized mice. After
180‑200 sec, fundus photos were captured using an angiog-
raphy camera (KOWA RC‑XV3; Kowa Company, Ltd., Osaka,
Japan); Two experienced individuals who were blinded to
the study processed and scored the images. Scores were
determined as previously described: 0, no staining; 1, slight
leakage; 2a, moderate leakage; and 2b, heavy leakage (19).
Images were standardized for the process. The area covered
with ChNV was determined using Image J software (available
at http://rsb.info.nih.gov/ij/index.html), version 1.62 (National
Institutes of Health).
Choroidal whole mounts and morphological determination
of neovascularization. The choroids from aforementioned
C57BL/6 mice that were excised for ChNV assays on day 14
after laser treatment and fluorescein angiography, were rinsed
in PBS and fixed in acetone for 20 min. After washing and
blocking with 2% bovine serum albumin (cat. no. 11021029;
Gibco; Thermo Fisher Scientific, Inc.) in PBS for 1 h, the
choroids were stained overnight at 4˚C with rat anti‑mouse
CD31 antibody (BD Biosciences). The choroids were rinsed
and then stained with an Alexa Fluor ® 488‑conjugated
secondary donkey anti‑rat antibody (Invitrogen; Thermo
Fisher Scientific, Inc.). The choroids were placed on slides,
covered with fluorescent mounting medium (Dako; Agilent
Technologies, Inc., Santa Clara, CA, USA) and stored at 4˚C in
the dark. The stained choroidal whole mounts were analyzed
using a fluorescence microscope at an excitation wavelength
of 495 nm (MZ16; Leica Microsystems GmbH). Each whole
mount image was captured at x25 magnification. The area
covered with neovascular tubes was determined using Image
J software.
RNA isolation and reverse transcription‑quantitative poly‑
merase chain reaction (RT‑qPCR). Total RNA was extracted
4392 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018

Figure 2. RT‑qPCR analysis of relative intracorneal target gene expression levels in alkali‑injured control and alkali‑injured diabetic mice (STZ‑induced).
Ratios of (A) VEGF, (B) HIF‑1α, (C) SDF‑1α, (D) CCL2, (E) CCL3, (F) CXCL‑2, (G) TSP‑1, (H) MMP‑2 and (I) MMP‑9 to GAPDH of the alkali‑injured
control mice (black bars) and diabetic mice (grey bars) were determined by RT‑qPCR at the indicated time intervals after alkali injury. Values represent
mean ± standard error of the mean (n=5 animals). STZ, streptozocin; VEGF, vascular endothelial growth factor; CC, Chemokine (C‑C motif) ligand; HIF,
hypoxia inducible factor; SDF, stromal cell‑derived factor; CXCL, C‑X‑C motif chemokine ligand; TSP, Thrombospondin; MMP, matrix metalloproteinase;
GAPDH, glyceraldehyde 3‑phosphate dehydrogenase; RT‑qPCR, reverse transcription‑quantitative polymerase chain reaction.

from the corneas of BALB/c mice or choroids of C57BL/6
mice after alkali treatment on corneas or laser treatment
on choroids using an RNeasy Mini Kit (Qiagen GmbH).
The resultant RNA preparations were further treated with
RNase‑free DNase (Thermo Fisher Scientific, Inc.) to remove
genomic DNA. The PCR solution contained 2 µl cDNA, the
specific primer set (0.2 µM final concentration), and 12.5 µl
SYBR® Premix Ex Taq™ (SYBR® Premix Ex Taq™ Perfect
Real Time PCR Kit; Takara Bio Inc., Kusatsu, Japan) in a
final volume of 25 µl. The sequences of the PCR primer
pairs are listed in Table I. Quantitative PCR was performed
using an iCycler iQ™ Multi‑Color Real Time PCR Detection
System (170‑8740; Bio‑Rad Laboratories, Hercules, CA,
USA). The PCR parameters involved initial denaturation at
95˚C for 1 min, followed by 40 cycles of 95˚C for 5 sec and
60˚C for 30 sec. The relative gene expression levels were
calculated using the 2‑∆∆Cq method (20), where Ct represents
the threshold cycle, and GAPDH was used as a reference
gene.
Western blot analysis. Choroidal lysates were prepared from
samples of the C57BL/6 mice taken at the indicated time
interval after laser injury. Protein samples, quantified using
NanoDrop 2000 UV‑Vis Spectrophotometer (30 µg/each lane;
Thermo Fisher Scientific, Inc.) were dissolved in Laemmli
buffer (cat. no. 1610737; Bio‑Rad Laboratories, Inc., Hercules,
CA, USA), boiled for 3‑4  min, and centrifuged at 4˚C for
2 min at 20,000 x g to remove insoluble materials. A total
of 30 µg protein per lane was separated by SDS‑PAGE (12%)
and transferred to 0.2 µm nitrocellulose membranes. The
blocked membranes were probed overnight (4˚C) with goat
anti‑VEGF (1:200; sc‑152‑G; Santa Cruz Biotechnology,
Inc.), goat anti‑HIF‑1α (1:200; sc‑12542Y‑15; Santa Cruz
Biotechnology, Inc.), goat anti‑SDF‑1α (1:200; sc‑7427;
Santa Cruz Biotechnology, Inc.), goat anti‑CCL3 (1:1,000;
AB‑450‑NA; R&D Systems) or goat anti‑GAPDH antibodies
(1:200; sc‑48166; Santa Cruz Biotechnology). The membranes
were then incubated at RT for 1 h with a horseradish peroxi-
dase‑conjugated rabbit anti‑goat secondary antibody (1:5,000;
5160‑2504; R&D Systems), and immunoreactive bands were
visualized using ECL reagent (Advansta, Menlo Park, CA,
USA). The intensities of the protein bands were quantified and
normalized to GAPDH using Image J Software version 2.1.4.7
(National Institutes of Health, Bethesda, MD, USA).
Flow cytometry of intrachoroidally infiltrating progenitor
cells and macrophages. Mononuclear cells were isolated from
choroids of C57BL/6 mice according to a previously described
procedure, with some modifications (10,11). Briefly, at day 4
after the laser injury, choroids were removed, teased away
with scissors, and incubated at 37˚C for 30 min with constant
shaking in the presence of 0.5 mg/ml collagenase type D
 LIU et al: EFFECTS OF DIABETES ON OCULAR NEOVASCULARIZATION 4393

Figure 3. Effect of STZ‑induced diabetes on laser‑induced ChNV. (A) Representative fundus angiographic leakage of the laser‑injured diabetic and laser‑injured
control mice two weeks after laser injury. (B) Percentages of grade 2b lesions were statistically evaluated and analyzed by χ2 test. (C) Representative ChNVs
assessed by choroidal whole mount cluster of differentiation 31 staining of the laser‑injured control and laser‑injured diabetic mice. Original magnification,
x25 and x100. (D) ChNV areas were statistically evaluated and compared by Student's t‑test. Each value represents mean ± standard error of the mean (n=5
animals). *P<0.05 vs. laser‑injured control mice. STZ, streptozocin; ChNV, choroidal neovascularization.

(Roche Diagnostics, Mannheim, Germany). Cell suspen- Results

sions were then passed over a nylon filter with a pore size of
100 µm. The resultant cells were stained with FITC‑labeled rat
anti‑mouse F4/80 monoclonal antibody (1:10) or goat anti‑c‑Kit
antibody (1:100) at 4˚C for 25 min, then washed with PBS and
centrifuged at 1,500 x g at 4˚C for 5 min. Subsequently, cells
were further stained with PE‑conjugated rabbit anti‑goat IgG
monoclonal antibody (1:100) at 4˚C for 25 min, then washed
with PBS and centrifuged at 1,500 x g at 4˚C for 5 min. Samples
stained with non‑immunized goat IgG (Sigma‑Aldrich; Merck
KGaA) were used as the isotype control. Fluorescence intensi-
ties were determined using a Beckman Coulter Cytomics FC
500 flow cytometer (Beckman Coulter, Inc., Brea, CA, USA)
and the data were analyzed using FlowJo version 7.6.1 (FlowJo
LLC, Ashland, OR, USA).
Effects of diabetes on alkali‑induced CrNV. CrNV was
macroscopically evident in mice two weeks after the alkali
injury, which was consistent with the results of previous
studies (10‑13). Macroscopic inspection revealed that the
untreated corneas were avascular and that alkali injury mark-
edly increased the vascular areas in corneas two weeks after
injury (data not shown). However, immunofluorescent staining
analysis using anti‑CD31 antibodies demonstrated that there
was no statistical difference in the size of the CD31‑positive
area between the alkali‑injured normal and alkali‑injured
diabetic mice (P>0.05) (Fig. 1). These results indicated that
STZ‑induced diabetes has no significant effect on the develop-
ment of alkali‑induced CrNV.

Statistical analysis. All experimental data were expressed
as the mean ± standard error of the mean and analyzed with
statistical software SPSS version 18.0 (SPSS, Inc., Chicago,
IL, USA). All experiments were repeated at least three times.
Data of gene expression of intracorneal and intrachoroidal
angiogenic factors were statistically analyzed using one‑way
analysis of variance followed by the post hoc Tukey's test. Data
of CrNV areas, ChNV areas, protein expression of intracho-
roidal angiogenic factors and C‑Kit+ and F4/80+ cell numbers
were statistically analyzed using the unpaired Student's t‑test.
Count data for grade 2b lesions were compared using the χ2
test. P<0.05 was considered to indicate a statistically signifi-
cant difference.
Intracorneal angiogenic factor expression in STZ‑induced
diabetic mice after alkali injury. The balance between angio-
genic and anti‑angiogenic factors determines the occurrence
of angiogenic processes. Therefore, the mRNA expression
of angiogenic factors in corneas at days 2 and 4 after alkali
injury was determined (10,11). Alkali injury enhanced
the mRNA expression of various angiogenesis‑associated
factors, including VEGF, HIF‑1α, SDF‑1α, CCL2, CCL3, and
chemokine (C‑X‑C motif) ligand (CXCL) 2 (data not shown).
However, there were no statistically significant differences in
the intracorneal mRNA expression levels of these factors and
other factors, such as thrombospondin (TSP)‑1, matrix metal-
lopeptidase (MMP)‑2 or MMP‑9, between the alkali‑injured
4394 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018

Figure 4. Gene expression of intrachoroidal angiogenic factors. Ratios of (A) VEGF, (B) HIF‑1α, (C) SDF‑1α, (D) CCL‑2, (E) CCL3, (F) CXCL2, (G) TSP‑1,
(H) MMP‑2 and (I) MMP‑9 to GAPDH of the laser‑injured control mice (black bars) and laser‑injured diabetic mice (grey bars) were determined by reverse
transcription‑quantitative polymerase chain reaction at the indicated time intervals after laser injury. Each value represents mean ± standard error of the mean
(n=5 animals). *P<0.05 vs. laser‑injured control mice. VEGF, vascular endothelial growth factor; HIF, hypoxia inducible factor; SDF, stromal cell‑derived
factor; CC, Chemokine (C‑C motif) ligand; CXCL, C‑X‑C motif chemokine ligand; TSP, Thrombospondin; MMP, matrix metalloproteinase; GAPDH,
glyceraldehyde 3‑phosphate dehydrogenase.

diabetic and alkali‑injured control mice at days 2 and 4 after a significant decrease in ChNV size compared to with the
alkali injury (P>0.05; Fig. 2). laser‑injured control mice (P=0.031; Fig. 3D).

Diabetic mice exhibit impaired angiographic leakage from
ChNV lesions. Fluorescein angiography revealed that the
laser‑induced ChNV size was significantly decreased in the
laser‑injured diabetic mice compared with the laser‑injured
control mice. On day 14, significant pathological leakage
(grade 2b lesions) was observed in 37.5% of the lesions in the
laser‑injured control mice, but only 11.8% of the lesions in the
laser‑injured diabetic mice. The difference in the percentages
of grade 2b lesions between the laser‑injured diabetic and
laser‑injured control mice was statistically significant (χ2 test,
P=0.039; Fig. 3A and B).
Diabetic mice exhibit impaired laser‑induced ChNV. The
mean size of the laser‑induced ChNV, measured in flat
mounted choroids, was smaller in the eyes of the laser‑injured
diabetic mice on day 14 after laser application compared with
laser‑injured control mice (Fig. 3C). The size of the ChNV
was 53732.81±5755.5 µm 2 in the laser‑injured control mice
and 33883.89±5344.60 µm2 in the laser‑injured diabetic mice
(68.1% of control). The laser‑injured diabetic mice exhibited
Diabetic mice exhibit reduced intrachoroidal VEGF, HIF‑1α,
CCL3, and SDF‑1α expression after laser injury. In order to
identify the mechanism of STZ‑induced diabetes on impaired
laser‑induced ChNV, the intrachoroidal angiogenic cytokine
and chemokine expression levels in the laser‑injured diabetic
and laser‑injured control mice at days 2 and 4 after laser injury
were determined using RT‑qPCR. The results indicated that
the expression of VEGF, HIF‑1α, SDF‑1α and CCL3 were
markedly reduced in the choroids of the laser‑injured diabetic
mice when compared with the laser‑injured control mice at
day 4 following laser injury (P<0.05; Fig. 4). Consistently, the
protein expression levels of intrachoroidal VEGF, HIF‑1α,
SDF‑1α and CCL3 were also reduced in the laser‑injured
diabetic mice compared with the laser‑injured control mice at
day 4 (P<0.05; Fig. 5). These observations demonstrated that
diabetes downregulated angiogenic molecule expression and
then reduced laser‑induced ChNV.
Diabetic mice exhibit impaired progenitor cell infiltration in
wounded choroids following laser injury. In the present study,
 LIU et al: EFFECTS OF DIABETES ON OCULAR NEOVASCULARIZATION 4395

Figure 5. Protein expression levels of intrachoroidal angiogenic factors. Protein extracts were obtained and subjected to western blot analysis. (A) Representative
results from three independent experiments are shown here. Ratios of (B) VEGF, (C) HIF‑1α, (D) SDF‑1α and (E) CCL3 to GAPDH of the laser‑injured control
mice (open bars) and laser‑injured diabetic mice (grey bars) were determined by western blotting at day 4 after laser injury. Each value represents mean ± stan-
dard error of the mean (n=5 animals). *P<0.05 vs. laser‑injured control mice. VEGF, vascular endothelial growth factor; HIF, hypoxia inducible factor; SDF,
stromal cell‑derived factor; CC, Chemokine (C‑C motif) ligand; GAPDH, glyceraldehyde 3‑phosphate dehydrogenase.

flow cytometric analyses of intrachoroidally infiltrating cells
demonstrated that the levels of c‑Kit+ cell infiltration were
markedly reduced in the laser‑injured diabetic mice compared
with the laser‑injured control mice after laser injury (P<0.05;
Fig. 6). The levels of F4/80+ macrophage intrachoroidal infil-
tration were lower in the laser‑injured diabetic mice compared
with the laser‑injured control mice, but there was no statisti-
cally significant difference between the two groups (P>0.05;
Fig. 6). These observations indicated that diabetes reduced
laser‑induced infiltration of progenitor cells rather than macro-
phages.
Discussion
CrNV, which frequently leads to impaired vision, can result
from a number of causes, including corneal infections, misuse
of contact lenses, chemical burns and inflammation (7‑9).
AMD and DR are major causes of low vision and blindness
throughout the world. The influence of lifestyle, as well as
vitamin and antioxidant supplementation, in the development
and prevention of AMD is well known (21‑24). However, to
the best of our knowledge, the effects of diabetes in CrNV and
AMD remain unknown.
Diabetes can cause blood vessel and microvascular abnor-
malities, and multiple organ systemic complications in the
cardiovascular system, urinary system and eye lesions (25).
Complications leading to local tissue ischemia, hypoxia,
and microcirculatory disturbances are caused by a variety
of mechanisms, including polyol pathway metabolism (26),
abnormally activated protein kinase C pathways (27), increased
oxidative stress (28) and the accumulation of advanced glyca-
tion end‑products (AGEs) (29). In the wound‑healing process,
diabetes can inhibit angiogenesis and thus cause delayed
wound healing (30).
Alkali injury‑induced CrNV involves inflammatory
neovascularization caused by burn lesions. In the early phase
of alkali‑induced CrNV, neutrophils, macrophages, and
other inflammatory cells infiltrate the corneal stroma and
release large amounts of inflammatory cytokines. da Costa
Pinto and Malucelli (31) and Zagon et al (32) suggested that
STZ‑induced diabetic rats exhibit reduced alkali injury‑induced
CrNV compared to control rats, but failed to show a significant
difference in VEGF or bFGF expression between the two
groups. Waltenberger et al and Tchaikovski et al found that
monocytes obtained from diabetic patients exhibit decreased
VEGF‑A‑induced chemotaxis in vitro, and proposed the puta-
tive concept of ‘VEGF resistance’, involving VEGF‑A/VEGF
receptor‑1‑mediated chemotaxis in monocytes from patients
with diabetes (33,34).
In the present study, a statistically significant difference in
the CrNV between alkali‑injured diabetic and alkali‑injured
control mice was not identified. There are several observations
supporting our conclusion. First, diabetic animals are usually
used in the study of limb ischemia or the skin wound‑healing
process. It is accepted that diabetes can affect wound healing by
inhibiting angiogenesis. However, in corneas, the micro‑envi-
ronment is immune specific, which may cause different
effects of diabetes on angiogenesis. Second, rats are widely
used as STZ‑induced diabetic animals, while in the present
study, BALB/c mice were used. There is a different response
of CrNV development to circulatory high‑glucose stimulation
between different species. Third, diabetic complications can
be divided into acute and chronic pathologies. The majority of
diabetic vascular anomalies occur gradually. AGEs may occur
through a chronic pathological process. There is the possibility
that a different effect on CrNV may gradually appear with
a long duration of diabetes. The results of the present study
suggested that in the early stages of the disease, diabetes has
4396 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018

Figure 6. C‑Kit+ and F4/80+ cell numbers in choroid following laser photocoagulation. (A) Open heavy‑lined histogram indicates the value from the laser‑injured
control mice and filled histogram indicates the value from the laser‑injured diabetic mice. Representative results from three independent experiments are
shown. (B) C‑Kit+ (left plot) and F4/80+ (right plot) cell numbers were statistically determined. Each value represents the mean ± standard error of the mean
(n=5 animals). *P<0.05 vs. laser‑injured control mice.

no significant effect on alkali injury‑induced CrNV, as the
blood glucose of the mice had already reached the diabetic
level.
The neovascular form of AMD, ChNV, occurs in at least
0.6‑0.7% of the population (35). Trauma, traction, degenera-
tion, and inflammatory invasion destroy the normal structures
of Bruch's membrane, leading to exposure of retinal pigmented
epithelial cells, choroidal capillary endothelial cells, pericytes,
and inflammatory cells to proinflammatory conditions, and
thereby inducing the occurrence of ChNV. In this process,
VEGF and platelet‑derived growth factor (PDGF) are major
contributing factors (36). ChNV maintenance depends on the
balance of angiogenic and anti‑angiogenic factors such as
PEDF, angiostatin, and endostatin. RPE may secrete VEGF,
monocyte chemoattractant protein 1, and IL‑8, as well as other
cytokines, in order to regulate monocyte and endothelial cell
migration during ChNV formation (37‑41).
Wound healing under hypoxic conditions induces increased
expression of HIF‑1α and promotes VEGF secretion. The
infiltration of SDF‑1α/CXCR4‑mediated bone marrow‑derived
endothelial progenitor cells (BM EPC) into the wounded area
can promote wound healing. It has been reported that diabetes
caused by high blood glucose can inhibit BM EPC mobilization
by reducing the SDF‑1α/CXCR4 signal (42). Gallagher et al (43)
demonstrated that high glucose can block eNOS activation
and reduce SDF‑1α expression, thereby causing reduced BM
EPC mobilization and delayed wound healing (43). During
laser‑induced ChNV, a wound‑healing process occurs after
laser coagulation. Thus, it is logical that STZ‑induced diabetic
mice have impaired wound healing following laser injury.
The present study demonstrated that laser‑induced ChNV
was markedly reduced in the laser‑injured diabetic mice
compared with the laser‑injured control mice. In order to
eliminate the differences attributable to different experimental
species, laser induced‑ChNV was also detected in laser‑injured
diabetic (STZ‑induced) BN (Brown Norway) rats and
laser‑injured control BN rats, and a similar result was obtained
(data not shown). The data suggested that diabetes had a nega-
tive effect on ChNV development. Intrachoroidal angiogenic
factor expression after laser injury was also examined and it
was revealed that the enhancement of VEGF, HIF‑1α, CCL3,
and SDF‑1α expression levels was impaired in the laser‑injured
diabetic mice compared with the laser‑injured control mice.
Jiraritthamrong et al (44) and Cao et al (45) found that high
glucose conditions suppressed the in vitro vessel‑forming
capacity of endothelial progenitor cells. Notably, the authors
previously reported that c‑Kit+ progenitor cells and F4/80+
macrophages infiltrate the injured corneas, reaching their peak
levels two to four days after alkali injury during experimental
CrNV in wild type mice (10,11). In the present study, c‑Kit+
cell intrachoroidal infiltration was significantly impaired in
the laser‑injured diabetic mice. Thus, diabetes downregulated
 LIU et al: EFFECTS OF DIABETES ON OCULAR NEOVASCULARIZATION
ChNV, at least in part, through impaired c‑Kit+ progenitor
endothelial cell infiltration and vessel formation. The results
of the present study provide novel evidence that experimental
ChNV development is associated with diabetes.
There are conflicting reports regarding the association
between diabetes and AMD. Klein et al (46) and Song et al (47)
found that the association between diabetes and early AMD
or dry AMD was not obvious. However, an AMD prevalence
survey of Korean participants over the age of 50 years revealed
that in diabetic patients, the probability of early AMD is higher
than that in the nondiabetic population (48). Another study of
a European population suggested that there is a positive asso-
ciation of DM with neovascular AMD (49). As the incidence
rates of both diabetic disease and AMD increase with age,
whether diabetes and AMD have pathological connections
requires further investigation. Moreover, the acute wound
healing process after laser injury during experimental ChNV
probably differs from that occurring naturally in the human
AMD process. If this is correct, it is important to note the
limitation of laser‑induced experimental ChNV for use as an
animal model of AMD.
In conclusion, the results of the present study demonstrated
that diabetes is involved in the process of neovascularization
in experimental laser‑induced ChNV model. It was revealed
that diabetes reduced ChNV. Furthermore, the pro‑angiogenic
factors VEGF‑A, HIF‑1α, SDF‑1α and CCL3 were reduced in
the laser‑injured diabetic mice compared with the laser‑injured
control mice; the level of intrachoroidal c‑Kit+ progenitor cell
infiltration was decreased in the laser‑injured diabetic mice
compared with the laser‑injured control mice. Taken together,
these findings suggested that diabetes reduced ChNV through
downregulation of intrachoroidal progenitor cell infiltration
and angiogenic factor expression.
Acknowledgements
Not applicable.
Funding
The present study was supported by the National Natural
Science Foundation in China (grant nos. 81671641, 81200727,
31600736), Suzhou Municipal Natural Science Foundation
(grant no. SYS201745), Jiangsu Provincial Medical Youth
Talent (grant no. QNRC2016718), Jiangsu Provincial Medical
Innovation Team (grant no. CXTDA2017039), Jiangsu
Provincial Natural Science Foundation (grant no. BK20151208)
and the Soochow Scholar Project of Soochow University
(grant no. R5122001).
Availability of data and materials
All data generated or analyzed during this study are included
in this published article.
Authors' contributions
GL and HW designed the study, led the experiments, prepared
figures and wrote the manuscript. LC, QC and ZC analyzed the
data and prepared the figures. XZ conceived and designed the
4397
study as well as drafted the manuscript. PL conceived, designed
and coordinated the study as well as drafted the manuscript. All
authors read and approved the final manuscript.
Ethics approval and consent to participate
All animal experiments followed the Guideline for the Care and
Use of Laboratory Animals of the Chinese Medical Academy
and were approved by the Soochow University Animal Care
Committee (Suzhou, China), and were performed in accor-
dance with the ARVO Statement for the Use of Animals in
Ophthalmic and Vision Research.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
 1. Wild S, Roglic G, Green A, Sicree R and King H: Global preva-
lence of diabetes: Estimates for 2000 and projections for 2030.
Diabetes Care 27: 1047‑1053, 2004.
 2. Smith SC, Lamping DL and Maclaine GD: Measuring
health‑related quality of life in diabetic peripheral neuropathy:
A systematic review. Diabetes Res Clin Pract 96: 261‑270, 2012.
 3. Laiteerapong N, Karter AJ, Liu JY, Moffet HH, Sudore R,
Schillinger D, John PM and Huang ES: Correlates of quality of
life in older adults with diabetes: The diabetes & aging study.
Diabetes Care 34: 1749‑1753, 2011.
 4. Keymel S, Heinen Y, Balzer J, Rassaf T, Kelm M, Lauer T and
Heiss C: Characterization of macro‑and microvascular func-
tion and structure in patients with type 2 diabetes mellitus. Am
J Cardiovasc Dis 1: 68‑75, 2011.
 5. Leiva A, Pardo F, Ramírez MA, Farías M, Casanello P and
Sobrevia L: Fetoplacental vascular endothelial dysfunction as an
early phenomenon in the programming of human adult diseases
in subjects born from gestational diabetes mellitus or obesity in
pregnancy. Exp Diabetes Res 2011: 349286, 2011.
 6. Ambati BK, Nozaki M, Singh N, Takeda A, Jani PD, Suthar T,
Albuquerque RJ, Richter E, Sakurai E, Newcomb MT, et al:
Corneal avascularity is due to soluble VEGF receptor‑1.
Nature 443: 993‑997, 2006.
 7. Cursiefen C, Masli S, Ng TF, Dana MR, Bornstein P, Lawler J
and Streilein JW: Roles of thrombospondin‑1 and ‑2 in regulating
corneal and iris angiogenesis. Invest Ophthalmol Vis Sci 45:
1117‑1124, 2004.
 8. Gao G and Ma J: Tipping the balance for angiogenic disorders.
Drug Discov Today 7: 171‑172, 2002.
 9. Zhang SX and Ma JX: Ocular neovascularization: Implication
of endogenous angiogenic inhibitors and potential therapy. Prog
Retin Eye Res 26: 1‑37, 2007.
10. Lu P, Li L, Kuno K, Wu Y, Baba T, Li YY, Zhang X and Mukaida N:
Protective roles of the fractalkine/CX3CL1‑CX3CR1 interac-
tions in alkali‑induced corneal neovascularization through
enhanced antiangiogenic factor expression. J Immunol 108:
4283‑4291, 2008.
11. Liu G, Lu P, Li L, Jin H, He X, Mukaida N and Zhang X:
Critical role of SDF‑1α‑induced progenitor cell recruitment
and macrophage VEGF production in the experimental corneal
neovascularization. Mol Vis 18: 2128‑2137, 2011.
12. Lu P, Li L, Liu G, van Rooijen N, Mukaida N and Zhang X:
Opposite roles of CCR2 and CX3CR1 macrophages in
alkali‑induced corneal neovascularization. Cornea 28: 562‑569,
2009.
13. Lu P, Li L, Liu G, Zhang X and Mukaida N: Enhanced
experimental corneal neovascularization along with aberrant
angiogenic factor expression in the absence of IL‑1 receptor
antagonist. Invest Ophthalmol Vis Sci 50: 4761‑4768, 2009.
4398 MOLECULAR MEDICINE REPORTS 18: 4388-4398, 2018
14. Hoerster R, Muether PS, Vierkotten S, Schröder S, Kirchhof B and
Fauser S: In‑vivo and ex‑vivo characterization of laser‑induced
choroidal neovascularization variability in mice. Graefes Arch
Clin Exp Ophthalmol 250: 1579‑1586, 2012.
15. Fujimura S, Takahashi H, Yuda K, Ueta T, Iriyama A, Inoue T,
Kaburaki T, Tamaki Y, Matsushima K and Yanagi Y: Angiostatic
effect of CXCR3 expressed on choroidal neovascularization.
Invest Ophthalmol Vis Sci 53: 1999‑2006, 2012.
16. Badr G, Badr BM, Mahmoud MH, Mohany M, Rabah DM and
Garraud O: Treatment of diabetic mice with undenatured whey
protein accelerates the wound healing process by enhancing
the expression of MIP‑1α, MIP‑2, KC, CX3CL1 and TGF‑β in
wounded tissue. BMC Immunol 13: 32, 2012.
17. Towner RA, Smith N, Saunders D, Henderson M, Downum K,
Lupu F, Silasi‑Mansat R, Ramirez DC, Gomez‑Mejiba SE,
Bonini MG, et al: In vivo imaging of immuno‑spin trapped radi-
cals with molecular magnetic resonance imaging in a diabetic
mouse model. Diabetes 61: 2405‑2413, 2012.
18. Yang Y, Mao D, Chen X, Zhao L, Tian Q, Liu C and Zhou BL:
Decrease in retinal neuronal cells in streptozotocin‑induced
diabetic mice. Mol Vis 18: 1411‑1420, 2012.
19. Semkova I, Fauser S, Lappas A, Smyth N, Kociok N, Kirchhof B,
Paulsson M, Poulaki V and Joussen AM: Overexpression of FasL
in retinal pigment epithelial cells reduces choroidal neovascular-
ization. FASEB J 20: 1689‑1691, 2006.
20. Livak KJ and Schmittgen TD: Analysis of relative gene expres-
sion data using real‑time quantitative PCR and the 2(‑Delta Delta
C(T)) method. Methods 25: 402‑408, 2001.
21. Evans JR and Lawrenson JG: Antioxidant vitamin and mineral
supplements for slowing the progression of age‑related macular
degeneration. Cochrane Database Syst Rev 7: CD000254, 2017.
22. Cheung LK and Eaton A: Age‑related macular degeneration.
Pharmacotherapy 33: 838‑855, 2013.
23. Sin HP, Liu DT and Lam DS: Lifestyle modification, nutritional
and vitamins supplements for age‑related macular degeneration.
Acta Ophthalmol 91: 6‑11, 2013.
24. McCusker MM, Durrani K, Payette MJ and Suchecki J: An eye
on nutrition: The role of vitamins, essential fatty acids, and anti-
oxidants in age‑related macular degeneration, dry eye syndrome,
and cataract. Clin Dermatol 34: 276‑285, 2016.
25. Stevens RJ, Coleman RL, Adler AI, Stratton IM, Matthews DR
and Holman RR: Risk factors for myocardial infarction case
fatality and stroke case fatality in type 2 diabetes: UKPDS 66.
Diabetes Care 27: 201‑207, 2004.
26. Chung SS, Ho EC, Lam KS and Chung SK: Contribution of
polyol pathway to diabetes‑induced oxidative stress. J Am Soc
Nephrol 14 (8 Suppl 3): S233‑S236, 2003.
27. Lee TS, Saltsman KA, Ohashi H and King GL: Activation of
protein kinase C by elevation of glucose concentration: Proposal
for a mechanism in the development of diabetic vascular compli-
cations. Proc Natl Acad Sci USA 86: 5141‑5145, 1989.
28. Giacco F and Brownlee M: Oxidative stress and diabetic compli-
cations. Circ Res 107: 1058‑1070, 2010.
29. Schmidt AM, Yan SD, Wautier JL and Stern D: Activation of
receptor for advanced glycation end products: A mechanism
for chronic vascular dysfunction in diabetic vasculopathy and
atherosclerosis. Circ Res 84: 489‑497, 1999.
30. Kolluru GK, Bir SC and Kevil CG: Endothelial dysfunction
and diabetes: Effects on angiogenesis, vascular remodeling, and
wound healing. Int J Vasc Med 2012: 918267, 2012.
31. da Costa Pinto FA and Malucelli BE: Inflammatory infiltrate,
VEGF and FGF‑2 contents during corneal angiogenesis in
STZ‑diabetic rats. Angiogenesis 5: 67‑74, 2002.
32. Zagon IS, Klocek MS, Griffith JW, Sassani JW, Komáromy AM
and McLaughlin PJ: Prevention of exuberant granulation tissue
and neovascularization in the rat cornea by naltrexone. Arch
Ophthalmol 126: 501‑506, 2008.
33. Waltenberger J, Lange J and Kranz A: Vascular endothelial
growth factor‑A‑induced chemotaxis of monocytes is attenu-
ated in patients with diabetes mellitus: A potential predictor for
the individual capacity to develop collaterals. Circulation 102:
185‑190, 2000.
34. Tchaikovski V, Olieslagers S, Böhmer FD and Waltenberger J:
Diabetes mellitus activates signal transduction pathways
resulting in vascular endothelial growth factor resistance of
human monocytes. Circulation 120: 150‑159, 2009.
35. Grossniklaus HE, Ling JX, Wallace TM, Dithmar S, Lawson DH,
Cohen C, Elner VM, Elner SG and Sternberg P Jr: Macrophage
and retinal pigment epithelium expression of angiogenic cyto-
kines in choroidal neovascularization. Mol Vis 8: 119‑126, 2002.
36. Greenberg JI, Shields DJ, Barillas SG, Acevedo LM, Murphy E,
Huang J, Scheppke L, Stockmann C, Johnson RS, Angle N and
Cheresh DA: A role for VEGF as a negative regulator of peri-
cytes function and vessel maturation. Nature 456: 809‑813, 2008.
37. Elner VM, Strieter RM, Elner SG, Baggiolini M, Lindley I and
Kunkel SL: Neutrophil chemotactic factor (IL‑8) gene expres-
sion by cytokine‑treated retinal pigment epithelial cells. Am J
Pathol 136: 745‑750, 1990.
38. Losso JN, Truax RE and Richard G: Trans‑resveratrol inhibits
hyperglycemia‑induced inflammation and connexin downregu-
lation in retinal pigment epithelial cells. J Agric Food Chem 58:
8246‑8252, 2010.
39. Yuan Z, Feng W, Hong J, Zheng Q, Shuai J and Ge Y: p38MAPK
and ERK promote nitric oxide production in cultured human
retinal pigmented epithelial cells induced by high concentration
glucose. Nitric Oxide 20: 9‑15, 2009.
40. Bento CF, Fernandes R, Matafome P, Sena C, Seiça R and
Pereira P: Methylglyoxal‑induced imbalance in the ratio of
vascular endothelial growth factor to angiopoietin 2 secreted by
retinal pigment epithelial cells leads to endothelial dysfunction.
Exp Physiol 95: 955‑970, 2010.
41. Villarroel M, García‑Ramírez M, Corraliza L, Hernández C and
Simó R: High glucose concentration leads to differential expres-
sion of tight junction proteins in human retinal pigment epithelial
cells. Endocrinol Nutr 56: 53‑58, 2009.
42. Tepper OM, Carr J, Allen RJ Jr, Chang CC, Lin CD, Tanaka R,
Gupta SM, Levine JP, Saadeh PB and Warren SM: Decreased
circulating progenitor cell number and failed mechanisms of
stromal cell‑derived factor‑1alpha mediated bone marrow mobi-
lization impair diabetic tissue repair. Diabetes 59: 1974‑1983,
2010.
43. Gallagher KA, Liu ZJ, Xiao M, Chen H, Goldstein LJ, Buerk DG,
Nedeau A, Thom SR and Velazquez OC: Diabetic impairments
in NO‑mediated endothelial progenitor cell mobilization and
homing are reversed by hyperoxia and SDF‑1 alpha. J Clin
Invest 117: 1249‑1259, 2007.
44. Jiraritthamrong C, Kheolamai P, U‑Pratya Y, Chayosumrit M,
Supokawej A, Manochantr S, Tantrawatpan C, Sritanaudomchai H
and Issaragrisil S: In vitro vessel‑forming capacity of endothelial
progenitor cells in high glucose conditions. Ann Hematol 91:
311‑320, 2012.
45. Cao C, Zhang H, Gong L, He Y and Zhang N: High glucose
conditions suppress the function of bone marrow‑derived endo-
thelial progenitor cells via inhibition of the eNOS‑caveolin‑1
complex. Mol Med Report 5: 341‑346, 2012.
46. Klein R, Klein BE and Moss SE: Diabetes, hyperglycemia,
and age‑related maculopathy. The beaver Dam Eye study.
Ophthalmology 99: 1527‑1534, 1992.
47. Song SJ, Youm DJ, Chang Y and Yu HG: Age‑related macular
degeneration in a screened South Korean population: Prevalence,
risk factors, and subtypes. Ophthalmic Epidemiol 16: 304‑310, 2009.
48. Choi JK, Lym YL, Moon JW, Shin HJ and Cho B: Diabetes
mellitus and early age‑related macular degeneration. Arch
Ophthalmol 129: 196‑199, 2011.
49. Topouzis F, Anastasopoulos E, Augood C, Bentham GC,
Chakravarthy U, de Jong PT, Rahu M, Seland J, Soubrane G,
Tomazzoli L, et al: Association of diabetes with age‑related
macular degeneration in the EUREYE study. Br J Ophthalmol 93:
1037‑1041, 2009.
This work is licensed under a Creative Commons
Attribution-NonCommercial-NoDerivatives 4.0
International (CC BY-NC-ND 4.0) License.
 Mishra et al. Nutrition and Diabetes (2018)8:57
DOI 10.1038/s41387-018-0065-6 Nutrition & Diabetes

BRIEF COMMUNICATION Open Access

Wdr13 and streptozotocin-induced

diabetes
Arun Prakash Mishra1,2, Komala Yedella1, Jyothi B. Lakshmi1 and Archana B. Siva1

Abstract
Type I diabetes, though contributes to only 5–10% of total diabetes cases, is a rising concern in today’s world. Our
previous studies have shown that the absence of WDR13 in mouse results in pancreatic β-cell hyper-proliferation. Also,
amelioration of the diabetic phenotype on introgression of Wdr13-null (Wdr13-/0) mutation in genetically diabetic mice
(Leprdb/db) [type II diabetes] was observed. It was thus, interesting to see the role of WDR13 in streptozotocin-mediated
diabetes in mice, a model for type I diabetes. Wdr13-/0 mice along with its wild type (Wdr13+/0 mice) littermates were
administered streptozotocin intraperitoneally for 5 consecutive days. Blood glucose levels and body weights of these
mice were monitored for subsequent 5 weeks and then they were sacrificed for physiological and histological
analyses. Results showed that Wdr13-/0 mice exhibited higher serum insulin levels, better glucose clearance and
significantly higher number of proliferating β-cells; reiterating the finding that absence of WDR13 helps in β-cell hyper-
proliferation and recovery from diabetes; further underscoring WDR13 as a key target molecule for diabetes treatment/
amelioration.
1234567890():,;
1234567890():,;
1234567890():,;
1234567890():,;

Introduction administration have been used to induce diabetes. High

Type I diabetes, though contributes only to 5–10% of
total diabetes incidence, is a rising concern for the juve-
niles and leads to severe consequences1. It is different
from type II diabetes as the presence of autoantibodies,
insulin dependence and insulitis are seen2. Susceptibility
towards type I diabetes is considered to be inherited and
the HLA locus alone is considered responsible for more
than 50% of genetic predisposition for the same1. Next is
the exposure to environmental triggers which alters
immune system and initiates β-cell destruction. Type I
diabetes has been extensively studied in mouse models3
and many studies have shown pancreatic regeneration
ability after destruction4–7.
Streptozotocin (denoted as STZ from now on) admin-
istration is a readily used method to induce diabetes in
rodent models and study pancreatic regeneration therein.
Both multiple low-dose STZ (30–50 mg/kg body weight)4
and a single high dose STZ (100–200 mg/kg body weight)7
Correspondence: Arun Prakash Mishra (apmccmb@gmail.com)
1
CSIR-Centre for Cellular and Molecular Biology, Hyderabad 500007, India
2
National Cancer Institute, NIH, Frederick, MD 21702, USA
dose STZ induces necrosis and multiple low-dose causes
apoptosis in β-cell lines8. Multiple low-dose STZ mimics
type I diabetes or Insulin-Dependent Diabetes Mellitus
(IDDM)9. β-cells take up STZ via glucose transporter
GLUT210 and this STZ then causes β-cell destruction via
alkylation of DNA11.
WDR13, a protein from WD repeat protein family, was
observed to be abundant in pancreas, liver, testes, and
ovary12. Wdr13-/0 mice exhibit higher pancreatic islet
mass and hyperinsulinemia. Absence of this protein in a
type II diabetes mouse model (Leprdb/db) ameliorated the
diabetic phenotype by increasing β-cell proliferation,
resulting in higher circulating insulin6. In the light of
above data it was interesting to study the role of WDR13
in β-cell proliferation in the type I diabetes mice model,
for which we used multiple low-doses STZ-treatment to
Wdr13-/0 mice and their wild type littermates (Wdr13+/0).
We found that the Wdr13-/0 mice demonstrated better
recovery from hyperglycaemia second week onwards, had
better insulin levels and gained more body weight than
the Wdr13+/0 mice.

© The Author(s) 2018

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction
in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if
changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If
material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain
permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Nutrition and Diabetes

Mishra et al. Nutrition and Diabetes (2018)8:57
Materials and methods
Animals and treatment
Mice were maintained under the guidelines of Institu-
tional Animal Ethics Committee (IAEC) of CSIR-CCMB
(Animal trial registration number-20/1999/CPCSEA
dated 10/3/99). Male C57Bl/6J mice lacking WDR13
(Wdr13-/0) with their wild type littermates (Wdr13+/0)
[8–10 weeks of age] were used randomly. Mice were fed
on standard diet ad libitum.
Streptozotocin [Sigma, S0130] was injected intraper-
itoneally (dissolved in 100 mM Na-Citrate Buffer pH 4.5,
50 mg/kg body weight) in mice for 5 consecutive days.
Control animals were injected with vehicle (Na-Citrate
Buffer) in a similar manner. n = 3 for vehicle treated
animals and n = 8 for STZ treated animals. Mice were
sacrificed after 6 weeks (5 weeks after the last injection),
with weekly observation of their blood glucose and body
weight.
Glucose tolerance tests (GTT)
GTT was done after 5 weeks of STZ treatment. Two
different cohorts of mice were used viz—3 mice per
group for control and 8 mice per group for STZ treat-
ment, all the animals used were littermates and of
8–10 weeks of age. After 16 h of fasting, mice were
injected intraperitoneally with D-glucose (1.5 g/kg
body weight). Blood was sampled from mouse tail
and glucose levels were analysed at every 30 min for 2
hours using Accu-Chek Active Glucometer (model
number: HM100005).
Histology
Pancreata were carefully excised off the sacrificed mice,
fixed in 4% paraformaldehyde and embedded in paraffin
wax. Four micrometer sections of the same were mounted
on positively charged slides (Fischer scientific). Tissue
histology was observed using hematoxylin-eosin staining.
Islet areas were measured in pancreatic sections (three
frames per section) from five different animals using
Axiovision software. To study the proliferation of β-cells,
immunostaining of Ki-67 (Millipore- AB9260) was per-
formed. All immunostaining was performed according to
manufacturer’s guidelines (BD Biosciences DAB substrate
kit Cat.-550880). Antibody positive cells were counted
manually (three frames per section) from five different
animals.
Serum collection and insulin analysis
500μl of blood drawn from the mice orbital sinus was
left to clot (room temperature) for 2 hours on ice.
This was then centrifuged at 10,000×g for 10 min
and the serum was collected. ELISA kit (Millipore-
EZMRI-13K) was used for analyzing serum insulin
levels.
Nutrition and Diabetes
Page 2 of 5
Statistical analyses
Data are represented as mean ± SEM. We used unpaired
Student’s t-test on all the data. *p < 0.05, **p < 0.01, ***p <
0.001. All studies were done without blinding. No var-
iance analyses were done.
Results and discussion
Multiple low-dose STZ attacks the pancreatic β-cells, by
entering into them via GLUT2 transporter and alkylating
their DNA10. Alkylation of DNA induces apoptosis
therein and a secondary trail of incidences take place via
interleukins and IFNγ. This causes severe insulitis,
resulting in hyperglycaemia13. However, pancreatic β-cells
have an ability to recover from this destruction4,5,7. In the
present study we observed a better recovery from diabetes
in Wdr13-/0 mice as compared to Wdr13+/0 mice after
multiple low-dose STZ administration. Weekly blood
glucose monitoring displayed lower blood glucose levels
in Wdr13-/0 mice from second week onwards, as com-
pared to Wdr13+/0 mice (Fig. 1a), during the diabetes
progression time of 5 weeks.
It is well known that there is a considerable amount of
weight loss in diabetic condition14,15. This was observed
in the Wdr13+/0 mice after multiple low-dose STZ
administration. In contrast, the Wdr13-/0 mice performed
better in maintaining their body weight (Fig. 1b) till the
end of the experiment, indicating better recovery and a
better health status in these animals, as compared to STZ
treated Wdr13+/0 mice.
The STZ-treated Wdr13-/0 mice exhibited significantly
better glucose clearance (GTT) as compared to the
Wdr13+/0 mice on similar treatment (Fig. 1d). GTT
conducted on vehicle administered mice showed similar
rate of glucose clearance in the Wdr13-/0 and Wdr13+/0
mice (Fig. 1c). The STZ administered Wdr13-/0 mice also
had significantly lower fasting blood glucose levels at the
end of the experiment (Fig. 1e), with significantly higher
serum insulin levels as compared to the Wdr13+/0 mice
(Fig. 1f) revealing a better glucose homoeostasis.
Hematoxylin-eosin staining of the pancreas showed a
significant decrease in average islet size in both the groups
of mice after STZ treatment; as compared to the vehicle
treated animals (Fig. 2a, b). To test whether β-cell pro-
liferation contributed to the restoration of β-cell function,
Ki-67 (cell proliferation marker) immunostaining of
pancreas was carried out. The results revealed more
number of dividing pancreatic islet cells in STZ treated
Wdr13-/0 mice as compared to that in Wdr13+/0 mice
(Fig. 2a, c), confirming higher β-cell proliferation.
Pancreatic regeneration in adults is still being under-
stood and is mainly attributed to replication of differ-
entiated β-cells and/or neogenesis of β-cells from
precursor cells16. However, there are important differ-
ences in the balance of these two pathways that depend
Mishra et al. Nutrition and Diabetes (2018)8:57 Page 3 of 5

Fig. 1 a Weekly blood glucose levels of vehicle and STZ treated Wdr13+/0 and Wdr13-/0 mice. b Gain in body weight of animals treated with vehicle
and STZ. c Glucose tolerance test of vehicle treated animals. d Glucose tolerance test of STZ treated animals. e Fasting glucose levels of vehicle and
STZ treated animals. f Serum insulin levels of vehicle and STZ treated Wdr13+/0 and Wdr13-/0 mice at the end of the experiment. n = 3 for vehicle
treated animals, n = 8 for STZ treated animals. *p < 0.05, ***p < 0.001

upon species and age. Eventually one or both of these
pathways may be manipulated for therapeutic treatment
of diabetes. With regards to WDR13, we have enough
evidence from this study and previous studies6,17 that
WDR13 has a role to play in the replication of
differentiated β-cells. Its role, however, in the neogenesis
process has not been unequivocally addressed. One study
carried out with a single high dose STZ administra-
tion (150 mg/kg body weight, dose meant to destroy all
existing adult β-cells), revealed severe necrosis in the

Nutrition and Diabetes

Mishra et al. Nutrition and Diabetes (2018)8:57
Fig. 2 a Histological analyses of pancreatic sections by hematoxylin-eoisin (H&E) staining, immunostaining with Ki-67 . b Average islet area of vehicle
and STZ treated Wdr13+/0 and Wdr13-/0 mice, determined by Axioskop software. c Percentage Ki-67 positive cells in STZ treated Wdr13+/0 and Wdr13-/
0
mice. *p < 0.05, **p < 0.01, ***p < 0.001.
pancreatic islets of both the Wdr13+/0 and Wdr13-/0 mice
and thus no recovery from diabetes, in terms of blood
glucose or gain in body weight was seen, during the
observation period of 30 days (Supplementary Fig. 1);
suggesting a less likely role of WDR13 in the neogenesis
process, even though the data available is rather
preliminary.
In the previous study6, we showed amelioration of dia-
betic phenotype in absence of WDR13 in a genetically
diabetic background, which makes it a type II diabetes
model and in the present study it is evident that absence
of WDR13 plays a protective role in type I diabetes mouse
model too. We demonstrate that β-cell destruction caused
due to STZ is recovered rapidly in the Wdr13-/0 mice as
compared to Wdr13+/0 mice. Unlike the previous stu-
dies6,17 which showed β-cell hyper-proliferation in
Nutrition and Diabetes
Page 4 of 5
Wdr13-/0 mice only after 6 months of age6,17, here we see
that happening in 2–3 months old animals after STZ
insult, revealing that absence of WDR13 per se confers a
proliferative advantage to β-cells, which advances the
onset of phenotype in stress conditions like age, obesity,
genetic background, STZ (this study), etc. To summarize,
the present study reiterates that absence of WDR13 has a
favourable effect on pancreatic β-cell proliferation and
is likley to be a potential drug target in diabetes treatment.
Acknowledgements
We acknowledge Avinash T. Raj for preparing histological sections. The work
was carried out in Dr Satish Kumar’s lab. Funding: No separate funding was
available for this study
Conflict of interest
The authors declare that they have no conflict of interest.
Mishra et al. Nutrition and Diabetes (2018)8:57
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations.
Supplementary Information accompanies this paper at (https://doi.org/
10.1038/s41387-018-0065-6).
Received: 5 June 2018 Revised: 7 September 2018 Accepted: 19 September
2018
References
1. Daneman, D. Type 1 diabetes. Lancet 367, 847–858 (2006).
2. Von Herrath, M., Sanda, S. & Herold, K. Type 1 diabetes as a relapsing-remitting
disease? Nat. Rev. Immunol. 7, 988–994 (2007).
3. Van Belle, T. L. & von Herrath, M. G. Mouse models of type1 diabetes. Drug
Discov. Today Dis. Model. 6, 41–45 (2009).
4. Chen, Y. C., Colvin, E. S., Griffin, K. E., Maier, B. F. & Fueger, P. T. Mig6 hap-
loinsufficiency protects mice against streptozotocin-induced diabetes. Diabe-
tologia 57, 2066–2075 (2014).
5. Cheng, Y. et al. Beta-cell regeneration from vimentin+/MafB+ cells after STZ-
induced extreme beta-cell ablation. Sci. Rep. 5, 11703 (2015).
6. Singh, V. P. et al. Genetic deletion of Wdr13 improves the metabolic phe-
notype of Lepr db/db mice by modulating AP1 and PPARγ target genes.
Diabetologia 58, 384–392 (2015).
7. Song, B., Scheuner, D., Ron, D., Pennathur, S. & Kaufman, R. J. Chop
deletion reduces oxidative stress, improves β cell function, and promotes cell
Nutrition and Diabetes
Page 5 of 5
survival in multiple mouse models of diabetes. J. Clin. Invest. 118, 3378–3389
(2008).
8. Saini, K. S., Thompson, C., Winterford, C. M., Walker, N. I. & Cameron, D. P.
Streptozotocin at low doses induces apoptosis and at high doses causes
necrosis in a murine pancreatic beta cell line, INS-1. Biochem Mol. Biol. Int. 39,
1229–1236 (1996).
9. Lukic, M., Stosic-Grujicic, S. & Shahin, A. Effector mechanisms in low-dose
streptozotocin-induced diabetes. Dev Immunol. 6,119–128 (1998).
10. Szkudelski, T. The mechanism of alloxan and streptozotocin action in B cells of
the rat pancreas. Physiol. Res. 50, 537–546 (2001).
11. Delaney, C. A. et al. Comparison of inhibition of glucose-stimulated insulin
secretion in rat islets of Langerhans by Streptozotocin and methyl and ethyl
nitrosoureas and methanesulphonates: lack of correlation with nitric
oxide-releasing or O6-alkylating ability. Biochem. Pharmacol. 50, 2015–2020
(1995).
12. Singh, B. N. et al. A highly conserved human gene encoding a novel member
of WD-repeat family of proteins (WDR13). Genomics 81, 315–328 (2003).
13. Lukić, M. L., Stosić-Grujicić, S. & Shahin, a Effector mechanisms in low-dose
streptozotocin-induced diabetes. Dev. Immunol. 6, 119–128 (1998).
14. Dekel, Y., Glucksam, Y., Elron-Gross, I. & Margalit, R. Insights into modeling
streptozotocin-induced diabetes in ICR mice. Lab. Anim. 38, 55–60 (2009).
15. Deeds, M. C. et al. Single dose streptozotocin-induced diabetes: considerations
for study design in islet transplantation models. Lab Anim. 45, 131–140
(2011).
16. Trucco M. Regeneration of the pancreatic beta cell. J. Clin. Invest. 115, 5–12
(2005).
17. Singh, V. P. et al. Lack of Wdr13 gene in mice leads to enhanced pancreatic
beta cell proliferation, hyperinsulinemia and mild obesity. PLoS One 7, 1–10
(2012).
Biosci. Biotechnol. Biochem., 67 (11), 2396–2401, 2003
Characterization of Streptozotocin-induced Diabetic Rats and
Pharmacodynamics of Insulin Formulations
Jae-Jeong LEE, Ho-Young YI, Jae-Won YANG, Jun-Seop SHIN, Jai-Hyun KWON,
and Chan-Wha KIM†
Graduate School of Life Sciences and Biotechnology, Korea University, Seoul 136-701, Korea
Received June 2, 2003; Accepted August 21, 2003
Morphological and functional changes of rat pan-
creatic islets caused by administration of streptozotocin
(STZ) and the bioavailability of insulin formulations
administered to STZ-induced diabetic rats with fasting
(12 h) or non-fasting were investigated. Islets isolated
from normal rats maintained a good three-dimensional
structure and the islet yield was 962.5±86.5 islet equiva-
lent number (IEQ, islets converted to an average
diameter of 150 mm). In the diabetic group (À500 mg W
ml blood glucose), the islet yield was only 44.4±8.3
IEQ and the islet was severely damaged. The minimum
reduction of blood glucose of each formulation, such as
insulin solution, microcrystal, and insulin microcrystal
capsule, was shown to be 11.3, 11.0, and 16.3 mg W dl,
respectively, at 6 h in fasting with diabetic rats. These
results indicated that the administration of insulin for-
mulations to the fasting groups increased the severe
hypoglycemic eŠect of insulin action more than in non-
fasting diabetic rats. The diabetic rat with fasting has a
regulatory disorder in maintaining the blood glucose
level. Accordingly, the validity of pharmacological
availability as an optimal modeling of insulin formula-
tions is best in non-fasting STZ-induced diabetic rats.
Key words: insulin; streptozotocin; diabetes; phar-
macodynamics; islet
Diabetes mellitus (DM) is classiˆed into two
types.1–3) Type I diabetes, also known as insulin-
dependent diabetes mellitus (IDDM), is characterized
by the autoimmune destruction of pancreatic b-
cells.4–6) Type II diabetes, also known as non-insulin-
dependent diabetes mellitus (NIDDM), is a complex
disease characterized by target organs, such as liver,
muscle, and adipocytes.7–9)
Streptozotocin (STZ)-induced diabetic animals
have been used for a model of IDDM. In general,
STZ given at a single dose of over 50 mg W kg causes
massive b-cell destruction and permanent hyperglyce-
mia in various experimental animals.10–12)
In this study, morphological and functional
changes of rat pancreatic islets caused by administra-
† To whom correspondence should be addressed. Tel: ＋82-2-3290-3439; Fax: ＋82-2-3290-3957; E-mail: cwkim＠korea.ac.kr
tion of STZ were investigated both in vivo and in
vitro. In order to assess the direct eŠect of STZ on
the rat pancreatic islets, the islet number, expressed
as 150 mm equivalent size (IEQ),13,14) islet morphology
with dithizone staining,15) blood glucose (BG) levels,
and intraperitoneal glucose tolerance test (IPGTT)16)
were examined.
The administration of insulin for the treatment of
IDDM and some cases of NIDDM usually controls
the BG level su‹ciently to maintain a normal physio-
logical state.17) One of the animal experimental
models to study the administration of insulin formu-
lations, such as insulin solution, insulin microcrystals
and insulin microcrystal capsules, is the Sprague-
Dawley rat with diabetes induced by STZ.18) In order
to measure pharmacokinetic and pharmacodynamic
properties of insulin formulations,19–21) we used STZ-
induced diabetic rats with fasting or non-fasting.
Materials and Methods
Materials. Insulin powder of bovine origin, STZ,
collagenase, Ficoll, and dithizone were purchased
from Sigma Chemical Co. (St. Louis, MO, USA).
Dulbecco's Modiˆed Eagle Medium (DMEM) and
fetal bovine serum (FBS) were purchased from
Gibco-BRL (Grand Island, NY, USA). Seven-week-
old male Sprague-Dawley (SD) rats (Dae-Han
Experimental Animal, Seoul, Korea) were housed in
an isolator cage system in air-conditioned animal
chamber at 22±19C.
Diabetes induction. Male SD rats were given no
food for 3 h before diabetes was induced with STZ.
They received a single intraperitoneal (IP) injection
of 60 mg Wkg STZ freshly dissolved in 0.05 M chilled
sodium citrate buŠer, pH 4.5. Normal rats were
injected with the equivalent volume of citrate buŠer.
STZ-induced diabetic animals with diabetic status
(À300 mg W dl) for 2 weeks were taken for the study.
 Characterization of Diabetic Rats and Pharmacodynamics of Insulin Formulations
Blood glucose concentration measurement. Blood
samples were collected from the rat tail vein. The
blood glucose (BG) levels of the rats were monitored
daily by using an One-touch blood glucose monitor-
ing system (LifeScan Inc., Milpitas, CA, USA), and
rats were considered to be diabetics when three
consecutive BG values were above 250 mg W dl.
Intraperitoneal glucose tolerance test. In-
traperitoneal glucose tolerance tests (IPGTT) in
the rat administered 60 mg W kg STZ and in normal
rat were done on rats with a BG level of normal (80–
120 mg W dl), 100–150, 200–300, 300–350, and À
500 mg W dl after STZ administration. These animals
were not fed for 12 h before the test and then
intraperitoneally administered a glucose load of 2 g W
kg body weight.
Pancreatic islet isolation. SD rats were killed by
cervical dislocation. Brie‰y, the pancreas was
exposed and distended by the intraductal injection of
collagenase (0.7 mg W ml, Type XI, Sigma Chem.
Co.). The distended pancreas was then immediately
dissected out and incubated at 379C for 20 min. The
reaction was stopped by adding ice-cold DMEM
containing 10z FBS, and the homogenate was
washed twice with DMEM. The islets were puriˆed
by discontinuous density gradient separation with
cm3 ). The
Ficoll solution (1.108, 1.096, and 1.037 g W
isolated pancreatic islets were ˆnally hand-picked
with a Pasteur pipette under the stereomicroscope.
Dithizone staining. Dithizone (DTZ) selectively
stains b-cells in pancreatic islets.15) DTZ solution was
prepared by dissolving 10 mg of DTZ in 3 ml of
absolute ethanol and 60 ml of ammonium hydroxide.
Islets were stained by adding 20 ml of DTZ solution to
islets in 1 ml of DMEM culture medium.
Assessment of islet yield. Immediately after islet
isolation, total islet yield evaluation was done in
triplicate using DTZ staining by a newly modiˆed
simple counting system for isolated islets.15) Islets
º50 mm in diameter were excluded from the islet
yield. The total volume of islets is expressed in the
number of islet equivalents (IEQs)—deˆned as islets
of 150 mm equivalent size in diameter.21)
Intraperitoneal injection of insulin and phar-
macodynamics analysis. Fasting or non-fasting
diabetic rats were subdivided into 4 groups. In non-
fasting diabetic groups, they received IP injections,
whereas in fasting groups, after a 12 h fast, they
received IP injections. One of the following drugs
was administered by the IP injection:
･Group 1: control, fasting W non-fasting rats who
received PBS (pH 7.4).
･Group 2: insulin solution, fasting W non-fasting
2397
rats who received the insulin dissolved in PBS
(pH 7.4).
･Group 3: insulin microcrystals, fasting W non-
fasting rats who received insulin micro-crystals
suspended in PBS (pH 7.4). Insulin microcrystals
were produced by insulin powder being dissolved in
an acetate solution of pH 2.0 and the acidity of the
insulin solution was varied using 1 N and 10 N
NaOH. Then, when the pH was further raised to
6.0, more than 65z of the insulin crystals produced
had a diameter of 5 mm or less.
･Group 4: insulin microcrystal capsules, fasting W
non-fasting rats who received the suspension of
microcrystals encapsulated with a copolymer of
lactic and glycolic acid (PLGA, 50:50) in PBS
(pH 7.4). Insulin microcrystals were encapsulated
within PLGA microspheres by the multiple emul-
sion-solvent evaporation technique.22) In this study,
the pharmacodynamic properties of insulin formu-
lations were evaluated by fasting or non-fasting
STZ-induced diabetic rats.23,24)
Results and Discussion
Changes of the blood glucose concentration and
body weight after STZ administration
The metabolic characterization was based on an
IPGTT, blood glucose (BG), and body weight. The
BG level of the normal group was 100±10 mg W dl
throughout the observation period of 1¿12 days. SD
rats with STZ-induced diabetes have reduced body
weight, hyperglycemia, and hypoinsulinemia because
of damaged insulin-secreting cells in the pancreatic
islets. When 50, 60, and 70 mg W mg STZ were
administered, then one day after STZ injection of
these rats, there was a marked increase of BG levels
(from about 300 to 500 mg W dl) (Fig. 1A). One of the
rats treated with 70 mg W kg STZ died from hyper-
glycemia on day 3 and showed severe weight loss
(Fig. 1B). IP administration of the STZ at 60 and
70 mg W kg body weight signiˆcantly reduced the body
weight in STZ-diabetic rats compared to the normal,
but body weight increased in 50 mg W kg diabetic rats
(Fig. 1B). Twelve days after STZ administration, the
STZ untreated normal group gained 45 g body weight
progressively and the group treated with 50 mg W kg
STZ also gained 23 g body weight in 12 days.
However, the increase in the body weight of rats
treated with 50 mg Wkg STZ was much lower than that
of the normal rats. Whereas, the groups treated with
60 and 70 mg W kg STZ lost the body weight continu-
ously for 12 days (22 g and 55 g, respectively).
Therefore, the treatment of 70 mg W kg STZ was not
appropriate for this study. At 50 mg W kg, induction
of diabetes was di‹cult and not reproducible, and
the rate of inducing diabetes was about 60z. Based
on these results, 60 mg Wkg STZ was selected as an
optimum dose to induce diabetes.
2398
Fig. 1(A). Proˆles of BG after Administration of STZ.
Changes of BG values were measured after STZ treatment of
SD rats at diŠerent doses for 12 days. The changes of BG
concentration when the SD rats are administered 50 (, n＝3),
60 (&, n＝4), and 70 mg W kg STZ (∇, n＝3) and the control
(PBS, , n＝6). Each plot denotes the mean±SEM.
Fig. 2. Phase-contrast Micrographic Morphology of Normal and STZ-Induced Diabetic Rat Islets (original magnitude ×40).
The rat pancreatic islets were isolated from rats with normal (A), 100¿150 (B), 200¿300 (C), 300¿350 (D), and 500 mg W
(E).
EŠects of STZ on islet morphology and yield
We investigated the eŠects of STZ on the function-
al and histological characteristics of endogenous
pancreatic islets in normal and STZ-induced diabetic
rats. After two weeks of STZ treatment, the STZ-
induced diabetic rat pancreatic islets were stained
with DTZ and their morphologies were observed
under the phase-contrast microscope. The diabetic
rats had severe diabetes as represented by decreased
body weight, high basal BG level, and severely
reduced total islet mass (with a mass representing
73.0±9.7¿4.6±9.6z) of the related normal islet
mass. The morphology of normal rat pancreatic islets
was round, compact, and well stained with DTZ
(Fig. 2A). While diabetic pancreatic islets were
J.-J. LEE et al.
Fig. 1(B). Proˆles of Body Weight Gain or Loss Levels after
Administration of STZ for 12 Days.
Changes of body weight in SD rats after a single i.p. injection
of various doses of STZ. , , & and ∇ represent for normal
(n＝6), 50 (n＝3), 60 (n＝4) and 70 mg W kg STZ (n＝3). Each
plot denotes the mean±SEM.
dl BG level
collapsed, amorphous, and dimly stained with DTZ
at the BG level of above 200 mg W dl (Fig. 2C, D and
E), islets which were isolated from rats with BG level
of 100±10 mg W dl were compact and maintained a
round shape (Fig. 2B). However, there was a remark-
able reduction in the number of islets as the BG level
increased to 100¿150, 200¿300, 300¿350, and
Æ500 mg W dl (Fig. 3). The islet yield was 962.5±86.5
islet number expressed as 150 mm equivalent size
(IEQ) W pancreas in the normal group, 694.0±94.9
IEQ W pancreas in the diabetes group with a BG level
100 (ranging from 100 to 150 mg W dl), 490.10±148.82
IEQ W pancreas in the diabetic group with a BG level
200 (ranging from 200 to 300 mg W dl), 123.8±15.2
IEQ W pancreas in the diabetes group with a BG level
 Characterization of Diabetic Rats and Pharmacodynamics of Insulin Formulations
Fig. 3. IEQs W Pancreas of Normal and STZ-Induced Diabetic
Rats from a Various BG Levels.
The yield of recovered islets decreased dramatically with
increases in the BG level (n＝3). Each plot denotes the mean±
SEM.
300 (ranging from 300 to 350 mg W dl) and 44.5±8.3
IEQ Wpancreas in the diabetes group with a BG level
higher than 500 mg W dl (n＝3, each). These results
indicated that the administration of increased STZ to
animals decreases the recovery of viable islets, and
reduces beta-cell function.
Intraperitoneal glucose tolerance test
We did IPGTT at various BG concentrations after
STZ administration to further clarify the characteris-
tics of the STZ-induced diabetic rat model. The
hypoglycemic property of each group was assessed by
IPGTT at a dose of 2 g W kg (body weight) glucose in
normal and STZ-induced diabetic rats (Fig. 4). The
rats were selected according to BG levels and given
no food for 12 h before the administration of
glucose. The initial BG levels in diabetic rats after
fasting for 12 h were diŠerent from the non-fasting
BG level of these rats. The fasting condition
contributed to the decline in BG level. BG levels in
each case were measured at various times. In normal
control rats, the BG level increased moderately to 140
±10 mg W dl after glucose infusion, but it was rapidly
restored to normal within 2 h (Fig. 4). There was no
signiˆcant diŠerence in BG levels between the normal
and diabetic groups (100 and 300 mg W dl), and the
normalized BG levels maintained for at least 2 h after
the glucose infusion. In the diabetic groups with BG
levels higher than 300 and À500 mg W dl, the glucose
level increased above 400 mg W dl, and declined
slowly. In diabetic groups with BG level of 100¿300
mg W dl, the BG level increased about 250 mg W dl,
which was restored to normal within 2 h. Normal,
BG 100¿150 mg W dl, BG 200¿300 mg W dl level (2 h),
produced a signiˆcant BG-lowering eŠect in the dia-
betic rats when compared to the BG 300¿350 mg W dl
and BG À500 mg W dl (º8.5 h). This results indicated
that glucose-stimulated insulin secretion is markedly
2399
Fig. 4. IPGTT in STZ-Induced Diabetic Rats Carried Out on
Day 12.
kg body weight)
After rats were fasted for 12 h, glucose (2 g W
was injected intraperitoneally to fasting with normal and diabet-
ic rats at time point `0'; blood samples were then collected at the
indicated times from the tail vein (n＝3). , , &, ∇ and 
represent for normal, 100¿150, 200¿300, 300¿350, and
À500 mg W dl BG range. Each plot denotes the mean±SEM.
impaired in the BG level of À300 mg W dl. Thus, we
examined the eŠects of insulin formulations by in BG
300¿350 mg W dl STZ-induced diabetic model.
Insulin administration and pharmacodynamic
analysis
To evaluate the eŠects of insulin on the BG level,
the STZ-induced diabetic rats with fasting or non-
fasting were IP injected with diŠerent insulin
formulations. In order to arrest insulin releasing,
fasting groups were without food for 12 h before
insulin administration by IP injection. Changes of
BG levels after administration of various insulin
formulations are shown in Fig. 5A and 5B. Fasting
groups are shown in Fig. 5A, when insulin solution
and microcrystals were administered, a signiˆcant
decrease of glucose level was seen, and then, their BG
levels were shown in a steady-state for 15 h. The
lowest BG level of the group received microcrystal
capsules was 6 h (16.3±8.4 mg W dl), and their BG
level gradually recovered and increased. Even though
in the control group, their BG level declined remark-
ably to 57.7±8.8 mg W dl (Table 1). This result was
compatible with that of other studies, on the eŠects
of fasting and insulin-induced hypoglycemia in
newborn piglets.10) Diabetic rats, fasted for 12 h be-
fore insulin administration, underwent hypoglycemic
(º60 mg W dl BG) shock in our previous experiments.
Shown in Fig. 5B, in case of diabetic rats without
fasting, in those groups received insulin solution and
microcrystals, their minimum reduction level of BG
was similar, as 382.3±15.9 and 394.7±62.3 mg W dl.
In diabetic rats, administration of microcrystal
capsules decreased their BG level to 75.0±8.2 mg W dl
in 2 h (Fig. 5B and Table 1). These results indicated
2400 J.-J. LEE et al.

Fig. 5(A). Changes of the BG Concentration in STZ-Induced
Diabetic Rats with Fasting by Insulin Formulations.
The changes of BG concentration when the STZ-induced
diabetic SD rats are administered a solution (, 2 IU, n＝3),
microcrystals (&, 5 IU, n＝3), microcrystal capsules (∇, 20 IU,
n＝3), and a control (, PBS, n＝3). Each plot denotes the
mean±SEM.
Fig. 5(B). Changes of the BG Concentration in STZ-Induced
Diabetic Rat with Non-fasting by Insulin Formulations.
The changes of BG concentration when the STZ-induced
diabetic SD rats are administered a solution (, 2 IU, n＝3),
microcrystals (&, 5 IU, n＝3), microcrystal capsules (∇, 20 IU,
n＝4), and a control (, PBS, n＝4). Each plot denotes the
mean±SEM.

Table 1. Pharmacodynamic Analysis of Insulin IP Administration by Using STZ-Induced Diabetic Rats with Fasting (F) and Non-fasting
(NF)

Insulin Dose MRBG1 (mg W

dl) TMBG2 (h) z TRBG3
Formulations kg)
(IU W F NF F NF F NF
4
PBS 0 57.7±8.8 407.5±27.5 14 5 56.1 9.3
Solution 2 11.3±1.8 382.3±15.9 6 5 88.4 7.5
Microcrystal 5 11.0 394.7±62.3 10 1 89.9 18.8
Microcrystal 20 16.3±8.4 75.0±8.2 6 2 80.2 30.6
capsule

MRBG1: the minimum reduction of blood glucose.

TMBG 2: time at minimum blood glucose.
z TRBG3: the percent of total reduction in blood glucose.
PBS4: phosphate-buŠered saline.

that the administration of insulin formulations to
fasting groups increased the synergistic eŠect of
insulin on hypoglycemia action than non-fasting
groups. The pharmacodynamic properties of insulin
formulations were evaluated. Table 1 presents the
opportunity to compare the pharmacodynamics of
fasting or non-fasting with STZ-induced diabetic
rats. The MRBG of insulin solution, crystals and
microcrystal capsules was 11.3±1.8, 11.0 and 16.3±
8.4 mg Wdl, respectively in fasting groups. This result
might be due to the fact that the diabetic rats had
been fasted.25) In‰ux of exogenous and endogenous
insulin results in a synergistic eŠect on the BG level
decrease.
The zTRBG of the non-fasting group was sig-
niˆcantly diŠerent from the fasting group. The z
TRBG of the non-fasting was shown in insulin
formulations, such as insulin solution, microcrystals,
and insulin microcrystal capsules (7.5, 18.8, and
30.6z, respectively). Whereas, fasting groups were
88.4, 89.9, and 80.2z, respectively. These results
indicated that diabetic rats with fasting have a regula-
tory disorder in maintaining BG levels. Therefore, in
order to investigate the pharmacodynamics of BG
level by exogenous insulin injection, an experiment
was done on diabetic rats without fasting.
In summary, this study indicates that the diabetic
rat model induced by a single IP injection of 60 mg W
kg STZ is IDDM, which is characterized by the
impaired insulin response to glucose stimulation
(IPGTT), islet yield, change of BG concentration,
and gain or loss of body weight. In addition, this
diabetic rat with fasting or non-fasting may be useful
to clarify the mechanism for IDDM in animal
experiments and to screen insulin formulations.
References
1) Kanazawa, Y., Kawakami, M., and Kawano, M.,
New classiˆcation of diabetes by ADA and WHO
with special reference to pathogenesis. Nippon
Rinsho, 57, 551–555 (1999).
2) Puavilai, G., Chanprasertyotin, S., and
Sriphrapradaeng, A., Diagnostic criteria for diabetes
mellitus and other categories of glucose intolerance:
 Characterization of Diabetic Rats and Pharmacodynamics of Insulin Formulations
1997 criteria by the expert committee on the diagnosis
and classiˆcation of diabetes mellitus (ADA), 1998
WHO consultation criteria, and 1985 WHO criteria.
Diabetes Res. Clin. Pract., 44, 21–26 (1999).
3) The committee of the Japan Diabetes Society on the
Diagnostic Criteria of Diabetes Mellitus. Report of
the committee on the classiˆcation and diagnostic
criteria of diabetes mellitus. Diabetes Res. Clin.
Pract., 55, 65–85 (2002).
4) Atkinson, M. A., and Maclaren, N. K., What causes
diabetes? Sci. Am., 263, 62–63 and 66–71 (1990).
5) Thomas, W. H. K., Helen, E. T., Leonard, C. H.,
and Janette, A., The beta cell in autoimmune
diabetes: many mechanisms and pathways of loss.
Trends Endocrinol. Metab., 11, 11–15 (2000).
6) Thomas, J. M., Contreras, J. L., Smyth, C. A.,
Lobashevsky, A., Jenkins, S., Hubbard, W. J.,
EckhoŠ, D. E., Stavrou, S., Neville, D. M. Jr., and
Thomas, F. T., Successful reversal of streptozotocin-
induced diabetes with stable allogeneic islet function
in a preclinical model of type 1 diabetes. Diabetes, 50,
1227–1236 (2001).
7) Kahn, C. R., Causes of insulin resistance. Nature,
373, 384–385 (1995).
8) Shaw, J. E., Zimmet, P. Z., McCarty, D., and
Courten, M., Type 2 diabetes worldwide according to
the new classiˆcation and criteria. Diabetes Care, 23
(Suppl. 2), B5–10 (2000).
9) Birnbaum, M. J., Dialogue between muscle and fat.
Nature, 409, 672–673 (2001).
10) Chang, Y. S., Park, W. S., Ko, S. Y., Kang, M. J.,
Han, J. M., Lee, M. Y., and Choi, J. H., EŠects of
fasting and insulin-induced hypoglycemia on brain
cell membrane function and energy metabolism
during hypoxia-ischemia in newborn piglets. Brain
Res., 844, 135–142 (1999).
11) Coppey, L. J., Gellett, J. S., Davidson, E. P.,
Dunlap, J. A., Lund, D. D., and Yorek, M. A.,
EŠect of antioxidant treatment of streptozotocin-
induced diabetic rats on endoneurial blood ‰ow,
motor nerve conduction velocity, and vascular
reactivity of epineurial arterioles of the sciatic nerve.
Diabetes, 50, 1927–1937 (2001).
12) Mikio, I., Yoichi, K., Akiko, N., Koji, H., and
Atsuhiko, N., Characterization of low dose
streptozotocin-induced progressive diabetes in mice.
Environ. Toxicol. Pharmacol., 9, 71–78 (2001).
13) Burg, van der M. P. M., Scheringa, M., Basir, I., and
Bouwman, E., Assessment of isolated islet equiva-
lents. Transplant. Proc., 29, 1971–1973 (1997).
14) Brandhorst, H., Brandhorst, D., Brendel, M. D.,
Hering, B. J., and Bretzel, R. G., Assessment of
intracellular insulin content during all steps of human
2401
islet isolation procedure. Cell Transplant., 7, 489–495
(1998).
15) Miyamoto, M., Inoue, K., Gu, Y., Thein, T., Cui,
W., Fujiwara, I., Ohyanagi, H., Hayashi, H.,
Yamazaki, T., Setoyama, H., Kawakami, Y., Ida, J.,
Kogire, M., Imamura, M., Iwata, H., and Ikada, Y.,
Improved large-scale isolation of breeder porcine
islets: possibility of harvesting from nonheart-beating
donor. Cell Transplant., 7, 397–402 (1998).
16) Hardikar, A. A., and Bhonde, R. R., Modulating
experimental diabetes by treatment with cytosolic
extract from the regenerating pancreas. Diabetes Res.
Clin. Pract., 46, 203–211 (1999).
17) Guthrie, R., Is there a need for a better basal insulin?
Clinical diabetes, 19, 66–70 (2001).
18) Movassat, J., Saulnier, C., and Portha, B., Insulin
administration enhances growth of the beta-cell mass
in streptozotocin-treated newborn rats. Diabetes, 46,
1445–1452 (1997).
19) Sakr, F. M., The pharmacokinetics of pulmonary
nebulized insulin and its eŠect on glucose tolerance
in streptozotocin-induced diabetic rabbits. Int. J.
Pharm., 128, 215–222 (1996).
20) Kawashima, Y., Yamamoto, H., Takeuchi, H.,
Fujioka, S., and Hino, T., Pulmonary delivery of
insulin with nebulized DL-lactide W glycolide copolymer
(PLGA) nanospheres to prolong hypoglycemic eŠect.
J. Control. Release, 62, 279–287 (1999).
21) Kaku, K., Matsuda, M., Urae, A., and Irie, S.,
Pharmacokinetics and pharmacodynamics of insulin
aspart, a rapid-acting analog of human insulin, in
healthy Japanese volunteers. Diabetes Res. Clin.
Pract., 49, 119–126 (2000).
22) Jeyanthi, R., Thanoo, B. C., Metha, R. C., and
Deluca, P. P., EŠect of solvent removal technique on
the matrix characteristics of polylactide W glycolide
microspheres for peptide delivery. J. Control.
Release, 38, 235–244 (1996).
23) Jonas, J. C., Sharma, A., Hasenkamp, W., Ilkova,
H., Patan àe, G., Laybutt, R., Bonner-Weir, S., and
Weir, G. C., Chronic hyperglycemia triggers loss of
pancreatic beta cell diŠerentiation in an animal model
of diabetes. J. Biol. Chem., 74, 14112–14121 (1999).
24) Pushparaj, P. N., Tan, B. K. H., and Tan, C. H.,
The mechanism of hypoglycemic action of the semi-
puriˆed fractions of Averrhoa bilimbi in strep-
tozotocin-diabetic rats. Life Sci., 70, 535–547 (2001).
25) Saeed, A., Sidney, A. J., Frank, Q. N., and Mary, C.
G., A fasting-induced decrease in plasma glucose
concentration does not aŠect the insulin response to
ingested protein in people with type 2 diabetes.
Metabolism, 51, 1027–1033 (2002).
 

Central 
Bringing Excellence in Open Access
JSM Diabetology and Management
Review Article *Corresponding author
Frank Christopher Howarth, Department of Physiology,

Effect of Streptozotocin-Induced College of Medicine & Health Sciences, P.O. Box 17666,
Al Ain, UAE University, UAE, Tel: 0097137137536; Email:

Type 1 Diabetes Mellitus Submitted: 16 September 2017

Accepted: 28 September 2017

on Contraction and Calcium Published: 29 September 2017

Copyright

Transport in the Rat Heart

© 2017 Howarth et al.

OPEN ACCESS

Frank Christopher Howarth1*, Lina AlKury2, Manal Smail1, Keywords

Muhammad Anwar Qureshi1, Vadym Sydorenko3, Anatoliy • Streptozotocin
• Diabetes mellitus
Shmygol1, Murat Oz4, and Jaipaul Singh5 • Rat
1
Department of Physiology, UAE University, UAE • Cardiomyopathy
2
Department of Health Sciences, Zayed University, UAE • Heart
3
Department of Cellular Membranology, Bogomoletz Institute of Physiology, Ukraine • Ventricle
4
Department of Basic Medical Sciences, Qatar University, Qatar • Calcium signaling
5
School of Forensic & Applied Sciences, University of Central Lancashire, UK • Contraction

Abstract
Diabetes mellitus (DM) is a major global health disorder currently affecting 450 million people. Diabetic cardiomyopathy (DC) is a disorder of cardiac
muscle that is independent of coronary artery disease and that may lead to heart failure in diabetic patients. The precise mechanism(s) of diabetic
cardiomyopathy are still not fully understood. Therefore, it is of paramount importance to develop experimental models of DM to study the time course and
cellular, subcellular and molecular mechanisms of diabetic cardiomyopathy. With this in mind, scientists initially discovered that the antibiotic, streptozotocin
(STZ) could be used to rapidly to induce diabetes mellitus in animal models. STZ destroys pancreatic beta cells, leading to hypoinsulinemia and hyperglycaemia.
If left untreated hyperglycaemia may lead to DC and eventually heart failure. Initially in DM, the cardiac myocytes become apoptotic, disorganised and the
number of myocytes are significantly reduced. The heart responds by enlarging itself (hypertrophy) which is accompanied by fibrosis leading to a physiological
remodelling process. Within the myocytes, the process of excitation-contraction coupling (ECC) is deranged. This is due to an inability of the heart cells to
regulate Ca2+ which is the initiator and regulator of cardiac muscle contraction. As a result, the heart takes longer to contract and to relax leading to DC,
progressive heart failure and eventually sudden cardiac death. The aim of this review was to evaluate our current understanding of contractile dysfunction and
disturbances in Ca2+ transport in the STZ-induced diabetic rat heart.

ABBREVIATIONS Experiments performed in ventricular myocytes isolated

DM: Diabetes Mellitus; DC: Diabetic Cardiomyiopathy; STZ:
Streptozotocin; ECC: Excitation-Contraction Coupling; SR:
Sarcoplasmic Reticulum; SERCA2: Sarcoplasmic Reticulum Ca2+
ATPase Pump; TPK: Time to Peak; THALF: Time to Half; EPI:
Epicardial; ENDO: Endocardial; DNA: Deoxyribonucleic Acid;
mRNA: Messenger Ribonucleic Acid; RYR: Ryanodine Receptor
INTRODUCTION
The STZ-induced diabetic rat is a widely used experimental
model of DM. STZ selectively enters pancreatic beta cells via
the GLUT2 glucose transporter where it causes damage to the
genetic machinery and ultimately leads to beta cell death [1]. The
general characteristics of the STZ-induced diabetic rat include
hypoinsulinemia, hyperglycemia, dyslipidemia, polyuria, reduced
body weight gain, polydipsia and polyphagia [2]. Contractile
dysfunction, which is frequently observed in the diabetic heart,
may include disturbances in heart rate, stroke volume, cardiac
output, ejection fraction and rates of pressure development and
relaxation rate [3-7].
from diabetic heart have variously displayed either unaltered or
reduced amplitude of shortening, and prolonged time course of
contraction and relaxation [8-11]. Intracellular free Ca2+ [Ca2+]i
transport systems are essential to the initiation and regulation of
cardiac myocyte contraction and relaxation. During the process
of ECC, the arrival of an action potential at a ventricular myocyte
causes membrane depolarization leading to the opening of
voltage-gated L-type Ca2+ channels and a small influx of Ca2+. This
small entry of Ca2+ triggers a much larger release of Ca2+ from the
sarcoplasmic reticulum (SR). There follows a transient rise in
intracellular Ca2+ (Ca2+ transient) which binds to the troponin C
and initiates and regulates the process of myocyte contraction.
Relaxation of contraction begins when Ca2+ is pumped back
into the SR via the SR Ca2+ ATPase pump (SERCA2) and effluxed
from the cell, primarily via the Na+/Ca2+ exchanger [12-14].
Experiments performed in cardiac myocytes from diabetic heart
have variously displayed disturbances in Ca2+ transient, time
course of Ca2+ transient, L-type Ca2+ current, SR Ca2+ content,
uptake and release and Na+/Ca2+ exchange current[5,15-18]. The
aim of this review was to evaluate our current understanding of

Cite this article: Howarth FC, AlKury L, Smail M, Qureshi MA, Sydorenko V, et al. (2017) Effect of Streptozotocin-Induced Type 1 Diabetes Mellitus on Contrac-
tion and Calcium Transport in the Rat Heart. JSM Diabetol Manag 2(1): 1004.
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

contractile dysfunction and disturbances in Ca2+ transport in the

STZ-induced diabetic rat heart.

Diabetogenic Action of Streptozotocin

The general chemical structure of STZ is shown in Figure
1. STZ is an antimicrobial agent which has also been used as a
chemotherapeutic alkylating agent [19,20]. STZ is typically
administered dissolved in a citrate buffer by either intraperitoneal
or intravenousinjection. Once in the blood circulation, STZ travels
to the pancreas where it selectively accumulates in pancreatic
beta cells via the low-affinity GLUT2 glucose transporter in the
plasma membrane. It should be noted that STZ is also able to
damage other organs that express GLUT2 including the kidney
and the liver [21,22]. It is generally believed that the toxicity
of STZ is dependent upon the DNA alkylating activity of its
methylnitrosourea moiety and methylation of the DNA molecule.
Transfer of the methyl group from STZ to the DNA molecule
causes damage and fragmentation of the DNA. Beta cell toxicity
might also arise from the action of reactive oxygen species [1,23].
Whatever the mechanism(s) of action, the consequences of STZ
treatment are damage to the beta islet cells of the pancreas and
a reduction in the ability of these cells to produce insulin (Figure
2). The nature of the pathophysiological effects of STZ depends to
a large extent on the dose and duration of treatment.

Blood Chemistry in the Streptozotocin-Induced Figure 2 A schematic diagram showing the toxic effects of streptozotocin in
Diabetic Rat beta cells. Adapted from Lenzen, 2008(1).

The general characteristics of the STZ-induced diabetic rat

include hypoinsulinemia, hyperglycemia, polyuria, decreased
body weight gain, polydipsia and polyphagia [2]. Insulin levels fall
dramatically in diabetic rats compared to controls (Table 1). Due
to the falling concentrations of insulin, target organs like the liver
and muscle are unable to clear glucose from the blood circulation
and blood glucose rises. Following a 45-60 mg/kg body weight
injection of STZ in adult rats the blood glucose levels typically
rise to an average of 400 mg/dl in STZ treated rats compared to
100 mg/dl in controls (Table 2). Urine glucose is also elevated
in diabetic rats [24] compared to controls. Persistently elevated
levels of glucose in the blood of diabetic rats causes glycosylation
of hemoglobin and glycosylated hemoglobin is a widely used
diagnostic criterion for DM (Table 3). Glycosylated hemoglobin
can rise to an average of 8.5% in diabetic rats compared to 4.0
% in controls (Table 3). Alterations in lipid profile including
increased cholesterol [7], increased free fatty acids [7], increased
atrial and brain natriuretic peptides[10,25], reduced insulin-like
growth factor-1 and triiodothyronine [7,26], increased creatine

Figure 3 Diagram showing the proposed actions of STZ-induced diabetes on

Ca2+ transport systems in the ventricular myocyte. -=No effect, ↓=Reduced
activity, ↑=Increased activity.

[27], and increased blood osmolarity also occur in diabetic

animals compared to controls [28,29].

Body and Heart Weight in the Streptozotocin-Induced

Diabetic Rat
Body weight gain is typically reduced in diabetic rats
Figure 1 Diagram showing the chemical structure of streptozotocin. compared to controls (Table 4). Heart weight is typically reduced

JSM Diabetol Manag 2(1): 1004 (2017)

2/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Table 1: Blood insulin levels in the streptozotocin-induced diabetic rat

Dose of STZ Insulin level
Treatment time Reference
(mg/kg body weight) (Control vs. STZ)
55 iv 6w 43.3 vs. 31.3 µU/ml [44]
65 iv 15, 27 d 31.2 vs. 12.4 15 d, 13.1 27 d µU/ml [7]
55 ip 7w 1.08 vs. 0.29 ng/ml [5]
45-50 ip 7-8 w 1.98 vs. 0.27 ng/ml [4]
65 iv 8w 157 vs. 45 pmol/L [64]
45 ip 8w 1.2 vs. 0.3 ng/ml [6]
45 8w 1.12 vs. 0.3 ng/ml [37]
60 ip 8-12 w 20.63 vs. 4.80 ng/ml [29]

Table 2: Blood glucose levels in the streptozotocin-induced diabetic rat.

Dose STZ (mg/kg body
Treatment time Glucose level (Control vs. STZ) Reference
weight)
60 ip 3d, 30 d 70 vs. 265, 77 vs. 309 mg/dl [40]
100 iv 4-6 d 96 vs. 329 mg/dl [50]
65 ip 5-7 d 270 vs. 529 mg/dL [51]
60 ip 1w 128.6 vs. 479.0 mg/dL [49]
65 iv 7d 126 vs. 509 mg/dL [52]
65 iv 7d 6.9 vs. 27 mmol/L [27]
65 iv 15 d,27 d 130 vs. 388 15 d, 130 vs. 435 27 d mg/dL [7]
40 ip 28 d 3.40 vs.28.78 mmol/l [36]
40 iv 3-4 w 10.3 vs. 40.4 mM [61]
40 ip 4w 3.40 vs. 28.78 mmol/L [36]
50 ip 4-5 w 10.08 vs. 48.05 mmol/L [56]
60 iv 4-6 w 163.2 vs. 511.3 mg/dL [60]
50 iv 4-7 w 217 vs. 529 mg/dL [55]
60 ip 4-10 w 92.4 vs. 407.5 mg/dL [16]
60 ip 4 w,24 w 76 vs. 292, 66 vs. 252 mg/dl [3]
50 ip 5w 101 vs. 458 mg/dL [57]
50 ip 5w 105 vs. 421 mg/dL [17]
55 iv 6w 6.2 vs. 19.1 mmol/L [44]
55 iv 7w 94 vs. 333 mg/dL [26]
55 ip 7w 4.9 vs. 21.2 mmol/L [5]
45-50 ip 7-8 w 7.2 vs. 22.8 mmol/L [4]
60 ip 8w 104.06 vs. 469.64 mg/dl [65]
60 ip 8w 98.00 vs. 440.38 mg/dl [66]
45 8w 5.2 vs. 22.6 mmol [37]
60 ip 8w 70.1 vs. 307.2 mg/dl [48]
65 iv 8w 180 vs. 546 mg/dl [64]
55 8w 105 vs. 344 mg/dl [50]
45 8w 5.2 vs. 22.6 mmol/L [37]
55 iv 8w 110 vs. 348 mg/dL [45]
50 ip 8w 116.6 vs. 386.8 mg/dL [41]
45 iv 8w 6.2 vs. 20.8 mmol/L [6]
60 iv 8w 4.7 vs. 30.8 mmol/L [30]
65 iv 8w 155 vs. 473 md/dL [35]
60 ip 8w 70.1 vs. 307.2 mg/dL [48]

JSM Diabetol Manag 2(1): 1004 (2017)

3/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

60 ip 8-12 w 69.4 vs. 322.5 mg/dl [43]

60 ip 8-12 w 92.4 vs. 407/5 mg/dl [29]
60 ip 8-12 w 71.83 vs. 308.23 mg/dl [47]
60 ip 8-12 w 78.3 vs. 366.7 mg/dL [28]
60 ip 8-12 w 70.0 vs. 331.5 mg/dL [46]
60 ip 8-12 w 71.83 vs. 308.23 mg/dL [47]
60 ip 8-12 w 92.4 vs. 407.5 mg/dL [29]
60 ip 8-12 w 68.0 vs. 347.4 mg/dL [10]
60 ip 8-12 w 69.4 vs. 322.5 mg/dL [43]
60 ip 9w 70.50 vs. 260.17 mg/dL [59]
60 ip 9w 90.21 vs. 529.21 mg/dL [38]
60 ip 12 w 7.57 vs. 19.47 mmol/L [39]
60 ip 12 w 90.5 vs. 455.0 mg/dL [11]
60 ip 13-24 w 110 vs. 554 mg/dl [49]

Table 3: Glycosylated hemoglobin in the streptozotocin-induced diabetic rat.

Dose STZ (mg/kg body
Treatment time Glucose level (Control vs. STZ) Reference
weight)
45-50 ip 7-8 w 3.9 vs. 8.3 % [4]
55 ip 7w 4.1 vs. 8.4 % [5]
45 iv 8w 3.3 vs. 8.3 % [6]
45 8w 4.3 vs. 8.9 % [37]

Table 4: Body weight in the streptozotocin-induced diabetic rat.

Dose STZ (mg/kg body Body weight
Treatment time Reference
weight) (Control vs. STZ)
100 iv 4-6 d 237 vs. 190 g [50]
65 ip 5-7 d 370 vs. 269 g [8]
65 ip 5-7 d 370 vs. 269 g [51]
60 ip 7d 282.1 vs. 237.2 g [49]
65 iv 7d 334.4 vs. 285.5 g [27]
65 iv 7d 351 vs. 279 g [52]
40 ip 28 d 265 vs. 202 g [36]
60 ip 30 d 314 vs. 238 g [40]
50 ip 4-5 w 256.32 vs. 186.12 g [56]
60 iv 4-6 w 420 vs. 239 g [60]
50 iv 4-7 w 425 vs. 233 g [55]
60 ip 4-10 w 385.4 vs. 233.8 g [16]
60 ip 4, 24 w 305 vs. 248, 410 vs. 308 g [3]
50 ip 5w 240.2 vs. 196.8 g [17]
50 ip 5w 249.2 vs. 197.8 g [57]
55 iv 6w 448 vs. 335 g [44]
55 iv 7w 434 vs. 293 g [26]
55 ip 7w 366.6 vs. 270.6 g [5]
45-50 ip 7-8 w 416.5 vs. 329.8 g [4]
60 ip 8w 352.25 vs. 267.57 g [65]
60 ip 8w 351.05 vs. 259.05 g [66]
45 8w 393.0 vs. 289.1 g [37]

JSM Diabetol Manag 2(1): 1004 (2017)

4/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

60 ip 8w 312.0 vs. 229.1 g [48]

65 iv 8w 467 vs. 258 g [64]
55 iv 8w 380 vs. 285 g [50]
55 iv 8w 411 vs. 310 g [45]
45 iv 8w 422.5 vs. 312.8 g [6]
60 iv 8w 438 vs. 247 g [30]
65 iv 8w 462 vs.270 g [35]
60 ip 8-12 w 304.3 vs. 221.1 g [43]
60 ip 8-12 w 381.4 vs. 232.8 g [29]
60 ip 8-12 w 326.83 vs. 226.23 g [47]
60 ip 8-12 w 269.1 vs. 209.9 g [46]
60 ip 8-12 w 300.6 vs. 224.0 g [10]
60 ip 8-12 w 307.1 vs. 232.8 g [28]
60 ip 9w 351.20 vs. 198.80 g [38]
60 ip 9w 285.33 vs. 229.33 g [59]
60 ip 12 w 589.83 vs. 256 g [39]
60 ip 12 w 361.5 vs. 255.8 g [11]
60 ip 13-24 w 426 vs. 266 g [49]

but may occasionally be unaltered in diabetic rats (Table 5). Heart
weight to body weight ratio is generally increased indicating a
sign of hypertrophy but may also be unaltered in diabetic rats
compared to controls (Table 6). Other studies have reported
unaltered heart weight to tibial length [30], reduced left ventricle
weight [31,32] and increased left ventricle to body weight ratio
[33] in diabetic rats compared to controls. These data provide
evidence of cardiac hypertrophy in the STZ-induced diabetic rat.
Hemodynamic Function In vivo and in the Isolated
Perfused Heart of the Streptozotocin-Induced
Diabetic Rat
Measures of hemodynamic function are shown in Table 7.
Echocardiographic and other techniques have generally reported
reduced heart rate [3-6,32,34,35,35-38] but sometimes unaltered
heart rate [7,39] in diabetic rats compared to controls (Table 7).
Associated with the changes in heart rate electrophysiological
measurements of QRS, QT, PQ and PR intervals are generally
prolonged [4,5,35,40] and sometimes unaltered [3,35,40] in
diabetic rats compared to controls. Cardiac output may either
be reduced or unaltered [4-6], stroke volume may be reduced
or unaltered [4-6] and ejection fraction was generally reduced
[5,6,32,37-39] but may also be unaltered [41] in diabetic rats
compared to controls. Percentage fractional shortening was
reduced [4-6,32,37-39] in diabetic rat. Left ventricular systolic
pressure was reduced [33,35,36,39,42] and left ventricular
diastolic pressure was increased [33,35-37,39,42] in diabetic rats
compared to controls. Rates of pressure development and decline
were lower [5,31,33,35-37,39] in diabetic rat. In the isolated
perfused heart the spontaneous heart rate was lower [9,43],
rates of pressure development and decline were lower [9] and
the time to peak (TPK) and half relaxation (THALF) of pressure
were prolonged [9] in diabetic rat heart. Collectively, these in
vivo and in vitro experiments provide evidence of disturbances
in hemodynamic function including heart rate, left ventricular
systolic and diastolic pressure, rate of pressure development and
decline, and cardiac output in the STZ-induced diabetic rat heart
compared to controls.
Contraction in Ventricular Myocytes from Streptozo-
tocin-Induced Diabetic Rat
The characteristics of ventricular myocyte contraction are
shown in Table 8. Generally, ventricular myocytes are isolated from
heart using a combination of enzymatic and mechanical dispersal
techniques [9,16]. The viability, calculated as the percentage of
rod shaped compared to round shaped myocytes, was generally
lower [4,16,29,44] in myocytes isolated from diabetic rats
compared to controls. Resting cell length was generally unaltered
[4,5,10,11,28,43,45-49], but sometimes reduced [27] in ventricular
myocytes from diabetic rats compared to controls. Cell width was
either unaltered [28] or reduced [27], cell thickness was unaltered
[27], surface area was increased [10] and calculated cell volume
may be unaltered [28] or reduced [27] in myocytes from diabetic
rats compared to controls. A recent study reported unaltered
length in epicardial (EPI) and endocardial (ENDO) ventricular
myocytes from diabetic rat [11]. The time course of shortening was
prolonged [4,5,8-11,26,28,29,43,45-51] and the time course for
half relaxation was either prolonged [4,5,8,9,11,26,43,45,46,50-
52] or unaltered [10,28,29,47-49] in myocytes from diabetic rats
compared to controls. A recent study reported prolonged TPK
shortening in EPI and ENDO myocytes and prolonged THALF
relaxation of shortening in ENDO but not in EPI left ventricular
myocytes from STZ-induced diabetic rat [11]. Rate of development
of shortening may be reduced [4,5,9,26,37] or unaltered [45,52]
and the rate of decline of shortening may also be reduced
[4,5,9,26,37] or unaltered [45,52] in myocytes from diabetic rats
compared to controls. Amplitude of shortening may be reduced
[4,5,9,26,27,37] or unaltered [8,10,11,28,29,43,45-49] in myocytes
from diabetic rat. Increasing frequency of stimulation produces a
negative staircase effect that was unaltered in myocytes from STZ-

JSM Diabetol Manag 2(1): 1004 (2017)

5/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Table 5: Heart weight in the streptozotocin-induced diabetic rat.

Dose STZ (mg/kg body Heart weight
Treatment time Reference
weight) (Control vs. STZ)
65 ip 5-7 d 1.10 vs. 0.92 g [8]
65 ip 5-7 d 1.10 vs. 0.92 g [51]
65 iv 7d 1.10 vs. 0.90 g [52]
50 iv 4-7 w 1.35 vs. 0.88 g [55]
60 ip 4-10 w 1.1 vs. 1.0 g [16]
50 ip 5w 4.04 vs. 4.08 mg/g [57]
55 iv 7w 1.85 vs. 1.37 g [26]
55 ip 7w 1.2 vs. 1.0 g [5]
45-50 ip 7-8 w 1.25 vs. 0.97 g NSD [4]
60 ip 8w 1.2 vs. 1.06 g [65]
60 ip 8w 1.18 vs. 1.05 g [66]
55 iv 8w 1.54 vs. 1.29 gNSD [45]
45 iv 8w 1.3 vs. 1.0 g [6]
60 iv 8w 1.60 vs. 1.24 g [30]
65 iv 8w 1.04 vs. 0.74 g [35]
60 ip 8-12 w 1.17 vs. 1.01 g [43]
60 ip 8-12 w 1.1 vs. 1.0 g [29]
60 ip 8-12 w 1.25 vs. 0.99 g [47]
60 ip 8-12 w 1.17 vs. 1.04 g [46]
60 ip 8-12 w 1.25 vs. 1.02 g [10]
60 ip 8-12 w 1.21 vs. 1.04 g [28]
60 ip 9w 1.86 vs. 1.00 g [38]
60 ip 12 w 780 vs. 595.1 mg [39]
60 ip 12 w 1.13 vs. 0.96 g [11]
60 ip 13-24 w 1.33 vs. 1.05 g [49]
NSD=No significant difference

Table 6: Heart weight to body weight ratio in the streptozotocin-induced diabetic rat.
Heart weight to body weight ratio (Control
Dose STZ (mg/kg body weight) Treatment time Reference
vs. STZ)
65 ip 1-7 d 3.05 vs. 3.03 mg/g NSD [8]
65 ip 5-7 d 3.03 vs. 3.05 mg/gNSD [51]
65 iv 7d 3.12 vs. 3.21 mg/g [52]
50 iv 4-7 w 3.16 vs. 3.81 mg/g [55]
55 iv 7w 4.33 vs. 5.23 mg/gNSD [26]
55 ip 7w 3.3 vs. 3.7 mg/g [5]
60 ip 8w 3.42 vs. 4.00 mg/g [65]
60 ip 8w 3.38 vs. 4.11 mg.g [66]
55 iv 8w 3.74 vs. 4.16 mg/g [45]
45 iv 8w 3.1 vs. 2.9 mg/gNSD [6]
60 iv 8w 3.7 vs. 5.3 mg/g [30]
65 iv 8w 2.25 vs. 2.74 mg/g [35]
60 ip 8-12 w 4.41 vs. 5.04 mg/g [46]
60 ip 8-12 w 4.28 vs. 4.71 mg/gNSD [10]
60 ip 9w 5.43 vs. 5.07 mg/gNSD [38]
60 ip 12 w 3.13 vs. 3.78 mg/g [11]
60 ip 13-24 w 3.14 vs. 3.97 mg/g [49]
NSD=No significant difference

induced diabetic rat compared to control [26,45]. Spontaneous
contractions (arrhythmic contractions) were increased in
myocytes from diabetic rat [2]. Experiments in sarcomeres have
reported reduced fractional shortening, decreased maximal rate
of shortening and re-lengthening in diabetic rats compared to
controls [31]. Collectively, these experiments provide evidence
of disturbances in the time course of shortening, relaxation of
shortening, and amplitude of shortening in ventricular myocytes
from STZ-induced diabetic rats compared to age-matched healthy
controls.

JSM Diabetol Manag 2(1): 1004 (2017)

6/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Excitation-Contraction Coupling in Ventricular Myo-
cytes
The arrival of an action potential at a ventricular myocyte
causes depolarization of the myocyte plasma membrane and
opening of L-type Ca2+ channels. A small entry of Ca2+ through
the Ca2+ channels triggers a large release of Ca2+ from the SR via
the SR Ca2+ release channels (Ryanodine receptors). There is a
transient rise in intracellular Ca2+ concentration, which binds
to troponin C and triggers and regulates the process of myocyte
contraction. The process of myocyte relaxation takes place
when Ca2+ is pumped back into the SR via the SERCA pump and
extruded from the myocyte, primarily via the Na+/Ca2+ exchanger,
and also to lesser extents via the plasma membrane Ca2+ ATPase
[12-14]. Alterations in intracellular [Ca2+]i and the mechanisms
that control intracellular [Ca2+]i including L-type Ca2+ current, SR

Table 7: In vivoventricular function in the streptozotocin-induced diabetic rat.

Dose STZ (mg/kg
Parameter Treatment time Control vs. STZ Reference
body weight)
HR 60 ip 10 d 348 vs. 255 bpm [40]
65 iv 24, 27 d 412 vs. 376 bpm, 412 vs. 362 bpm [7]
40 ip 28 d 388.63 vs. 339.50 bpm NSD [36]
60 ip 4, 22 w 347 vs. 268,316 vs. 266 bpm [3]
55 ip 7w 416.5 vs. 304.8 bpm [5]
45-50 ip 7-8 w 401.5 vs. 320.8 bpm [4]
60 iv 8w 390 vs. 311 bpm [30]
45 iv 8w 370.2 vs. 283.9 bpm [6]
50 ip 8w 318.24 vs. 243.80 bpm [32]
45 8w 382 vs. 291 bpm [37]
65 iv 8w 357 vs. 283 bpm [35]
60 ip 9w 346 vs. 267 bpm [38]
55 iv 12 w 346 vs. 264 bpm [9]
60 ip 12 w 420 vs. 388 bpm NSD [39]
CO 55 ip 7w 127.0 vs. 94.5 ml/min [5]
45-50 ip 7-8 w 128.4 vs. 93.0 ml/min [4]
45 iv 8w 118.7 vs. 82.3 ml/min [6]
SV 55 ip 7w 0.31 vs. 0.31 ml NSD [5]
45-50 ip 7-8 w 0.32 vs. 0.29 ml [4]
45 iv 8w 0.32 vs. 0.29 ml NSD [6]
EF 55 ip 7w 84.1 vs. 76.5% [5]
45-50 ip 7-8 w 84.06 vs. 71.8% [4]
50 ip 8w NSD [41]
45 iv 8w 83.5 vs. 72.5% [6]
50 ip 8w 84.4 vs. 67.8% [32]
45 8w 85 vs. 70% [37]
60 ip 9w 77.33 vs. 64.80% [38]
60 ip 12 w 76.1 vs. 67.7% [39]
FS 55 ip 7w 61.7 vs. 51.9% [5]
45-50 ip 7-8 w 60.6 vs. 52.9% [4]
45 iv 8w 60.9 vs. 49.3% [6]
50 ip 8w 55.7 vs. 39.6% [32]
45 8w 61 vs. 51% [37]
60 ip 9w 41.0 vs. 30.8% [38]
60 ip 12 w 45.4 vs. 37.6% [39]
150 vs.136 mmHg 21 d,150 vs. 131 mmHg 24 d,150
LVSP 65 iv 21, 24, 27 d [7]
vs. 122 mmHg 27 d
40 ip 28 d 136.87 vs. 106.32 mmHg [36]
55 ip 7w Reduced [5]
45 8w 130 vs. 104 mmHg [37]
65 iv 8w 151 vs. 123 mmHg [35]
LVDP 65 iv 21, 24, 27 d 2.3 vs. 8.6 mmHg 21 d,9.6 mmHg 24 d,9.8 mmHg 27 d [7]

JSM Diabetol Manag 2(1): 1004 (2017)

7/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

65 ip 21 d Increased [42]
40 ip 28 d 2.38 vs. 6.30 mmHg [36]
60 ip 8w Increased [33]
45 8w 0.6 vs. 4.8 mmHg [37]
65 iv 8w 3 vs. 19 mmHg [35]
60 ip 12 w Increased [39]
LVPD (+dP/dt) 65 iv 21, 24, 27 d Reduced [7]
40 ip 28 d 5.71 vs. 3.12 mmHg/ms [36]
60 ip 8w Reduced [33]
60 ip 8w Reduced [31]
5 ip 8w Reduced [5]
45 8w 9753 vs. 5176 mmHg/sec [37]
65 iv 8w 6137 vs. 4332 mmHg/sec [35]
60 ip 12 w Reduced [39]
LVPR (-dP/dt) 65 iv 21, 24, 27 d Reduced [7]
40 ip 28 d -4.91 vs. -2.66 mmHg/ms [36]
55 ip 7w Reduced [5]
60 ip 8w Reduced [33]
60 ip 8w Reduced [31]
45 ip 8w 9088 vs. 4723 mmHg/sec [37]
65 iv 8w 5415 vs. 3610 mmHg/sec [35]
60 ip 12 w Reduced [39]
LVRT 60 ip 8w Longer [31]
LVEDD 55 ip 7w 6.28 vs. 6.91 [5]
45-50 ip 7-8 w 6.58 vs. 6.70 mm NSD [4]
45 iv 8w 2.6 vs. 3.6 mm [6]
60 ip 12 w 11.67 vs. 7.5 mm [39]
55 iv 12 w 6.73 vs. 6.86 mm NSD [9]
LVESD 55 ip 7w 2.66 vs. 3.35 [5]
45-50 ip 7-8 w 2.67 vs. 3.234 mm NSD [4]
60 ip 12 w 5.84 vs. 4.1 mm [39]
55 iv 12 w 2.52 vs. 2.86 mm NSD [9]
IVRT 50 ip 8w Increased [32]
55 iv 12 w Longer [9]
IVCT 60 ip 8w Longer [31]
BP 55 iv 8w 110 vs. 105 mmHg NSD [45]
HR=Heart rate, CO=Cardiac output, SV=Stroke volume, EF=Ejection fraction, FS=Fractional shortening, LVSP=Left ventricular systolic pressure,
LVDP=Left ventricular diastolic pressure, LVPR=Left ventricular rate of pressure relaxation, LVRT=Left ventricle relaxation time, LVEDD=Left
ventricular end-diastolic dimension, LVESD=Left ventricular end-systolic dimension, IVRT=Isovolumic relaxation time, IVCT=Isovolumic contraction
time, BP=Blood pressure.NSD=No significant difference

Ca2+ transport and Na+/Ca2+ exchange might partly underlie the
disturbances reported in myocyte shortening.
Calcium Transport in Ventricular Myocytes from the
Streptozotocin-Induced Diabetic Rat
The effects of STZ-induced diabetes on intracellular Ca2+
are shown in Table 9. Resting [Ca2+]i was generally unaltered
[8,9,11,18,28,43,44,47-49,51,53] but sometimes reduced
[15,26,44,52,52,54] in ventricular myocytes from diabetic rats
compared to controls. A recent study reported unaltered resting
Ca2+ in EPI and ENDO myocytes in EPI and ENDO left ventricular
myocytes from STZ-induced diabetic rats compared to controls
[11]. TPK Ca2+ transient was either prolonged [9,17,28,49,55,56]
or unaltered [10,16,29,38,43,47,48] in myocytes from diabetic
rats. THALF decay of the Ca2+ transient was generally prolonged
[4-6,8-10,16,17,26,28,29,38,48-52,54-57] in myocytes from
diabetic rats compared to controls. A recent study reported
prolonged TPK Ca2+ transient and prolonged THALF decay
of the Ca2+ transient in ENDO, but not in EPI left ventricular
myocytes from STZ-induced diabetic rat [11]. Amplitude of
the Ca2+ transient was either unaltered [11,16,18,28,29,43,46-
49,53,55] or lowered[4-6,9,15,17,26,27,31,32,37,38,54,56,57] in
ventricular myocytes from diabetic rats. In addition, the rate of
Ca2+transient development and decay were lower in ventricular
myocytes from STZ-induced diabetic rats compared to controls
[4-6,9,37]. Collectively, these experiments provide evidence
of disturbances in the time course of development and decay
of the Ca2+transient and the amplitude of the Ca2+ transient in

JSM Diabetol Manag 2(1): 1004 (2017)

8/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Table 8: Contraction in ventricular myocytes from streptozotocin-induced diabetic rat.

Dose STZ (mg/kg
Parameter Treatment time Control vs. STZ Reference
body weight)
CV 60 ip 4-10 w 49.4 vs. 25.3% [16]
55 iv 6w 79.4 vs. 70.4% [44]
45-50 ip 7-8 w 70 vs. 55% [4]
60 ip 8-12 w 49 vs. 25% [29]
55 iv 12 w 69 vs. 60 % NSD [9]
RCL 100 iv 4-6 d 110 vs. 109 µm NSD [50]
65 ip 5-7 d 129 vs. 108 µm [8]
65 ip 5-7 d 127 vs. 113 µm [51]
65 iv 7d 95 vs. 103 µm [52]
65 iv 7d 128.9 vs. 113.9 µm LV [27]
40 iv 3-4 w 126.4 vs. 121.7 µm NSD [61]
55 ip 7w 110.7 vs. 117.8 µm LV NSD [5]
45-50 ip 7-8 w 112.30 vs. 112.83 µm NSD [4]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
55 iv 8w 111 vs. 110 µm NSD [50]
55 iv 8w NSD [45]
60 ip 8-12 w NSD [29]
60 ip 8-12 w 131.49 vs. 122.48 µm [47]
60 ip 8-12 w 117 vs. 113 µm NSD [46]
60 ip 8-12 w 131.49 vs. 122.48 µm [47]
60 ip 8-12 w 117 vs. 123 µm NSD [10]
60 ip 8-12 w 126 vs. 125 µm NSD [43]
60 ip 8-12 w NSD [28]
124.5 vs. 124.4 µm EPI NSD, 119.9 vs 121.7
60 ip 12 w [11]
ENDO NSD LV
60 ip 13-24 w 138.80 vs. 136.93 µm NSD [49]
60 ip 20 w 134.88 vs. 134.94 µm NSD [48]
TPK Shortening 100 iv 4-6 d 0.1-2.0 Hz NSD [50]
65 ip 5-7 days 117 vs. 131 ms [8]
65 ip 5-7 days 119 vs. 181 ms [51]
65 iv 7 days 103.3 vs. 97.3 ms NSD [52]
55 iv 7w Prolonged [26]
60 ip 8w NSD [66]
55 iv 8w 0.1-2.0 Hz Prolonged [50]
55 iv 8w Prolonged [45]
60 ip 8-12 w 305 vs. 360 ms [10]
60 ip 8-12 w 105.5 vs. 137.2 ms [67]
60 ip 8-12 w 94 vs. 113 ms [46]
60 ip 8-12 w 103 vs. 135 ms [47]
60 ip 8-12 w 99 vs. 136 ms [29]
60 ip 8-12 w 73 vs. 100 ms [43]
60 ip 8-12 w Prolonged [28]
55 iv 12 w Prolonged [9]
60 ip 12 w 83 vs. 107 ms EPI, 90 vs. 110 ms ENDO [11]
60 ip 13-24 w 97.4 vs. 123.5 ms [49]
60 ip 20 w 98.1 vs. 112.1 ms [48]
THALF relaxation of
100 iv 4-6 d Prolonged [50]
shortening
55 ip 7w 285.9 vs. 445.8 ms NSD [5]
45-50 ip 7-8 weeks 382.60 vs. 472.52 ms [4]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
55 iv 8w Prolonged [50]
60 ip 8-12 w NSD [10]
60 ip 8-12 w 46.5 vs. 48.6 ms NSD [67]
60 ip 8-12 w NSD [29]

JSM Diabetol Manag 2(1): 1004 (2017)

9/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

60 ip 8-12 w NSD [68]

60 ip 8-12 weeks 41 vs. 51 ms [46]
60 ip 8-12 weeks 37 vs. 48 ms [43]
60 ip 8-12 w NSD [28]
55 iv 12 w Prolonged [9]
60 ip 12 w 51 vs. 59 ms EPI NSD, 51 vs. 59 ms ENDO [11]
60 ip 13-24 w 55.7 vs. 61.1 ms NSD [49]
60 ip 20 w 54.7 vs. 53.8 ms NSD [48]
Time to 90% relaxation of
65 ip 5-7 d 143 vs. 160 ms [8]
shortening
65 ip 5-7 days 141 vs. 184 ms [51]
65 iv 7 days 104.9 vs 138.5 ms [52]
Tau relaxation 55 iv 7w Prolonged [26]
55 iv 8w Prolonged [45]
55 iv 12 w Prolonged [9]
Velocity of shortening (+dL/
100 iv 4-6 days 0.5-2.0 Hz Slowed [50]
dt)
65 iv 7d 58 vs 58 µm/s NSD [52]
55 iv 7w Reduced [26]
55 ip 7w 132.2 vs. 75.0 µm/s [5]
45-50 ip 7-8 w 159.44 vs. 74.91 µm/s [4]
55 iv 8w 0.1-2.0 Hz Slowed [50]
55 iv 8w NSD [45]
45 8w 228.6 vs. 89.9 µm/s [37]
55 iv 12 w Lower [9]
Velocity of relengthening
100 iv 4-6 d 0.1-2.0 Hz Slowed [50]
(-dL/dt)
65 iv 7d -54 vs. -52 µm/s NSD [52]
55 iv 7w Reduced [26]
55 ip 7w 117.9 vs. 60.9 µm/s [5]
45-50 ip 7-8 w 111.56 vs. 65.21 µm/s [4]
55 iv 8w 0.1-2.0 Hz Slowed [50]
55 iv 8w NSD [45]
45 8w 186.5 vs. 77.1 µm/s [37]
55 iv 12 w Lower [9]
AMP of shortening 100 iv 4-6 d 0.1 – 2.0 Hz NSD [50]
65 ip 5-7 d 7.5 vs. 8.1% NSD [8]
65 ip 5-7 d 7.5 vs. 6.7% NSD [51]
65 iv 7d 5.69 vs. 5.51 % [52]
65 iv 7d 9.6 vs. 7.2 (0.5 Hz), 9.7 vs. 8.7 % (2 Hz) NSD [27]
55 ip 7w 11.4 vs. 8.4 µm [5]
55 iv 7w Reduced [26]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
45 8w 14.3 vs. 9.6 % [37]
55 iv 8w NSD [45]
55 iv 8w 0.1-2.0 Hz Reduced [50]
60 ip 8-12 w NSD [43]
60 ip 8-12 w 9.3 vs. 9.6 % NSD [10]
60 ip 8-12 w NSD [67]
60 ip 8-12 w NSD [29]
60 ip 8-12 w NSD [47]
60 ip 8-12 w NSD [46]
60 ip 8-12 weeks 9.3 vs. 9.6 % NSD [10]
60 ip 8-12 w NSD [28]
55 iv 12 w Lower [9]
6.0 vs. 6.1 % EPI NSD, 6.3 vs. 6.2 % ENDO
60 ip 12 w [11]
NSD
60 ip 13-24 w 7.29 vs. 7.32 % NSD [49]
60 ip 20 w 7.15 vs. 7.41 % NSD [48]
CV=Cell viability, RCL=Resting cell length, TPK=Time to peak, THALF=Time to half, AMP=Amplitude.NSD=No significant difference

JSM Diabetol Manag 2(1): 1004 (2017)

10/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

ventricular myocytes from STZ-induced diabetic rats compared L-type Calcium Current and Sodium/Calcium Ex-
to controls. change Currents in Ventricular myocytes from the
Sarcoplasmic Reticulum Calcium in Ventricular Myo- Streptozotocin-Induced Diabetic Rat
cytes from the Streptozotocin-Induced Diabetic Rat The effects of STZ-induced diabetes on L-type Ca2+ current
and Na+/Ca2+ exchange are shown in Table 11 and 12. Ventricular
The effects of STZ-induced diabetes on SR Ca2+ transport are
myocyte capacitance, which provides a measure of cell size, has
shown in Table 10. Rapid application of caffeine stimulates release
been variously reported as either unaltered [17,57,60], increased
of Ca2+ from the SR and provides a measure of releasable SR Ca2+
[18], or decreased [9] in ventricular myocytes from diabetic rats
content [58]. Generally, caffeine-evoked Ca2+ transients were
compared to controls. Entry of Ca2+ current via the L-type Ca2+
reduced [4,5,9,15,17,32,41,44,54,57] or sometimes unaltered
channels provides the primary trigger for SR Ca2+ release. The
[11,16,46] in ventricular myocytes from diabetic rats compared
density of L-type Ca2+ current across a range of test voltages
to controls. The rate of rise of the caffeine-evoked Ca2+ transient
were either unaltered [2,4,11,57,60,61], or reduced [62,63]in
was slower [4,5,9] in diabetic rat. TPK caffeine-evoked Ca2+
myocytes from diabetic hearts compared to controls. Steady-
transient was either prolonged [9] or unaltered [16], while the
state inactivation [11,60] and recovery from inactivation [11] are
rate of decay of the caffeine-evoked Ca2+ transient was generally
unaltered in ventricular myocytes from diabetic rats compared to
decreased [5,9,16,44,46] or sometimes unaltered [30] in diabetic
controls. Some studies have simultaneously measured L-type Ca2+
rats compared to controls. In contrast, the THALF decay of the
current and either shortening or Ca2+ transients. In these studies,
caffeine-evoked Ca2+ transient was prolonged [4,9,16,29] in
L-type Ca2+ current and shortening were reduced [16,29], and
ventricular myocytes from diabetic rats compared to controls.
L-type Ca2+ current was unaltered and Ca2+ transient was reduced
The recovery rate of electrically-evoked Ca2+ transients following
in myocytes from diabetic rats compared to controls[9,41].
application of caffeine was generally unaltered [11,15,28] or
Collectively, these experiments provide strong evidence that
sometimes increased [46]. SR fractional Ca2+ release (electrically-
L-type Ca2+ current may be unaltered or reduced and that
evoked as a fraction of caffeine-evoked Ca2+ transient) was
changes in L-type Ca2+ current may or may not be associated with
unaltered [16,28,46,48] in ventricular myocytes from diabetic
changes in shortening or Ca2+ transient in ventricular myocytes
rats compared to controls. Ca2+-stimulated ATPase activity was
from STZ-induced diabetic rat compared to control. Similarly,
generally decreased [26,41], but sometimes unaltered [7], SR
the Na+/Ca2+ exchange current density was reduced [18,41,63],
Ca2+ATPase mRNA was reduced [33] and SR Ca2+ ATPase protein
and the current decay was prolonged in myocytes from diabetic
was generally reduced [9,30,32,39,54] or unaltered [5,37] in
rats compared to controls [63]. These alterations in amplitude
diabetic rats compared to controls. Ryanodine receptor (RyR)
and kinetics of current were associated with reduced [18] Na+/
mRNA was unaltered [4]and RyR protein was either reduced
Ca2+exchange mRNA and generally reducedNa+/Ca2+ exchange
[9,17,32,39,54,56] or unaltered [4-6,37] in diabetic rats compared
protein [9,18,39,54] in diabetic rat hearts compared to controls.
to controls. Moreover, RyR number of functional receptors
was decreased [4] RyR activity was decreased [37] and RyR Myocardial Fibrosis in Ventricular Myocytes from the
sensitivity to Ca2+ was increased [4,5] in diabetic rats compared Streptozotocin-Induced Diabetic Rat
to controls. In general, the RyR receptors, which conveyed less
During development of DC, which is caused by hyperglycemia,
current, were more responsive to Ca2+, but instead had reduced
and the resulting changes in contraction in vivo, the heart responds
threshold for Ca2+ activation and displayed gain of function [6].
by producing the transforming growth factor beta 1, which is an
In addition calsequestrin mRNA and calsequestrin total protein
initiator and regulator of myocardial fibrosis. Another factor that
content were either reduced [33]or unaltered [9,59] in diabetic
is also involved in fibrosis is the connective tissue growth factor.
rats compared to controls.
Both factors were increased in STZ-induced diabetic hearts
Calcium Sparks in Ventricular Myocytes from the compared to controls [36]. Fibrosis was also enhanced [31] with
Streptozotocin-Induced Diabetic Rat a marked increase in type 1 collagenin diabetic hearts compared
to controls [30].
Calcium sparks represent SR Ca2+ release from clusters of
ryanodine receptors. The peak amplitude of sparks was either CONCLUSION
unaltered [17,57], lower [4,5,41] or increased [39] in myocytes
Figure 3 summarizes some of the mechanisms of Ca2+ transport
from diabetic rat compared to controls. In addition, the spark
that are altered in STZ-induced diabetic rat heart. It is well known
frequency was either increased [5,6,17,57], reduced [39,41] or
that STZ (45-65 mg/kg ip or iv), administered to adult rats,
unaltered [4], and the duration of sparks was also unaltered [4,5]
damages pancreatic beta cells and reduces the capacity of these
or reduced [6] in diabetic rats compared to controls. The TPK
cells to release insulin resulting in hyperglycemia and various
amplitude of sparks was either prolonged [17,57] or unaltered
other characteristics that are observed in DM. In vivo, and to a
[39] and the rate of Ca2+ rise was either shorter [4-6] or unaltered
certain extent in the isolated perfused heart, contractile function,
[41] in myocytes from diabetic hearts compared to controls.
in terms of amplitude and kinetics of contraction, are frequently
There was also evidence that the THALF decay of sparks were
disturbed in the STZ-induced diabetic rat heart. These contractile
either prolonged [5,17,39,57], or unaltered [6] and SR Ca2+ load
disturbances are due to many factors including alterations
was reduced [39] in ventricular myocytes from diabetic rats
in cellular Ca2+ homeostasis, disorganization of the structure
compared to controls.

JSM Diabetol Manag 2(1): 1004 (2017)

11/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Table 9: Intracellular calcium in ventricular myocytes from streptozotocin-induced diabetic rat.

Dose STZ (mg/kg
Parameter Treatment time Control vs. STZ Reference
body weight)
Resting fluorescence ratio
100 iv 4-6 d 1.72 vs. 1.59 RU NSD [50]
or calcium
65 ip 5-7 d 1.04 vs. 0.98 RU NSD [51]
65 ip 5-7 d 1.04 vs. 1.01 RU NSD [8]
65 iv 7d 1.00 vs. 0.90 RU [52]
40 iv 3-4 w Reduced [15]
45 iv 4-6 w 0.306 vs. 0.327 RU NSD [18]
50 ip 5w Increased [17]
50 ip 5w 0.41 vs. 0.49 RU [57]
55 iv 6w 79 vs. 79 nM NSD [44]
55 ip 7w 83.1 vs. 119.1 nM RU LV [5]
55 iv 7w Reduced [26]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
60 ip 8-12 w 1.13 vs. 1.08 RU [47]
60 ip 8-12 w 2.10 vs. 2.31RU [10]
60 ip 8-12 w 2.29 vs. 2.40 RU [43]
60 ip 8-12 w NSD [28]
55 iv 12 w 44 vs. 48 nM [9]
0.71 vs. 0.69 EPI NSD, 0.73 vs. 0.73 ENDO NSD
60 ip 12 w [11]
LV
60 ip 13-24 w 1.19 vs. 1.15 RU NSD [49]
65 ip 14 w Reduced [54]
60 ip 20 w 1.13 vs. 1.17 RU NSD [48]
Rate of Ca rise (+dP/dt) 55 ip 7w 78.8 vs. 12.4 f.u/s LV [5]
45-50 ip 7-8 w 39.4 vs. 9.8 f.au/s [4]
45 iv 8w 98.7 vs. 72.2 f.au/s [6]
45 8w 90.7 vs. 70.7 f.au/s [37]
55 iv 12 w Lower [9]
Rate of Ca decline (-dP/dt) 55 ip 7w 3.0 vs. 0.6 s-1 LV [5]
45-50 ip 7-8 w 3.7 vs. 1.2 s-1 [4]
45 8w 280.5 vs. 710.0 f.au/ms [37]
55 iv 12 w Lower [9]
TPK Ca transient 50 ip 4-5 w Longer [56]
60 ip 4-8 w NSD [16]
50 ip 5w Prolonged [17]
50 ip 5w 180 vs. 260 ms [57]
45-50 ip 7-8 w 65.0 vs. 200.2 ms [4]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
60 ip 8-12 w NSD [43]
60 ip 8-12 w NSD [10]
60 ip 8-12 w NSD [67]
60 ip 8-12 w NSD [29]
60 ip 8-12 w 64.1 vs. 74.3 ms NSD [47]
60 ip 8-12 w Prolonged [28]
60 ip 9w NSD [38]
55 iv 12 w Prolonged [9]
56.2 vs. 64.2 EPI ms NSD, 60.6 vs. 71.3 ms ENDO
60 ip 12 w [11]
LV
60 ip 13-24 w 63.5 vs. 76.9 ms [49]
60 ip 20 w 65.5 vs. 76.9 ms NSD [48]

THALF decay Ca transient 65 ip 5-7 days 130 vs. 170 ms [8]

40 iv 3-4 w 108 vs. 139 ms [15]
50 ip 4-5 w Longer [56]
60 ip 4-8 w 91.8 vs. 166.5 ms [16]

JSM Diabetol Manag 2(1): 1004 (2017)

12/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

50 ip 5w Prolonged [17]
50 ip 5w 500 vs. 640 ms LV [57]
50 ip 7w 231.5 vs. 1076.1 ms LV [5]
45-50 ip 7-8 w 193.2 vs. 742.6 ms [4]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
45 iv 8w 260.5 vs. 699.1 ms [6]
60 ip 8-12 w NSD [43]
60 ip 8-12 w 104.8 vs. 148.4 ms [67]
60 ip 8-12 w Prolonged [29]
60 ip 8-12 w NSD [47]
60 ip 8-12 w 215 vs. 267 ms [10]
60 ip 8-12 w Prolonged [28]
60 ip 9w Prolonged [38]
55 iv 12 w Longer [9]
189.6 vs. 197.5 ms EPI NSD, 150.3 vs 189.1 ms
60 ip 12 w [11]
ENDO LV
60 ip 13-24 w 118.4 vs. 160.3 ms [49]
60 ip 20 w 115.4 vs. 159.9 ms [48]
Tau Ca transient 100 iv 4-6 d 0.5 & 1.0 Hz Increased [50]
40 iv 3-4 w 89.6 vs. 105.2 ms [15]
55 iv 7w Elevated [26]
50 ip 8w Longer [32]
55 iv 12 w Longer [9]
Fluorescence decay time 65 ip 5-7 d 141 vs. 223 ms [51]
65 iv 7d 248 vs. 320 ms [52]
65 ip 14 w 34 vs. 47 ms [54]
AMP Ca transient 100 iv 4-6 d 2.00 vs. 1.77 RU [50]
0.5 Hz 4.78 vs. 4.03 FU
65 iv 7d [27]
2.0 Hz 3.64 vs. 3.50 FU NSD
40 iv 3-4 w Decreased [15]
50 ip 4-5 w Decreased [56]
45 iv 4-6 w 0.377 vs. 0.399 RU NSD [18]
60 ip 4-8 w NSD [16]
50 ip 5w Reduced [17]
50 ip 5w 0.35 vs. 0.23 AU [57]
55 iv 7w Reduced [26]
55 ip 7w 3.0 vs. 1.1 f.u LV [5]
45-50 ip 7-8 w 2.3 vs. 1.1 f.au [4]
60 ip 8w NSD [65]
60 ip 8w NSD [66]
50 ip 8w Decreased [32]
50 ip 8w 1.82 vs. 1.46 RU [41]
45 iv 8w 4.4 vs. 3.0 fu [6]
45 8w 6.1 vs. 3.8 f.au [37]
60 ip 8-12 w NSD [43]
60 ip 8-12 w NSD [67]
60 ip 8-12 w NSD [29]
60 ip 8-12 w NSD [47]
60 ip 8-12 w NSD [46]
60 ip 8-12 w 0.29 vs. 0.39 RU [10]
60 ip 8-12 w NSD [28]
60 ip 9w Reduced [38]
55 iv 12 w Lower [9]
0.17 vs. 0.18 EPI NSD, 0.20 vs. 0.19 RU ENDO
60 ip 12 w [11]
NSD LV
60 ip 13-24 w 0.42 vs. 0.43 RU NSD [49]
65 ip 14 w 0.25 vs. 0.21 RU [54]
60 ip 20 w 0.39 vs. 0.47 RU NSD [48]
RU=Ratio Units, AU=Arbitrary Units, FU=Fluorescence Units, TPK=Time to peak, THALF=Time to half, AMP=Amplitude.NSD=No significant
difference

JSM Diabetol Manag 2(1): 1004 (2017)

13/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

Table 10: Sarcoplasmic reticulum calciumtransport in ventricular myocytes from the streptozotocin-induced diabetic rat.
Dose STZ (mg/kg body
Parameter Treatment time Control vs. STZ Reference
weight)
AMP caffeine-evoked Ca
40 3-4 w 3-4 w 210.1 vs. 140.8 nM Reduced [15]
transient
50ip 5w 0.42 vs. 0.36 AU [57]
50 ip 5w Reduced [17]
55 6 w 6w 303 vs. 208 nM. Reduced [44]
60 ip 6-8 w 25.7 vs. 25.9 % NSD [16]
55 ip 7w Reduced LV [5]
45-50 ip 7-8 w 0.26 vs. 0.20 RU [4]
60 ip 8w NSD [66]
60 ip 8-12 w NSD [46]
60 ip 8-12 w NSD [28]
60 ip 8w NSD [65]
50 ip 8w Reduced [32]
50 ip 8w Reduced [41]
55 iv 12 w Reduced [9]
60 ip 12 w EPI ENDO LV NSD [11]
65 14 w 0.89 vs. 0.57 RU [54]
Rate of rise of caffeine-evoked
55 7w 0.014 vs. 0.040 RU/s LV [5]
Ca transient
45-50 ip 7-8 w 0.058 vs. 0.048 RU/s [4]
55 iv 12 w Decreased [9]
TPK caffeine-evoked Ca
60 ip 6-8 w 250.3 vs.330.1 ms NSD [16]
transient
55 iv 12 w Prolonged [9]
Rate of decay of the caffeine- 55 38 vs. 14 nM/sec Decreased [44]
6w
evoked Ca transient
60 ip 6-8 w 0.73 vs. 0.56 RU/s [16]
60iv 8w NSD [30]
60 ip 8-12 w Decreased [46]
55 iv 12 w Decreased [9]
THALF decline of the caffeine-
60 6-8 w 91.8 vs. 156.1 ms [16]
evoked Ca transient
55 ip 7w 17.31 vs. 8.66 s LV [5]
45-50 ip 7-8 w 6.70 vs. 11.29 s [4]
60 ip 8-12 w Prolonged [29]
55 iv 12 w 0.52 vs. 1.00 s [9]
Tau rate of decline of the
45-50 ip 7-8 w 0.116 vs. 0.065 s-1 [4]
caffeine-evoked Ca transient
55 iv 12 w 0.54 vs. 1.18 s [9]
Recovery rate of electrically-
evoked Ca transient after 40 iv 3-4 w 2.26 vs. 3.15 s NSD [15]
caffeine-evoked Ca transient
60 ip 8w NSD [65]
60 ip 8w NSD [66]
60 ip 8-12 w NSD [28]
60 ip 8-12 w Increased [46]
60 ip 12 w ENDO EPI LV NSD [11]
SR fractional Ca release 60 ip 6-8 w 89.7 vs. 83.5 NSD [16]
60 ip 8w NSD [65]
60 ip 8w Increased [66]
60 ip 8-12 w NSD [28]
60 ip 8-12 w NSD [46]
60 ip 8-12 w NSD [28]
60 ip 12 w ENDO NSD EPI Decreased LV [69]
60 20 w NSD [48]

JSM Diabetol Manag 2(1): 1004 (2017)

14/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

SR Ca uptake 65 iv 15-27 d Reduced 21-27 d [7]

55 iv 12 w 0.482 vs. 0.149 µM/s [9]
SR Ca-stimulated ATPase 65 iv 15-27 d Reduced 21-27 d [7]
50 ip 8w Decreased [41]
SR Ca ATPase mRNA 60 ip 8w Reduced [33]
SR Ca ATPase protein
55 iv 7w Reduced [26]
(SERCA2)
55 7w LV NSD [5]
60 ip 8w Reduced [33]
50 ip 8w Reduced [41]
50 8w Reduced [32]
45 8w NSD [37]
60 iv 8w Reduced [30]
60 ip 12 w Reduced [39]
55 iv 12 w Reduced [9]
65 ip 14 w Reduced [54]
PLB/PLN protein 55 ip 7w NSD LV [5]
55 iv 7w NSD [26]
50 ip 8w NSD [41]
45 8w NSD [37]
60 ip 12 w Increased [39]
55 iv 12 w Increased [9]
PLB/PLN Ser 16/Thr 17
55 ip 7w NSD LV [5]
(Phos)
50 ip 8w NSD [41]
60 ip 12 w Reduced [39]
RyR mRNA 45-50 ip 7-8 w NSD [4]
RyR protein 50 ip 4-5 w Reduced [56]
50 ip 5w Reduced [17]
55 7w LV NSD [5]
45-50 ip 7-8 w NSD [4]
45 8w NSD [6]
50 8w Reduced [32]
45 8w NSD [37]
55 iv 12 w Reduced [9]
65 14 w Reduced [54]
RyR2 phosphorylated 50 ip 4-5 w Increased [56]
50 ip 5w Reduced [17]
55 ip 7w Increased LV [5]
Phos RyR2/RyR2 50 ip 4-5 w Decreased [56]
Vmax Ca uptake into SR 55 iv 12 w Decreased [9]
TPK=Time to peak, THALF=Time to half, AMP=Amplitude.NSD=No significant difference

Table 11: L-type Ca2+ current in ventricular myocytes from the streptozotocin-induced diabetic rat.
Dose STZ (mg/kg body
Parameter Treatment time Control vs. STZ Reference
weight)
Myocyte capacitance 40 iv 3-4 q 127.4 vs. 127.7 pF NSD [61]
40 iv 3-4 w 123 vs. 106 pF NSD [63]
45 iv 4-6 w 134.4 vs. 146.8 pF NSD [18]
60 iv 4-6 w 196.1 vs. 175.7 pF NSD [60]
50 ip 5w 189.9 vs. 180.6 pF NSD [57]
50 ip 5w 189.9 vs 180.6 pF NSD [17]
60 ip 8-12 w NSD [29]
55 iv 12 w 173.82 vs. 112.71 pF [9]
L-type Ca2+ current density 40 iv 3-4 w Reduced [63]
40 iv 3-4 w NSD [61]
60iv 4-6 w 7.5 vs. 8.3 pA/pF NSD [60]

JSM Diabetol Manag 2(1): 1004 (2017)

15/18
 Howarth et al. (2017)
Email:


Central 
Bringing Excellence in Open Access

60 ip 4-10 w Reduced [16]

50 5w NSD [57]
45-50 7-8 w 12.0 vs. 11.8 pA/pF NSD [4]
60 ip 8w 11.27 vs. 7.36 pA/pF [66]
50 iv 8w NSD LV [2]
Peak current -0.465 vs. –0.304
60 ip 8-12 w [67]
nA
60 ip 12 w Unaltered EPI ENDO LV [11]
65 24-34 w Reduced [62]
EPI=Epicardial, ENDO=Endocardial.NSD=No significant difference

Table 12: Sodium/calcium exchange in ventricular myocytes from the streptozotocin-induced diabetic rat.
Dose STZ (mg/kg body
Parameter Treatment time Control vs. STZ Reference
weight)
Na+/Ca2+ exchange current
40 iv 3-4 w 0.49 vs. 0.33 pA/pF [63]
density
45iv 4-6 w 3.50 vs. 1.94 pA/pF [18]
50 ip 8w Reduced [41]
Na+/Ca2+ current decay 40 iv 3-4 w 1.59 vs. 3.42 s [63]
NCX1 protein 45 iv 4-6 w 100 vs. 69 % [18]
60 iv 8w NSD [30]
55 iv 12 w Reduced [9]
65 14 w Reduced [54]
60 ip 12 w Reduced [39]
Reversal potential 45 iv 4-6 w -96 vs. -89 mV [18]
NSD=No significant difference

of the myocytes, apoptosis, endothelial and mitochondrial
dysfunctions, fibrosis and remodeling of the myocardium. In turn,
these endogenous processes lead to hemodynamic dysfunction
including reduced cardiac output, reduced stroke volume and
ejection fraction, reduced percentage of fractional shortening,
reduced systolic and increased diastolic pressure, and lower rate
of pressure development and decline. In ventricular myocytes,
the amplitude of shortening is frequently reduced and the time
course of shortening and re-lengthening may be prolonged
(delayed contraction) and this can be partly attributed to
derangement in cellular Ca2+ transport. Alterations in cellular
Ca2+transport,including disturbances in L-type Ca2+current(the
primary trigger for SR Ca2+ release), Na+/Ca2+ exchange current
(the major pathway for Ca2+ efflux from the cell), SR Ca2+ content
and SR Ca2+ uptake and release mechanism(s) all contribute to
contractile dysfunction in the STZ-induced diabetic rat heart.
ACKNOWLEDGMENTS
of streptozotocin-induced diabetes on the electrocardiogram, physical
activity and body temperature in rats. Exp Physiol. 2005; 90: 827-835.
4. Shao CH, Rozanski GJ, Patel KP, Bidasee KR. Dyssynchronous (non-
uniform) Ca2+ release in myocytes from streptozotocin-induced
diabetic rats. J Mol Cell Cardiol. 2007; 42: 234-246.
5. Shao CH, Wehrens XH, Wyatt TA, Parbhu S, Rozanski GJ, Patel KP, et
al. Exercise training during diabetes attenuates cardiac ryanodine
receptor dysregulation. J Appl Physiol (1985 ). 2009; 106:1280-1292.
6. Tian C, Shao CH, Moore CJ, Kutty S, Walseth T, DeSouza C, et al. Gain
of function of cardiac ryanodine receptor in a rat model of type 1
diabetes. Cardiovasc Res. 2011; 91: 300-309.
7. Takeda N, Dixon IM, Hata T, Elimban V, Shah KR, Dhalla NS. Sequence
of alterations in subcellular organelles during the development of
heart dysfunction in diabetes. Diabetes Res and Clin Pract. 1996; 30:
113-122.
8. Ren J, Walsh MF, Hamaty M, Sowers JR, Brown RA. Altered inotropic
response to IGF-I in diabetic rat heart: influence of intracellular Ca2+
and NO. Am J Physiol. 1998; 275: H823-H830.

Grants from the College of Medicine & Health Sciences,
United Arab Emirates University, Al Ain; United Arab Emirates
University, Al Ain; Sheikh Hamdan Bin Rashid Al Maktoum
Award, Dubai; Zayed University, Abu Dhabi.
REFERENCES
1. Lenzen S. The mechanisms of alloxan- and streptozotocin-induced
diabetes. Diabetologia. 2008; 51: 216-226.
2. Ding Y, Zou R, Judd RL, Zhong J. Endothelin-1 receptor blockade
prevented the electrophysiological dysfunction in cardiac myocytes of
streptozotocin-induced diabetic rats. Endocrine. 2006; 30: 121-127.
3. Howarth FC, Jacobson M, Shafiullah M, Adeghate E. Long-term effects
9. Choi KM, Zhong Y, Hoit BD, Grupp IL, Hahn H, Dilly KW, et al. Defective
intracellular Ca(2+) signaling contributes to cardiomyopathy in Type 1
diabetic rats. Am J Physiol Heart Circ Physiol. 2002 ;283: H1398-1408.
10. Howarth FC, Adem A, Adeghate EA, Al Ali NA, Al Bastaki AM, Sorour
FR, et al. Distribution of atrial natriuretic peptide and its effects on
contraction and intracellular calcium in ventricular myocytes from
streptozotocin-ind... Peptides. 2005; 26: 691-700.
11. Smail MM, Qureshi MA, Shmygol A, Oz M, Singh J, Sydorenko V, et al.
Regional effects of streptozotocin-induced diabetes on shortening and
calcium transport in epicardial and endocardial myocytes from rat left
ventricle. Physiol Rep. 2016; 4: e13034.
12. Bodi I, Mikala G, Koch SE, Akhter SA, Schwartz A. The L-type calcium

JSM Diabetol Manag 2(1): 1004 (2017)

16/18


Central 
Bringing Excellence in Open Access
channel in the heart: the beat goes on. J Clin Invest. 2005; 115: 3306-
3317.
13. Brette F, Leroy J, Le Guennec JY, Sallé L. Ca2+ currents in cardiac
myocytes: Old story, new insights. Prog Biophys Mol Biol. 2006; 91:
1-82.
14. Bers DM1. Cardiac excitation-contraction coupling. Nature. 2002; 415:
198-205.
15. Lagadic-Gossmann D, Buckler KJ, Le Prigent K, Feuvray D. Altered
Ca2+ handling in ventricular myocytes isolated from diabetic rats. Am
J Physiol. 1996; 270: H1529-537.
16. Bracken N, Howarth FC, Singh J. Effects of streptozotocin-induced
diabetes on contraction and calcium transport in rat ventricular
cardiomyocytes. Ann N Y Acad Sci. 2006; 1084: 208-222.
17. Yaras N, Bilginoglu A, Vassort G, Turan B. Restoration of diabetes-
induced abnormal local Ca2+ release in cardiomyocytes by angiotensin
II receptor blockade. Am J Physiol Heart Circ Physiol. 2007; 292:
H912-20.
18. Hattori Y, Matsuda N, Kimura J, Ishitani T, Tamada A, Gando S, et al.
Diminished function and expression of the cardiac Na+-Ca2+ exchanger
in diabetic rats: implication in Ca2+ overload. J Physiol. 2000; 527: 85-
94.
19. White FR. Streptozotocin. Cancer Chemother Rep. 1963; 30: 49-53.
20. Schein PS, Cooney DA, Vernon ML. The use of nicotinamide to modify
the toxicity of streptozotocin diabetes without loss of antitumor
activity. Cancer Res. 1967; 27: 2324-2332.
21. Rerup CC. Drugs producing diabetes through damage of the insulin
secreting cells. Pharmacol Rev. 1970; 22: 485-518.
22. Weiss RB. Streptozocin: a review of its pharmacology, efficacy, and
toxicity. Cancer Treat Rep. 1982; 66: 427-438.
23. Szkudelski T. The mechanism of alloxan and streptozotocin action in B
cells of the rat pancreas. Physiol Res. 2001; 50: 537-546.
24. Belcastro AN, Maybank P, Rossiter M, Secord D. Effect of endurance
swimming on rat cardiac myofibrillar ATPase with experimental
diabetes. Can J Physiol Pharmacol. 1985; 63: 1202-1205.
25. Howarth FC, Al-Shamsi N, Al-Qaydi M, Al-Mazrouei M, Qureshi
A, Chandranath SI, et al. Effects of brain natriuretic peptide on
contraction and intracellular Ca2+ in ventricular myocytes from the
streptozotocin-induced diabetic rat. Ann N Y Acad Sci. 2006; 1084:
155-165.
26. Norby FL, Wold LE, Duan J, Hintz KK, Ren J. IGF-I attenuates diabetes-
induced cardiac contractile dysfunction in ventricular myocytes. Am J
Physiol Endocrinol Metab. 2002; 283: E658-E666. 43. Howarth FC, Qureshi MA. Effects of carbenoxolone on heart rhythm,
27. Cagalinec M, Waczulíková I, Uličná O, Chorvat D Jr. Morphology and
contractility of cardiac myocytes in early stages of streptozotocin-
induced diabetes mellitus in rats. Physiol Res. 2013; 62: 489-501.
28. Howarth FC, Qureshi MA, White E. Effects of hyperosmotic shrinking
on ventricular myocyte shortening and intracellular Ca(2+) in
streptozotocin-induced diabetic rats. Pflugers Arch. 2002; 444: 446-
51.
29. Bracken NK, Woodall AJ, Howarth FC, Singh J. Voltage-dependence
of contraction in streptozotocin-induced diabetic myocytes. Mol Cell
Biochem. 2004; 261: 235-243.
30. Zhang L, Ward ML, Phillips AR, Zhang S, Kennedy J, Barry B, et al.
Protection of the heart by treatment with a divalent-copper-selective
chelator reveals a novel mechanism underlying cardiomyopathy in
diabetic rats. Cardiovasc Diabetol. 2013; 12:123.
JSM Diabetol Manag 2(1): 1004 (2017)
Howarth et al. (2017)
Email:
31. Delucchi F, Berni R, Frati C, Cavalli S, Graiani G, Sala R, et al. Resveratrol
treatment reduces cardiac progenitor cell dysfunction and prevents
morpho-functional ventricular remodeling in type-1 diabetic rats.
PLoS One. 2012; 7: e39836.
32. Kranstuber AL, Del Rio C, Biesiadecki BJ, Hamlin RL, Ottobre J, Gyorke
S, et al. Advanced glycation end product cross-link breaker attenuates
diabetes-induced cardiac dysfunction by improving sarcoplasmic
reticulum calcium handling. Front Physiol. 2012; 3: 292.
33. Cheng YS, Dai DZ, Dai Y, Zhu DD, Liu BC. Exogenous hydrogen sulphide
ameliorates diabetic cardiomyopathy in rats by reversing disordered
calcium-handling system in sarcoplasmic reticulum. J Pharm
Pharmacol. 2016; 68: 379-388.
34. Galderisi M, Celentano A, Tammaro P, Garofalo M, Mureddu GF, de
Divitiis O. Hypertension and arrhythmias: effects of slow-release
nicardipine vs chlorthalidone: a double-blind crossover study. Int J
Clin Pharmacol Ther Toxicol. 1990; 28: 410-415.
35. Afzal N, Ganguly PK, Dhalla KS, Pierce GN, Singal PK, Dhalla NS.
Beneficial effects of verapamil in diabetic cardiomyopathy. Diabetes.
1988; 37: 936-942.
36. Liu Y, Qi H, Wang Y, Wu M, Cao Y, Huang W, et al. Allicin protects
against myocardial apoptosis and fibrosis in streptozotocin-induced
diabetic rats. Phytomedicine. 2012; 19: 693-698.
37. Moore CJ, Shao CH, Nagai R, Kutty S, Singh J, Bidasee KR. Mol Cell
Biochem. 2013; 376:121-1 35.
38. da Silva MF, Natali AJ, da SE, Gomes GJ, Teodoro BG, Cunha DN, et al.
Attenuation of Ca2+ homeostasis, oxidative stress, and mitochondrial
dysfunctions in diabetic rat heart: insulin therapy or aerobic exercise?
J Appl Physiol(1985 ). 2015; 119: 148-156.
39. Zhao SM, Wang YL, Guo CY, Chen JL, Wu YQ. Progressive decay of
Ca2+ homeostasis in the development of diabetic cardiomyopathy.
Cardiovasc Diabetol. 2014; 13: 75.
40. Howarth FC, Jacobson M, Naseer O, Adeghate E. Short-term effects of
streptozotocin-induced diabetes on the electrocardiogram, physical
activity and body temperature in rats. Exp Physiol. 2005; 90: 237-245.
41. Lacombe VA, Viatchenko-Karpinski S, Terentyev D, Sridhar A, Emani
S, Bonagura JD, et al. Mechanisms of impaired calcium handling
underlying subclinical diastolic dysfunction in diabetes. Am J Physiol
Regul Integr Comp Physiol. 2007; 293: R1787-R1797.
42. Liu Z, Cai H, Zhu H, Toque H, Zhao N, Qiu C, et al. Protein kinase RNA-
like endoplasmic reticulum kinase (PERK)/calcineurin signaling is a
novel pathway regulating intracellular calcium accumulation ... Cell
Signal. 2014; 26: 2591-2600.
contractility and intracellular calcium in streptozotocin-induced
diabetic rat. Mol Cell Biochem. 2006; 289: 21-29.
44. Yu JZ, Quamme GA, McNeill JH. Altered [Ca2+]i mobilization in diabetic
cardiomyocytes: responses to caffeine, KCl, ouabain, and ATP.
Diabetes Res Clin Pract. 1995; 30: 9-20.
45. Wold LE, Relling DP, Colligan PB, Scott GI, Hintz KK, Ren BH, et al.
Characterization of contractile function in diabetic hypertensive
cardiomyopathy in adult rat ventricular myocytes. J Mol Cell Cardiol.
2001; 33: 1719-1726.
46. Rithalia A, Qureshi MA, Howarth FC, Harrison SM. Effects of halothane
on contraction and intracellular calcium in ventricular myocytes from
streptozotocin-induced diabetic rats. Br J Anaesth. 2004; 92: 246-253.
47. Howarth FC, Qureshi A, Singh J. Effects of acidosis on ventricular
myocyte shortening and intracellular Ca2+ in streptozotocin-induced
diabetic rats. Mol Cell Biochem. 2004; 261: 227-233.
17/18


Central 
Bringing Excellence in Open Access
48. Howarth FC, Almugaddum FA, Qureshi MA, Ljubisavljevic M. Effects
of varying intensity exercise on shortening and intracellular calcium
in ventricular myocytes from streptozotocin (STZ)-induced diabetic
rats. Mol Cell Biochem. 2008; 317: 161-167.
49. Howarth FC, Almugaddum FA, Qureshi MA, Ljubisavljevic M. The
effects of heavy long-term exercise on ventricular myocyte shortening
and intracellular Ca2+ in streptozotocin-induced diabetic rat. J
Diabetes Complications. 2010; 24: 278-285.
50. Ren J, Davidoff AJ. Diabetes rapidly induces contractile dysfunctions in
isolated ventricular myocytes. Am J Physiol. 1997; 272: H148-H158.
51. Ren J, Walsh MF, Hamaty M, Sowers JR, Brown RA. Augmentation of
the inotropic response to insulin in diabetic rat hearts. Life Sci. 1999;
65: 369-380.
52. Ren J, Wold LE, Epstein PN. Diabetes enhances acetaldehyde-induced
depression of cardiac myocyte contraction. Biochem Biophys Res
Commun. 2000; 269: 697-703.
53. Ha T, Kotsanas G, Wendt I. Intracellular Ca2+ and adrenergic
responsiveness of cardiac myocytes in streptozotocin-induced
diabetes. Clin Exp Pharmacol Physiol. 1999; 26: 347-353.
54. Lee TI, Chen YC, Kao YH, Hsiao FC, Lin YK, Chen YJ. Rosiglitazone
induces arrhythmogenesis in diabetic hypertensive rats with calcium
handling alteration. Int J Cardiol. 2013; 165: 299-307.
55. Ishikawa T, Kajiwara H, Kurihara S. Alterations in contractile
properties and Ca2+ handling in streptozotocin-induced diabetic rat
myocardium. Am J Physiol. 1999; 277: H2185-2194.
56. Okatan EN, Tuncay E, Turan B. Cardioprotective effect of selenium via
modulation of cardiac ryanodine receptor calcium release channels in
diabetic rat cardiomyocytes through th... J Nutr Biochem. 2013; 24:
2110-2118.
57. Yaras N, Ugur M, Ozdemir S, Gurdal H, Purali N, Lacampagne A, et al.
Effects of diabetes on ryanodine receptor Ca release channel (RyR2)
and Ca2+ homeostasis in rat heart. Diabetes. 2005; 54: 3082-3088.
58. Varro A, Negretti N, Hester SB, Eisner DA. An estimate of the calcium
content of the sarcoplasmic reticulum in rat ventricular myocytes.
Pflugers Arch. 1993; 423: 158-160.
59. Howarth FC, Glover L, Culligan K, Qureshi MA, Ohlendieck K.
Calsequestrin expression and calcium binding is increased in
Cite this article
Howarth FC, AlKury L, Smail M, Qureshi MA, Sydorenko V, et al. (2017) Effect of Streptozotocin-Induced Type 1 Diabetes Mellitus on Contraction and Calcium
Transport in the Rat Heart. JSM Diabetol Manag 2(1): 1004.
JSM Diabetol Manag 2(1): 1004 (2017)
Howarth et al. (2017)
Email:
streptozotocin-induced diabetic rat skeletal muscle though not in
cardiac muscle. Pflugers Arch. 2002; 444: 52-58.
60. Arikawa M, Takahashi N, Kira T, Hara M, Saikawa T, Sakata T.
Enhanced inhibition of L-type calcium currents by troglitazone in
streptozotocin-induced diabetic rat cardiac ventricular myocytes. Br
J Pharmacol. 2002; 136: 803-810.
61. Jourdon P, Feuvray D. Calcium and potassium currents in ventricular
myocytes isolated from diabetic rats. J Physiol. 1993; 470: 411-429.
62. Wang DW, Kiyosue T, Shigematsu S, Arita M. Abnormalities of K+ and
Ca2+ currents in ventricular myocytes from rats with chronic diabetes.
Am J Physiol. 1995; 269: H1288-1296.
63. Chattou S, Diacono J, Feuvray D. Decrease in sodium-calcium exchange
and calcium currents in diabetic rat ventricular myocytes. Acta Physiol
Scand. 1999; 166: 137-144.
64. Tappia PS, Maddaford TG, Hurtado C, Dibrov E, Austria JA, Sahi N, et
al. Defective phosphatidic acid-phospholipase C signaling in diabetic
cardiomyopathy. Biochem Biophys Res Commun. 2004; 316: 280-289.
65. Hamouda NN, Qureshi MA, Alkaabi JM, Oz M, Howarth FC. Reduction
in the amplitude of shortening and Ca(2+) transient by phlorizin and
quercetin-3-O-glucoside in ventricular myocytes from streptozotocin-
induced diabetic rats. Physiol Res. 2016; 65: 239-250.
66. Hamouda NN, Sydorenko V, Qureshi MA, Alkaabi JM, Oz M, Howarth
FC. Dapagliflozin reduces the amplitude of shortening and Ca(2+)
transient in ventricular myocytes from streptozotocin-induced
diabetic rats. Mol Cell Biochem. 2015; 400: 57-68.
67. Woodall A, Bracken N, Qureshi A, Howarth FC, Singh J. Halothane
alters contractility and Ca2+ transport in ventricular myocytes from
streptozotocin-induced diabetic rats. Mol Cell Biochem. 2004; 261:
251-261.
68. Toriyama T, Yokoya M, Nishida Y, Kawajiri K, Takahashi H, Kawahara
H. [Increased incidence of coronary artery disease and cardiac
death in elderly diabetic nephropathy patients undergoing chronic
hemodialysis therapy]. J Cardiol. 2000; 36: 165-171.
69. Campbell SG, Flaim SN, Leem CH, McCulloch AD Mechanisms of
transmurally varying myocyte electromechanics in an integrated
computational model. Philos Trans A Math Phys Eng Sci. 2008; 366:
3361-3380.
18/18
 diabetes research and clinical practice 103 (2014) 35–41

Contents available at ScienceDirect

Diabetes Research
and Clinical Practice
journ al h ome pa ge : www .elsevier.co m/lo cate/diabres

Streptozotocin-induced diabetes in rats diminishes

the size of the osteoprogenitor pool in bone
marrow

E. Weinberg a, T. Maymon a, O. Moses b, M. Weinreb a,*

a
Department of Oral Biology, The Maurice and Gabriela Goldschleger School of Dental Medicine,
Tel-Aviv University, Tel-Aviv, Israel
b
Department of Periodontology, The Maurice and Gabriela Goldschleger School of Dental Medicine,
Tel-Aviv University, Tel-Aviv, Israel

article info abstract

Article history: Aims: Bone formation is reduced in animals and humans with type 1 diabetes, leading to
Received 17 June 2013 lower bone mass and inferior osseous healing. Since bone formation greatly depends on the
Received in revised form recruitment of osteoblasts from their bone marrow precursors, we tested whether experi-
24 August 2013 mental type 1 diabetes in rats diminishes the number of bone marrow osteoprogenitors.
Accepted 12 November 2013 Methods: Diabetes was induced by 65 mg/kg streptozotocin and after 4 weeks, femoral bone
Available online 19 November 2013 marrow cells were extracted and cultured. Tibia and femur were frozen for further analysis.
Results: The size of the osteoprogenitor pool in bone marrow of diabetic rats was signifi-
Keywords: cantly reduced, as evidenced by (1) lower (35%) fraction of adherent stromal cells (at 24 h of
Diabetes culture); (2) lower (20–25%) alkaline phosphatase activity at 10 days of culture; and (3) lower
Bone marrow stromal cells (40%) mineralized nodule formation at 21 days of culture. Administration of insulin to
Apoptosis hyperglycemic rats normalized glycemia and abrogated most of the decline in ex vivo
Oxidative stress mineralized nodule formation. Apoptotic cells in tibial bone marrow were more numerous
in hyperglycemic rats. Also, the levels of malondialdehyde (indicator of oxidative stress)
were significantly elevated in bone marrow of diabetic animals.
Conclusions: Experimental type 1 diabetes diminishes the osteoprogenitor population in
bone marrow, possibly due to increased apoptosis via Oxidative Stress. Reduced number of
osteoprogenitors is likely to impair osteoblastogenesis, bone formation, and bone healing in
diabetic animals.
# 2013 Elsevier Ireland Ltd. All rights reserved.

Common to all these studies is that DM is associated with a

1. Introduction
Osteoporosis is a common complication of diabetes mellitus
(DM) and patients with either type 1 or type 2 DM experience a
higher incidence of fractures [1,2]. In addition, type 1 DM,
induced in rats or mice, results in reduced bone mass [3,4].
reduction in bone formation rate [4,5]. Systemically, reduced
bone formation leads to bone fragility, and locally, it hampers
bone healing, such as in femoral fractures [6], bone marrow
ablation [7], and insertion of titanium implants [8]. Thus,
reduced osteoblastogenesis and bone formation are promi-
nent features of DM.

* Corresponding author at: Department of Oral Biology, The Maurice and Gabriela Goldschleger School of Dental Medicine, Tel-Aviv
University, Tel-Aviv 69978, Israel. Tel.: +972 3 6406430; fax: +972 3 6409250.
E-mail address: Weinreb@post.tau.ac.il (M. Weinreb).
0168-8227/$ – see front matter # 2013 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.diabres.2013.11.015
36 diabetes research and clinical practice 103 (2014) 35–41
The actual mechanism of DM-associated osteopenia is yet
unclear. Lack of insulin action and the presence of hypergly-
cemia per se are some obvious possibilities. Recently,
attention has been drawn to AGEs (advanced glycation end
products) and oxidative stress (OxS, exaggerated production of
reactive oxygen species (ROS)) as major mechanisms of many
diabetic complications [9,10].
Accelerated AGE formation due to hyperglycemia in DM
[11] leads to their accumulation in bone tissue, which may
participate in the pathogenesis of DM-related osteoporosis [2].
Hyperglycemia in DM causes OxS either directly (via
glucose overloading of the mitochondria) or indirectly (sec-
ondary to signaling pathways such as AGEs and Polyol)) [9].
The increased ROS levels result in cell death, tissue damage
and impaired healing. As in many other DM-associated
pathologies, OxS has been implicated in the pathogenesis of
DM-related loss of bone mass [4,12], possibly via osteoblast
apoptosis.
It is well known that bone marrow includes hemopoietic
and stromal compartments and that osteoblast precursors
reside within the latter [13]. In vitro, explanted bone marrow
cells form fibroblastic colonies initiated by cells called CFUf
(colony forming units-fibroblastic) [14,15]. Given appropri-
ate culture conditions (such as dexamethasone, organic
phosphate, and ascorbate), these cells express bone-associ-
ated markers and form mineralized bone-like nodules
[16,17]. The number of osteogenic CFUs (CFU-O) declines
in conditions characterized by reduced bone formation rate,
such as aged rats [18], ovariectomized osteopenic rats [19],
IL-10 knockout osteopenic mice [20], and unloaded, osteo-
penic rat bones [21]. On the other hand, we reported that
administration of anabolic doses of PGE2 into young and old
rats increases bone formation and, in parallel, the number of
bone marrow osteoprogenitors [18,22]. Taken together,
these studies indicate that the rate of bone formation
greatly depends on the recruitment of osteoblasts from their
marrow progenitors [23] and a lower number of osteopro-
genitors within the marrow stroma may impede osteoblast
generation and bone formation and will compromise bone
mass and healing.
The objective of this study was to test whether type 1 DM in
rats, which is known to cause diminished bone formation and
lower bone mass, results in a reduced number of osteopro-
genitors in bone marrow.
2. Materials and methods
Four-month-old Wistar rats (8–10 per group) were used in all
experiments in this study, except where noted otherwise. All
animal procedures were approved by the animal use ethics
committee of the Faculty of Medicine, Tel-Aviv University.
2.1. Materials
Chemicals for tissue culture were from Biological Indus-
tries (Beit Haemek, Israel), unless otherwise stated.
Dexamethasone (DEX), streptozotocin (STZ), ascorbic acid,
naphthol AS-MX phosphate, fast red violet B, phosphatase
substrate, alkaline buffer solution, silver nitrate, sodium
carbonate and formalin were from Sigma–Aldrich (Reho-
vot, Israel). Beta-glycerophosphate (b-GP) was from Cal-
biochem (La Jolla, CA, USA). Tissue culture dishes were
from Nunc (Rosekilde, Denmark). HbA1c levels were
measured with the Glyco-tek column kit from Helena
Laboratories (Beaumont, TX, USA). Ketamine chlorhydrate
was from Rhone-Mérieux (Lyon, France) and Xylazine from
Vitamed (Bat-Yam, Israel). Sustained-release insulin
implants were from LinShin (Toronto, ON, Canada). OXI-
TEK TBARS assay kit was from Enzo Life Sciences (Lausen,
Switzerland) and BCA protein determination kit was from
Pierce (Rockford, IL, USA).
2.2. Induction of DM and insulin repletion
Diabetes in rats was induced with a single intra-peritoneal (IP)
administration of streptozotocin (65 mg/kg of body weight)
diluted in citrate buffer (0.01 M, pH = 4.3). Control animals
receive the buffer alone. Animals were given food and water
ad libitum and body weight was continuously monitored.
Blood glucose level was evaluated at regular intervals using a
glucometer (Accu-Check, Roche Diagnostics, Basel,
Switzerland) and rats with blood glucose level >250 mg/dL
were considered diabetic.
In one of the experiments, STZ-injected animals were
treated with insulin via sustained-release implants or with
identical implants without insulin (sham). Success of insulin
repletion was monitored via blood glucose and HbA1c levels.
2.3. Isolation and enumeration of BMSCs
Four weeks after injection of STZ, rats were sacrificed with an
overdose of ketamine chlorhydrate (90 mg/kg) and xylazine
(10 mg/kg), followed by asphyxiation with carbon dioxide.
Blood was collected from the tail vein for final glucose and
HbA1C measurements. Femurs were retrieved and bone
marrow was expelled and pooled from both femurs of each
animal. Cells were counted with a hemocytometer and seeded
in 6-well plates at 2  107 cells/well in a medium composed of
Minimum Essential Medium-Alpha containing 5.5 mmol/L D-
glucose in triplicates for each assay. This medium was
supplemented with 13% fetal Calf Serum (FCS) + 2 mM
glutamine + 100 m/mL penicillin + 100 mg/mL streptomy-
cin + 12.5 U/mL Nystatin (basic medium). After 24 h, cultures
were washed with PBS to remove non adherent cells and
attached cells were collected with 0.25 w/v trypsin/0.02 w/v
EDTA, counted and their number calculated as percent of the
cells seeded.
2.4. Osteoblastic differentiation
Explanted cells were seeded in 6-well plates as described,
in basic culture medium supplemented with 10 mM b-
GP + 50 mg/mL ascorbic acid + 10 nM DEX (osteogenic medi-
um). Cultures were washed with PBS after 24 h to remove
non-adherent cells and were cultured for 10 or 21 days at
5% CO2 and 37 8C in the same medium, which was changed
twice a week. The number of osteoprogenitor cells was
evaluated by measuring alkaline phosphatase (ALP) activi-
ty and mineralized nodule formation as described below.
 diabetes research and clinical practice 103 (2014) 35–41
2.5. ALP activity
For in situ histochemical assessment, cultures were fixed on
day 10 in a 1:1:1.5 solution of 10% formalin/methanol/water for
2 h. Dishes were stained with naphthol AS-MX phosphate and
fast red violet B solution and the area of positively stained
(purple) nodules (representing CFU-ALP = ALP-positive colony
forming units) was determined per dish using an image
analysis system (NOVA, BIOQUANT Corporation, Nashville).
For biochemical measurement of ALP activity, cells were
washed in PBS on day 10, scraped in 10 mmol/L Tris-HCl buffer
(pH 7.6) containing 10 mmol/L MgCl2 and 0.1% Triton X-100,
and stored at 20 8C until use. Protein content was measured
using the BCA protein determination kit and lysates were
incubated with phosphatase substrate and alkaline buffer
solution for 15 min at 37 8C and then quenched by addition of
0.2 N NaOH. The resulting optical density was measured at
405 nm using a SpectraMax 190 Microplate reader (Molecular
Devices, Sunnyvale, CA). ALP activity was expressed as
International Units per milligram protein (IU/mg protein).
2.6. Mineralized nodule formation
On day 21, cultures were washed in PBS, fixed as indicated
above and stained with the Von Kossa method [21]. Briefly,
cells were washed with distilled water, treated with 5% silver
nitrate for 15 min, washed again with distilled water, treated
with 5% sodium carbonate in 25% formalin for 5 min and
washed with tap water. The area of mineralized nodules
(stained black, representing CFU-O = colony forming unit,
osteoblastic) was determined per dish using the same image
analysis system. Due to the vast number of dishes for BMSC
cultures generated from each animal, the experiment de-
scribed hitherto was divided into 2 similar parts. In each part,
values belonging to control (normoglycemic) animals were
transformed to 100%, and data from the 2 parts were thus
merged.
2.7. In situ measurement of bone marrow cell apoptosis
Tibiae from 4 animals from each group were decalcified with
10% EDTA, embedded in paraffin and sectioned longitudinally
at 5 mm. Apoptotic cells were detected using the DeadEnd
Colorimetric TUNEL System (Promega, CA) as per the
manufacturer’s instructions. TUNEL positive cells in bone
marrow were counted in the epiphyseal bone marrow in 6–8
adjacent fields under a 10 objective of a Zeiss Axioplan 2
microscope.
2.8. Measurement of lipid peroxidation in bone
Tibiae (5–6 per group) were cleaned from the adhering
muscles; the proximal metaphysis was frozen at 70 8C until
use (4–6 weeks). Then, thawed bones were homogenized with
a polytron1 tissue disperser (Kinematica, Luzern, Switzerland)
in PBS, and centrifuged at 8000  g for 8 min at 4 8C to remove
cortical bone and epiphyseal cartilage. The levels of mal-
ondialdehyde (MDA), an indicator of lipid peroxidation and
hence tissue oxidative stress, were determined in super-
natants by the thiobarbituric acid-reacting substances
37
(TBARS) assay (OXI-TEK kit) according to the manufacturer’s
instructions. The intensity of fluorescence was read using a
SpectraMax M5 Microplate reader (Molecular Devices) at
530 nm excitation and 550 nm emission. Protein content
was measured using BCA protein determination kit. Values
of TBARS fluorescence were expressed as nmol MDA per mg of
protein.
2.9. Statistical analysis
Means and standard deviations were calculated for all
parameters and analyzed with non-paired t tests using the
SPSS (IBM) software.
3. Results
Administration of STZ successfully induced diabetes in all
animals, as evidenced by increased mean blood glucose at
sacrifice (588.2  19.3 mg/dL vs. 128.3  29.7 mg/dL in control
rats (P < 0.001)). HbA1c levels were elevated accordingly
(11.54  1.33% (102 mmol/mol) vs. 5.25  0.96% (34 mmol/
mol), respectively, P < 0.001).
The size of the osteoprogenitor pool in bone marrow was
estimated by 3 parameters: the relative number (%) of
adherent (stromal) cells (CFU-F), the extent of CFU-ALP
(ALP-positive colonies) and the extent of CFU-O (mineralized
tissue forming colonies). Fig. 1 shows that the fraction of
stromal bone marrow cells is significantly reduced (35%
lower) in hyperglycemic rats compared with normoglycemic
animals. When these cells were induced to differentiate into
osteoblasts for 10 days, the area of CFU-ALP was significantly
(>20%) lower in hyperglycemic, compared with normoglyce-
mic animals (Fig. 2A). In support of this finding, we used an
alternative biochemical method to measure ALP activity in
BMSC cultures and found it to be significantly (>20%) lower in
hyperglycemic rats (Fig. 2B). When osteoblastic differentiation
was induced for 21 days, and mineralized bone-like tissue was
formed in culture, the extent of CFU-O (Von-Kossa positive
colonies) was significantly (40%) smaller in hyperglycemic
animals (Fig. 3A). These data support the notion that STZ-
induced hyperglycemia is associated with a reduction in the
osteoprogenitor population in bone marrow.
120
Adherent (stromal) cells
(% of control animals)
100 P < 0.001
80
60
40
20
0
Control STZ
Fig. 1 – Number (mean and standard deviation (SD)) of
adherent (stromal) bone marrow cells in normoglycemic
(control) and diabetic (STZ) rats expressed as % of the
number found in control animals. Difference is
statistically significant by non-paired t-test at P < 0.001.
38 diabetes research and clinical practice 103 (2014) 35–41

A 140 result in significant bone loss [24,25] and is therefore most

(% of control animals) 120 valid for the exploration of diabetes-induced osteopenia.
Area of CFU-ALP

P < 0.05
100 The actual mechanism of DM-associated osteopenia is yet
80 unclear. Since several studies demonstrated unaltered [26] or
60 decreased [27] bone resorption in type 1 DM patients, and in
40 diabetic rats [28] and mice [29], reduced bone formation, as
20 documented in type 1 DM patients [26,30] and in in vivo
0 models of experimental diabetes [24,25,31] is likely to be the
Control STZ cause of osteopenia. This suggests that a decrease in
osteoblast number and/or activity is the major mechanism
for the DM-related reduction in bone formation. While
systemic bone remodeling requires constant recruitment of
new osteoblasts, trabecular bone formation in response to
B ‘‘acute’’ healing models is even more dependent on rapid
Biochemical ALP activity
(% of control animals)

120
100
P < 0.04
80
60
40
20
0 bone formation in type 1 DM may stem from deficit in the
Control
Fig. 2 – (A) Dish area (mean and SD) occupied by ALP-
positive colonies (CFU-ALP) in BMSC cultures of
normoglycemic (control) and diabetic (STZ) rats expressed
as % of the value found in control animals. Difference is
statistically significant by non-paired t-test at P < 0.05.
Under the bar of each group a representative ALP-stained
dish is depicted. (B) ALP activity (determined
biochemically, mean and SD) of BMSC cultures of
normoglycemic (control) and diabetic (STZ) rats expressed
as % of the values found in control animals. Difference is
statistically significant by non-paired t-test at P < 0.04.
Administration of insulin to STZ-injected animals via
sustained-release implants normalized glycemia (i.e. returned
blood glucose and HbA1C levels to normal values (data not
shown) and abrogated most of the decline in CFU-O colonies
(Fig. 3B).
In a follow-up experiment, we found that apoptotic cells
were more numerous (>2-fold) in the tibial bone marrow of
hyperglycemic, compared with normoglycemic rats (Fig. 4).
Finally, to test the possible involvement of OxS in the STZ-
induced reduction in the bone marrow osteoprogenitor
population, the levels of malondialdehyde (MDA), an indicator
of lipid peroxidation and hence tissue oxidative stress, were
found to be significantly (35%) elevated in the proximal tibial
metaphysis (which comprises mainly of bone marrow) of
diabetic, compared with normoglycemic, animals (Fig. 5).
Thus, bone marrow of hyperglycemic rats contains fewer
osteoprogenitors, a higher number of apoptotic cells and
increased levels of an oxidative stress biomarker.
4. Discussion
The animal model we used, i.e. 4 weeks post-diabetes
induction with STZ in rats, has been repeatedly reported to
recruitment of osteoblasts from their stromal precursors.
Thus, according to our working hypothesis, it is not surprising
that bone formation in response to femoral fractures [6], bone
marrow ablation [7], and dental implants [8] is diminished in
diabetic animals.
Taken together, these studies imply that the decreased
STZ recruitment of osteoblasts from their marrow osteoprogeni-
tors. Our results in this study, showing reduced numbers of
osteoprogenitor cells in bone marrow of hyperglycemic rats
(also seen in diabetic mice [32]) could point to this direction.
Repletion of insulin in diabetic animals in this study
normalized glycemia and abrogated most of the decline in
ex vivo mineralized nodule formation, suggesting causal
relationship between the diabetic condition and decreased
OP number within the bone marrow. Our finding of reduced
size of the OP pool four weeks after induction of DM agrees
well with many reports documenting reduced bone formation
as early as 4 weeks after injection of STZ [24,25].
In addition, marrow adiposity is known to increase in
diabetic humans and rodents, in whom bone formation is
suppressed [33,34], suggesting a reciprocal relationship
between adiposity and bone formation. Therefore, our
hypothesis that diabetes reduces the number of osteopro-
genitors in bone marrow, certainly fits within this paradigm.
Interestingly, metformin, a well-known anti-diabetic drug,
exerts concomitant pro-osteogenic as well as anti-adipogenic
effects on rat mesenchymal stem cells [35,36], in line with this
notion.
Regarding the mechanism for fewer osteoprogenitors in
bone marrow, our data of increased number of apoptotic cells
in bone marrow of diabetic rats suggests (although it does not
prove definitively) that apoptosis of BMSCs/OPs is a likely
explanation for the reduction in their number, induced by STZ.
There are many studies showing that diabetic conditions have
detrimental effects (including apoptosis) on osteoblastic cells
in vivo (e.g. [37,38]) or that AGEs (whose levels increase in
diabetic bone) cause in vitro apoptosis of various osteoblastic
cells [39,40]. Although very little is known about the possible
apoptogenic effect of the diabetic conditions on osteopro-
genitors within the bone marrow, this possibility seems likely
since AGEs and high concentrations of glucose in vitro inhibit
the proliferation and/or osteogenic differentiation of mesen-
chymal stem cells [41,42]. In clear support for our hypothesis
that diabetic conditions induce apoptosis of osteoprogenitors,
we recently demonstrated directly that AGE-BSA increases
 diabetes research and clinical practice 103 (2014) 35–41 39

Fig. 3 – (A) Dish area (mean and SD) occupied by mineralized, Von Kossa-positive, colonies (CFU-OB) in BMSC cultures of
normoglycemic (control) and diabetic (STZ) rats, expressed as % of the value found in control animals. Difference is
statistically significant by non-paired t-test at P < 0.001. Under the bar of each group a representative Von Kossa-stained
dish is depicted. (B) Dish area (mean and SD) occupied by mineralized, Von Kossa-positive, colonies (CFU-OB) in BMSC
cultures of normoglycemic (control), diabetic (STZ) and insulin-treated diabetic (Ins) rats, expressed as % of the value found
in control animals. Difference between the diabetic and the other 2 groups is statistically significant by non-paired t-test at
P < 0.01 or P < 0.05, as indicated.

apoptosis of rat BMSCs in vitro 2- to 3-fold in a caspase-
dependent manner (Weinberg et al., [43]).
The most prominent mechanisms proposed for the
impairment of bone formation in diabetes include hypergly-
cemia per se, lack of insulin signaling, accumulation of AGEs
and oxidative stress (OxS). Recently, mounting evidence
focuses on the latter two as plausible mechanisms to many
of the DM-associated pathologies such as nephropathy,
retinopathy, neuropathy, and impaired dermal healing [44],
including osteoporosis [45].
Specifically, the search for the intracellular pathways in
which diabetic conditions induce apoptotic cell loss in various
tissues, has highlighted the participation of oxidative stress
(OxS), which may be associated with the pathogenesis of
diabetic bone disorder. In vitro data confirm that OxS can
cause death of many cell types [46], including osteoblasts [47].
Studies that examined the relationship between OxS and
diabetic bone disease in vivo have suggested that OxS may be
involved in the pathogenesis of diabetic osteopenia [4,48]. We
found that the levels of MDA, an indicator of tissue OxS, were

M M
B

Control STZ
(8.25 ± 1.27 cells per field) (21.35 ± 3.73 cells per field)
P < 0.001

Fig. 4 – Representative histologic micrographs of tibial epiphysis showing in situ detected apoptotic (TUNEL-stained) cells
(marked by black arrows). B = bone trabeculae; M = bone marrow. Hematoxylin counter-stain. Scale bar = 100 mm. Mean and
SD of cell counts are given under each photomicrograph. Difference is statistically significant by non-paired t-test at
P < 0.001.
40 diabetes research and clinical practice 103 (2014) 35–41
Fig. 5 – Concentrations (mean and SD) of malondialdehyde
(MDA, expressed as nmol/mg protein) in the tibial
metaphysis of normoglycemic (control) and hyperglycemic
(STZ) rats. Difference is statistically significant by non-
paired t-test at P < 0.01.
significantly elevated in bone marrow of diabetic, compared
with normoglycemic animals, suggesting that the local
involvement of OxS is a strong possible explanation for
osteoprogenitor apoptosis and reduced bone formation in DM.
Our finding is in agreement with those of Mordwinkin et al.
[49], who documented increased ROS (reactive oxygen species)
levels in bone marrow of diabetic mice. In clear support for our
hypothesis that OxS is involved in apoptosis of osteoprogeni-
tors in diabetes, we recently demonstrated directly that rat
BMSC apoptosis induced by AGE-BSA involves excessive ROS
production and is inhibited by the antioxidant NAC (N-
acetylcysteine) (Weinberg et al., [43]).
5. Conclusions
This study reports that streptozotocin-induced type 1 diabetes
in rats results in a diminution in the size of the osteopro-
genitor pool in bone marrow, possibly due to oxidative stress-
mediated apoptosis. This detrimental effect of hyperglycemia
on bone marrow osteoprogenitors could help explain the
reduction in bone formation and bone mass and healing,
which are constant features of this disease in humans and
animals.
Conflict of interest
The authors declare that they have no conflict of interest.
Acknowledgments
This work was performed in partial fulfillment of the
requirements for a Ph.D. degree of E. Weinberg, Sackler
Faculty of Medicine, Tel Aviv University, Israel. This study was
supported by grant no. 4824 from the Chief Scientist Office of
the Ministry of Health, Government of Israel.
references
[1] Schwartz AV. Diabetes mellitus does it affect bone? Calcif
Tissue Int 2003;73(6):515–9.
[2] Yamagishi S, Nakamura K, Inoue H. Possible participation
of advanced glycation end products in the pathogenesis of
osteoporosis in diabetic patients. Med Hypotheses
2005;65(6):1013–5.
[3] Verhaeghe J, van Herck E, Visser WJ, Suiker AM, Thomasset
M, Einhorn TA, et al. Bone and mineral metabolism in BB
rats with long-term diabetes. Decreased bone turnover and
osteoporosis. Diabetes 1990;39(4):477–82.
[4] Hamada Y, Kitazawa S, Kitazawa R, Fujii H, Kasuga M,
Fukagawa M. Histomorphometric analysis of diabetic
osteopenia in streptozotocin-induced diabetic mice: a
possible role of oxidative stress. Bone 2007;40(5):1408–14.
[5] Krakauer JC, McKenna MJ, Buderer NF, Rao DS, Whitehouse
FW, Parfitt AM. Bone loss and bone turnover in diabetes.
Diabetes 1995;44(7):775–82.
[6] Funk JR, Hale JE, Carmines D, Gooch HL, Hurwitz SR.
Biomechanical evaluation of early fracture healing in
normal and diabetic rats. J Orthop Res 2000;18(1):126–32.
[7] Lu H, Kraut D, Gerstenfeld LC, Graves DT. Diabetes
interferes with the bone formation by affecting the
expression of transcription factors that regulate osteoblast
differentiation. Endocrinology 2003;144(1):346–52.
[8] Takeshita F, Murai K, Iyama S, Ayukawa Y, Suetsugu T.
Uncontrolled diabetes hinders bone formation around
titanium implants in rat tibiae. A light and fluorescence
microscopy, and image processing study. J Periodontol
1998;69(3):314–20.
[9] Figueroa-Romero C, Sadidi M, Feldman EL. Mechanisms of
disease: the oxidative stress theory of diabetic neuropathy.
Rev Endocr Metab Disord 2008;9(4):301–14.
[10] Prasad A, Bekker P, Tsimikas S. Advanced glycation end
products and diabetic cardiovascular disease. Cardiol Rev
2012;29(4):177–83.
[11] Kim W, Hudson BI, Moser B, Guo J, Rong LL, Lu Y, et al.
Receptor for advanced glycation end products and its
ligands: a journey from the complications of diabetes to its
pathogenesis. Ann N Y Acad Sci 2005;1043:553–61.
[12] Manolagas SC, Almeida M. Gone with the Wnts: beta-
catenin, T-cell factor, forkhead box O, and oxidative stress
in age-dependent diseases of bone, lipid, and glucose
metabolism. Mol Endocrinol 2007;21(11):2605–14.
[13] Owen M. Lineage of osteogenic cells and their relationship
to the stromal system. In: Peck WA, editor. Bone and
mineral research, vol. 3. Amsterdam: Elsevier; 1985. p. 1–25.
[14] Friedenstein AJ, Chailakhjan RK, Lalykina KS. The
development of fibroblast colonies in monolayer cultures of
guinea-pig bone marrow and spleen cells. Cell Tissue Kinet
1970;3(4):393–403.
[15] Friedenstein AJ, Deriglasova UF, Kulagina NN, Panasuk AF,
Rudakowa SF, Luriá EA, et al. Precursors for fibroblasts in
different populations of hematopoietic cells as detected by
the in vitro colony assay method. Exp Hematol 1974;2(2):
83–92.
[16] Maniatopoulos C, Sodek J, Melcher AH. Bone formation
in vitro by stromal cells obtained from bone marrow of
young adult rats. Cell Tissue Res 1988;254(2):317–30.
[17] Herbertson A, Aubin JE. Dexamethasone alters the
subpopulation make-up of rat bone marrow stromal cell
cultures. J Bone Miner Res 1995;10(2):285–94.
[18] Keila S, Kelner A, Weinreb M. Systemic prostaglandin E2
increases cancellous bone formation and mass in aging
rats and stimulates their bone marrow osteogenic capacity
in vivo and in vitro. J Endocrinol 2001;168(1):131–9.
 diabetes research and clinical practice 103 (2014) 35–41
[19] Tabuchi C, Simmons DJ, Fausto A, Russell JE, Binderman I,
Avioli LV. Bone deficit in ovariectomized rats. Functional
contribution of the marrow stromal cell population and the
effect of oral dihydrotachysterol treatment. J Clin Invest
1986;78(3):637–42.
[20] Dresner-Pollak R, Gelb N, Rachmilewitz D, Karmeli F,
Weinreb M. Interleukin 10-deficient mice develop
osteopenia: decreased bone formation, and mechanical
fragility of long bones. Gastroenterology 2004;127(3):792–801.
[21] Keila S, Pitaru S, Grosskopf A, Weinreb M. Bone marrow from
mechanically unloaded rat bones expresses reduced
osteogenic capacity in vitro. J Bone Miner Res 1994;9(3):321–7.
[22] Weinreb M, Suponitzky I, Keila S. Systemic administration
of an anabolic dose of PGE2 in young rats increases the
osteogenic capacity of bone marrow. Bone 1997;20(6):521–6.
[23] Marie PJ. Human osteoblastic cells: a potential tool to
assess the etiology of pathologic bone formation. J Bone
Miner Res 1994;9(12):1847–50.
[24] Bain S, Ramamurthy NS, Impeduglia T, Scolman S, Golub
LM, Rubin C. Tetracycline prevents cancellous bone loss
and maintains near-normal rates of bone formation in
streptozotocin diabetic rats. Bone 1997;21(2):147–53.
[25] Shyng YC, Devlin H, Sloan P. The effect of streptozotocin-
induced experimental diabetes mellitus on calvarial defect
healing and bone turnover in the rat. Int J Oral Maxillofac
Surg 2001;30(1):70–4.
[26] Kemink SA, Hermus AR, Swinkels LM, Lutterman JA, Smals
AG. Osteopenia in insulin-dependent diabetes mellitus;
prevalence and aspects of pathophysiology. J Endocrinol
Invest 2000;23(5):295–303.
[27] Gunczler P, Lanes R, Paz-Martinez V, Martins R, Esaa S,
Colmenares V, et al. Decreased lumbar spine bone mass
and low bone turnover in children and adolescents with
insulin dependent diabetes mellitus followed
longitudinally. J Pediatr Endocrinol Metab 1998;11(3):413–9.
[28] Locatto ME, Abranzon H, Caferra D, Fernandez MC, Alloatti
R, Puche RC. Growth and development of bone mass in
untreated alloxan diabetic rats. Effects of collagen
glycosylation and parathyroid activity on bone turnover.
Bone Miner 1993;23(2):129–44.
[29] Botolin S, Faugere MC, Malluche H, Orth M, Meyer R,
McCabe LR. Increased bone adiposity and peroxisomal
proliferator-activated receptor-gamma2 expression in type
I diabetic mice. Endocrinology 2005;146(8):3622–31.
[30] Bouillon R, Bex M, Van Herck E, Laureys J, Dooms L, Lesaffre
E, et al. Influence of age, sex, and insulin on osteoblast
function: osteoblast dysfunction in diabetes mellitus. J Clin
Endocrinol Metab 1995;80(4):1194–202.
[31] Shires R, Teitelbaum SL, Bergfeld MA, Fallon MD,
Slatopolsky E, Avioli LV. The effect of streptozotocin-
induced chronic diabetes mellitus on bone and mineral
homeostasis in the rat. J Lab Clin Med 1981;97(2):231–40.
[32] Lozano D, de Castro LF, Dapı́a S, Andrade-Zapata I,
Manzarbeitia F, Alvarez-Arroyo MV, et al. Role of
parathyroid hormone-related protein in the decreased
osteoblast function in diabetes-related osteopenia.
Endocrinology 2009;150(5):2027–35.
[33] Botolin S, McCabe LR. Bone loss and increased bone
adiposity in spontaneous and pharmacologically induced
diabetic mice. Endocrinology 2007;148(1):198–205.
41
[34] Fowlkes JL, Bunn RC, Liu L, Wahl EC, Coleman HN, Cockrell
GE, et al. Runt-related transcription factor 2 (RUNX2) and
RUNX2-related osteogenic genes are down-regulated
throughout osteogenesis in type 1 diabetes mellitus.
Endocrinology 2008;149(4):1697–704.
[35] Gao Y, Xue J, Li X, Jia Y, Hu J. Metformin regulates
osteoblast and adipocyte differentiation of rat
mesenchymal stem cells. J Pharm Pharmacol
2008;60(12):1695–700.
[36] Molinuevo MS, Schurman L, McCarthy AD, Cortizo AM,
Tolosa MJ, Gangoiti MV, et al. Effect of metformin on bone
marrow progenitor cell differentiation: in vivo and in vitro
studies. J Bone Miner Res 2010;25(2):211–21.
[37] Motyl KJ, McCauley LK, McCabe LR. Amelioration of type I
diabetes-induced osteoporosis by parathyroid hormone is
associated with improved osteoblast survival. J Cell Physiol
2012;227(4):1326–34.
[38] Liang J, Chen H, Pan W, Xu C. Puerarin inhibits caspase-3
expression in osteoblasts of diabetic rats. Mol Med Rep
2012;5(6):1419–22.
[39] Alikhani M, Alikhani Z, Boyd C, MacLellan CM, Raptis M, Liu
R, et al. Advanced glycation end products stimulate
osteoblast apoptosis via the MAP kinase and cytosolic
apoptotic pathways. Bone 2007;40(2):345–53.
[40] Mercer N, Ahmed H, Etcheverry SB, Vasta GR, Cortizo AM.
Regulation of advanced glycation end product (AGE)
receptors and apoptosis by AGEs in osteoblast-like cells.
Mol Cell Biochem 2007;306(1–2):87–94.
[41] Gopalakrishnan V, Vignesh RC, Arunakaran J, Aruldhas
MM, Srinivasan N. Effects of glucose and its modulation by
insulin and estradiol on BMSC differentiation into
osteoblastic lineages. Biochem Cell Biol 2006;84(1):93–101.
[42] Stolzing A, Coleman N, Scutt A. Glucose-induced
replicative senescence in mesenchymal stem cells.
Rejuvenation Res 2006;9(1):31–5.
[43] Weinberg E, Maymon T, Weinreb M. AGEs induce caspase-
mediated apoptosis of rat BMSCs via TNFa production and
oxidative stress. J Mol Endocrinol 2013. in press.
[44] Ahmed N. Advanced glycation endproducts – role in
pathology of diabetic complications. Diabetes Res Clin Pract
2005;67(1):3–21.
[45] Yamagishi S. Role of advanced glycation end products
(AGEs) in osteoporosis in diabetes. Curr Drug Targets
2011;12(14):2096–102.
[46] Maiese K, Chong ZZ, Shang YC. Mechanistic insights into
diabetes mellitus and oxidative stress. Curr Med Chem
2007;14(16):1729–38.
[47] Chen RM, Wu GJ, Chang HC, Chen JT, Chen TF, Lin YL, et al.
2,6-Di-isopropylphenol protects osteoblasts from oxidative
stress-induced apoptosis through suppression of caspase-3
activation. Ann N Y Acad Sci 2005;1042:448–59.
[48] Hamada Y, Fujii H, Kitazawa R, Yodoi J, Kitazawa S,
Fukagawa M. Thioredoxin-1 overexpression in transgenic
mice attenuates streptozotocin-induced diabetic
osteopenia: a novel role of oxidative stress and therapeutic
implications. Bone 2009;44(5):936–41.
[49] Mordwinkin NM, Meeks CJ, Jadhav SS, Espinoza T, Roda N,
diZerega GS, et al. Angiotensin-(1-7) administration
reduces oxidative stress in diabetic bone marrow.
Endocrinology 2012;153(5):2189–97.
Bull Vet Inst Pulawy 53, 783-790, 2009

PATHOLOGICAL CHANGES IN THE ACUTE PHASE

OF STREPTOZOTOCIN-INDUCED DIABETIC RATS
OZGUR OZDEMIR, PINAR PEKER AKALIN1,
NURI BASPINAR1, AND FATIH HATIPOGLU

Department of Pathology, 1Department of Biochemistry, Faculty of Veterinary Medicine,

University of Selcuk, 42079, Konya, Turkey
oozdemir@selcuk.edu.tr

Received for publication May 12, 2009

Abstract

This study aimed at investigating the acute phase of pathological changes in streptozotocin-induced diabetic rats with
varying glucose levels. Eighteen rats, six control, six D1 group (with glucose level of 200-300 mg/dl), and six D2 group (with
glucose level over 300 mg/dl), were used. They were euthanasied on the 14th d after streptozotocin administration. Samples taken
from internal organs were examined under a light microscope after routine histopathology processes. The changes in the organs were
scored as light, mild and severe. The glomerulus, Bowman’s space, and renal corpuscle areas were calculated. There were significant
differences between THE diabetic groups and control in terms of degenerative lesions in the pancreas, liver, spleen, and kidneys. It
was found that increasing the area of Bowman’s space was directly proportional to blood glucose level. There was a significant
difference between D1 and D2 in terms of the number of apoptotic cells in the spleen and there was an increase in apoptosis. It was
concluded that the increased width of the Bowman’s space in the acute phase of type-I diabetes, and the changes observed in the
other organs, would be useful for further studies on diabetes.

Key words: rat, streptozotocin, diabetes mellitus, acute phase, pathology.

Diabetes mellitus is a metabolic disease, which
progresses with chronic hyperglycaemia related to
absolute and relative insulin deficiency, and it is also
induced by genetic or environmental factors. The
disease causes carbohydrate and protein and lipid
metabolism disorders (4). As a result of hyperglycaemia,
glucose combines with longer-lasting proteins in blood-
vessel walls and in interstitial tissue, thus turning into
irreversible products. Accumulation of these products
may lead to serious complications like microangiopathy,
nephropathy, neuropathy, or retinopathy (6).
Streptozotocin (STZ) is a N-methyl
nitrosocarbamil-glucosamine-structured substance
synthesised by Streptomyces achromogenes (14). It is
known that it destroys the DNA of the related cell by
increasing pancreatic β-cell poly adenine diphosphate
ribose synthetase activity, and also causes degenerative
lesions by decreasing NAD levels With these effects, it
blocks pro-insulin synthesis and leads to type I diabetes
characterised by insulin insufficiency (20, 39). One hour
after intravenous STZ administration to rats, it was
observed that STZ mostly accumulated in the liver and
kidneys, and in the pancreas at lower amounts, but
mostly combined to pancreatic proteins (20).
Histopathologically, the basic lesions occur in
the islets of Langerhans in the pancreas; while in the
other organs the lesions are supposed to relate to
metabolic disorders (4). The decrease in the number of
the islets of Langerhans and their cellular content, and
the necrosis and lymphocyte infiltration of some islets,
are noted. In the kidneys, basal vacuolisation, glycogen
accumulation, degeneration of tubular epithelium,
thickening of tubular basal membranes, hypertrophy in
glomeruli, increased mesangial matrix, hyalinisation,
glomerulosclerosis, thickening of the glomerular basal
membrane, decreasing the width of Bowman’s space,
and thickening of the parietal layer of Bowman’s
capsule, were reported, as well as changes in the chronic
phase in type I diabetes (9, 15, 28, 31, 33, 35-38, 40).
It was reported that the effect of diabetes on the
liver is related to fattening occurring in chronic cases
(11). Periportal necrosis, cell infiltration and congestion
(9), shrinking of hepatocyte nuclei and dilatation of
sinusoids were noted (23). In the studies on the liver of
rats with experimentally-induced diabetes, it was
emphasised that decreases in liver weight and volume,
narrowing of sinusoids, and shrinking of hepatocyte
nuclei, were clearly in the chronic phase (24).
Take et al. (34) pointed out that there were
significant degenerative changes in the myocardium 8
weeks after STZ injection, and Bahçeci et al. (5) noted
that the myocardium was also affected minimally in the
acute phase of diabetes; and heart-related disorders
started in this phase. Congestion and hemorrhages in the
lungs (21) and proliferation of the epithelium of the
gastrointestinal tract were also observed (23).
784
It was reported that diabetes affects gonadal
functions and decreases testosterone levels, thus leading
to insufficiency in sperm production in human and some
animals (8, 32). Additionally, degeneration and necrosis
in seminiferous tubules, giant cell formation, interstitial
changes, and changes in Leydig cells and vessel walls
were shown (3, 27, 30). Besides, reducing the size of
seminiferous tubules, degeneration of germ cells, and
increase in the incidence of apoptosis, and decrease in
testicular weight, were seen (7, 10).
Acute diabetes was reported to occur between 8
d and 3 weeks, and chronic diabetes within 3 weeks after
STZ administration (19).
In this study, the pathological changes in STZ-
diabetic rats with different blood glucose levels in the
acute phase were investigated and pathological lesions
and some parameters were compared.
Material and Methods
Rats. Male Sprague-Dawley rats (11-week-old,
200-250 g b.w.) were used. The rats were kept in
polycarbonate cages (Tecnipalst, Italy) in which each rat
had a 250 cm2 area, at 21±2 0C, in 14:10 light-darkness
cycle and were fed standard rat chow (Purina, Canada)
and water ad libitum.
In order to induce diabetes, 12 rats were given
intraperitoneally 60 mg/kg of STZ (Sigma-Aldrich) (in
0.1M citrate buffer, pH 4.5). Six rats in the control
group were given intraperitoneally (0.1ml/100g b.w.)
0.9% NaCl solution. Two weeks later, the rats with
polyphagia, polydipsia, and with blood glucose levels
higher than 200 mg/dl (Gluko Dr, Allmedicus Co. Ltd.,
Korea) were acknowledged as diabetic. According to
blood glucose levels, the rats were divided into two
groups: six rats (D1) with 200-300 mg/dl and six rats
(D2) with glucose level higher than 300 mg/dl.
Biochemical analysis. Two weeks after STZ
treatment, blood samples were taken from the tail vein
and the plasma glucose levels were determined
spectrophotometrically according to the glucose-oxidase
method (Spinreact SA, Glucose LQ, Spain), the insulin
levels were determined with rat insulin specific Linco
RIA kits (Research, USA), and the glucagon levels were
determined with pancreatic-glucagon specific Linco RIA
kits (Research, USA).
Histopathology. Two weeks after STZ
treatment, all the animals were euthanasied under
thiopental (40 mg/kg, i.p.) anaesthesia. Necropsies of the
animals were performed and the pancreases were
weighed. Samples were taken from the lungs, liver,
heart, spleen, kidneys, pancreas, intestine, and testes,
and fixed in a 10%-buffered neutral formalin. After
routine histopathological procedures, 5 µm paraffin
sections were stained with haematoxylin and eosin (HE).
In addition, the pancreas was stained with aldehyde
fuchsine-haematoxylin (AF) and the kidneys were
stained with periodic acid Schiff (PAS)-light green (18).
All the preparations were assessed under a light
microscope.
The lesions in the organs were generally scored
as light (+), mild (++), and severe (+++), according to
Vardi et al. (37). Some scorings were done according to
the following criteria: Decreasing sperma density in the
epididymis channels, full (normal) (-), partially empty
(+), half empty (++), empty (+++), apoptosis in the
spleen (400 x), 5-15 apoptotic cell (+), 15-25 (++), 25
and over (+++).
In the kidney sections, Bowman’s space,
glomerulus, and renal corpuscle areas were measured
under a light microscope (Olympus, Japan) using the
images taken with a digital camera (Olympus, Japan) by
using an image analysis program (Digital Life Science
Imaging, Olympus, Germany). For each animal,
measurements were performed on five different
glomeruli and averages of results were taken.
Statistics. The statistical assessments were
done by using the non-parametric test Mann Whitney-U
and the parametric two-sample-t test in Minitab 12.1
software program. The results of the parametric data
were given as mean ± SEM (P<0.05). The results of
nonparametric test were given by lettering according to
P<0.05.
Results and Discussion
Blood parameters and pancreas weights are
given in Table 1, the histopathological changes in the
organs are given in Table 2, and the measurements of
kidney structures are given in Table 3.
In the experimental diabetes, the period
between 8 d to 3 weeks was reported to be the acute
phase (19). In this study, the pathological changes in the
organs in the acute phase were assessed and
comparisons were made between the two different
groups in terms of blood glucose level.
The high plasma glucose and low insulin levels
in STZ-diabetic groups were found to be compatible
with the findings of other researchers (17). High
glucagon levels were compatible with the results of
Hemmings and Spafford (12). Besides, Li et al. (16)
found that the morphology of the islet α-cells changed 5
d after STZ treatment, and that while β-cells atrophied
on the 14th d they enlarged towards the middle of the α-
cell islets, and that the volume of the α-cells increased
by up to 2 to 3 times in the islet. These changes were
attributed to the increased glucagon levels in blood.
In most of the studies on experimental diabetes
(9, 15, 24, 28, 31, 33, 35-38, 40), it was noticed that
generally the findings related to chronic damage in the
pancreas, kidney, and liver were assessed, and literature
including all internal organs was very limited. The
literature available to us reported the damage and
involution in Langerhans islets and infiltration in
lymphocyte, degeneration and nuclear shrinking
(puckering) in hepatocytes, enlargement in sinusoids in
the liver, and proliferation in the epithelial layer of the
intestine (23). In rabbits there was necrosis and
decrease in terms of number of Langerhans islets,
congestion and haemorrhage in the lungs and congestion
and degeneration in the liver, and myopathy and

haemorrhage in the heart. Mild neuronal changes in the
brain were observed and no pathological changes in the
digestion channel were encountered (21).
When pancreas weights were considered, it was
observed that there was a significant decrease (P<0.05)
in the weights of diabetic groups (D1 and D2) compared
to control (Table 1). Although the difference between
D1 and D2 groups was not statistically significant
(P>0.05), it was seen that average weight in D2 group
was lower and harmonised with plasma glucose and
insulin levels, meaning that β-cells were affected by
necrosis. In histopathological investigation, necrotic
changes and a decreased number of islets was more
evidenced in group D2. Pancreas islets had distinctly
positive staining with AF in the control group (Fig. 1A),
but there was no positive staining with AF in D2 group
(Fig. 1C) and slightly positive staining in the D1 group
(Fig. 1 B). Likewise, Akbarzadeh et al. (1) determined
irreversible changes in pancreas biopsies on 10 d after
STZ treatment. Aykan et al. (4) reported that up to 60%
- 70% of pancreas islet cells consisted of β-cells, and
these cells constituted 1%-3% of pancreas weight and
the decrease in pancreas weight in diabetes was related
to necrosis of the cells. Researchers reported a
degeneration and decrease in terms of the number in the
β-cells (15, 23, 40). On the 0 d after STZ was injected,
there was 35% islet loss, and on the 3rd d there was
mononuclear cell infiltration, and it was increasing until
the 14th d and then decreased (16). There were no
observed cell infiltrations of pancreas islets in the
diabetic groups.
While the difference between the D1 and D2
groups was not statistically significant in terms of
changes in tubules (P>0.05), there was a significant
difference between experimental and control groups
(P<0.05) (Fig. 2A). Although in terms of glomerulus
areas they were not statistically different, it was
observed that the glomerulus areas in the diabetic groups
were rather smaller than in the control group. When the
Bowman’s space areas were examined, there an obvious
difference (P<0.05) was found between control and
diabetic groups (Table 3). While there was no statistical
difference between D1 and D2 (P>0.05), it was found
that the Bowman’s space areas in D2 enlarged and
groups were arranged as D2>D1>control under light-
microscope examination (Figs 1D, E, F). It was
considered that this change was owing to the effect on
the vessel walls and increased glomerular function in the
very early phases of diabetes. As a matter of fact, there
were observed pale pink accumulations in some
Bowman’s spaces. Olsen (25) reported that glomerular
hypertrophy depended on the increase in glomerular
function; however, this change could be identified
neither under a light microscope nor under electron
microscope in the early phase. To our knowledge,
contrary to the findings in this study, it was found that
there was hypertrophy in the glomeruli,
glomerulosclerosis, narrowing in the Bowman’s space,
which were mostly chronic-phase findings (22, 31, 36-
38). No change was found in the tubular and glomerular
basement membranes, but a slight thickening in the
785
parietal layer of Bowman’s capsule in the diabetic
groups was observed.
It was determined that in terms of the
degeneration of hepatocytes, the D1 and D2 groups
showed similar changes, and they were different from
the control group (P<0.05) (Table 2). In terms of
regeneration and increase in big hepatocytes, the
readings in the D2 group were higher and statistically
significant (P<0.05) compared to D1 and the control
group (Fig. 2H). This situation was observed owing to
early hyperplasia and decreased apoptosis in the liver of
rats with STZ-induced diabetes (13). The other findings
were found to be statistically insignificant. El-Soud et
al. (9) reported periportal necrosis, congestion in the
portal veins, and mononuclear cell infiltration in the
portal area three weeks after STZ administration, while
Noor et al. (23) reported contraction in the hepatocyte
nuclei and dilatation in sinusoids. Noorafshan et al. (24)
emphasised that the narrowing in the sinusoids was
evident. In the study, the difference between diabetic
groups in terms of regenerative activities was
significant, and narrowing in sinusoids, cell infiltration
in the portal area, and bile duct hyperplasia was were
observed; however, they were statistically insignificant
(P>0.05).
While there was a significant difference
between D1-D2 and control groups in terms of necrosis
and depletion in follicules in the spleen (P<0.05) (Table
2), there was no difference between D1 and D2 groups.
In terms of an increase in apoptotic cell number, the
difference between D1 and D2 groups was found to be
significant (P<0.05). The changes in the spleen in this
study were not encountered in the literature available to
us but increased rates of apoptosis in lymphocytes were
reported in diabetes (26, 29).
There was found to be a statistically-significant
difference between the diabetic groups and control in
terms of degeneration of the seminiferous tubules
(P<0.05) (Table 2). Although the statistical difference in
other findings were not significant, in diabetic groups,
tubule abnormality, giant cell formation (Fig. 2C), and
interstitial cell infiltration were more marked compared
to the control group (Fig. 2A). Only the Sertoli cells
(Fig. 2B) and seminiferous tubule basement membrane
integrity were undamaged in the testes, where severe
degeneration was observed. Owing to diabetes,
degeneration and necrosis in the seminiferous tubules,
giant cell formation, interstitial changes (3, 27, 30),
decrease in seminiferous tubules diameter, increase in
apoptosis incidence, and decrease in testis weights (7,
10) were reported. There was found to be a significant
(P<0.05) difference between diabetic and control groups
in terms of sperma density in the epididymis channels
and it was determined that in diabetes the amount of
sperma in the channels decreased dramatically (Figs 2D,
E, F). This was considered to be due to the degeneration
of the seminiferous tubules.
786

Table 1
Mean blood parameters and pancreas weights
Control (n=6) D1 (n=6) D2 (n=6)

Glucose (mg/dl) 108.17 ± 4.0c 254.50 ± 15b 381.50 ± 17a

Insulin (ng/mL) 0.76 ± 0.03b 0.31 ± 0.04a 0.26 ± 0.07a
Glucagon (pg/mL) 32.30 ± 4.70b 77.00 ± 9.70a 94.2 ± 14a
Pancreas weight (g) 1.33 ± 0.13a 0.79 ± 0.08b 0.71 ± 0.05b
a, b, c: the different letters on the same line denote statistical significance (P<0.05);
± SEM

Table 2
Histopathological findings
Organ Lesions Score Control D1 D2
(n=6) (n=6) (n=6)
Tubular distortion 2/6a 5/6a 5/6a
+ 2 3 2
++ 0 1 2
+++ 0 1 1
Tubular degeneration 0/6b 6/6a 6/6a
+ 0 0 1
++ 0 1 1
+++ 0 5 4
Giant-cell formation 1/6a 4/6a 5/6a
+ 1 0 4
++ 0 0 1
Testis

+++ 0 4 0
Interstitial-cell infiltration 0/6a 2/6a 3/6a
+ 0 0 3
++ 0 0 0
+++ 0 2 0
Oedema of vessel walls 0/6a 1/6a 2/6a
+ 0 1 2
++ 0 0 0
+++ 0 0 0
Decreased sperma density in the 0/6b 6/6a 6/6a
epididymis channels + 0 0 1
++ 0 1 1
+++ 0 5 4
Thickened alveolar walls 6/6a 6/6a 6/6a
+ 5 2 2
++ 1 4 4
+++ 0 0 0
Interstitial-cell infiltration 6/6a 5/6a 6/6a
+ 1 1 3
Lung

++ 3 2 3
+++ 2 2 0
Oedema of vessel walls 0/6a 2/6ab 5/6b
+ 0 2 2
++ 0 0 2
+++ 0 0 1
Epithelial degeneration and 0/6a 2/6a 2/6a
desquamation + 0 1 2
Small intestine

++ 0 1 0
+++ 0 0 0
Cell infiltration in lamina propria 2/6b 6/6a 6/6ab
+ 2 4 3
++ 0 2 3
+++ 0 0 0
 787

Hyperaemia 2/6b 6/6a 6/6a

+ 2 3 5
++ 0 2 1
+++ 0 1 0
Haemorrhage 0/6a 4/6a 3/6a
+ 0 3 2
++ 0 0 1
+++ 0 1 0
Heart

Hyalin degeneration and Zenker’s 0/6a 4/6a 4/6a

necrosis + 0 3 4
++ 0 1 0
+++ 0 0 0
Interstitial cell infiltration 0/6a 0/6a 1/6a
+ 0 0 1
++ 0 0 0
+++ 0 0 0
Degeneration 3/6b 6/6a 6/6a
+ 3 3 3
++ 0 3 3
+++ 0 0 0

Regeneration 1/6b 5/6b 6/6a

(binucleated hepatocytes) + 1 5 2
++ 0 0 4
+++ 0 0 0
Cell infiltration in portal area 1/6a 2/6a 3/6a
Liver

+ 1 1 3
++ 0 1 0
+++ 0 0 0
Bile duct hyperplasia 0/6a 3/6a 4/6a
+ 0 3 3
++ 0 0 1
+++ 0 0 0
Narrowing sinusoids 2/6a 5/6a 5/6a
Increase in number of large 0/6b 3/6b 6/6a
hepatocytes
Follicular depletion 0/6b 6/6a 6/6a
+ 0 6 4
++ 0 0 1
Spleen

+++ 0 0 1
Apoptosis 0/6b 2/6b 5/6a
+ 0 2 1
++ 0 0 1
+++ 0 0 3
Tubular degeneration 0/6b 6/6a 6/6a
+ 0 1 2
Kidney

++ 0 5 4
+++ 0 0 0
Hyaline droplets 0/6b 6/6a 6/6a
Hyaline cylinders 1/6b 6/6a 6/6a
a, b , c: the different letters on the same line denote statistical significance (P<0.05); light (+), mild (++), severe (+++).
788

Fig. 1. A. Pancreas. Normal islet of Langerhans (Li), AF positive staining is diffused to all islets, control, (bar 50 µm).
B. Pancreas. Necrosis in Langerhans islet, positive staining (arrowheads) decreased, group D1, AF, (bar 50 µm). C.
Pancreas. Necrosis in Langerhans islet, AF positive staining is almost absent, group D2, AF, (bar 50 µm). D. Kidney.
Normal glomerulus and tubules, control, HE, (bar 50 µm). E. Kidney. Degeneration of tubules and increase in the
Bowman’ space area (arrow), group D1, HE (bar 50 µm). F. Kidney. Degeneration of tubules and increase in the
Bowman’s space area (bilateral arrow), group D2, HE (bar 50 µm).

Fig. 2. Testis. A. Normal seminiferous tubules, control, HE (bar 200 µm). B. Degeneration of seminiferous tubules
(+++) and Sertoli cells (arrows), group D2, HE (bar 50 µm). C. Giant cells in necrotic seminiferous tubules (arrows),
basal membrane is undamaged, group D2, HE (bar 50 µm). D. Degeneration of tubules and depletion in epididymis
channels (+), group D2, HE (bar 100 µm). E. Depletion in epididymis channels (++), group D1, HE (bar 200 um). F.
Depletion in epididymis channels (+++), group D1, HE (bar 200 um). G. Lung. Severe oedema on the vessel wall
(bilateral arrow), group D2, HE (bar 50 um). H. Liver degeneration and necrosis of hepatocytes, large hepatocyte
(arrow head) and binucleated hepatocytes (arrows), group D2 (bar 50 µm). K. Intestine. Mononuclear cell infiltration in
lamina propria, group D1 (bar 100 µm).

Table 3
Mean glomerulus, Bowman’s space, and renal corpuscle areas in the kidney
Control (n=6)
Renal corpuscle area (µm2) 4,074 ± 387a
Glomerulus area (µm2) 3,385 ± 335a
Bowman’s space area (µm2) 1,049 ± 135b
a, b, c: the different letters on the same line denote statistical significance (P<0.05).
± SEM
In the heart, there was a statistically-significant
difference between diabetic and control group, but only
in terms of hyperaemia (Table 2). Although there was no
statistical significance, there was an increase in the
diabetic groups in terms of bleeding and hyaline
degeneration, and it was reported that the heart muscle
was affected at a minimal level in the acute phase of
diabetes (5). In addition, changes in plasma parameters
like insulin, glucose, leptin, and lipid concentrations
were seen to affect diabetic cardiomyopathy (2).
There was a significant difference between D2
and control groups in terms of edema in lung vessel
walls (P<0.05) (Fig. 2G) (Table 2), Crawford and Cotran
(6) reported that the glucose increase in diabetes may
affect the vessel walls and cause micro-angiopathy. The
other findings in the lungs were similar in all groups.
While the differences in the morphology of the
epithelium of the intestines were found to be
insignificant (P>0.05) only between D1 and control
group the intensity of cell infiltration in the propria was
different (P<0.05) (Fig. 2K), and the differences in the
morphology between D1 and D2, and D2-Control were
insignificant (P>0.05) (Table 2).
As a result, there were found histopathological
effects and different blood glucose levels in the acute
phase in the internal organs of the STZ-diabetic rats.
Although some of the pathological changes observed in
the organs were statistically insignificant between
groups, there were observed evident microscopic
changes.
In the kidneys, contrary to the literature data
(22, 31, 36-38), the Bowman’s space areas increased,
and it was interesting to note that an increase in the
number of apoptotic cells in the spleen was directly
proportional to the increase in blood glucose level.
It was noticed that changes of in the chronic
phase were observed in most of the studies on diabetes,
and that there were few studies on the acute phase. The
results of the presented studies contribute to the changes
in the pancreas, kidneys, and liver observed in the acute
phase of diabetes.
Acknowledgments: We thank departed
Professor Dr Metin Münir Kıran for his invaluable
contributions to the study.
789
D1 (n=6) D2 (n=6)
4,974 ± 753a 5,068 ± 843a
3,175 ± 581a 3,098 ± 475a
1,799 ± 192a 2,369 ± 454a
References
1. Akbarzadeh A., Norouzian D., Mehrabi M.R., Jamshidi
Sh., Farhangi A., Allah Verdi A., Mofidan S.M.A., Lame
Rad B.: Induction of diabetes by streptozotocin in rats.
Indian J Clin Biochem 2007, 22, 60-64.
2. An D., Rodrigues B.: Role of changes in cardiac
metabolism in development of diabetic cardiomyopathy.
Am J Physiol Heart Circ Physiol 2006, 291, 1489-1506.
3. Anderson J.E., Thliveris J.A.: Testicular histology in
streptozotocin-induced diabetes. Anat Rec 1986, 214,
378-382.
4. Aykan B.T., Tüzüner N., Sav A., İnce U.: Kısa Patoloji,
Nobel Tıp Kitabevi, İstanbul, 1990, pp. 546-552.
5. Bahçeci S., Canoruç N., Nergiz Y., Söker S., Gökalp D.,
Akbalık M.E., Tutşi Y.: Light microscopic evaluation of
cardio-vasculare system in alloksan-induced diabetic rats
in acute period. Dicle Tıp Dergisi 2007, 34, 111-115.
6. Crawfod J.M., Cotran R.S.: The Pancreas. In: Pathologic
Basis of Disease, edited by Cotran R.S., Kumar V.,
Collins T., W.B. Saunders Com., Philadelphia, 1999, pp.
913-923.
7. Cai L., Chen S., Evans T., Deng D.X., Mukherjee K.,
Chakrabarti S.: Apoptotic germ-cell death and testicular
damage in experimental diabetes, prevention by
endothelin antagonism. Urol Res 2000, 28, 342-347.
8. Cameron D.F., Murray F.T., Drylie D.D.: Interstitiel
compartment pathology and spermatogenic disruption in
testes from impotent diabetic men. Anat Rec 1985, 213,
53-62.
9. El-Soud N.H.A., Khalil M.Y., Hussein J.S., Oraby
F.S.H., Farrag A.R.H.: Antidiabetic effects of fenugreek
alkoloid axtract in streptozotocin induced hyperglicemic
rats. J Appl Sci Res 2007, 3, 1073-1083.
10. Guneli E., Tugyan K., Ozturk H., Gumustekin M.,
Cilaker S., Uysal N.: Effect of melatonin on testicular
damage in streptozotocin-induced diabetes rats. Eur Surg
Res 2008, 40, 354-360.
11. Hazıroğlu R., Milli U.H.: Veteriner Patoloji. Medipres,
Ankara, 2001, pp. 220-223.
12. Hemmings S.J., Spafford D.: Neonatal STZ model of
type II diabetes mellitus in the Fischer 344 rat,
characteristics and assessment of the status of the hepatic
adrenergic receptors. Int J Biochem Cell Biol 2000, 32,
905-919.
13. Herrman C.E., Sanders R.A., Klaunig J.E., Schvarz L.R.,
Watkins B.: Decreased apoptosis as a mechanism for
hepatomegaly in streptozotocin-induced diabetic rats.
Toxicol Sci 1999, 50, 146-151.
14. Hinz M., Katsilambros N., Maier V., Schatz H., Pfeiffer
E.F.: Significance of streptozotocin induced
nicotinamide-adenine dinucleotide (NAD) degradation in
790
mouse pancreatic islands. FEBS Letters 1973, 30, 225-
228.
15. Hu M., Wu Y., Wu H.: Influence of streptozotocin-
induced diabetes in rats on the lithium content of tissue
and the effect of diaetary lithium supplements on the this
diabetic condition. Metabolism 1999, 48, 558-563.
16. Li Z., Karlsson F.A., Sandler S.: Islet loss and α-cell
expansion in type 1 diabetes induced by multiple low-
dose streptozotocin administration in mice. J Endocrinol
2000, 165, 93-99.
17. Locatelli V., Petraglia F., Tirloni N., Müller E.E.: ß-
endorphin concentrations in the hypothalamus, pituitary,
and plasma of streptozotocin-diabetic rats with or without
insulin substitution therapy. Life Sci 1986, 38, 379-386.
18. Luna L.G.: Manuals of histologic staining methods of the
Armed Forces Institute of Pathology, McGraw-Hill Book
Company, New York, 1968.
19. Malder H., Ahren B., Sundler F.: Islet amyolid
polypeptide (amylin) and insulin are differentially
expressed in chronic diabetes induced by streptozotocin
in rats. Diabetologia 1996, 39, 649- 657.
20. Masiello P., Karunanayake E.H., Bergamini E., Hearse
D.J., Mellows G.: 12C-streptozotocin, its distribution and
interaction with nucleic acids and proteins. Biochem
Pharmacol 1981, 30, 1907-1913.
21. Mir S.H., Bagui A., Bhagat R.C., Darzi M.M., Shah
A.W.: Biochemical and histomorphological study of
streptozotocin-induced diabetes mellitus in rabbits.
Pakistan J Nutr 2008, 7, 359-364.
22. Nobrega M.A., Fleming S., Roman R.J., Shiozawa M.,
Schlick N., Lazar J., Jacob H.J.: Initial characterization
of a rat model of diabetic nephropathy. Diabetes 2004,
53, 735-742.
23. Noor A., Gunasekaran S., Manickam A.S.,
Vijayalakshmi M.A.: Antidiabetic activity of Aloe vera
and histology of organs in streptozotocin-induced
diabetic rats. Current Sci 2008, 94, 1070-1076.
24. Noorafshan A., Esmail-Zadeh B., Bahmanpour S., Poost-
Pasand A.: Early sterelogical changes in liver of Sprague-
Dawley rats after streptozotocin injection. Indian Soc
Gastroenterol 2005, 24, 104-407.
25. Olsen S.: Identification of non-diabetic glomerular
disease in renal biopsies from diabetics-a dilemma.
Nephrol Dial Transplant 1999, 14, 1846-1849.
26. Otton R., Soriano F.G., Verlengia R., Curi R.: Diabetes
induces apoptosis in lymphocytes. J Endocrinol 2004,
182, 145–156.
27. Öztürk F., Gül M., Ağkadir M., Yağmurca M.:
Histological alterations of rat testes in experimental
diabetes. T Klin J Med Sci 2002, 22, 173-178.
28. Öztürk F., Iraz M., Eşrefoğlu M., Kuruş M., Gül M., Otlu
A.: The histological alterations of experimental diabetes
on the rat kidneys. J Inonu Univ Med Fac 2005, 12,1-4.
29. Pires J., Curi R., Otton R.: Induction of apoptosis in rat
lymphocytes by starvation. Clin Sci 2007, 112, 59–67.
30. Sanguinetti R.E., Ogawa K., Kurohmaru M., Hayashi Y.:
Ultrastructural changes in mouse Leydig cells after
streptozotocin administration. Exp Anim 1995, 44, 71-
73.
31. Shortland J.R.: Kidney and urinary tract. In: General and
Systematic Pathology, Edited by Underwood J.C.E.,
Churchill Livingstone, Edinburg, 1996, pp. 617-658.
32. Steger R.W., Rabe M.: The effect of diabetes mellitus on
endocrine and reproductive function. Proc Soc Exp Biol
Med 1997, 214, 1-11.
33. Şen S., Üstündağ S., Yalçın Ö., Aydoğdu N.: Effects of
enalapril and L-carnitine in experimental diabetic
nephropathy. Official J Turkish Soc Nephrol 2002, 11,
80-86.
34. Take G., Karabay G., Yazıcı A.C., ve Erdoğan D.:
Ultrastructural demonstration of the effects of
streptozotocin-induced diabetes on heart muscle in
female rats. J Uludag Univ Med Fac 2004, 30, 199-204.
35. Tekmen I., Erbil G., Sönmez Ü.: The assesment of
antioxidant effect of vitamin E on kidney glomerule
changes in the experimental induced diabetes in rats.
Turkish J Ecopathol 2002, 8, 54-58.
36. Tunçdemir M., Öztürk M.: Effects of octreotide on
kidney and IGF-1 levels in the neonatal streptozotocin
diabetic rats. Cerrahpaşa J Med 2002, 33, 117-123.
37. Vardı N., Iraz M., Öztürk F., Uçar M., Gül M., Eşrefoğlu
M., Otlu A.: Improving effects of melatonin on the
histologic alterations of rat kidneys induced by
experimental diabetes. J Inonu Univ Med Fac 2005, 12,
145-152.
38. Vardı N., Iraz M., Gül M., Öztürk F., Uçar M., Otlu A.:
Improving effects of melatonin on the histologic
alterations of rat kidneys induced by experimental
diabetes. J Inonu Univ Med Fac 2006, 12, 145-152.
39. Yamamoto H., Uchigata Y., Okamoto H.: Streptozotocin
and alloxan induced DNA strand breaks and poly
(ADP_RİBOSE) synthetase in pancreatic islets. Nature
1981, 294, 284-286.
40. Yavuz Ö., Cam M., Bukan N., Güven A., Silan F.:
Protective effects of melatonin on β-cell damage in
streptozotoci-induced diabetes in rats. Acta Histochem
2003, 105, 261-266.

This information is current as
of November 9, 2020.
The Chemokine Binding Protein M3 Prevents
Diabetes Induced by Multiple Low Doses of
Streptozotocin
Andrea P. Martin, Jennifer M. Alexander-Brett, Claudia
Canasto-Chibuque, Alexandre Garin, Jonathan S. Bromberg,
Daved H. Fremont and Sergio A. Lira
J Immunol 2007; 178:4623-4631; ;
doi: 10.4049/jimmunol.178.7.4623
http://www.jimmunol.org/content/178/7/4623

Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020

References This article cites 48 articles, 19 of which you can access for free at:
http://www.jimmunol.org/content/178/7/4623.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision
• No Triage! Every submission reviewed by practicing scientists
• Fast Publication! 4 weeks from acceptance to publication
*average

Subscription Information about subscribing to The Journal of Immunology is online at:

http://jimmunol.org/subscription
Permissions Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Email Alerts Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by

The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
 The Journal of Immunology

The Chemokine Binding Protein M3 Prevents Diabetes

Induced by Multiple Low Doses of Streptozotocin1

Andrea P. Martin,* Jennifer M. Alexander-Brett,† Claudia Canasto-Chibuque,*

Alexandre Garin,* Jonathan S. Bromberg,*‡ Daved H. Fremont,† and Sergio A. Lira2*
Multiple injections of low-dose streptozotocin (MLDS) induce lymphocytic insulitis and diabetes in rodents. To test whether the
influx of inflammatory cells was associated with changes in the expression of chemokines, we measured the expression of all known
chemokine ligands by real-time quantitative PCR in isolated islets. With the exception of CCL20 and CCL19, chemokines were
not significantly expressed in islets from wild-type mice before MLDS treatment. Ten days after treatment, the expression of
several chemokines, including CXCL9, CCL1, CXCL10, and CCL21, was dramatically up-regulated. The expression of CCL1,
CXCL9, and CCL21 protein was confirmed by immunohistochemistry and was mostly associated with the infiltrating cells. The
mouse herpesvirus 68-encoded chemokine decoy receptor M3 can broadly engage these chemokines with high affinity. To test

Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020

whether a blockade of chemokine function would alter the onset or magnitude of insulitis and diabetes, we used transgenic mice
expressing M3 in ␤ cells (rat insulin promoter (RIP)-M3 mice). RIP-M3 mice were normoglycemic and responded normally to
glucose challenge but were remarkably resistant to diabetes induced by MLDS. Islets from MLDS-treated RIP-M3 mice had fewer
inflammatory cells and expressed lower levels of chemokines than those from MLDS-treated controls. The role of M3 in chemokine
blockade during insulitis was further supported by in vitro experiments demonstrating that multiple chemokines up-regulated
during islet inflammation are high-affinity M3 ligands that can be simultaneously sequestered. These results implicate chemokines
as key mediators of insulitis and suggest that their blockade may represent a novel strategy to prevent insulitis and islet
destruction. The Journal of Immunology, 2007, 178: 4623– 4631.

T ype 1 diabetes is an autoimmune disease characterized by
a local inflammatory reaction in and around islets that is
followed by selective destruction of insulin-secreting ␤
cells (1). The factors leading to the destruction of the islets are still
not known, but it is well accepted that immune-based mechanisms
involving macrophages and T cells are responsible for the death of
the ␤ cells (2, 3).
Experimentally induced insulin-dependent diabetes mellitus in
rodents with multiple low doses of streptozotocin (MLDS)3 is a
widely used model that has clinical and histoimmunological fea-
tures similar to those of human disease, with T cells and macro-
phages playing a major pathogenic role (4). When administered in
animals at multiple low doses, the ␤ cell toxin streptozotocin is
thought to induce initial cell damage by alkylating the DNA in islet
*Immunobiology Center, Mount Sinai School of Medicine, New York, NY 10029;
†
Department of Pathology and Immunology, Washington University School of Med-
icine, St. Louis, MO 63110; and ‡Gene and Cell Medicine, Mount Sinai School of
Medicine, New York, NY 10029
Received for publication August 16, 2006. Accepted for publication January 18, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grants DK067381 (to
S.A.L.) and AI051426 (to D.H.F.).
2
Address correspondence and reprint requests to Dr. Sergio A. Lira, Immunobiology
Center, Mount Sinai School of Medicine, 1425 Madison Avenue, Box 1630, New
York, NY 10029. E-mail address: sergio.lira@mssm.edu
3
Abbreviations used in this paper: MLDS, multiple low-doses of streptozotocin; h,
human; MHV-68, mouse herpesvirus 68; m, mouse; Q-PCR, quantitative real time
PCR; RIP, rat insulin promoter; RU, resonance unit; SPR, surface plasmon resonance;
STZ, streptozotocin; tg, transgenic; VEGF, vascular endothelial growth factor; wt,
wild type.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
cells (5) and/or by spontaneously releasing NO (6). Subsequently,
as a result of a novel ␤ cell Ag expression, mononuclear cells will
infiltrate the islets and start a multifactorial process (7) that will
lead to islet destruction and diabetes.
The trafficking of macrophages and T cells has been shown to be
regulated by chemokines, small m.w. chemoattractant proteins that
interact with G protein-coupled receptors present at the cell surface
of these leukocytes to regulate their migration, differentiation, and
function (8 –10). The migration of macrophages and T cells is con-
trolled by multiple chemokines, including CCL2, CCL21, CCL19
(9, 11, 12), CXCL10, and CXCL9 (13). The migration of mono-
cytes and macrophages is mediated by CCL2 and its receptor,
CCR2 (14). Both homeostatic and inflammatory T cell trafficking
are under the control of chemokines. The homeostatic migration of
T cells is regulated by CCL21 and CCL19. Both CCL19 and
CCL21 interact with a common receptor, CCR7, which is ex-
pressed by naive and memory T cells (15). The influx of effector
T cells into inflamed areas is regulated by multiple chemokines,
including the IFN-␥-inducible chemokines CXCL10 and CXCL9
and their receptor CXCR3 (13).
Chemokines are not highly expressed by the normal islets, but
chemokine expression has been detected in islets cultured in vitro.
Primary cultures of murine and human pancreatic islets express
and secrete CCL2 (16). CCL2 expression in the pancreas parallels
disease progression in NOD mice (17, 18). A recent study has
suggested an important role for CCL2 in the clinical outcome of
islet transplantation in patients with type I diabetes (16). Low
CCL2 secretion by islets before transplantation was the most rel-
evant factor for predicting long-lasting insulin independence.
CCL21 is not normally expressed by pancreatic islets, but its
expression has been observed in the pancreas of NOD mice (19,
20). The expression of CCL21 by the islets has been proposed

www.jimmunol.org
4624
to be an important factor contributing to autoimmunity (21).
Moreover, ␤ cells secrete CXCL9 and CXCL10 during virus-
induced diabetes (13, 22).
Interference with the chemokine system has been shown to at-
tenuate or prolong the development of experimental models of
diabetes. For instance, animals lacking the chemokine receptor
CXCR3 show a delayed onset of type 1 diabetes subsequent to a
viral infection (13). In addition, Ab neutralization of a macro-
phage-derived chemokine (CCL22) causes a significant reduction
of CCR4⫹ T cells within the pancreatic infiltrates and inhibits the
development of insulitis and diabetes in NOD mice (23). Finally,
the treatment of NOD mice with a neutralizing anti-CCR5 Ab
inhibits ␤ cell destruction and diabetes (24). In none of these mod-
els, however, is there a complete abrogation of disease, which
suggests that other factors (including additional chemokines) may
be relevant for pathogenesis.
Testing a possible role for multiple chemokines in the patho-
genesis of diabetes has been hampered by the lack of pharmaco-
logical agents with broad specificity and by the fact that many
chemokine receptor genes are clustered in the genome, which pre-
cludes the generation of compound mutants by conventional
breeding techniques. A novel tool for testing chemokine function
is M3, a chemokine-binding protein encoded by the mouse her-
pesvirus 68 (MHV-68). M3 blocks chemokine receptor-binding
interfaces and displaces and removes chemokines from inflamma-
tory sites (25). Recent studies from our laboratory show that the
expression of M3 by ␤ cells blocks lymphocyte recruitment in-
duced by transgenic (tg) expression of CCL21 (26), CCL2, and
CXCL13 (27).
In this study we show that chemokines are expressed in the islets
of mice treated with MLDS before the development of diabetes.
Furthermore, we show that the expression of the promiscuous che-
mokine decoy receptor M3 in the islets reduces the leukocyte in-
filtration and islet destruction induced by MLDS. These results
indicate that chemokines are important determinants of diabetes
and suggest that multichemokine blockade may be a novel ap-
proach to prevent insulitis and diabetes.
Materials and Methods
Transgenic mice
Rat insulin promoter (RIP)-M3 tg mice were described previously (26).
B6D2F1 mice were obtained from Charles River Laboratories. All mice
were housed under specific pathogen-free conditions in individually ven-
tilated cages at the Mount Sinai School of Medicine Animal Facility (New
York, NY). All experiments were performed following institutional
guidelines.
Streptozotocin treatment in vivo
To induce diabetes, mice (6 –10 wk of age) were injected i.p. with strep-
tozotocin (STZ) (40 mg/kg freshly dissolved in cold 0.1 M citrate buffer
(pH 4.5); Calbiochem, EMD Biosciences) for 5 consecutive days as pre-
viously described (28). Blood glucose was monitored weekly over the fol-
lowing 35 or 70 days using an Ascensia Elite XL one-touch blood glu-
cometer (Bayer). Animals were considered diabetic when their blood
glucose levels were ⬎250 mg/dl in two consecutive daily measurements. In
some experiments mice were treated with a single i.p. of STZ (300 mg/kg
body weight) and blood glucose was observed daily for 1 wk. Mice in the
control group received a corresponding volume of sodium citrate buffer
alone.
Histology
Tissues for light microscopic examination were fixed by immersion in 10%
phosphate-buffered formalin and then processed for paraffin sections. Rou-
tinely, 5-␮m sections were cut and stained with H&E. For immunohisto-
chemical staining fresh-frozen sections were first fixed with ice-cold ace-
tone for 20 min and dried and stored at ⫺20°C. Slides were incubated for
1 h at room temperature with purified primary Abs followed by incubation
with the appropriate labeled secondary Abs for 30 min. Primary Abs used
M3 PREVENTS MLDS-INDUCED DIABETES
were anti-CD45 (catalog no. 550539), CD3 (catalog no. 553058), CD11c
(catalog no. 553799), CD11b (catalog no. 553308), and CD31 (catalog no.
550274) from BD Biosciences, rat anti-insulin (catalog no. MAB1417),
anti-CCL1 (catalog no. MAB845), anti-CCL21 (catalog no. AF455) from
R&D Systems, anti-CXCL9 (provided by J. Farber and H. Zhang, National
Institute of Allergy and Infectious Diseases), and guinea pig polyclonal
anti-insulin (catalog no. A0564) from DakoCytomation. The secondary
Abs used were Alexa Fluor 488 goat anti-rat IgG (catalog no. A-11006),
Alexa Fluor 594 goat anti-rat IgG (catalog no. A-11007), and Alexa Fluor
594 goat anti-rabbit IgG (catalog no. A-11037) from Molecular Probes
and FITC anti-Guinea Pig IgG (catalog no. 127065160) from Jackson
ImmunoResearch Laboratories.
To study the cellular changes promoted by STZ treatment we performed
semiquantitative analysis on insulin/CD45-stained sections, assessing
20 – 80 islets per animal. Three grades of infiltration were based on the
number of CD45⫹ cells in or around the islet: 1 (10 –20 cells), 2 (20 –50
cells), and 3 (⬎50 cells). At least 20 sections were evaluated per mouse and
per day in a blinded fashion. Data are presented as mean insulitis score ⫾
SD for the indicated experimental groups.
Intraperitoneal glucose tolerance test
After a 16-h fast, glucose (1.5 g/kg body weight in saline (0.9% NaCl)) was
administered i.p. The blood glucose was monitored at 0, 30, 60, 120, and
Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020
240 min using an Ascensia Elite XL one-touch blood glucometer (Bayer).
Isolation of pancreatic islets of Langerhans
Islets of Langerhans were isolated as previously described (29). Briefly, the
common bile duct was clamped distal to the pancreatic duct junction at its
hepatic insertion. The proximal common bile duct was then cannulated
using a 27-gauge needle, and the pancreas was infused by retrograde in-
jection of 2 ml of ice-cold collagenase solution (1.0 mg/ml; Sigma-Aldrich)
in HBSS (Invitrogen Life Technologies). Pancreatic tissue was recovered
and subjected to a 12-min digestion at 37°C. Subsequently, ice cold HBSS
was added and the suspension was vortexed at full speed for 10 s. Islets
were hand picked under a dissection microscope. Islets were used imme-
diately after isolation to obtain RNA or protein.
Western analysis
To analyze Glut-2 expression, islets from control and tg mice were soni-
cated in freshly prepared lysis buffer (5% SDS, 80 mmol/L Tris-HCl (pH
6.8), 5 mmol/L EDTA, and 0.5 mmol/L PMSF). The supernatants contain-
ing the cell lysate were separated by centrifugation and the protein con-
centrations were determined using the MicroBCA assay (Pierce). Forty
micrograms of protein from each sample was added to loading buffer and
analyzed using 10% SDS-polyacrylamide gels. Proteins were transferred
from the gels to Immobilon-P membranes (Millipore) using standard tech-
niques. Blots were incubated with Abs against Glut-2 (Santa Cruz Bio-
technology) and actin (Sigma-Aldrich) and then with a peroxidase-conju-
gated donkey anti-goat IgG (Santa Cruz Biotechnology) and a peroxidase-
conjugated rabbit anti-mouse IgG (Abcam), respectively.
To analyze M3 expression, 200 islets from control and tg animals were
incubated for 24 h in glucose-free medium and supernatants were collected.
Twenty micrograms of protein from each sample was processed as de-
scribed above. Blots were incubated with primary Abs against M3 (26) and
a peroxidase-conjugated goat anti-rabbit IgG (Abcam). Chemilumines-
cence was detected using the Western Lightning Western Blot Chemilu-
minescence Reagent Plus (enhanced luminol) (PerkinElmer).
Islet glucose-stimulated insulin release
The insulin secretion assay was performed as described by Eizirik et al.
with some modifications (30). Briefly, 20 islets from each group were set
in quintuplicate in a 24-well plate and incubated in CMRL 1066 medium
(Cellgro, Mediatech) supplemented with 1.7 mM glucose or with 16.7 mM
glucose for 60 min at 37°C in an atmosphere of 95% O2 and 5% CO2. For
insulin content, fresh islets were collected, washed with 1 ml of PBS, and
sonicated in acid ethanol to extract insulin. All of supernatants and extrac-
tions were kept at ⫺20°C. Insulin released into supernatants and insulin
content was measured by ELISA (ALPCO Diagnostic).
Quantitative real-time PCR (Q-PCR)
Total RNA was extracted from pooled islets using the RNeasy maxi kit
(Qiagen) according to the manufacturer’s instructions. Reverse transcrip-
tion was performed for 3 ␮g of RNA. Q-PCR was conducted in duplicate
from 25 ng of cDNA and with each primer at 0.4 ␮M in a 30-␮l final
reaction volumes of 1⫻ SYBR Green PCR Master Mix (Applied Biosys-
tems). PCR cycling conditions were 50°C for 2 min, 95°C for 15 min, and
The Journal of Immunology 4625

Table I. Sequences of primers used to study mRNA chemokine expression by Q-PCR (5⬘ to 3⬘)

Chemokine Forward Primers Reverse Primers

CCL1 CCCAGCTGTGGTATTCAGGC GTGATTTTGAACCCACGTTTTG

CCL2 GCTGGAGCATCCACGTGTT ATCTTGCTGGTGAATGAGTAGCA
CCL3 CCAAGTCTTCTCAGCGCCAT GAATCTTCCGGCTGTAGGAGAAG
CCL4 TCTGCGTGTCTGCCCTCTC TGCTGAGAACCCTGGAGCA
CCL5 GCAAGTGCTCCAATCTTGCA CTTCTCTGGGTTGGCACACA
CCL6 CTTGGGTCCCAGGCTGG AGTGTCTTGAAAGCCTTGATGAATT
CCL7 GGGAAGCTGTTATCTTCAAGACAAA CTCCTCGACCCACTTCTGATG
CCL8 GCTACGAGAGAATCAACAATATCCAGT CAGAGAGACATACCCTGCTTGGT
CCL9.10 GGTTCCAGGTCTGTGCCAA GTGGTTGTGAGTTTTTCTCCAATCT
CCL11 CCAGGCTCCATCCCAACTT TGGTGATTCTTTTGTAGCTCTTCAGT
CCL12 AATCACAAGCAGCCAGTGTCC TCAGCACAGATCTCCTTATCCAGT
CCL13 GCTGGAGAGCTACAAGAGGATCAC TGCCCAACCTGGTCTTGAAG
CCL17 GGATGCCATCGTGTTTCTGA GCCTTCTTCACATGTTTGTCTTTG
CCL19 ATGCGGAAGACTGCTGCC AGCGGAAGGCTTTCACGAT
CCL20 CCAAGTCTTCTCAGCGCCAT GAATCTTCCGGCTGTAGGAGAAG
CCL21 CCCCGGCTGCAGGAA TGTTCAGTTCTCTTGCAGCCC
CCL22 TGCCAGGACTACATCCGTCA GGCAGGATTTTGAGGTCCAG
CCL24 TGGTAGCCTGCGCGTGTT AAGGACGTGCAGCAAGATGA
CCL25 TGAAAGGAAGAAGTCAAACCATATGA AGGGTGGCACTCCTCACG

Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020

CCL27 CAGGCTGCTGAGGAGGATTG CACGACAGCCTGGAGGTGA
CCL28 CATACTTCCCATGGCCTCC GAGAGGCTTCGTGCCTGTG
CXCL1 AATGAGCTGCGCTGTCAGTG TGAGGGCAACACCTTCAAGC
CXCL2 CCTGCCAAGGGTTGACTTCA TTCTGTCTGGGCGCAGTG
CXCL4 GCCTGGAGGTGATCAAGGC GGCAAATTTTCCTCCCATTCT
CXCL5 CATCCCCAGCGGTTCCA CGTGAACAGCAACAGAAATGC
CXCL7 CGTGCCTGGACCCAAATG GCTGGTCAGTAACCTTCCAAGATT
CXCL9 TGCACGATGCTCCTGCA AGGTCTTTGAGGGATTTGTAGTGG
CXCL10 GACGGTCCGCTGCAACTG GCTTCCCTATGGCCCTCATT
CXCL11 CGGGATGAAAGCCGTCAA AACTTTGTCGCAGCCGTTACTC
CXCL12 GCTCCTCGACAGATGCCTTG GACCCTGGCACTGAACTGGA
CXCL13 CATAGATCGGATTCAAGTTACGCC TCTTGGTCCAGATCACAACTTCA
CXCL14 AGCACTGCCTGCACCCTAAG TCTCGTTCCAGGCATTATACCA
CXCL15 GCTCCTGCTGGCTGTCCTTA CACAGACATCGTAGCTCTTGAGTGT
CXCL16 AGCACACCAGCTTGGGTACC CATGGCTGCAGTGAGGAAGA
XCL1 GGTGAAAGCAGCGATCAAG TGGGAACAGTTTCAGCCATGT
CX3CL1 CAGCAGTGACCGGATCATCTC TGCTCTGAGGCTTAGCCGTAA

40 cycles of 95°C for 15 s and 60°C for 1 min. Relative expression levels
were calculated as 2Ct ubiquitin ⫺ Ct gene (where Ct is cycle threshold; for
details see ABI PRISM 7700 User Bulletin no. 2; Applied Biosystems)
using ubiquitin RNA as endogenous control. The melt curve was per-
formed and primer dimers were absent. The sequences of primers used to
study chemokine mRNA expression are described in Table I. The results
were graphed as fold increase in chemokine expression between days 0 and
10 and the experiments were repeated at least three times.
Surface plasmon resonance (SPR)-based competition assay
SPR experiments were conducted using a Biacore 2000 biosensor at 25°C
under conditions of 20 mM HEPES (pH 7.4), 150 mM sodium chloride,
0.005% Triton X-100. The M3 and human (h)CCL2 used in this analysis
were produced as described elsewhere (J. M. Alexander-Brett and D. H.
Fremont, submitted for publication). Murine (m)CXCL10, mCCL21, and
hXCL1 were purchased from BioSource, and vascular endothelial growth
factor (VEGF) was from PeproTech. For the two-site binding assay, M3
was pre-equilibrated with biotinylated CCL2 at a 10:1 ratio, and the mix-
ture was injected over a NeutrAvidin-coated sensor chip to immobilize
⬃500 resonance units (RU) of material. M3 is captured via stable inter-
action with CCL2 and only the free second site is available for binding. The
chemokines CXCL10 and CCL21 were injected over the sensor chip at 50
nM to assess their ability to bind the second M3 site, with XCL1 and VEGF
(each at 50 nM) serving as positive and negative controls, respectively.
M3-chemokine binding affinities were measured using an SPR-based
competition assay, which is described in full detail elsewhere (J. M.
Alexander-Brett and D. H. Fremont, 2006, submitted for publication).
Briefly, the competition assay facilitates the measurement of M3-chemo-
kine binding affinities that are otherwise unobtainable by direct surface
binding methods due to severe mass transport artifacts. The solution-sur-
face competition assay uses a mutant form of M3 in which the s2b-s3 loop
is mutated from 80EELGQ84 to 80SRRGR84, referred to as M3BBXB (where
B represents a basic amino acid such as arginine and X is any other amino
acid), which exhibits decreased chemokine binding on-rates and thus does
not suffer from mass transport limitations. The solution-surface competi-
tion assay is conducted by measuring equilibrium (Req) chemokine binding
to surface-bound M3BBXB as the amount of M3 solution competitor is
increased. The experiment yields a competition titration curve that is math-
ematically fit to obtain the solution-based wild-type (wt) M3-chemokine
binding affinity.
To perform this assay, the M3BBXB mutant was immobilized on a CM5
sensor chip to a level of 800 RU. CXCL10 (15 nM) and CCL21 (8 nM)
were each pre-equilibrated with M3 over a range of concentrations from
1:0 to ⬃1:2 molar ratio. Mixtures were injected over the flow cells at 60
␮l/min, and the surface was regenerated with 1 M calcium chloride. Com-
petition titration curves were analyzed using equations previously derived
for solution-surface SPR competition using the program Scientist (Micro-
math Science Software) to yield KI, the solution affinity for M3 binding to
each chemokine.
For the second-site binding assay, M3 (1 mg/ml) was pre-equilibrated
with biotinylated CCL2 at a 10:1 ratio, and the mixture was injected over
a neutravidin coated sensor chip to immobilize ⬃500 RU of material. M3
is captured via a stable 2:1 interaction with CCL2 and only the free second
site is available for binding to other chemokines. The chemokines CXCL10
and CCL21 were injected over the sensor chip at 50 nM to assess their
ability to bind the second M3 site, with XCL1 and VEGF (each at 50 nM)
serving as the positive and negative controls, respectively.
Statistical analysis
Data are expressed as means ⫾ SD. An unpaired t test, one-way ANOVA,
and repeated measures ANOVA were used to determine statistical signif-
icance. Differences were considered significant when p ⬍ 0.05.
Results
Streptozotocin treatment induces chemokine production
MLDS initially induce ␤ cell damage (5), and mononuclear cells
that infiltrate the islets start a multifactorial process that leads to
4626
FIGURE 1. MLDS treatment induces the expression
of chemokines and the recruitment of inflammatory
cells to the islets of Langerhans. A, Fold increase in
chemokine mRNA levels in islets of Langerhans after
MLDS. Values were determined by Q-PCR before treat-
ment and at day 10. Shown are chemokines for which
there was at least a 3-fold difference in expression lev-
els. B and C, Insulin/CD45 (green/red) staining at day 0
(B) and day 10 (C). D–F, CCL1 (red) together with
CD45 (green; D), CD11b (green; E) and CD11c (green;
F) staining. G, Immunostaining for CCL21 (red). H,
CCL21 (red) and CD31 (green) staining. I and J,
CXCL9 (red) together with CD11b (green; I) and
CD11c (green; J) staining. Note that chemokine expres-
sion is mostly associated with the inflammatory cells.
White arrowheads point to the coexpression of chemo-
kines and the cell marker analyzed in each case. In B–J
immunostaining was performed in pancreata 10 days
after of MLDS treatment. Scale bars, 25 ␮m.
destruction of the insulin-producing ␤ cells (31). To characterize
the chemokines produced in the MLDS model, we performed
Q-PCR on total RNA isolated from islets. We examined the
expression of all known murine chemokine ligands in islets of
Langerhans taken from control mice before (day 0, n ⫽ 40) and
after MLDS treatment on days 3 (n ⫽ 6), 5 (n ⫽ 6), and 10 (n
⫽ 30). With the exception of CCL20 and CCL19, chemokines
were expressed at very low levels before treatment (data not
shown). No significant differences in chemokine expression
were detected 3–5 days after the initiation of treatment (data not
shown). However, there were striking differences in the expres-
sion levels of some chemokines, most notably CXCL9,
CXCL10, and CCL1 (which were expressed at 31- to 178-fold
higher levels than at day 0) (Fig. 1A).
We then used immunohistochemical analysis to determine
whether MLDS led to changes in chemokine protein expression.
Several sections of pancreata from control mice (n ⫽ 8) before and
10 days after initiation of MLDS were analyzed using Abs against
some of the chemokine ligands that were found to be highly up-
regulated in the Q-PCR analysis (CXCL9, CCL1, and CCL21). To
determine the cellular source of chemokines, we used Abs against
insulin, the pan-leukocyte marker CD45, the myeloid marker
CD11b, dendritic cells (CD11c), T cells (CD3), and endothelial
cells (CD31). Few CD45⫹ cells were found within islets of Lang-
erhans before treatment (Fig. 1B). However, by day 10 we ob-
served many CD45⫹ inflammatory cells within the islets (Fig. 1C).
At this point, we detected strong staining for the chemokines stud-
ied (Fig. 1, D–J). As shown in Fig. 1, CCL1 and CXCL9 were
localized to the infiltrating cells (within CD45⫹ cells; Fig. 1D and
data not shown). Further analysis showed that CCL1 and CXCL9
were expressed mainly by CD11b⫹ and CD11c⫹ cells (Fig. 1, E–F
M3 PREVENTS MLDS-INDUCED DIABETES
Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020
and I–J, respectively) but not for T cells or endothelial cells (data
not shown). CCL21 was found in areas where there was an accu-
mulation of inflammatory cells (Fig. 1G) mainly expressed by en-
dothelial (CD31⫹) cells (Fig. 1H). These results validate the re-
sults obtained by Q-PCR analysis and indicate that MLDS
treatment induced the expression of chemokines primarily in cells
infiltrating the islets of Langerhans.
Expression of M3 does not affect the ability of ␤ cells to
produce or secrete insulin
Next, we tested the hypothesis that an islet-specific chemokine
blockade affected the development of diabetes induced by MLDS.
To this end we used mice expressing the chemokine-binding pro-
tein M3 in the islets (RIP-M3 mice) (26). We have previously
shown that mice expressing M3 in the islets develop normally and
are normoglycemic. Furthermore, we found that the constitutive
expression of M3 in the pancreas of the RIP-M3 mice did not affect
the development of lymphoid or nonlymphoid tissues. To rule out
that expression of M3 affected ␤ cell function we performed both
in vitro and in vivo experiments.
First we confirmed that islets from tg animals secreted M3 in
vitro. Isolated islets from tg RIP-M3 mice secreted immunoreac-
tive 44-kDa M3 protein after 24 h of culture (Fig. 2A). No immu-
noreactivity was found in the medium from control islets. Densi-
tometric scanning of the bands showed that islets from
homozygous (tg/tg) mice released approximately double the
amount of M3 as heterozygous (tg/wt) islets (data not shown, n ⫽
4 experiments).
To determine whether the expression of M3 by ␤ cells affected
glucose homeostasis, we analyzed the insulin content and the se-
cretion of insulin after a glucose challenge in islets from controls
The Journal of Immunology 4627

FIGURE 2. Expression of M3 does

not alter the function of ␤ cells. A,
Western blot analysis of M3 protein in
supernatants of cultured islets. B, Insu-
lin content measured by ELISA in
freshly isolated islets from control and
RIP-M3 mice (n ⫽ 15 per group, p ⫽
0.65; one-way ANOVA). C, Isolated
islets were cultured with 1.7 or 16.7
mM glucose for 1 h. The insulin con-
centration in supernatants was deter-
mined by ELISA. The results represent
three separate experiments under simi-
lar experimental conditions (p ⫽ 0.75;
one-way ANOVA). D, Intraperitoneal
glucose tolerance test. Glucose was in-
jected i.p. into fasting non-tg and tg
mice (8 wk old) and blood glucose was
measured every 30 min (p ⫽ 0.97; one-
way ANOVA). E, Blood glucose levels

Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020

after the administration of a high dose
of STZ in RIP-M3 tg/wt (n ⫽ 5, E),
RIP-M3 tg/tg (n ⫽ 5, F) and their
non-tg (wt) littermates (n ⫽ 5, 䊐) (p ⫽
0.78; one-way ANOVA).

and RIP-M3 tg mice. There was no significant difference in the

insulin content between islets from control and RIP-M3 mice
(n ⫽ 15 per group, Fig. 2B). As expected, higher levels of
secreted insulin were detected in the supernatants of cultured
islets from both control and RIP-M3 tg mice after they were
exposed to high concentrations of glucose, but there was no
difference between the groups (Fig. 2C, n ⫽ 3 experiments).
Finally, the results of an i.p. glucose tolerance test on 8-wk-old
control and RIP-M3 tg mice were identical, with plasma glu-
cose reaching maximal levels 90 min after glucose administra-
tion (Fig. 2D). To evaluate whether ␤ cell integrity was altered
by M3 expression we treated the mice with a high dose of STZ
(300 mg/kg). Two days after treatment all control and RIP-M3
tg mice (n ⫽ 5 per group) became diabetic (Fig. 2E). Taken
together these results indicate that the insulin synthesis and se-
cretion are not altered by the expression of M3.

Expression of M3 in ␤ cells blocks the development of diabetes

induced by MLDS
To test the effect of M3 on the development of diabetes we treated
6 –10 wk-old male RIP-M3 mice and control littermates with either
STZ (40 mg/kg) or vehicle for 5 consecutive days. As expected
(32), Four weeks after the beginning of treatment 85% of the con-
trol mice treated with MLDS were diabetic. At this point only 35%
of the RIP-M3 tg/wt mice and, remarkably, none of the homozy-
gous RIP-M3 mice were diabetic (Fig. 3A). After 70 days all con-
trol mice were diabetic but only 60% of heterozygous mice and FIGURE 3. Expression of M3 in ␤ cells blocks the development of
none of the homozygous RIP-M3 mice developed disease (n ⫽ 5 diabetes induced by MLDS. A, Diabetes incidence in animals treated
per group). with multiple low doses of STZ. Shown is the cumulative incidence of
diabetes in RIP-M3 tg/wt (n ⫽ 25, 䊊) and RIP-M3 tg/tg (n ⫽ 13, F)
To exclude the possibility that RIP-M3 mice were resistant to
mice and their non-tg (wt) littermates (n ⫽ 24, 䊐). Animals were con-
the effects of STZ, we analyzed the expression of Glut-2 (the trans-
sidered diabetic if blood glucose levels were higher than 250 mg/dl in
porter for STZ (33)) in islets of RIP-M3 tg/wt, tg/tg, and control two consecutive measurements. B, Western blot analysis of islet ex-
mice by Western blotting. The levels of Glut-2 protein in the islets tracts from controls and RIP-M3 mice (n ⫽ 6) using Glut-2 Ab together
of normal and tg mice were comparable (Fig. 3, C and D), sug- with actin Ab as an internal control. C, Densitometric scanning of West-
gesting that the expression of M3 did not alter the mechanism of ern blots. The results are representative of two separate experiments
STZ uptake into the cell. (p ⫽ 0.44; one-way ANOVA).
4628 M3 PREVENTS MLDS-INDUCED DIABETES

Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020

FIGURE 4. Expression of M3 in ␤ cells prevents recruitment of inflammatory cells. A, Semiquantitative analysis of islet infiltrates in the pancreas from
control and RIP-M3 mice before (day 0) and after (days 7, 14, and 21) MLDS treatment. There is a significant difference in the number of infiltrated islets
between RIP-M3 and control mice (p ⬍ 0.05; one-way ANOVA). B, Immunostaining for CD45 (red) and insulin (green) in the pancreata of control (wt),
heterozygous (tg/wt), and homozygous (tg/tg) mice before (day 0) and after (days 7, 14, and 21) MLDS treatment. Scale bars, 25 ␮m.

Expression of M3 in ␤ cells prevents the recruitment of
inflammatory cells
Recent studies from our laboratory show that islet-specific expres-
sion of M3 blocks leukocyte recruitment induced by islet-specific
expression of CCL21 (26), CCL2, and CXCL13 (27).
To test the hypothesis that M3 expression blocked STZ-induced
diabetes by preventing chemokine-induced recruitment of inflam-
matory cells, we treated mice (n ⫽ 3 per group) with MLDS and
then sacrificed at 7, 14, and 21 days after the first injection. The
infiltration of CD45⫹ cells into the islets of control mice was first
seen on day 7 (Fig. 4, A and B), and the number of inflammatory
cells and the frequency of infiltrated islets increased thereafter. By
day 21 most control islets were infiltrated by mononuclear cells
and had lost normal morphologic integrity. In contrast, a small
number of infiltrating cells was found in RIP-M3 tg/wt mice only
after 21 days of treatment and the morphological appearance of
the islets was normal. Remarkably, none of the homozygous
RIP-M3 mice showed infiltrating cells at day 21 ( p ⫽ 0.035,
one-way ANOVA), and the insulin-positive cells appeared nor-
mal (Fig. 4B).
To determine whether the M3 blockade of inflammatory cell
influx altered the mRNA chemokine expression, we performed Q-
PCR on total RNA isolated from islets before and after MLDS.
After 10 days of treatment, several chemokines were up-regulated
in control mice. However, there was no increase in chemokine
mRNA expression in islets from tg mice (data not shown). These
results are consistent with the view that the main source of che-
mokines at this point were the infiltrating cells.
M3 binds multiple chemokines expressed during insulitis with
high affinity
Inflammatory stimuli generally result in the up-regulation of
groups of chemokines rather than a single species, as reflected by
the elevated expression of numerous chemokines in the MLDS
model described here. Previous studies have indicated that M3
binds to both murine and human chemokines from all four struc-
tural classes, thus acting as a broad-spectrum chemokine scavenger
(34, 35). However, the M3 affinities for several chemokines that
are relevant to the MLDS model have not been reported. To es-
tablish whether M3 binds to up-regulated inflammatory and ho-
meostatic chemokines, we measured its affinity for mCCL21 and
mCXCL10. Binding studies were conducted using a SPR-based
competition assay (J. M. Alexander-Brett and D. H. Fremont, sub-
mitted for publication), which yielded affinities of 12 ⫾ 1 and
320 ⫾ 30 pM for mCCL21 and mCXCL10, respectively (Fig. 5A).
It was also of interest to assess whether a single M3 dimer could
The Journal of Immunology
FIGURE 5. High-affinity M3 binding of relevant
chemokines. A, Solution binding affinity of murine
CCL21 and CXCL10 to M3. Representative titration
curves are shown with equilibrium chemokine binding
(Req) to surface-bound M3BBXB plotted as a function of
coinjected M3 concentration with corresponding fits to
the data. Thus, M3 chemokine binding affinities are de-
termined by the competitive inhibition of chip binding.
B, The schematically depicted second-site binding assay
was used to assess the ability of M3 dimers to simulta-
neously bind distinct chemokines. M3 is loaded with
CCL2 with a 2:1 stoichiometry and bound to the chip
via interaction with biotinylated hCCL2. Chemokine
binding to the second free M3 chemokine binding site is
qualitatively assessed by sensorgram response, shown
here for 50 nM injections of CXCL10, CCL21, hXCL1
(KD ⫽ 500 pM), and VEGF used as a negative control.
simultaneously engage two distinct chemokines. This question was
addressed using a two-site SPR binding assay in which M3 was
immobilized to the sensor chip via interaction with the high-affin-
ity chemokine hCCL2, and chemokine binding to the second site
was demonstrated by injecting several chemokines over the M3-
CCL2 coupled sensor chip (shown schematically in Fig. 5B). The
chemokines mCCL21, mCXCL10, and hXCL1 all bind the avail-
able M3 second site, indicating that M3 is capable of simulta-
neously binding relevant chemokines of different structural classes
at opposite ends of the dimer (Fig. 5B). The lack of binding for the
negative control protein VEGF demonstrates the specificity of this
interaction.
Discussion
Autoimmune diseases are thought to result from complex interac-
tions between genetic and environmental factors. Although the
mechanisms by which autoimmune diseases evolve in individuals
are inevitably comprised of numerous variables, there is evidence
that infection may represent a key element in the development of
certain autoimmune responses leading to tissue-specific destruc-
tion (36 –39). Leukocytes are frequently involved in the response
to infection and in autoimmune responses, but information on
mechanisms leading to their recruitment and the emergence of the
autoimmune attack is lacking.
In diabetes, an accumulation of cells around the islets precedes
the onset of clinical disease. We hypothesized that chemokines are
critical determinants of the influx of leukocytes into the islets and,
thus, constitute one of the major component in the pathogenesis of
diabetes. To start addressing the role of chemokines in diabetes,
we have examined in a comprehensive and quantitative fashion the
expression of chemokines in the MLDS model. Our results show
that of all the murine chemokine ligands, only two (CCL20 and
CCL19) were expressed, albeit at low levels, in pancreatic islets
of B6D2F1 mice before MLDS treatment. MLDS treatment in-
duced the high expression of several chemokines, including
CXCL9, CXCL10, and CCL2, before the onset of diabetes. The
expression of these chemokines was likely triggered by IFN-␥
and TNF-␣ (40), cytokines whose expression has been docu-
mented in islets before the onset of MLDS-induced diabetes
(41). The early expression of these cytokines likely influenced
4629
Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020
the production of chemokines by resident inflammatory cells,
endocrine cells, and endothelial cells and promoted the infil-
tration of the islets, first by macrophages and subsequently by
lymphocytes (31). The infiltrating cells themselves represent a
major source of chemokines, as suggested by our immunohis-
tochemical analysis. We propose that this initial burst in the
expression of chemokines contributes to the further recruitment
of inflammatory cells and the destruction of the islets. Further
studies focusing on the temporal analysis of chemokine mRNA
and protein will be required to evaluate the role of chemokines
in the onset of diabetes triggered by MLDS.
Although the changes in chemokine expression suggest a link
with pathogenesis, they do not prove it. The results shown here
indicate that chemokines are critical for pathogenesis. The expres-
sion of a chemokine scavenger in the islets dramatically reduced
cellular infiltration and blocked the development of diabetes. This
effect was more pronounced in the islets from homozygous
RIP-M3 mice, which expressed higher levels of M3 than the islets
of heterozygous mice. We believe that the blockade in cellular
recruitment was caused by M3 inactivation of one or more che-
mokines expressed during the course of MLDS treatment. The
crystal structure of M3 shows that M3 dimerizes and generates
a binding site for the N-terminal region of chemokines that
precludes the binding to their receptors (42). M3 also uses elec-
trostatic mimicry to directly inhibit chemokine-glycosamino-
glycan interactions for a diverse array of chemokines (D. H.
Alexander and J. M. Fremont-Brett, 2006, submitted for pub-
lication). Glycosaminoglycan association is important for che-
mokine function, being a prerequisite for chemokine uptake,
transcytosis to the apical side of the endothelial cell, and ap-
propriate solid-phase presentation to the passing leukocytes
(43). In vivo, M3 reduces mononuclear cellular responses after
MHV-68-induced meningitis in mice (44) and blocks leukocyte
recruitment to the pancreas induced by CCL21 (26), CXCL13,
and CCL2 (27), respectively.
We suggest that these scavenging properties of M3 are essential
for the reduced inflammation observed in the RIP-M3 tg mice.
Many of the chemokines up-regulated in the MLDS model are
known to bind M3 with high affinity (34, 35). In this study we
show that M3 binds the murine chemokines CCL21 and CXCL10
4630
with picomolar affinity (12 and 320 pM, respectively) (Fig. 5).
Further, we show that M3 is able to engage either of these che-
mokines while simultaneously binding CCL2 at opposite ends of
the dimer structure, suggesting that M3 can effectively inhibit
mixed populations of chemokines as observed in the insulitis mod-
els. As such, M3 may disrupt the proper presentation and function
of CCL2 (42), CXCL10, and CCL21, important players regulating
the migration of monocytes and T cells that are critical for the
development of diabetes (19, 23). Although our results suggest that
the primary site of chemokine blockade induced by M3 is the
endocrine pancreas, we cannot rule out that the trace amounts of
M3 present in pancreatic lymph nodes and the bloodstream (not
shown) may contribute to the effects seen here.
In conclusion, we demonstrate that chemokine expression is
a hallmark of insulitis promoted by MLDS treatment. This al-
tered expression is not limited to one or a few chemokines;
several chemokines are expressed at the same time, a pattern
already observed in other conditions (8, 45– 48). We also show
that a chemokine blockade prevents mice from developing in-
sulitis and diabetes induced by MLDS. Taken together, these
results constitute direct evidence that chemokines are critical
determinants of MLDS-induced diabetes. Future work will be
directed to investigate whether M3 can block diabetes occurring
in autoimmune settings and to test whether it can prevent the
rejection of transplanted islets.
Acknowledgments
We thank Limin Shang for expert technical assistance. We also thank Jay
Unkeless for critical comments on the manuscript and A. Zlotnik and R. de
Wall Malefyt for primer sequences.
Disclosures
The authors have no financial conflict of interest.
References
1. Foulis, A. K. 1987. C. L. Oakley lecture (1987): the pathogenesis of ␤ cell
destruction in type I (insulin-dependent) diabetes mellitus. J. Pathol. 152:
141–148.
2. Adorini, L., S. Gregori, and L. C. Harrison. 2002. Understanding autoimmune
diabetes: insights from mouse models. Trends Mol. Med. 8: 31–38.
3. Yoon, J. W., H. S. Jun, and P. Santamaria. 1998. Cellular and molecular mech-
anisms for the initiation and progression of ␤ cell destruction resulting from the
collaboration between macrophages and T cells. Autoimmunity 27: 109 –122.
4. Elliott, J. I., H. Dewchand, and D. M. Altmann. 1997. Streptozotocin-induced
diabetes in mice lacking ␣␤ T cells. Clin. Exp. Immunol. 109: 116 –120.
5. Like, A. A., and A. A. Rossini. 1976. Streptozotocin-induced pancreatic insulitis:
new model of diabetes mellitus. Science 193: 415– 417.
6. Kwon, N. S., S. H. Lee, C. S. Choi, T. Kho, and H. S. Lee. 1994. Nitric oxide
generation from streptozotocin. FASEB J. 8: 529 –533.
7. Kolb-Bachofen, V., S. Epstein, U. Kiesel, and H. Kolb. 1988. Low-dose strep-
tozotocin-induced diabetes in mice: electron microscopy reveals single-cell in-
sulitis before diabetes onset. Diabetes 37: 21–27.
8. Luster, A. D. 2002. The role of chemokines in linking innate and adaptive im-
munity. Curr. Opin. Immunol. 14: 129 –135.
9. Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system and
their role in immunity. Immunity 12: 121–127.
10. Rossi, D., and A. Zlotnik. 2000. The biology of chemokines and their receptors.
Annu. Rev. Immunol. 18: 217–242.
11. Martin, A. P., E. C. Coronel, G. Sano, S. C. Chen, G. Vassileva,
C. Canasto-Chibuque, J. D. Sedgwick, P. S. Frenette, M. Lipp, G. C. Furtado, and
S. A. Lira. 2004. A novel model for lymphocytic infiltration of the thyroid gland
generated by transgenic expression of the CC chemokine CCL21. J. Immunol.
173: 4791– 4798.
12. Grewal, I. S., B. J. Rutledge, J. A. Fiorillo, L. Gu, R. P. Gladue, R. A. Flavell,
and B. J. Rollins. 1997. Transgenic monocyte chemoattractant protein-1
(MCP-1) in pancreatic islets produces monocyte-rich insulitis without diabe-
tes: abrogation by a second transgene expressing systemic MCP-1. J. Immu-
nol. 159: 401– 408.
13. Frigerio, S., T. Junt, B. Lu, C. Gerard, U. Zumsteg, G. A. Hollander, and L. Piali.
M3 PREVENTS MLDS-INDUCED DIABETES
2002. Beta cells are responsible for CXCR3-mediated T-cell infiltration in insu-
litis. Nat. Med. 8: 1414 –1420.
14. Rollins, B. J. 1997. Chemokines. Blood 90: 909 –928.
15. Homey, B., A. Muller, and A. Zlotnik. 2002. Chemokines: agents for the immu-
notherapy of cancer? Nat. Rev. Immunol. 2: 175–184.
16. Piemonti, L., B. E. Leone, R. Nano, A. Saccani, P. Monti, P. Maffi, G. Bianchi,
A. Sica, G. Peri, R. Melzi, et al. 2002. Human pancreatic islets produce and
secrete MCP-1/CCL2: relevance in human islet transplantation. Diabetes 51:
55– 65.
17. Cameron, M. J., G. A. Arreaza, M. Grattan, C. Meagher, S. Sharif,
M. D. Burdick, R. M. Strieter, D. N. Cook, and T. L. Delovitch. 2000. Differential
expression of CC chemokines and the CCR5 receptor in the pancreas is associ-
ated with progression to type I diabetes. J. Immunol. 165: 1102–1110.
18. Chen, M. C., P. Proost, C. Gysemans, C. Mathieu, D. L. Eizirik, 2001. Monocyte
chemoattractant protein-1 is expressed in pancreatic islets from prediabetic NOD
mice and interleukin-1 ␤-exposed human and rat islet cells. Diabetologia 44:
325–332.
19. Bouma, G., J. M. Coppens, S. Mourits, T. Nikolic, S. Sozzani, H. A. Drexhage,
and M. A. Versnel. 2005. Evidence for an enhanced adhesion of DC to fibronectin
and a role of CCL19 and CCL21 in the accumulation of DC around the pre-
diabetic islets in NOD mice. Eur. J. Immunol. 35: 2386 –2396.
20. Hjelmstrom, P., J. Fjell, T. Nakagawa, R. Sacca, C. A. Cuff, and N. H. Ruddle.
2000. Lymphoid tissue homing chemokines are expressed in chronic inflamma-
tion. Am. J. Pathol. 156: 1133–1138.
Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020
21. Ploix, C., D. Lo, and M. J. Carson. 2001. A ligand for the chemokine receptor
CCR7 can influence the homeostatic proliferation of CD4 T cells and progression
of autoimmunity. J. Immunol. 167: 6724 – 6730.
22. Christen, U., D. B. McGavern, A. D. Luster, M. G. von Herrath, and
M. B. Oldstone. 2003. Among CXCR3 chemokines, IFN-␥-inducible protein of
10 kDa (CXC chemokine ligand (CXCL) 10) but not monokine induced by IFN-␥
(CXCL9) imprints a pattern for the subsequent development of autoimmune dis-
ease. J. Immunol. 171: 6838 – 6845.
23. Kim, S. H., M. M. Cleary, H. S. Fox, D. Chantry, and N. Sarvetnick. 2002.
CCR4-bearing T cells participate in autoimmune diabetes. J. Clin. Invest. 110:
1675–1686.
24. Carvalho-Pinto, C., M. I. Garcia, L. Gomez, A. Ballesteros, A. Zaballos,
J. M. Flores, M. Mellado, J. M. Rodriguez-Frade, D. Balomenos, and
A. C. Martinez. 2004. Leukocyte attraction through the CCR5 receptor controls
progress from insulitis to diabetes in non-obese diabetic mice. Eur. J. Immunol.
34: 548 –557.
25. Proudfoot, A. E., T. M. Handel, Z. Johnson, E. K. Lau, P. LiWang,
I. Clark-Lewis, F. Borlat, T. N. Wells, and M. H. Kosco-Vilbois. 2003. Glycos-
aminoglycan binding and oligomerization are essential for the in vivo activity of
certain chemokines. Proc. Natl. Acad. Sci. USA 100: 1885–1890.
26. Jensen, K. K., S. C. Chen, R. W. Hipkin, M. T. Wiekowski, M. A. Schwarz,
C. C. Chou, J. P. Simas, A. Alcami, and S. A. Lira. 2003. Disruption of CCL21-
induced chemotaxis in vitro and in vivo by M3, a chemokine-binding protein
encoded by murine ␥herpesvirus 68. J. Virol. 77: 624 – 630.
27. Martin, A. P., C. Canasto-Chibuque, L. Shang, B. J. Rollins, and S. A. Lira. 2006.
The chemokine decoy receptor M3 blocks CC chemokine ligand 2 and CXC
chemokine ligand 13 function in vivo. J. Immunol. 177: 7296 –7302.
28. Flodstrom, M., B. Tyrberg, D. L. Eizirik, and S. Sandler. 1999. Reduced sensi-
tivity of inducible nitric oxide synthase-deficient mice to multiple low-dose strep-
tozotocin-induced diabetes. Diabetes 48: 706 –713.
29. Gotoh, M., T. Maki, T. Kiyoizumi, S. Satomi, and A. P. Monaco. 1985. An
improved method for isolation of mouse pancreatic islets. Transplantation 40:
437– 438.
30. Eizirik, D. L., G. S. Korbutt, and C. Hellerstrom. 1992. Prolonged exposure of
human pancreatic islets to high glucose concentrations in vitro impairs the ␤-cell
function. J. Clin. Invest. 90: 1263–1268.
31. Kolb-Bachofen, V., and H. Kolb. 1989. A role for macrophages in the patho-
genesis of type 1 diabetes. Autoimmunity 3: 145–154.
32. Mabley, J. G., G. Hasko, L. Liaudet, F. Soriano, G. J. Southan, A. L. Salzman,
and C. Szabo. 2002. NF␬B1 (p50)-deficient mice are not susceptible to multiple
low-dose streptozotocin-induced diabetes. J. Endocrinol. 173: 457– 464.
33. Schnedl, W. J., S. Ferber, J. H. Johnson, and C. B. Newgard. 1994. STZ transport
and cytotoxicity: specific enhancement in GLUT2-expressing cells. Diabetes 43:
1326 –1333.
34. van Berkel, V., J. Barrett, H. L. Tiffany, D. H. Fremont, P. M. Murphy,
G. McFadden, S. H. Speck, and H. I. Virgin. 2000. Identification of a ␥ herpes-
virus selective chemokine binding protein that inhibits chemokine action. J. Vi-
rol. 74: 6741– 6747.
35. Parry, C. M., J. P. Simas, V. P. Smith, C. A. Stewart, A. C. Minson, S. Efstathiou,
and A. Alcami. 2000. A broad spectrum secreted chemokine binding protein
encoded by a herpesvirus. J. Exp. Med. 191: 573–578.
36. Yoon, J. W., S. H. Ihm, and K. W. Kim. 1989. Viruses as a triggering factor of
type 1 diabetes and genetic markers related to the susceptibility to the virus-
associated diabetes. Diabetes Res. Clin. Pract. 7(Suppl. 1): S47–S58.
37. Honeyman, M. C., B. S. Coulson, N. L. Stone, S. A. Gellert, P. N. Goldwater,
C. E. Steele, J. J. Couper, B. D. Tait, P. G. Colman, and L. C. Harrison. 2000.
The Journal of Immunology
Association between rotavirus infection and pancreatic islet autoimmunity in
children at risk of developing type 1 diabetes. Diabetes 49: 1319 –1324.
38. von Herrath, M. G., R. S. Fujinami, and J. L. Whitton. 2003. Microorganisms and
autoimmunity: making the barren field fertile? Nat. Rev. Microbiol. 1: 151–157.
39. Marks, D. J., N. A. Mitchison, A. W. Segal, and J. Sieper. 2006. Can unresolved
infection precipitate autoimmune disease? Curr. Top. Microbiol. Immunol. 305:
105–125.
40. Mahalingam, S., and G. Karupiah. 1999. Chemokines and chemokine receptors in
infectious diseases. Immunol. Cell Biol. 77: 469 – 475.
41. Herold, K. C., V. Vezys, Q. Sun, D. Viktora, E. Seung, S. Reiner, and
D. R. Brown. 1996. Regulation of cytokine production during development of
autoimmune diabetes induced with multiple low doses of streptozotocin. J. Im-
munol. 156: 3521–3527.
42. Alexander, J. M., C. A. Nelson, V. van Berkel, E. K. Lau, J. M. Studts, T. J. Brett,
S. H. Speck, T. M. Handel, H. W. Virgin, and D. H. Fremont. 2002. Structural
basis of chemokine sequestration by a herpesvirus decoy receptor. Cell 111:
343–356.
4631
43. Middleton, J., S. Neil, J. Wintle, I. Clark-Lewis, H. Moore, C. Lam, M. Auer,
E. Hub, and A. Rot. 1997. Transcytosis and surface presentation of IL-8 by
venular endothelial cells. Cell 91: 385–395.
44. van Berkel, V., B. Levine, S. B. Kapadia, J. E. Goldman, S. H. Speck, and
H. W. T. Virgin. 2002. Critical role for a high-affinity chemokine-binding protein
in ␥-herpesvirus-induced lethal meningitis. J. Clin. Invest. 109: 905–914.
45. Arimilli, S., W. Ferlin, N. Solvason, S. Deshpande, M. Howard, and S. Mocci.
2000. Chemokines in autoimmune diseases. Immunol. Rev. 177: 43–51.
46. Gerard, C., and B. J. Rollins. 2001. Chemokines and disease. Nat. Immunol. 2:
108 –115.
47. Gerszten, R. E., F. Mach, A. Sauty, A. Rosenzweig, and A. D. Luster. 2000.
Chemokines, leukocytes, and atherosclerosis. J. Lab. Clin. Med. 136: 87–92.
48. Bone-Larson, C. L., K. J. Simpson, L. M. Colletti, N. W. Lukacs, S. C. Chen,
S. Lira, S. L. Kunkel, and C. M. Hogaboam. 2000. The role of chemokines in the
immunopathology of the liver. Immunol. Rev. 177: 8 –20.
Downloaded from http://www.jimmunol.org/ by guest on November 9, 2020
Am J Physiol Heart Circ Physiol 291: H2660 –H2668, 2006.
First published September 1, 2006; doi:10.1152/ajpheart.00489.2006.
Streptozotocin-induced diabetes progressively increases blood-brain barrier
permeability in specific brain regions in rats
Jason D. Huber, Reyna L. VanGilder, and Kimberly A. Houser
Department of Basic Pharmaceutical Sciences, West Virginia University, Morgantown, West Virginia
Submitted 12 May 2006; accepted in final form 24 August 2006
Huber, Jason D., Reyna L. VanGilder, and Kimberly A.
Houser. Streptozotocin-induced diabetes progressively increases
blood-brain barrier permeability in specific brain regions in rats. Am J
Physiol Heart Circ Physiol 291: H2660 –H2668, 2006. First published
September 1, 2006; doi:10.1152/ajpheart.00489.2006.—This study
investigated the effects of streptozotocin-induced diabetes on the
functional integrity of the blood-brain barrier in the rat at 7, 28, 56,
and 90 days, using vascular space markers ranging in size from 342 to
65,000 Da. We also examined the effect of insulin treatment of
diabetes on the formation and progression of cerebral microvascular
damage and determined whether observed functional changes oc-
curred globally throughout the brain or within specific brain regions.
Results demonstrate that streptozotocin-induced diabetes produced a
progressive increase in blood-brain barrier permeability to small
molecules from 28 to 90 days and these changes in blood-brain barrier
permeability were region specific, with the midbrain most susceptible
to diabetes-induced microvascular damage. In addition, results
showed that insulin treatment of diabetes attenuated blood-brain
barrier disruption, especially during the first few weeks; however, as
diabetes progressed, it was evident that microvascular damage oc-
curred even when hyperglycemia was controlled. Overall, results of
this study suggest that diabetes-induced perturbations to cerebral
microvessels may disrupt homeostasis and contribute to long-term
cognitive and functional deficits of the central nervous system.
in situ; endothelial; cerebral blood flow; neurovascular; dementia
DIABETES MELLITUS IS A CHRONIC progressive disease that often
results in vascular complications, including the development of
microangiopathy, which is characterized by basement mem-
brane thickening (25, 52), cytoskeletal rearrangement (65), and
increased paracellular leakage (29). Extensive research has
been conducted on endothelial cell dysfunction in a number of
tissues, including kidney, peripheral nerve, retina, heart, and
skeletal muscle (6, 14, 20, 25, 43, 61). From these studies,
important factors, including prolonged hyperglycemia, hyper-
tension, increased oxidant stress, dyslipidemia, and insulin
resistance (5, 36, 39, 47, 54, 57), have been shown to play a
role in diabetes-induced endothelial cell dysfunction. While
overwhelming evidence shows that diabetes is a disease of the
vascular system, few studies have investigated the effects of
diabetes on the vasculature of the central nervous system
(CNS). However, recent clinical evidence suggests diabetes
leads to increased incidences of vascular dementia, ventricular
hypertrophy, lacunar infarcts, and hemorrhage (2, 12, 30, 51)
and may be a predisposing factor for Alzheimer’s disease (49).
Thus, with the growing prevalence of diabetes in our society,
understanding how diabetes affects the vascular system of the
brain is an understudied yet important area of inquiry.
Address for reprint requests and other correspondence: J. D. Huber, Dept. of
Basic Pharmaceutical Sciences, West Virginia Univ. School of Pharmacy, PO
Box 9530, Morgantown, WV 26506 (jhuber@hsc.wvu.edu).
H2660 0363-6135/06 $8.00 Copyright © 2006 the American Physiological Society
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
The blood-brain barrier (BBB) is situated at the level of the
endothelial cell and serves to partition the systemic circulation
from the brain parenchyma. The BBB forms discrete microen-
vironments within the brain to support optimal functioning of
a diverse array of neurotransmitters (1). The BBB is charac-
terized by a well-defined basement membrane, presence of
tight junctions, absence of fenestrations, and close apposition
to other brain cell types, including astrocytes, pericytes, mi-
croglia, and neurons. These unique characteristics confer dis-
tinct properties that differentiate the BBB from peripheral
capillaries (27). For example, tight junctions between BBB
endothelial cells lead to a high transendothelial electrical re-
sistance of 1,500 –2,000 ⍀ 䡠cm2 as compared with 3–33 ⍀䡠cm2
in other vascular tissues (9, 13). The net result of this high
electrical resistance is low paracellular diffusion and limited
formation of transcapillary endocytosis, thus enabling a highly
regulated and stable microenvironment within the brain. Being
a dynamic barrier allows the BBB to maintain and regulate
brain homeostasis and compensate for fluctuations in the sys-
temic circulation and increased metabolic functions within the
brain; however, a number of CNS-associated diseases, includ-
ing human immunodeficiency virus encephalitis (58), menin-
gitis (62), multiple sclerosis (44), Alzheimer’s and Parkinson’s
diseases (3, 67), epilepsy (53), and stroke (35), have been
shown to disrupt BBB structural integrity, leading to functional
breakdown.
Many studies measure BBB disruption by increased perme-
ability of the microvasculature to albumin (31, 59). We argue
that by the time albumin, a 65,000-Da protein, is measurable in
the brain parenchyma, the BBB is already compromised.
Rather, we contend that changes in BBB function using much
smaller vascular space markers, such as sucrose (342 Da) and
inulin (5,000 Da), provide an intriguing opportunity to inves-
tigate the regulatory properties of the tight junction and adja-
cent extracellular matrix during a pathological insult and may
identify future therapeutic targets. Morphologically, BBB mi-
crovasculature has shown signs of diabetes-induced angiopa-
thy, with increased vesicle formation and serum albumin stain-
ing in the Virchow-Robin space (8). Recent studies demon-
strated that small openings in the BBB can have a significant
impact on BBB function and structure. Using magnetic reso-
nance imaging on patients with Type II diabetes, investigators
showed increased BBB permeability to gadolinium-diethylene-
triamine pentaacetic acid (DTPA) and concluded that, although
the openings in the BBB were to a small molecule (gadolini-
um-DTPA; 570 Da), clinical significance was substantial be-
cause these effects may play a role in the increased progressive
The costs of publication of this article were defrayed in part by the payment
of page charges. The article must therefore be hereby marked “advertisement”
in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
http://www.ajpheart.org
 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS
cognitive impairment often seen in patients with diabetes (56).
Additionally, a recent study showed that streptozotocin (STZ)-
induced diabetes in rats altered the molecular structure of BBB
tight junctions by decreasing the expression of occludin, with
no change in the accessory protein zonula occludens 1 (11).
Because of the progressive nature of diabetes and the unique
phenotype of the BBB, the effects of diabetes on the cerebro-
microvasculature are different from other microvascular beds
and barrier systems, such as seen at the retina and peripheral
nerves. Adverse effects at the BBB may be more insidious
because vascular dysregulation is less perceptible at first, and
by the time clinical signs are noticeable, irreversible neurolog-
ical damage may have occurred. We hypothesize that diabetes
has a long-term, progressive effect on BBB endothelial cells,
resulting, at first, in small, transient breaches that, over time,
grow larger and more pronounced.
RESEARCH DESIGN AND METHODS
Chemicals and radioisotopes. STZ, regular insulin, Evans blue, and
reagent-grade chemicals were purchased from Sigma Chemical (St.
Louis, MO). [14C]sucrose (specific activity: 485 mCi/mmol, ⬎99.5%
purity) and [3H]inulin (specific activity: 355 mCi/g, ⬎99% purity)
were purchased from MP Biomedical (Costa Mesa, CA). [3H]butanol
(specific activity: 20 Ci/mmol, ⬎99% purity) was purchased from
American Radiolabeled Chemicals (St. Louis, MO).
Animals. Male Sprague-Dawley rats (Harlan Sprague Dawley,
Indianapolis, IN) weighing 250 –274 g were housed under 12-h:12-h
light-dark conditions and received food and water ad libitum. Animals
were acclimatized to the environment for 7 days before induction of
diabetes. All protocols involving animals were approved by the West
Virginia University Animal Care and Use Committee and abide by
National Institutes of Health guidelines.
Diabetic induction procedures. STZ was dissolved in sodium
citrate (50 mM; pH 4.5)-buffered 0.9% saline, and regular insulin was
dissolved in 0.9% saline. Rats were divided into three treatment
groups. Group I received a single injection of sodium citrate-buffered
0.9% saline and served as the control. Group II received a single
injection (intraperitoneally) of STZ (60 mg/kg; 100 ␮l). Group III
received a single injection of STZ (60 mg/kg; 100 ␮l) and then
received regular insulin (4 U/kg sc) twice daily upon determination of
hyperglycemia. Glucose water (10%) was put into cages of rats given
STZ for 12 h to protect against STZ-induced hypoglycemia. Animals
were classified as diabetic if blood glucose level measured ⬎350
mg/dl, and only animals with a blood glucose level ⬎350 mg/dl were
allowed to continue in groups II and III.
Experimental procedures. Animal studies were conducted at 7, 28,
56, and 90 days. Blood glucose and weight were measured before the
start of the studies. Animals from each group were assessed for BBB
permeability to Evans blue albumin (65,000 Da), [3H]inulin (5,000
Da), and [14C]sucrose (342 Da). To determine localization of changes
in BBB permeability, rat brains were dissected on ice (in the following
order): hypothalamus, cerebellum, midbrain, cerebral cortex, hip-
pocampus, basal ganglia, and thalamus.
Evans blue extravasation. For quantification of albumin extravasa-
tion, rats were anesthetized with pentobarbital sodium (60 mg/kg ip),
and 2% Evans blue (4 ml/kg; 1 ml) was infused via the femoral artery
and allowed to circulate for 1 h. Rats were perfused with cold
phosphate-buffered saline with heparin (2 U/ml; pH 7.4) for 15 min
via the left ventricle. After perfusion, rats were killed by decapitation
and the brain was extracted. Excised brain was weighed, dissected,
and homogenized in 500 ␮l of 50% trichloroacetic acid. Tissue was
incubated for 24 h at 37°C. At 24 h, samples were centrifuged at
13,000 g for 10 min and the supernatants were diluted fourfold with
absolute ethanol. Fluorescence intensity was measured using a spec-
trofluorometer at 620-nm excitation, 680-nm emission (RF 5301 PC;
AJP-Heart Circ Physiol • VOL
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
H2661
Shimadzu, Columbia, MD). Calculations were based on external
standard readings, and extravasated dye was expressed as nanograms
of Evans blue per milligram brain tissue.
In situ brain perfusion. In situ brain perfusion studies were carried
out based on the method of Preston et al. (46). Briefly, rats were
anesthetized with intramuscular injection of rat cocktail (2.5 mg/kg
flunixine, 90 mg/kg ketamine, and 5 mg/kg xylazine) and heparinized
(10,000 U/kg ip), and body temperature was maintained at 37°C.
Common carotid arteries were exposed, and right common carotid
was cannulated and perfused with an erythrocyte-free perfusion media
consisting of a modified Krebs-Henseleit Ringer solution [117 mM
NaCl; 4.7 mM KCl; 0.8 mM MgSO4, 24.8 mM NaHCO3, 1.2 mM
KH2PO4, 2.5 mM CaCl2, 10 mM D-glucose, 29 g/l dextran (70,000
Da), and 1 g/l bovine serum albumin], which was aerated with 95%
O2-5% CO2 and warmed to 37°C. With the start of the perfusion, the
right jugular vein was sectioned to allow for drainage. Once the
desired perfusion pressure (85–95 mmHg) and flow rate (3.1 ml/min)
were achieved for right common carotid artery, the contralateral
carotid artery was cannulated and perfused in a similar manner. Once
both arteries were cannulated, radiolabeled compound was infused via
a slow-drive syringe pump (flow rate: 0.5 ml/min; model 22, Harvard
Apparatus) into the inflowing mammalian Ringer solution (total flow
rate: 3.6 ml/min per hemisphere). After 20 min, brain was flushed for
20 s with unlabeled Ringer solution and the animal was decapitated.
The brain was removed, and choroid plexuses and meninges were
excised. The brain was dissected into brain regions as described in
Experimental procedures and homogenized. Perfusion fluid was col-
lected from carotid cannula by briefly resuming perfusion of radiola-
beled compound following termination. Brain tissue samples (⬃500
mg wet wt) and 100 ␮l of perfusate samples were prepared for
radioactive counting by addition of 1 ml of tissue solubilizer (TS-2;
Research Products, Mount Prospect, IL); 30 ␮l of glacial acetic acid
(to quench chemiluminescence) and 4 ml of scintillation cocktail
(Budget Solve; Research Products) were then added, and samples
were analyzed by liquid scintillation counting on a Beckman LS5801
(Beckman Coulter, Fullerton, CA). Amount of [3H] and [14C] radio-
activity in the brain [Ctissue, in disintegrations per minute (dpm) per
gram (dpm/g)] was expressed as a percentage of that in the artificial
perfusate (Cperfusate, in dpm/ml) and termed Rtissue% (in ␮l/g) as
follows: Rtissue% ⫽ (Ctissue/Cperfusate) ⫻ 100%.
Capillary depletion studies. Capillary depletion method was based
on the method of Triguero et al. (60). After in situ perfusion, brain was
removed and choroid plexuses and meninges were excised, dissected
as described in In situ brain perfusion, and homogenized in 1.5 ml of
capillary depletion buffer [4-(2-hydroxyethyl)-1-piperaxineethane
sulfonic acid; 141 mM NaCl, 4 mM KCl, 2.8 mM CaCl2, 1 mM
MgSO4, 1 mM NaH2PO4, and 10 mM D-glucose; pH 7.4] and kept on
ice. Two milliliters of ice-cold dextran (60,000 Da) solution were
added to homogenate. Two aliquots of homogenate were taken and
centrifuged at 5,400 g for 15 min. Capillary-depleted supernatant was
separated from vascular pellet. Homogenate, supernatant, and pellet
were counted for radioactivity on scintillation counter. All homoge-
nation procedures were carried out within a 2-min time span.
Measurement of cerebral blood flow. The perfusion method of
Preston et al. (46) was adapted to determine both cerebral blood flow
(CBF) and rate of cerebral perfusion in situ to determine the [3H]bu-
tanol uptake, using derived equations of Gjedde and Crone (18). In
situ brain perfusion was carried out as stated above with a Ringer
solution containing 4 ml/l unlabeled ethanol. With the use of a
slow-drive syringe pump (0.5 ml/min per hemisphere), [3H]butanol
was added during last 10 s of a 20-min perfusion. A partition
coefficient (␭br) was determined by using a separate group of animals
(n ⫽ 3) for each treatment and time that was perfused with a constant
[3H]butanol concentration in arterial inflow for 20 min followed by
brain sampling and analysis. After perfusion, brains were weighed and
sectioned. Brain and Ringer solution samples were taken for liquid
scintillation counting. A small portion of frontal lobes (⬃50 mg) was
291 • DECEMBER 2006 • www.ajpheart.org
H2662 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS

removed and weighed separately to determine the brain tissue dry

weight by drying in an oven at 95°C to constant weight. Unlabeled
ethanol was added to saturate endogenous alcohol dehydrogenase for
both measurements.
Calculation of CBF. Measurement of CBF was quantified by using
the derived equation from Gjedde and Crone (18): Fbl ⫽ ⫺␭br ln{[1 ⫺
Cbr(t)/␭br ⫻ Ca]/t}, where Fbl is rate of blood flow [in ml 䡠 min⫺1 䡠 unit
mass⫺1 (g)] and Ca is the constant [3H]butanol concentration in
arterial inflow at time t between introduction of [3H]butanol and
decapitation. Cbr is activity in unit weight of brain at time t; ␭br is the
distribution ratio of [3H]butanol between brain and perfusion medium
at steady state. The value of ␭br was calculated as the ratio of 3H
radioactivity in brain versus 3H radioactivity in arterial inflow. Ex-
traction of the tracer from blood is assumed to be complete during a
single capillary pass.
Statistical analysis. Statistical significance (␣ ⫽ 0.05) for differ-
ences in BBB permeability to vascular space markers, capillary
depletion, CBF, and interaction between treatment groups and day of
whole brain and brain regions was determined by two-way ANOVA
followed by Tukey’s honest significant difference post hoc analyses.

RESULTS

Determination of Evans blue extravasation. BBB permeabil-

ity to albumin (65,000 Da) was measured in whole brain of
age-matched vehicle-treated (group I), diabetic (group II), and
insulin-treated diabetic (group III) rats at 7, 28, 56, and 90 days
by quantification of Evans blue. Evans blue binds with affinity
to albumin and is a commonly used tool to quantify albumin
extravasation in tissue and predict edema formation. Results
showed no significant (P ⬎ 0.05) difference in total Evans blue
extravasation in whole brain between any treatment group at
any time point (Fig. 1A). No significant (P ⬎ 0.05) interaction
between treatment and day was observed.
Determination of regional differences in Evans blue extrav-
asation. Regional differences in BBB permeability to albumin
(65,000 Da) were measured in rats from groups I, II, and III at
7, 28, 56, and 90 days by quantification of Evans blue (Table
1). Results showed that extravasation of Evans blue was not
significantly (P ⬎ 0.05) different between groups I, II, and III
at 7, 28, and 56 days. At 90 days, groups II and III exhibited
a significant (P ⬍ 0.05) increase in Evans blue extravasation in
the midbrain (1.0 ⫾ 0.2 and 0.9 ⫾ 0.1, respectively) as
compared with group I (0.3 ⫾ 0.1). Moreover, group II had a
significant (P ⬍ 0.05) increase in Evans blue extravasation in
the basal ganglia (1.5 ⫾ 0.2) as compared with group I (1.0 ⫾
0.1) at 90 days. No significant (P ⬎ 0.05) interaction between
treatment and day within a region was observed.
In situ brain perfusion using [3H]inulin. BBB permeability
was assessed in whole brain of rats from groups I, II, and III at
7, 28, 56, and 90 days after STZ induction by in situ brain
perfusion with an impermeant marker ([3H]inulin; 5,000 Da)
over 20 min. Results showed no significant difference (P ⬎
0.05) in inulin associated with total brain between the treat-
ment groups (groups II and III) as compared with group I at
any time point (Fig. 1B). No significant (P ⬎ 0.05) interaction
between treatment and day was observed.
Determination of regional differences in [3H]inulin associ-
ation with brain. Using in situ brain perfusion with [3H]inulin,
we assessed rats in groups I, II, and III for changes in
permeability of inulin into different brain regions at 7, 28, 56,
and 90 days following STZ-induced diabetes (Table 2). Results
showed no significant (P ⬎ 0.05) change in overall BBB
AJP-Heart Circ Physiol • VOL
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
Fig. 1. Measurement of changes in blood-brain barrier permeability to vascu-
lar space markers in total brain during the progression of streptozotocin-
induced diabetes in rats (n ⫽ 6). Varying sized vascular space markers albumin
(A), inulin (B), and sucrose (C) were quantified at 7, 28, 56, and 90 days after
initial determination of hyperglycemia (group II). Control animals (group I)
received a single injection (intraperitoneally) of the vehicle, and group III was
determined to be hyperglycemic and was treated twice daily with regular
insulin (4 U/day). EB, Evans blue; Rbr%, percentage of the amount of
radioactivity found in the brain compared with that found in the perfusate
media. Bars represent means ⫾ SE. *Significant (P ⬍ 0.05) difference from
group I (control) within day; #significant (P ⬍ 0.05) difference from group II
(diabetes) within day.
permeability to [3H]inulin; however, a few brain regions of
groups II and III exhibited a significant (P ⬍ 0.05) increase in
inulin associated with the brain parenchyma as compared with
those regions in group I. A significant (P ⬍ 0.05) increase in
inulin permeability across the BBB was observed in the cere-
bral cortex of group II at 56 days (2.3 ⫾ 0.1) and 90 days
(2.5 ⫾ 0.2) as compared with group I (1.8 ⫾ 0.1 and 1.8 ⫾ 0.1,
respectively). Group III showed increased permeability of
inulin across the BBB in the cerebral cortex at 90 days (2.4 ⫾
0.1) as compared with group I (1.8 ⫾ 0.1). Groups II and III
exhibited increased inulin permeability across the BBB in the
midbrain at 56 days (2.1 ⫾ 0.3 and 1.8 ⫾ 0.1, respectively) and
90 days (2.3 ⫾ 0.1 and 2.0 ⫾ 0.1, respectively) as compared
with group I (1.1 ⫾ 0.1 and 1.1 ⫾ 0.1, respectively). A
291 • DECEMBER 2006 • www.ajpheart.org
 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS H2663
Table 1. Measurement of albumin extravasation in various permeability of sucrose into different brain regions at 7, 28, 56,
brain regions at 7, 28, 56, and 90 days following and 90 days following STZ-induced diabetes (Table 3). Results
STZ-induced diabetes showed a significant (P ⬍ 0.05) increase in BBB permeability
to [14C]sucrose in a number of brain regions of groups II and
Day III when compared with group I. A significant (P ⬍ 0.05)
7 28 56 90 increase in sucrose permeability was observed in the cerebral
Cortex
cortex of group II at 28 days (2.5 ⫾ 0.3) and 56 days (4.5 ⫾
Control 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 0.3) as compared with both groups I (2.0 ⫾ 0.2 and 2.0 ⫾ 0.2,
Diabetes 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.3⫾0.1 respectively) and III (2.0 ⫾ 0.2 and 2.4 ⫾ 0.2, respectively).
Diabetes ⫹ insulin 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 No significant (P ⬎ 0.05) difference was observed between the
Cerebellum cortex of groups I and III at 7, 28, and 56 days. At 90 days,
Control 1.0⫾0.1 1.0⫾0.1 1.0⫾0.1 1.0⫾0.1
Diabetes 1.0⫾0.1 1.0⫾0.1 1.0⫾0.1 1.0⫾0.1 groups II and III demonstrated a significant (P ⬍ 0.05) in-
Diabetes ⫹ insulin 1.0⫾0.2 1.0⫾0.1 1.0⫾0.1 1.0⫾0.1 crease in sucrose permeability in the cerebral cortex as com-
Thalamus pared with group I. No significant (P ⬎ 0.05) difference
Control 1.1⫾0.2 1.1⫾0.2 1.1⫾0.3 1.2⫾0.1 between groups II and III was observed in the cortex at 90
Diabetes 1.1⫾0.2 1.1⫾0.1 1.2⫾0.2 1.1⫾0.1
Diabetes ⫹ insulin 1.2⫾0.1 1.1⫾0.1 1.1⫾0.2 1.1⫾0.1
days. Group II exhibited a significant (P ⬍ 0.05) increase in
Midbrain sucrose associated with the brain parenchyma in the hippocam-
Control 0.4⫾0.1 0.4⫾0.1 0.3⫾0.1 0.3⫾0.1 pus at 56 days (2.4 ⫾ 0.1) and 90 days (2.8 ⫾ 0.2) as compared
Diabetes 0.3⫾0.1 0.4⫾0.1 0.4⫾0.1 1.0⫾0.2* with groups I (1.5 ⫾ 0.1 and 1.5 ⫾ 0.1, respectively) and III
Diabetes ⫹ insulin 0.4⫾0.1 0.5⫾0.1 0.3⫾0.1 0.9⫾0.1* (1.7 ⫾ 0.2 and 1.8 ⫾ 0.2, respectively). At 28, 56, and 90 days,
Hypothalamus
Control 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 groups II (3.1 ⫾ 0.3, 3.5 ⫾ 0.4, and 4.6 ⫾ 0.5, respectively)
Diabetes 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 and III (2.1 ⫾ 0.3, 2.8 ⫾ 0.3, and 3.7 ⫾ 0.5, respectively)
Diabetes ⫹ insulin 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 showed a significant (P ⬍ 0.05) increase in sucrose permeabil-
Hippocampus
Control 0.8⫾0.3 0.8⫾0.1 0.9⫾0.3 0.8⫾0.1
Diabetes 0.9⫾0.2 0.9⫾0.2 0.9⫾0.2 0.9⫾0.1
Diabetes ⫹ insulin 0.9⫾0.2 0.9⫾0.3 1.0⫾0.1 0.9⫾0.1 Table 2. Rbr% following a 20-min in situ brain perfusion
Basal ganglia using [3H]inulin in various brain regions at 7, 28, 56, and
Control 1.0⫾0.2 1.0⫾0.3 1.0⫾0.1 1.0⫾0.1 90 days following STZ-induced diabetes
Diabetes 1.0⫾0.1 1.0⫾0.1 1.3⫾0.2 1.5⫾0.2*
Diabetes ⫹ insulin 1.0⫾0.1 1.0⫾0.2 1.2⫾0.3 1.3⫾0.3
Day
Values are means ⫾ SE (in ng Evans blue/mg tissue) for n ⫽ 6 rats. 7 28 56 90
Statistical significance was determined using two-way ANOVA followed by
Tukey’s honest significant difference (HSD) post hoc analyses. STZ, strepto- Cortex
zotocin. *Significant (P ⬍ 0.05) difference compared with control (group I) Control 1.8⫾0.1 1.8⫾0.1 1.8⫾0.1 1.8⫾0.1
within brain region. Diabetes 1.9⫾0.1 1.9⫾0.1 2.3⫾0.1*† 2.5⫾0.2*
Diabetes ⫹ insulin 1.8⫾0.2 1.8⫾0.1 1.8⫾0.1 2.4⫾0.1*
significant (P ⬍ 0.05) increase in inulin associated with the Cerebellum
brain parenchyma in the basal ganglia was observed in group Control 1.5⫾0.1 1.5⫾0.1 1.6⫾0.1 1.6⫾0.1
Diabetes 1.6⫾0.1 1.6⫾0.1 1.5⫾0.1 1.6⫾0.1
II at 56 days (1.7 ⫾ 0.01) and 90 days (2.3 ⫾ 0.1) as compared Diabetes ⫹ insulin 1.6⫾0.1 1.6⫾0.1 1.6⫾0.1 1.6⫾0.1
with both groups I (1.2 ⫾ 0.1 and 1.2 ⫾ 0.1, respectively) and Thalamus
III (1.3 ⫾ 0.1 and 1.2 ⫾ 0.1, respectively). A significant (P ⬍ Control 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1
0.05) interaction was observed between treatment and day Diabetes 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.2
Diabetes ⫹ insulin 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.3
within brain regions. Midbrain
In situ brain perfusion using [14C]sucrose. BBB permeabil- Control 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1 1.1⫾0.1
ity was assessed in whole brain of rats from groups I, II, and Diabetes 1.1⫾0.1 1.2⫾0.2 2.1⫾0.3* 2.3⫾0.1*
III at 7, 28, 56, and 90 days after STZ induction by in situ brain Diabetes ⫹ insulin 1.1⫾0.1 1.2⫾0.1 1.8⫾0.1* 2.0⫾0.1*
perfusion with an impermeant marker ([14C]sucrose; 342 Da) Hypothalamus
Control 1.7⫾0.1 1.7⫾0.1 1.8⫾0.1 1.8⫾0.1
over 20 min (Fig. 1C). Results showed no significant difference Diabetes 1.7⫾0.1 1.7⫾0.1 1.7⫾0.1 1.7⫾0.1
(P ⬎ 0.05) in sucrose associated with total brain between the Diabetes ⫹ insulin 1.7⫾0.1 1.7⫾0.1 1.8⫾0.1 1.7⫾0.1
treatment groups (groups II and III) as compared with group I Hippocampus
at 7 days. A significant increase (P ⬍ 0.05) in sucrose associ- Control 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1
Diabetes 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1
ated with total brain of group II (2.96 ⫾ 0.13) was noted at 28 Diabetes ⫹ insulin 1.5⫾0.1 1.5⫾0.1 1.4⫾0.1 1.4⫾0.1
days as compared with groups I (2.14 ⫾ 0.02) and III (2.19 ⫾ Basal ganglia
0.05). At 56 and 90 days, both groups II (3.75 ⫾ 0.12 and Control 1.3⫾0.1 1.3⫾0.1 1.2⫾0.1 1.2⫾0.1
4.73 ⫾ 0.54, respectively) and III (3.17 ⫾ 0.16 and 3.70 ⫾ Diabetes 1.3⫾0.1 1.3⫾0.1 1.7⫾0.1 2.3⫾0.1*†
0.20, respectively) showed a significant (P ⬍ 0.05) increase in Diabetes ⫹ insulin 1.2⫾0.1 1.2⫾0.1 1.3⫾0.1 1.2⫾0.1
sucrose association with total brain as compared with group I Values are means ⫾ SE (in Rbr% [3H]inulin) for n ⫽ 6 rats. Statistical
(2.11 ⫾ 0.6 and 2.11 ⫾ 0.6, respectively). A significant (P ⬍ significance was determined using two-way ANOVA followed by Tukey’s
0.05) interaction between treatment and day was observed. HSD post hoc analyses. *Significant (P ⬍ 0.05) difference compared with
group I (control) within brain region; †significant (P ⬍ 0.05) difference in
Determination of regional differences in [14C]sucrose asso- percentage of the amount of radioactivity found in the brain compared with
ciation with brain. Using in situ brain perfusion with [14C]su- that found in the perfusate media (Rbr%) compared with group III (diabetes ⫹
crose, we assessed rats in groups I, II, and III for changes in insulin) within brain region.

AJP-Heart Circ Physiol • VOL 291 • DECEMBER 2006 • www.ajpheart.org

Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
H2664 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS

Table 3. Rbr% following a 20-min in situ brain perfusion pressures and rates showed no difference between groups II
using [14C]sucrose in various brain regions at 7, 28, 56, and III as compared with control (group I) at 7, 28, 56, and 90
and 90 days following STZ-induced diabetes days. CBF (Fbl) was calculated at t ⫽ 10 s using in situ brain
perfusion with [3H]butanol. Results showed no significant
Day (P ⬎ 0.05) change in CBF in the treatment groups (groups II
7 28 56 90 and III) as compared with control (group I). Brain weights and
Cortex
the percent water content were similar among all treatment
Control 2.0⫾0.2 2.0⫾0.2 2.0⫾0.2 2.0⫾0.2 groups (groups II and III) compared with control (group I).
Diabetes 2.1⫾0.1 2.5⫾0.3 4.5⫾0.3*† 4.3⫾0.6*
Diabetes ⫹ insulin 2.0⫾0.2 2.0⫾0.2 2.4⫾0.2 3.7⫾0.3* DISCUSSION
Cerebellum
Control 2.3⫾0.1 2.3⫾0.1 2.2⫾0.1 2.3⫾0.1 The main findings of this study were that STZ-induced
Diabetes 2.3⫾0.1 2.4⫾0.2 2.5⫾0.2 2.5⫾0.3 diabetes produced a progressive increase in BBB permeability
Diabetes ⫹ insulin 2.3⫾0.1 2.5⫾0.3 2.5⫾0.2 2.5⫾0.3 to small molecules from 28 to 90 days and that these changes
Thalamus in BBB permeability were region specific, with the midbrain
Control 1.8⫾0.1 1.8⫾0.1 1.8⫾0.1 1.8⫾0.1
Diabetes 1.8⫾0.1 2.0⫾0.2 1.8⫾.01 1.9⫾0.1 seemingly most susceptible to diabetes-induced microvascular
Diabetes ⫹ insulin 1.8⫾0.1 1.8⫾0.1 2.1⫾0.1 2.1⫾0.2 damage. Furthermore, this study showed that increased asso-
Midbrain ciation of a vascular space marker with the brain parenchyma
Control 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1 1.4⫾0.1
Diabetes 1.4⫾0.1 3.1⫾0.3*† 3.5⫾0.4* 4.6⫾0.5*
Diabetes ⫹ insulin 1.4⫾0.1 2.1⫾0.3*† 2.8⫾0.3* 3.7⫾0.5* Table 4. Capillary depletion studies after a 20-min
Hypothalamus
Control 2.5⫾0.1 2.4⫾0.2 2.4⫾0.2 2.5⫾0.1 in situ brain perfusion
Diabetes 2.5⫾0.3 2.5⫾0.2 2.6⫾0.1 2.8⫾0.4
Diabetes ⫹ insulin 2.5⫾0.2 2.4⫾0.1 2.4⫾0.2 2.7⫾0.4 Fraction
Vascular
Hippocampus Day Marker/Group Pellet Supernatant Homogenate
Control 1.5⫾0.1 1.6⫾0.1 1.5⫾0.1 1.5⫾0.1
Diabetes 1.5⫾0.1 1.5⫾0.1 2.4⫾0.1*† 2.8⫾.02*† 7 Sucrose
Diabetes ⫹ insulin 1.5⫾0.1 1.6⫾0.1 1.7⫾0.2 1.8⫾0.2 Group I 0.3⫾0.2* 1.5⫾0.3 1.6⫾0.2
Basal ganglia Group II 0.2⫾0.1* 1.5⫾0.2 1.5⫾0.2
Control 1.8⫾0.2 1.7⫾0.1 1.7⫾0.1 1.7⫾0.1 Group III 0.3⫾0.2* 1.6⫾0.3 1.5⫾0.2
Diabetes 1.8⫾0.1 2.1⫾0.2 3.6⫾0.5*† 3.8⫾0.5*† Inulin
Diabetes ⫹ insulin 1.8⫾0.1 1.8⫾0.1 2.2⫾0.3 3.5⫾0.2*† Group I 0.2⫾0.1* 1.4⫾0.3 1.4⫾0.2
Group II 0.2⫾0.1* 1.4⫾0.1 1.5⫾0.1
Values are means ⫾ SE (in Rbr% [ C]sucrose) for n ⫽ 6 rats. Statistical
14
Group III 0.2⫾0.1* 1.5⫾0.2 1.4⫾0.2
significance was determined using two-way ANOVA followed by Tukey’s
HSD post hoc analyses. *Significant (P ⬍ 0.05) difference compared with 28 Sucrose
group I (control) within brain region; †significant (P ⬍ 0.05) difference in Group I 0.3⫾0.1* 1.4⫾0.1 1.5⫾0.2
Rbr% compared with group III (diabetes ⫹ insulin) within brain region. Group II 0.3⫾0.1* 2.7⫾0.2†‡ 2.8⫾0.3†‡
Group III 0.3⫾0.1* 1.6⫾0.1 1.6⫾0.2
ity across the BBB in the midbrain as compared with group I Inulin
(1.4 ⫾ 0.1, 1.4 ⫾ 0.1, and 1.4 ⫾ 0.1, respectively). The Group I 0.2⫾0.1* 1.4⫾0.2 1.3⫾0.1
Group II 0.2⫾0.1* 1.5⫾0.2 1.4⫾0.1
difference in the increase of sucrose permeability across the Group III 0.2⫾0.1* 1.7⫾0.2 1.4⫾0.1
BBB in the midbrain at 28 and 56 days between groups II and
III was significant (P ⬍ 0.05). At 56 days, group II (3.6 ⫾ 0.5) 56 Sucrose
showed a significant (P ⬍ 0.05) increase in sucrose permeabil- Group I 0.3⫾0.2* 1.5⫾0.2 1.4⫾0.3
Group II 0.3⫾0.1* 3.4⫾0.5†‡ 3.6⫾0.3†
ity across the BBB in the basal ganglia as compared with both Group III 0.3⫾0.2* 1.7⫾0.4 3.3⫾0.4†
groups II (2.2 ⫾ 0.3) and III (1.7 ⫾ 0.1). At 90 days, groups Inulin
II (3.8 ⫾ 0.5) and III (3.5 ⫾ 0.2) had a significant (P ⬍ 0.05) Group I 0.2⫾0.1* 1.4⫾0.1 1.4⫾0.1
increase in sucrose permeability across the BBB in the basal Group II 0.2⫾0.1* 1.4⫾0.1 1.6⫾0.1
ganglia as compared with group I (1.7 ⫾ 0.1). A significant Group III 0.2⫾0.1* 1.4⫾0.1 1.2⫾0.2
(P ⬍ 0.05) interaction between treatment and day within brain 90 Sucrose
regions was observed. Group I 0.3⫾0.1* 1.3⫾0.2 1.5⫾0.3
Determination of sucrose/inulin associated with cerebral Group II 0.3⫾0.1* 3.7⫾0.6† 3.9⫾0.7†
microvessels using capillary depletion. Table 4 shows capillary Group III 0.3⫾0.2* 3.6⫾0.1† 3.5⫾0.4†
Inulin
depletion data in groups I, II, and III after a 20-min in situ brain Group I 0.2⫾0.1* 1.4⫾0.1 1.6⫾0.3
perfusion using [3H]inulin and [14C]sucrose at 7, 28, 56, and 90 Group II 0.2⫾0.1* 1.4⫾0.2 1.4⫾0.1
days. Capillary depletion data showed no significant (P ⬎ Group III 0.2⫾0.1* 1.4⫾0.1 1.4⫾0.1
0.05) difference in the amount of inulin or sucrose trapped in Values are means ⫾ SE (in Rbr% [3H]inulin or [14C]sucrose for n ⫽ 6 rats.
the vascular pellet between the groups at any day evaluated. Data are the percent values of sucrose/inulin associated with the brain sepa-
Furthermore, the study revealed that the percent amount of rated into fractions (vascular pellet and supernatant) and the total brain
inulin/sucrose associated with actual entry into the brain pa- homogenate. Statistical significance was determined using two-way ANOVA
followed by Tukey’s HSD post hoc analyses. *Significant (P ⬍ 0.05) differ-
renchyma (supernatant) was not statistically (P ⬎ 0.05) differ- ence from homogenate within treatment group; †significant (P ⬍ 0.05)
ent from that in total brain homogenate. difference from group I (control) within day and vascular space marker;
Measurement of CBF. Table 5 shows parameters measured ‡significant (P ⬍ 0.05) difference from group III (diabetes ⫹ insulin) within
for CBF after a 10-s in situ perfusion. Cerebral perfusion day and vascular space marker.

AJP-Heart Circ Physiol • VOL 291 • DECEMBER 2006 • www.ajpheart.org

Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS H2665
Table 5. Cerebral blood flow analyses using in situ brain perfusion with [3H]butanol and measurement of percent brain
water in rats at 7, 28, 56, and 90 days following STZ-induced diabetes
Day Parameter Group I Group II Group III

7 ␭br 0.72 0.75 0.74

Perfusion pressure, mmHg 83.4⫾4.8 82.8⫾3.1 83.8⫾2.4
Perfusion rate, ml䡠min⫺1䡠g⫺1 1.70⫾0.03 1.69⫾0.07 1.73⫾0.02
Cerebral blood flow, ml䡠min⫺1䡠g⫺1 1.22⫾0.31 1.35⫾0.21 1.28⫾0.37
Perfused brain weight, g 2.1⫾0.2 2.2⫾0.2 2.1⫾0.2
Perfused brain water, % 82.8⫾0.4 83.1⫾0.7 82.7⫾0.7

28 ␭br 0.69 0.74 0.73

Perfusion pressure, mmHg 81.5⫾3.6 84.2⫾4.7 83.0⫾2.1
Perfusion rate, ml䡠min⫺1䡠g⫺1 1.66⫾0.04 1.74⫾0.06 1.71⫾0.02
Cerebral blood flow, ml䡠min⫺1䡠g⫺1 1.15⫾0.24 1.26⫾0.34 1.20⫾0.12
Perfused brain weight, g 2.2⫾0.3 2.2⫾0.2 2.2⫾0.2
Perfused brain water, % 82.1⫾1.2 82.7⫾0.8 83.2⫾0.9

56 ␭br 0.71 0.80 0.75

Perfusion pressure, mmHg 83.4⫾2.8 81.7⫾3.7 86.2⫾3.3
Perfusion rate, ml䡠min⫺1䡠g⫺1 1.71⫾0.05 1.76⫾0.04 1.68⫾0.05
Cerebral blood flow, ml䡠min⫺1䡠g⫺1 1.31⫾0.25 1.27⫾0.19 1.22⫾0.29
Perfused brain weight, g 2.2⫾0.1 2.2⫾0.2 2.3⫾0.2
Perfused brain water, % 81.4⫾0.8 81.2⫾1.1 82.4⫾0.7

90 ␭br 0.73 0.74 0.73

Perfusion pressure, mmHg 87.1⫾3.6 83.4⫾4.7 85.5⫾3.9
Perfusion rate, ml䡠min⫺1䡠g⫺1 1.72⫾0.04 1.78⫾0.09 1.67⫾0.03
Cerebral blood flow, ml䡠min⫺1䡠g⫺1 1.14⫾0.26 1.34⫾0.19 1.26⫾0.21
Perfused brain weight, g 2.2⫾0.2 2.2⫾0.1 2.2⫾0.2
Perfused brain water, % 81.1⫾0.4 81.3⫾0.6 81.7⫾1.2
Values are means ⫾ SE for n ⫽ 6 rats. Group I, control; group II, diabetes; group III, diabetes ⫹ insulin; ␭br, partition coefficient.

was due to transfer from the systemic circulation to the brain
and not increased trapping or endocytosis into brain capillary
endothelial cells. In addition, this study showed that insulin
treatment of diabetes attenuated BBB disruption, especially
during the first few weeks; however, as diabetes progressed, it
was evident that microvascular damage occurred even when
hyperglycemia was controlled. Finally, this study demon-
strated that STZ-induced diabetes did not alter total CBF or
edema formation at any time point evaluated; therefore, it is
improbable that these factors played a role in the increased
association of radiolabeled vascular space marker with the
brain.
STZ induced hyperglycemia in ⬎95% of rats by 24 h after
administration. Availability of 10% glucose water was used to
alleviate potential severe hypoglycemia in the rats as a result of
increased insulin release during the destruction of pancreatic
␤-cells. To limit episodes of hypoglycemia in group III ani-
mals, insulin treatment was divided into two doses and glucose
levels were regularly monitored. With the use of this approach,
group III animals had a fasting blood glucose level of 128 ⫾
19 mg/dl as compared with 146 ⫾ 10 mg/dl in group I and
426 ⫾ 31 mg/dl in group II animals.
Changes in BBB permeability due to STZ-induced diabetes
were assessed by using three varying sized vascular space
markers [albumin (65,000 Da), inulin (5,000 Da), and sucrose
(342 Da)]. Moreover, using differential permeability of radio-
labeled vascular space markers has been effective at measuring
regional changes in brain uptake (40, 41, 66). Assessment of
albumin extravasation is a frequently used method to measure
vascular leakage. The intact BBB has negligible transport of
albumin into the brain and serves as a physical barrier to
partition the systemic circulation from the brain parenchyma.
AJP-Heart Circ Physiol • VOL
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
However, susceptibility of the BBB to increased permeability
has been documented in a number of diseases. Whereas dia-
betic-induced microvascular leakage is commonly associated
with early endothelial dysfunction of the retina (14), kidney
(10), and peritoneum (64), few studies have documented
changes in the brain. One possible reason for this may be due
to BBB phenotype and the relative resistance of the BBB to
damage as compared with other microvascular areas. In this
study, we measured albumin extravasation into the brain pa-
renchyma by quantifying the amount of Evans blue albumin
extracted from the brains of rats in groups I, II, and III. No
change in total albumin extravasation was observed in the
treatment groups (II and III) as compared with control rats,
thus suggesting that the BBB remained intact. This observation
was reinforced by measurements showing no change in the
percentage of brain water, a hallmark indicator of increased
extracellular albumin and edema formation. Whereas total
albumin extravasation remained unchanged, on closer evalua-
tion of brain regions, we noted a significant increase in Evans
blue albumin in the midbrain of groups II and III at 90 days and
in the basal ganglia of group II at 90 days. These results
suggest that the BBB is not a homogenous membrane but,
rather, may have areas of increased susceptibility. Moreover,
these results argue in favor of our rationale that, by the time
albumin is measured, the BBB is compromised and therefore
assessment of smaller vascular markers would be more indic-
ative of how the BBB is responding to diabetes-related vascu-
lar complications.
In situ brain perfusion, which was used to measure changes
in BBB permeability to inulin and sucrose, is a methodology
that has successfully assessed drug transport across the BBB
into the CNS (15, 22, 33) and, more recently, changes in BBB
291 • DECEMBER 2006 • www.ajpheart.org
H2666 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS
function following pathology (16, 23, 26, 63). In situ brain
perfusion has been shown to maintain good neurological func-
tion and other physiological factors in rat and guinea pig
models (46, 68), and, when coupled to capillary depletion,
these techniques are precise tools for assessing BBB function.
Using these techniques, we determined that BBB functional
integrity was maintained to molecules ⬎5,000 Da out to 90
days of STZ-induced diabetes; however, BBB functional in-
tegrity was disrupted to small molecules by 28 days and
progressively worsened out to 90 days. In addition, our studies
indicated that control of STZ-induced diabetes with insulin
treatment attenuated BBB disruption to sucrose. However, as
diabetes progressed, insulin treatment in group III did not
effectively reduce the increased BBB permeability to sucrose
observed at 56 and 90 days. The finding that BBB disruptions
increased over time supports our rationale that effects of
diabetes on the cerebral microvasculature occur in a more
insidious manner than effects of other microvascular deficits.
Furthermore, since diabetes is a lifelong disease, occurring
more prevalently in younger populations, the long-term effects
of diabetes on brain function are of paramount importance.
We assessed whether diabetes-induced BBB permeability to
inulin and sucrose was occurring globally or in specific brain
regions. Early changes in microvascular permeability noted in
other tissues were not apparent in the BBB, even to small
molecules. Although no change in inulin permeability was
observed in the total brain at any time point assessed, when
brain regions were evaluated separately, we observed increased
permeability to inulin in the cerebral cortex and midbrain in
group II at 56 and 90 days, in the basal ganglia of group II at
90 days, and in the midbrain of group III at 90 days. Assess-
ment of brain region-specific permeability of sucrose demon-
strated a greater distribution of sucrose than observed with
inulin. We observed increased permeability in the cortex at 28,
56, and 90 days in group II and increased permeability in the
midbrain, hippocampus, and basal ganglia in group II at 56 and
90 days. Group III showed an increased permeability in the
midbrain at 56 and 90 days and in the cerebral cortex and basal
ganglia at 90 days. These findings suggest that the BBB has
certain areas more susceptible to breakdown than others. On
the basis of our findings and the current literature, we hypoth-
esize that BBB disruptions observed in this study were due to
changes in cell-cell contacts leading to increased paracellular
flux; however, the possibility exists that these changes were
due to alterations in transcytotic pathways or increased capil-
lary fenestrations, and future studies will need to address this
important issue.
Findings that BBB permeability changes were regional
rather than global are not surprising, and yet this area has been
understudied with regard to the effects of diabetes. CBF and
capillary density are not evenly distributed in white and gray
matter areas of the brain (4). Under basal conditions, areas with
higher metabolic need (i.e., greater demand for glucose) have
greater capillary density and increased CBF. However, during
CNS pathology, the area of the brain affected has a large
influence on the ability for recovery. Results from this study
suggest a differential susceptibility to diabetes-induced BBB
disruption in brain regions. BBB disruptions in the midbrain,
an area with lower capillary density and CBF than the cortex,
were observed at 28 days and were larger in size than seen in
other brain areas. Clinical case reports cite an increased sus-
AJP-Heart Circ Physiol • VOL
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
ceptibility to third nerve palsies in diabetics due to an increased
prevalence of midbrain lesions and hemorrhaging (24, 37).
Furthermore, diabetes-induced lesions have been reported to
attenuate morphine analgesia due to decreased serotonergic
activity in the raphe magnus nucleus (48, 55). Of particular
interest in this investigation was the finding that other brain
areas with greater cerebral flow were affected as diabetes
progressed to 56 and 90 days. These findings suggest that
diabetes-related changes to the CNS (i.e., increased oxidative
stress, decreased vascular reactivity, and altered access to
metabolic substrates) have a cumulative effect that takes a
greater period of time to manifest in altered BBB function.
The “neurovascular unit,” which is composed of cerebral
endothelial cells, pericytes, glia, and neurons, carefully orches-
trates localized changes in CBF to rapidly meet metabolic
demands. Under basal physiological conditions, the spatial and
temporal relationship between neural activity and CBF, termed
neurovascular coupling, utilizes cerebrovascular changes in-
duced by activation to map regional changes in function in the
human brain (19, 32). Moreover, CBF is maintained in a
narrow range by autoregulatory mechanisms, irrespective of
changes in systemic blood flow (50). However, in several brain
pathologies, interactions between neural activity and cerebral
blood vessels are disrupted, and the resulting homeostatic
unbalance, known as neurovascular uncoupling, may contrib-
ute to brain dysfunction, including but not limited to BBB
disruptions. In Alzheimer’s disease, hypertension, and ische-
mic stroke, cerebrovascular function is altered, resulting in
reduced CBF, altered autoregulation, disruption in nutrient
trafficking across the BBB, and attenuated response to in-
creased metabolic demand (7, 19, 38, 42). Often, these changes
in cerebrovascular function precede onset of any cognitive
impairment, suggesting a role for neurovascular uncoupling in
the etiology and progression of cognitive dysfunction. Using
these concepts, we argue that observed regional changes in
BBB function were due to a number of factors (differential
neuronal viability, increased metabolic demand, and oxidative
stress) in specific brain regions brought about by diabetes-
associated effects, including hyperglycemia, dyslipidemia, and
increased cholesterol (15, 17). Future studies would be well
served to gain a better understanding of how neural and glia
cells respond to diabetes and how changes in these cells affect
cerebrovascular function.
CBF in control rats (group I) using [3H]butanol was consis-
tent with previously reported values ranging from 0.8 –1.49
ml䡠min⫺1 䡠g⫺1 (Table 5) (28). The current study showed no
change in CBF at any time point assessed regardless of treat-
ment. A number of factors associated with diabetes have been
found to play an integral role in cerebrovascular changes,
including oxidative stress, hyperglycemia, atherosclerosis, and
autonomic dysfunction (5, 21, 45, 47). Results of this study
suggest cerebral autoregulation of blood flow in the whole
brain remained intact during diabetes, which further reaffirms
that the increased association of the vascular space marker with
the brain parenchyma was due to changes in BBB functional
integrity and not changes in hemodynamics. However, what
cannot be extrapolated from our findings are possible regional
breakdowns in cerebral autoregulation (i.e., neurovascular un-
coupling) and the cerebral vascular response to further stres-
sors, such as an acute hypertensive state or additional oxidative
stress in the STZ-treated groups (groups I and II). Future
291 • DECEMBER 2006 • www.ajpheart.org
 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS
studies are needed to evaluate the ability of cerebral microves-
sels to adapt and respond to stressors in diabetic rats.
In summary, we have shown that, as diabetes progresses, the
extent of microvascular leakage to small molecules increases.
These results suggest that diabetes-induced perturbations to
cerebral microvessels may disrupt homeostasis and contribute
to long-term cognitive and functional deficits. The BBB per-
turbations observed are to small molecules; nonetheless, these
disruptions are significant, as noted in the gadolinium-DTPA
study (56), due to the correlation between increased BBB
permeability, altered CNS homeostasis, and impaired neuronal
function. Interestingly, changes in BBB permeability were
region specific, and many of the areas affected can be associ-
ated with detrimental CNS outcomes, including the midbrain,
basal ganglia, cortex, and hippocampus. Thus these results put
forward the rationale that microangiopathy of the cerebrovas-
culature may play a primary role in the etiology of diabetes-
induced CNS disorders. Further studies will be needed to
evaluate the role of BBB endothelial cell tight junction regu-
lation and basement membrane alterations in increased micro-
vascular permeability and focus on how alterations in neuro-
vascular unit function in the identified brain regions relate to
the etiology of adverse CNS effects.
GRANTS
This study was supported by the American Diabetes Association through a
Faculty Development Award 7-05JF-22 (to J. D. Huber).
REFERENCES
1. Abbott NJ. Neurobiology: glia and the blood-brain barrier. Nature 325:
195, 1987.
2. Appelros P, Samuelsson M, and Lindell D. Lacunar infarcts: functional
and cognitive outcomes at five years in relation to MRI findings. Cere-
brovasc Dis 20: 34 – 40, 2005.
3. Ariga T, Jarvis WD, and Yu RK. Role of the sphingolipid-mediated cell
death in neurodegenerative diseases. J Lipid Res 39: 1–16, 1998.
4. Baborie A, and Kuschinsky W. Lack of relationship between cellular
density and either capillary density or metabolic rate in different regions
of the brain. Neurosci Lett 404: 20 –22, 2006.
5. Baird AT, Parsons WM, Barber AP, Butcher SK, Desmond MP, Tress
MB, Colman GP, Jerums G, Chambers RB, and Davis MS. The
influence of diabetes mellitus and hyperglycaemia on stroke incidence and
outcome. J Clin Neurosci 9: 618 – 626, 2002.
6. Basile DP, Fredrich K, Weihrauch D, Hattan N, and Chilian WM.
Angiostatin and matrix metalloprotease expression following ischemic
acute renal failure. Am J Physiol Renal Physiol 286: F893–F902, 2004.
7. Boado RJ. Molecular regulation of the blood-brain barrier GLUT1 glu-
cose transporter by brain-derived factors. J Neural Transm Suppl 53:
323–331, 1998.
8. Bouchard P, Ghitescu LD, and Bendayan M. Morpho-functional studies
of the BBB in streptozotocin-induced diabetic rat. Diabetologia 45:
1017–1025, 2002.
9. Butt AM, Jones HC, and Abbott NJ. Electrical resistance across the
blood-brain barrier in anesthetized rats: a developmental study. J Physiol
429: 47– 62, 1990.
10. Casey G R, Joyce M, Roche-Nagle G, Chen G, and Bouchier-Hayes D.
Pravastatin modulates early diabetic nephropathy in an experimental
model of diabetic renal disease. J Surg Res 123: 176 –181, 2005.
11. Chehade JM, Haas MJ, and Mooradian AD. Diabetes-related changes
in rat cerebral occludin and ZO-1 expression. Neurochem Res 27: 249 –
252, 2002.
12. Colwell J. Pathogenesis of vascular disease. Diabetes Obes Metab 2:
S19 –S24, 2000.
13. Crone C and Christensen O. Electrical resistance of a capillary endo-
thelium. J Gen Physiol 77: 349 –371, 1981.
14. Cukiernik M, Hileeto D, Evans T, Mukherjee S, Downey D, and
Chakrabarti S. Vascular endothelial growth factor in diabetes induced
early retinal abnormalities. Diabetes Res Clin Pract 65: 197–208, 2004.
AJP-Heart Circ Physiol • VOL 291 • DECEMBER 2006 •
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
H2667
15. Egleton DR, Mitchell AS, Huber DJ, Palian MM, Polt R, and Davis
PT. Improved blood-brain barrier penetration and enhanced analgesia of
an opioid peptide by glycosylation. J Pharmacol Exp Ther 299: 967–972,
2001.
16. Egleton RD, Campos CR, Huber JD, Brown RC, and Davis TP.
Differential effects of diabetes on rat choroid plexus ion transporter
expression. Diabetes 52: 1496 –1501, 2003.
17. Faraci FM. Oxidative stress: the curse that underlies cerebral vascular
dysfunction? Stroke 36: 186 –188, 2005.
18. Gjedde A and Crone C. Blood-brain glucose transfer: repression in
chronic hyperglycemia. Science 214: 456 – 457, 1981.
19. Girouard H and Iadecola C. Neurovascular coupling in the normal brain
and in hypertension, stroke, and Alzheimer’s disease. J Appl Physiol 100:
328 –335, 2006.
20. Gustafsson T and Kraus WE. Exercise-induced angiogenesis-related
growth and transcription factors in skeletal muscle, and their modification
in muscle pathology. Front Biosci 6: 75– 89, 2001.
21. Hachinski VC, Wilson JX, and Smith KE. Effect of age on autonomic
and cardiac responses in a rat stroke model. Arch Neurol 49: 690 – 696,
1992.
22. Hau SV, Huber DJ, Campos RC, Lipkowski WA, Misicka A, and
Davis PT. Effect of guanidino modification and proline substitution on the
in vitro stability and blood-brain barrier permeability of endomorphin II.
J Pharm Sci 91: 2140 –2149, 2002.
23. Hawkins TB, Abbruscato JT, Egleton DR, Brown CR, Huber DJ,
Campos RC, and Davis P T. Nicotine increases in vivo blood-brain
barrier permeability and alters cerebral microvascular TJ protein distribu-
tion. Brain Res 1027: 48 –58, 2004.
24. Heckmann JG, Schuttler M, and Tomandl B. Achard-Levi syndrome:
pupil sparing oculomotor nerve palsy due to midbrain stroke. Cerebrovasc
Dis 16: 109 –110, 2003.
25. Hill RE and Williams PE. Perineurial cell basement membrane thicken-
ing and myelinated nerve fibre loss in diabetic and nondiabetic peripheral
nerve. Neurol Sci 217: 157–163, 2004.
26. Huber DJ, Hau SV, Borg L, Campos RC, Egleton DR, and Davis PT.
Blood-brain barrier tight junctions are altered during a 72-h exposure to
␭-carrageenan-induced inflammatory pain. Am J Physiol Heart Circ
Physiol 283: H531–H537, 2002.
27. Huber JD, Egleton RD, and Davis TP. Molecular physiology and
pathophysiology of tight junctions in the blood-brain barrier. Trends
Neurosci 24: 719 –725, 2001.
28. Huber JD, Witt KA, Hom S, Mark KS, and Davis TP. Inflammatory
pain alters blood-brain barrier permeability and tight junctional protein
expression. Am J Physiol Heart Circ Physiol 280: H1241–H1248, 2001.
29. Idris I, Gray S, and Donnelly R. Protein kinase C-beta inhibition and
diabetic microangiopathy: effects on endothelial permeability responses in
vitro. Eur J Pharmacol 485: 141–144, 2004.
30. Karapanayiotides T, Piechowski-Jozwiak B, van Melle G, Bogous-
slavsky J, and Devuyst G. Stroke patterns, etiology, and prognosis in
patients with diabetes mellitus. Neurology 62: 1558 –1562, 2004.
31. Kaya M, Gulturk S, Elmas I, Kalayci R, Arican N, Kocyildiz ZC,
Kucuk M, Yorulmaz H, and Sivas A. The effects of magnesium sulfate
on blood-brain barrier disruption caused by intracarotid injection of
hyperosmolar mannitol in rats. Life Sci 76: 201–212, 2004.
32. Koehler RC, Gebremedhin D, and Harder DR. Role of astrocytes in
cerebrovascular regulation. J Appl Physiol 100: 307–317, 2006.
33. Koziara JM, Lockman PR, Allen DD, and Mumper RJ. In situ
blood-brain barrier transport of nanoparticles. Pharm Res 20: 1772–1778,
2003.
34. Kuchinsky W and Baborie A. Lack of relationship between cellular
density and either capillary density or metabolic rate in different regions
of the brain. Neurosci Lett 404: 20 –22, 2006.
35. Latour LL, Kang DW, Ezzeddine MA, Chalela JA, and Warach S.
Early blood-brain barrier disruption in human focal brain ischemia. Ann
Neurol 56: 468 – 477, 2004.
36. Lee IK, Kim HS, and Bae JH. Endothelial dysfunction: its relationship
with acute hyperglycemia and hyperlipidemia. Int J Clin Pract Suppl:
59 – 64, 2002.
37. Mizushima H, and Seki T. Midbrain hemorrhage presenting with ocu-
lomotor nerve palsy: case report. Surg Neurol 58: 417– 420, 2002.
38. Mooradian AD. Effect of aging on the blood-brain barrier. Neurobiol
Aging 9: 31–39, 1988.
39. Osicka TM, Russo LM, Qiu ML, Brammar GC, Thallas V, Forbes
JM, Comper WD, and Jerums G. Additive effects of hypertension and
www.ajpheart.org
H2668 STZ DIABETES ALTERS BBB PERMEABILITY IN RATS
diabetes on renal cortical expression of PKC alpha and epsilon and alpha
tubulin but not PKC beta 1 and beta 2. J Hypertens 21: 2399 –2407, 2003.
40. Pan W, Banks WA, and Kastin AJ. Blood-brain barrier permeability to
ebiratide and TNF in acute spinal cord injury. Exp Neurol 146: 367–373,
1997.
41. Pan W, Banks WA, Kennedy MK, Guitierrez EG, and Kastin AJ.
Differential permeability of the BBB in acute EAE: enhanced transport of
TNF-␣. Am J Physiol Endocrinol Metab 271: E636 –E642, 1996.
42. Parihar MS and Brewer GJ. Assembly of mitochondrial cytochrome
c-oxidase, a complicated and highly regulated cellular process. Am J
Physiol Cell Physiol 291: C1129 –C1147, 2006.
43. Pereira L, Matthes J, Schuster I, Valdivia HH, Herzig S, Richard S,
and Gomez MA. Mechanisms of [Ca2⫹]i transient decrease in cardiomy-
opathy of db/db Type 2 diabetic mice. Diabetes 55: 608 – 615, 2006.
44. Plumb J, McQuaid S, Mirakhur M, and Kirk J. Abnormal endothelial
tight junctions in active lesions and normal-appearing white matter in
multiple sclerosis. Brain Pathol 12: 154 –169, 2002.
45. Prasad K. Oxidative stress as a mechanism of diabetes in diabetic BB
prone rats: effect of secoisolariciresinol diglucoside (SDG). Mol Cell
Biochem 209: 89 –96, 2000.
46. Preston JE, al-Sarraf H, and Segal MB. Permeability of the developing
blood-brain barrier to 14C-mannitol using the rat in situ brain perfusion
technique. Brain Res Dev Brain Res 87: 69 –76, 1995.
47. Pricci F, Leto G, Amadio L, Iacobini C, Cordone S, Catalano S, Zicari
A, Sorcini M, Di Mario U, and Pugliese G. Oxidative stress in diabetes-
induced endothelial dysfunction involvement of nitric oxide and PKC.
Free Radic Biol Med 35: 683– 694, 2003.
48. Ramakrishnan R, Sheeladevi R, and Suthanthirarajan N. PKC-alpha
mediated alterations of indoleamine contents in diabetic rat brain. Brain
Res Bull 64: 189 –194, 2004.
49. Ristow M. Neurodegenerative disorders associated with diabetes mellitus.
J Mol Med 82: 510 –529, 2004.
50. Rosengarten B, Huwendiek O, and Kaps M. Neurovascular coupling
and cerebral autoregulation can be described in terms of a control system.
Ultrasound Med Biol 27: 189 –193, 2001.
51. Rosenkranz CA, Hood GS, Woods LR, Dusting JG, and Ritchie HR.
B-type natriuretic peptide prevents acute hypertrophic responses in the
diabetic rat heart: importance of cyclic GMP. Diabetes 52: 2389 –2395,
2003.
52. Roy S and Sato T. Role of vascular basement membrane components in
diabetic microangiopathy. Drug News Perspect 13: 91–98, 2000.
53. Saija A, Princi P, Pisani A, Santoro G, DePasquale R, Massi M, and
Costa G. Blood-brain barrier dysfunctions following systemic injection of
kainic acid in the rat. Life Sci 51: 467– 477, 1992.
54. Salmi M, Stolen C, Jousilahti P, Yegutkin GG, Tapanainen P, Jana-
tuinen T, Knip M, Jalkanen S, and Salomaa V. Insulin-regulated
increase of soluble vascular adhesion protein-1 in diabetes. Am J Pathol
161: 2255–2262, 2002.
AJP-Heart Circ Physiol • VOL 291 • DECEMBER 2006 •
Downloaded from journals.physiology.org/journal/ajpheart (202.080.212.010) on November 9, 2020.
55. Sounvoravong S, Nakashima NM, Wada M, and Nakashima K.
Decrease in serotonin concentration in raphe magnus nucleus and atten-
uation of morphine analgesia in two mice models of neuropathic pain. Eur
J Pharmacol 484: 217–223, 2004.
56. Starr JM, Wardlaw J, Ferguson K, MacLullich A, Deary IJ, and
Marshall I. Increased blood-brain barrier permeability in Type II diabetes
demonstrated by gadolinium magnetic resonance imaging. J Neurol Neu-
rosurg Psychiatry 74: 70 –76, 2003.
57. Thomas AJ, Kalaria RN, and O’Brien JT. Depression and vascular
disease: what is the relationship? J Affect Disord 79: 81–95, 2004.
58. Toborek M, Lee YW, Pu H, Malecki A, Flora G, Garrido R, Henning
B, Bauer HC, and Nath A. HIV Tat protein induces oxidative and
inflammatory pathways in brain endothelium. J Neurochem 84: 165–179,
2003.
59. Tomkins O, Kaufer D, Korn A, Shelef I, Golan H, Reichenthal E,
Soreq A, and Friedman A. Frequent blood-brain barrier disruption in the
human cerebral cortex. Cell Mol Neurobiol 21: 675– 691, 2001.
60. Triguero D, Buciak J, and Pardridge WM. Capillary depletion method
for quantification of blood-brain barrier transport of circulating peptides
and plasma proteins. J Neurochem 54: 1882–1888, 1990.
61. Wada R and Yagihashi S. Role of advanced glycation end products and
their receptors in development of diabetic neuropathy. Ann NY Acad Sci
1043: 598 – 604, 2005.
62. Winkler F, Koedel U, Kastenbauer S, and Pfister HW. Differential
expression of nitric oxide synthases in bacterial meningitis: role of the
inducible isoform for blood-brain barrier breakdown. J Infect Dis 183:
1749 –1759, 2001.
63. Witt KA, Mark KS, Hom S, and Davis TP. Effects of hypoxia-
reoxygenation on rat blood-brain barrier permeability and tight junctional
protein expression. Am J Physiol Heart Circ Physiol 285: H2820 –H2831,
2003.
64. Wong TY, Szeto CC, Szeto CY, Lai KB, Chow KM, and Li PK.
Association of eNOS polymorphism with basal peritoneal membrane
function in uremic patients. Am J Kidney Dis 42: 781–786, 2003.
65. Yu PK, Yu DY, Cringle SJ, and Su EN. Endothelial F-actin cytoskeleton
in the retinal vasculature of normal and diabetic rats. Curr Eye Res 30:
279 –290, 2005.
66. Ziylan YZ, Robinson PJ, and Rapoport SI. Blood-brain barrier perme-
ability to sucrose and dextran after osmotic opening. Am J Physiol Regul
Integr Comp Physiol 247: R634 –R648, 1984.
67. Zlokovic BV. Vascular disorder in Alzheimer’s disease: role in pathogen-
esis of dementia and therapeutic targets. Adv Drug Deliv Rev 54: 1553–
1559, 2002.
68. Zlokovic BV, Begley DJ, Djuricic BM, and Mitrovic DM. Measurement
of solute transport across the blood-brain barrier in the perfused guinea pig
brain: method and application to N-methyl-alpha-aminoisobutyric acid.
J Neurochem 46: 1444 –1451, 1986.
www.ajpheart.org
 International Journal of
Molecular Sciences

Article
Effect of Streptozotocin-Inducted Diabetes on the
Pathophysiology of Enteric Neurons in the Small
Intestine Based on the Porcine Diabetes Model
Michał Bulc * , Jarosław Całka and Katarzyna Palus
Department of Clinical Physiology Faculty of Veterinary Medicine, University of Warmia and Mazury,
Oczapowskiego Str. 13, 10-719 Olsztyn, Poland; jaroslaw.calka@uwm.edu.pl (J.C.);
katarzyna.palus@uwm.edu.pl (K.P.)
* Correspondence: michal.bulc@uwm.edu.pl




Received: 13 January 2020; Accepted: 14 March 2020; Published: 17 March 2020


Abstract: Hyperglycemia is one of the main causes of diabetes complications. Gastrointestinal (GI)
disturbances are one of the most frequent complications during diabetes. The porcine digestive tract
possesses physiological and pathological similarities to the human digestive tract. This also applies
to the innervation of the gastrointestinal tract. In this study, the influence of experimentally-inducted
hyperglycemia was examined on the expression of vesicular acetylcholine transporter (VAChT),
cocaine- and amphetamine-regulated transcript (CART), galanin (GAL), vasoactive intestinal
polypeptide (VIP), and calcitonin gene-related peptide (CGRP) in the enteric nervous system
(ENS) neurons in the small intestine of the pig. During the current study, an increased number of
neurons containing CART, VIP, GAL, and CGRP under streptozotocin injection were observed. The
augmentation of expression included all enteric plexuses present in the small intestine. The same
results were obtained in the case of VAChT; namely, chronic hyperglycemia led to an increase in the
number of neurons utilizing VAChT in all investigated plexuses. The obtained results suggested that
the function of neuropeptides studied in this experiment depended on their localization in the ENS
structures, as well as part of the GI tract. Diabetes led to alterations in the neurochemical phenotype
of small intestine enteric neurons.

Keywords: enteric nervous system; diabetes; neuropeptides; pig; gastrointestinal complications

1. Introduction
The gastrointestinal (GI) tract is innervated by both the central nervous system (CNS) and by the
enteric nervous system (ENS), located within the wall of the digestive tract [1]. The ENS throughout the
intramural plexuses (connected itself by a neuronal network) controls many digestive functions [1–3].
The ENS is characterized by high autonomy in the regulation of the GI tract function, but its functions
may be regulated by CNS. The organization of the ENS clearly depends on the digestive tract region,
but intraspecies differences have also been observed [4–6]. The intramural plexuses created by neuronal
cell bodies are organized by two plexuses. In large animals, we can distinguish two plexuses in the
stomach: myenteric plexus (MP) and submucosal plexus (SP), while in the gut (small and large),
the latter is additionally divided into the inner submucosal plexus (ISP) and the outer submucosal
plexus (OSP) [6,7]. The ENS in the small intestine contains several classes of neurons, including sensory
neurons, interneurons, and motor neurons, through which smooth muscle activity, transmucosal fluid
fluxes, local blood flow, nutrient resorption, and other functions are controlled and regulated. It should
be stressed that the ENS controls gut functions independently from vago-vagal reflexes [8].
Furthermore, each neuron utilizes different neurotransmitters, which determine its chemical
code [9]. Using immunohistochemical methods, numerous biologically active substances have been

Int. J. Mol. Sci. 2020, 21, 2047; doi:10.3390/ijms21062047 www.mdpi.com/journal/ijms

Int. J. Mol. Sci. 2020, 21, 2047 2 of 25

described in enteric neurons [10,11]. To date, more than 50 neurotransmitters and/or neuromodulators
have been noted in the ENS [12]. One of the most widespread substances in the GI tract is acetylcholine
(ACh) [12]. In order to identify neurons containing the ACh enzymes, synthesis or transport
markers of ACh are used. Vesicular acetylcholine transporter (VAChT) is considered to be the main
marker of cholinergic structures in the GI tract [13]. Its presence has been confirmed in neurons
playing different functions, e.g., in excitatory motoneurons, interneurons, and sensory neurons [13].
Cocaine- and amphetamine-regulated transcript (CART) peptide, for the first time isolated from ovine
hypothalamus [14], is extensively distributed in central and peripheral nervous systems, including
the ENS [15,16]. Despite numerous studies, the accurate function of CART in GI physiology is poorly
understood. Previous research revealed that CART could decrease gastric acid secretion and change
colon motility [17]. Galanin (GAL) is an endogenous 29- or 30-amino-acid neuropeptide, with a broad
expression on nervous system structures [18]. GAL has shown a broad spectrum of action in the
digestive tract [19] by activating metabotropic G-coupled receptors, which changes permeability by
opening membrane potassium ion channels. This results in the secretion of other neurotransmitters,
as well as the regulation of gut motility and fluid circulation [20,21]. In turn, 28-amino acid-peptide
vasoactive intestinal polypeptide (VIP) is one of the main inhibitory peptides in the GI tract [22].
VIP, through hyperpolarization, induces smooth muscle relaxation, decreases gastric acid secretion,
and simultaneously increases bile secretion [23]. Moreover, VIP is a potent neuroprotective factor in
the ENS [24]. In the proper function of gut physiology, the transduction of sensory and pain stimuli
from the GI tract to the CNS is necessary. This type of information is transmitted via the afferent
pathway, in which calcitonin gene-related peptide (CGRP) plays the main role [25]. Obviously, this is
the main (but not the only) function that it performs by CGRP in the GI tract. Several studies have
addressed numerous other important attributes of CGRP inside the digestive tract [26,27]. It should be
mentioned that suppression of gastric acid secretion, hyperpolarization of the GI smooth muscular
membrane, vasodilatation, and regulation of the absorption of nutrients from the gut are assigned to
physiological functions of CGRP [28].
It is well-known that neurons located in both central and peripheral nervous systems exhibit a
high degree of plasticity [29]. Many factors can damage neuronal tissue, and one of them is long-lasting
high glucose levels. This, in turn, leads to injury of nerves (sensory, motors, and autonomic), which
often occurs in the course of diabetes [30]. Due to the huge number of neurons creating the ENS,
the digestive tract is often the victim of hyperglycemia [31]. Every organ of the GI tract can be damaged
in the course of diabetes [31]. Symptoms, such as postprandial fullness, nausea, vomiting, bloating,
early satiety, and abdominal pain, are typically described [32].
Studies on the pathomechanism of gastrointestinal complications in type 1 diabetes are often
performed using animal models [33]. The well-known and often used rodent models of diabetes do
not fully reflect the anatomical and physiological properties of the human digestive tract. Considering
this fact, large mammals, including the pig, seem to be a better model to investigate gastrointestinal
complications than small laboratory animals [34]. The pig is very useful in many aspects as a model
for human physiology and pathophysiology because many organ systems of this species, as well as
physiological and pathophysiological responses, resemble those observed in humans. Since diabetes
occurs extremely rarely in pigs, exogenous injection of streptozotocin (STZ) is needed to induce
diabetes [35]. After a few days of STZ injections, clear symptoms of diabetes are present [36–41]. In this
experimental model, the main defining factor of diabetes is chronic hyperglycemia. Therefore, the goal
of the present investigation was to induce diabetes in the pig model. Secondly, immunohistochemistry
was used to assess changes in the number of enteric neurons in the small intestine expressing VAChT,
CART, VIP, GAL, and CGRP immunoreactivity. Moreover, the role of peptides investigated in diabetes,
especially in the GI tract, is poorly understood, and the data originate exclusively from rodents [31].
Taking the above data into consideration, it is reasonable to conduct this research using the pig diabetes
model. In turn, the obtained results might be more representative in relation to humans.
Int. J. Mol. Sci. 2020, 21, 2047 3 of 25

2. Results

2.1. General Condition

All pigs which received STZ developed diabetes within a few days, showing blood glucose
concentration over 20 mmol/L. The mean glucose concentration in the diabetic group during the
time of the experiment was 20.57 mmol/L ± 0.94, while, in the control group, it was at physiological
level 5.07 mmol/L ± 0.12 (Table 1). It should be added that although glucose level in blood serum in
experimental animals was remarkably higher than in controls, all pigs which received STZ survived
the duration of the experiment in a good health, and none of the animals required exogenous
insulin injections.

Table 1. Serum glucose levels after induction of diabetes and glucose concentration after streptozotocin
administration (from 1 week to 6 weeks).

Control Group SEM Experimental Group SEM

Date
mg/dL ± mg/dL ±
Before streptozotocin
90.18 0.10 90.4 0.10
injection
1 week after
91.44 0.10 312.48 0.38
streptozotocin injection
2 weeks after
88.38 0.18 372.96 0.24
streptozotocin injection
3 weeks after
93.42 0.06 388.44 0.27
streptozotocin injection
4 weeks after
95.58 0.12 361.44 0.09
streptozotocin injection
5 weeks after
87.12 0.32 400.68 1.21
streptozotocin injection
6 weeks after
93.6 0.1 386.1 1.11
streptozotocin injection

2.2. Cocaine- and Amphetamine-Regulated Transcript (CART) Distribution

2.2.1. Duodenum
During the present investigation, CART occurred in both submucosal and myenteric plexuses in
the duodenum (Figures 1A and 2A,D,G,J,M,P). In the control group, neurons immunoreactive to CART
(CART-IR) counted 11.04 ± 0.98% of neurons immunoreactive to Hu C/D in the myenteric plexus (MP)
and increased in diabetic pigs to 18.86 ± 1.11% (Figures 1A and 2A,D). In the submucosal plexuses, the
total number of CART-IR neurons were slightly lower compared to MP. In the outer submucosal plexus
(OSP) in control animals, the number of CART neurons was estimated at 3.92 ± 0.76% (Figures 1A
and 2G), while, in the experimental group, we observed a reduced level of CART-IR cell bodies
(8.35 ± 1.56%) (Figures 1A and 2J). Meanwhile, in the inner submucosal plexus (ISP), we observed a
statistically significant increase in the experimental group compared to control ones (6.29 ± 0.56% vs.
14.30 ± 1.81%) (Figures 1A and 2M,P).
Int. J. Mol.
Int. Sci.
J. Mol. 2020,
Sci. 21,20,
2019, 2047
x FOR PEER REVIEW 4 of 2525
4 of

A Duodenum B Jejunum
**
18,86 ***
20 22,46
Frequency of CART-IR neurons

Frequency of CART-IR neurons

24
18 22
***
16 14,30 20
14 18
11,04 16 13,39
12
** 14
10 8,35
12 8,99 8,67
8 6,29 10
6 8 6,02 5,41
3,92
6
4
4
2 2
0 0
OSP ISP MP OSP ISP MP

Figure 1. Diagram of the numbers of perikarya immunoreactive to Cocaine- and amphetamine-regulated

Figure 1. Diagram of the numbers of perikarya immunoreactive to Cocaine- and amphetamine-
transcript (CART) (A–C) of the control (blue bars) and experimental group (grey bars) in the
regulated transcript (CART) (A–C) of the control (blue bars) and experimental group (grey bars) in
particular parts of the small intestine. OSP – outer submucosal plexus, ISP—inner submucosal
the particular parts of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal
plexus, MP—myenteric plexus. * p < 0.05, ** p < 0.01, *** p < 0.001—indicate differences between all
plexus,
groups forMP
the–same
myenteric plexus.
neuronal * p < 0.05, ** p < 0.01, *** p < 0.001 – indicate differences between all
populations.
groups for the same neuronal populations.
Int. J. Mol. Sci. 2020, 21, 2047 5 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 5 of 25

Figure2.2.Immunofluorescent
Figure Immunofluorescent staining
staining presenting
presenting CARTCART immunoreactivity
immunoreactivity in cellin bodies
in cell bodies in the
the particular
particular intramural plexuses in the small intestine in both control and experimental
intramural plexuses in the small intestine in both control and experimental groups. All photographs groups. All
photographs
have been createdhave
bybeen created
the digital by the digitalofsuperimposition
superimposition two color channels; of Hu
twoC/D-positive—used
color channels; Hu hereC/D-
as
apositive—used here as(green),
pan-neuronal marker a pan-neuronal marker (green),
and CART-positive andarrow
(red). The CART-positive (red). The
shows perikaryon arrow shows
containing both
perikaryon
examined containingMyenteric
substances. both examined
plexussubstances. Myenteric
of the duodenum plexus
(A,D), of the
jejunum duodenum
(B,E), and ileum (A,D),
(C,F)jejunum
under
(B,E), and ileum
physiological (C,F) (A–C)
condition under andphysiological conditionadministration
after streptozotocin (A–C) and after streptozotocin
(D–F). administration
Outer submucosal plexus
(D–F).
of Outer submucosal
the duodenum plexus
(G,J), jejunum of the
(H,K), andduodenum (G,J), jejunum
ileum (I,L) under (H,K),
physiological and ileum
condition (G–I)(I,L)
andunder
after
streptozotocin administration
physiological condition (G–I)(J–L). Inner
and after submucosal plexus
streptozotocin of the duodenum
administration (J–L). Inner(M,P), jejunum plexus
submucosal (N,R),
and ileum
of the (O,S) under
duodenum physiological
(M,P), jejunum (N,R),condition (M–O)(O,S)
and ileum and under
after streptozotocin
physiologicaladministration
condition (M–O) (P–S).
and
after streptozotocin administration (P–S).
Int. J. Mol. Sci. 2020, 21, 2047 6 of 25

2.2.2. Jejunum
Also, in this part of the small intestine, CART-IR neurons were detected in all kinds of plexuses
(Figures 1B and 2B,E,H,K,N,R). In the MP, in control animals, neurons immunopositive to CART
constituted 13.39 ± 1.09% (Figures 1B and 2B) and increased in diabetes animals to 22.46 ± 2.46%
(Figures 1B and 2E). In turn, in the OSP, CART-IR neurons constituted 6.02 ± 0.78% of Hu C/D neurons,
and their quantity did not change as a result of STZ injection (Figures 1B and 2H,K). A similar situation
was observed in the ISP, where, in the control group, the number of CART-IR cell bodies was estimated
at 8.99 ± 0.87% and did not change in the experimental group (Figures 1B and 2N,R).

2.2.3. Ileum
In this part of the intestine, CART-IR neurons were also presented in all plexuses (Figures 1C
and 2C,F,I,L,O,S), and their total number was the highest of all small intestine segments. In the
control animals inside the MP, CART-IR neurons were estimated at 15.32 ± 1.23% (Figures 1C and 2C)
and increased to 26.27 ± 2.64% in diabetic animals (Figures 1C and 2F). Also, in the OSP, we noted
an increased number of CART-IR neurons (8.88 ± 0.93% in control animals and 13.85 ± 1.56% in
hyperglycemic animals) (Figures 1C and 2O,L). In turn, in the ISP, we noted 10.16 ± 0.65% of CART-IR
neurons in control animals (Figures 1C and 2O) and 17.10 ± 2.07% in the experimental group (Figures 1C
and 2S).

2.3. Galanin (GAL) Distribution

2.3.1. Duodenum
Another investigated substance was GAL. Neurons immunoreactive to GAL (GAL-IR) in control
animals in the MP constituted 19.84 ± 0.78% of total Hu C/D positive neurons (Figures 3A and 4A).
Higher glucose blood concentration in experimental animals led to an increase in the number of
GAL-IR neurons (to 23.95 ± 2.21%) (Figures 3A and 4D). In the OSP, in healthy animals, the number
of GAL-IR neurons was estimated at 10.30 ± 0.93% (Figures 3A and 4G), while, in the experimental
group, we noted an increased level of GAL-IR cell bodies (16.19 ± 1.57% (Figures 3A and 4J). In turn,
in the ISP, we observed statistically significant changes in the experimental group compared to control
ones (12.84 ± 0.45% vs. 21.17 ± 1.13%) (Figures 3A and 4M,P).
 Int. J. Mol. Sci. 2020, 21, 2047 7 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 7 of 25

A Duodenum
*
23,95
**

Frequency of GAL-IR neurons

24 21,17
22 19,84
20 *
18 16,19
16
12,84
14
12 10,30
10
8
6
4
2
0
OSP ISP MP

B Jejunum
***
Frequency of GAL-IR neurons

34 30,61
32
30
28 **
26 21,94
24
22 19,12
20
18 *
16 13,92 13,74
14 11,77
12
10
8
6
4
2
0
OSP ISP MP

C Ileum
***
31,36
Frequency of GAL-IR neurons

34
32
30
28
26 21,83
24 **
20,21
22
20
18
16 12,88 12,77
14 11,67
12
10
8
6
4
2
0
OSP ISP MP

Figure
Figure 3.
3. Schematic
Schematicdiagram
diagramofofthe
thenumbers
numbersof ofperikarya
perikarya immunoreactive
immunoreactive to to galanin
galanin (GAL)
(GAL) (A–C)
(A–C) of
of
the control (blue bars) and experimental group (grey bars) in the particular parts of the small intestine.
the control (blue bars) and experimental group (grey bars) in the particular parts of the small intestine.
OSP
OSP –– outer
outersubmucosal
submucosalplexus,
plexus,ISP – inner submucosal
ISP—inner submucosalplexus,
plexus,MP – myenteric plexus.
MP—myenteric * p*<p0.05,
plexus. **
< 0.05,
p**<p0.01, *** p < 0.001 – indicate differences between all groups for the same neuronal populations.
< 0.01, *** p < 0.001 – indicate differences between all groups for the same neuronal populations.
Int. J. Mol. Sci. 2020, 21, 2047 8 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 8 of 25

Figure 4.4.Immunofluorescent
Figure Immunofluorescent staining
staining presenting
presenting GALGAL immunoreactivity
immunoreactivity in cellinbodies
in cell bodies in the
the particular
particular intramural
intramural plexuses inplexuses
the smallinintestine
the small intestine
in both in both
control control and experimental
and experimental groups. All
groups. All photographs
photographs have been created by the digital superimposition of two color
have been created by the digital superimposition of two color channels; Hu C/D-positive—used channels; Huhere
C/D-
as
positive—used here as a pan-neuronal marker (green), and GAL-positive (red).
a pan-neuronal marker (green), and GAL-positive (red). The arrow shows perikaryon containing both The arrow shows
perikaryonsubstances.
examined containingMyenteric
both examinedplexussubstances. Myenteric
of the duodenum plexus
(A,D), of the(B,E),
jejunum duodenum (A,D),
and ileum jejunum
(C,F) under
(B,E), and ileum
physiological (C,F) under
condition (A–C) physiological condition administration
and after streptozotocin (A–C) and after(D–F).Outer
streptozotocin administration
submucosal plexus
(D–F).Outer
of the duodenumsubmucosal plexus(H,K),
(G,J), jejunum of theandduodenum
ileum (I,L)(G,J),
underjejunum (H,K),condition
physiological and ileum (I,L)
(G–I) andunder
after
physiological condition (G–I) and after streptozotocin administration (J–L). Inner submucosal
streptozotocin administration (J–L). Inner submucosal plexus of the duodenum (M,P), jejunum (N,R), plexus
of the
and duodenum
ileum (M,P),
(O,S) under jejunum (N,R),
physiological and ileum
condition (M–O) (O,S)
andunder physiological administration
after streptozotocin condition (M–O) and
(P–S).
after streptozotocin administration (P–S).
Int. J. Mol. Sci. 2020, 21, 2047 9 of 25

2.3.2. Jejunum
In the jejunum, GAL-IR neurons were described in all enteric plexuses. Namely, in the MP,
their number was estimated at 19.12 ± 0.67 in control (Figures 3B and 4B) and 30.61 ± 2.87% in the
experimental group (Figures 3B and 4E). While, in the OSP, the total number of GAL-IR cell bodes
amounted to 11.77 ± 0.94% in the control group (Figures 3B and 4H) and increased slightly in the
experimental group (13.92 ± 0.67%) (Figures 3A and 4K). With regard to the ISP, the number of GAL-IR
neurons was estimated at 13.74 ± 0.93% in control animals (Figures 3B and 4N) and elevated in the
diabetic group (21.94 ± 2.89%) (Figures 3B and 4R).

2.3.3. Ileum
The number of GAL-IR neurons in control animals inside the MP was estimated at 21.83 ± 2.06%
(Figures 3C and 4C), while, in hyperglycemic animals, their number was statistically higher
(31.36 ± 2.27%) (Figures 3C and 4F). In submucosal plexuses, we noted an increased number of
GAL-IR neurons only in the ISP (12.77 ± 0.97% vs. 20.21 ± 2.37%) (Figures 3C and 4I,L), while, in the
OSP, the quality changes in GAL-IR neurons did not occur (Figures 3C and 4O,S).

2.4. Vasoactive Intestinal Polypeptide (VIP) Distribution

2.4.1. Duodenum
The next investigated substance was VIP, whose presence was described in all intestine plexuses.
In the MP, in control animals, neurons immunoreactive to VIP (VIP-IR) constituted 25.78 ± 3.45%
(Figures 5A and 6A). Injection of STZ led to an increase in the number of VIP-IR neurons in the MP
(45.02 ± 2.29%) (Figures 5A and 6D). In submucosal plexuses, the increased population of VIP-IR
neurons was visible only in the ISP (19.46 ± 1.56% vs. 22.96 ± 2.08%) (Figures 5A and 6M,P). In the
OSP, we had not observed statistically significant changes (Figures 5A and 6G,J).
Int. J. Mol. Sci. 2020, 21, 2047 10 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 10 of 25

Figure 5. Schematic
Figure 5. Schematic diagram
diagram of the numbers
of the numbers of of perikarya
perikarya immunoreactive
immunoreactive toto aa vasoactive
vasoactive intestinal
intestinal
polypeptide (VIP)
polypeptide (VIP)(A–C)
(A–C)of of
thethe
control (blue(blue
control bars)bars)
and experimental group (grey
and experimental group bars) in the
(grey particular
bars) in the
parts of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal
particular parts of the small intestine. OSP – outer submucosal plexus, ISP—inner submucosal plexus, MP –
plexus, MP—myenteric plexus. * p < 0.05, ** p < 0.01, *** p < 0.001—indicate differences betweenthe
myenteric plexus. * p < 0.05, ** p < 0.01, *** p < 0.001 – indicate differences between all groups for all
same
groupsneuronal populations.
for the same neuronal populations.
Int. J. Mol. Sci. 2020, 21, 2047 11 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 11 of 25

6. Immunofluorescent
FigureFigure 6. Immunofluorescentstaining presenting
staining VIP immunoreactivity
presenting VIP immunoreactivity in cell
in bodies in thein
cell bodies particular
the
intramural plexuses in the small intestine in both control and experimental groups. All
particular intramural plexuses in the small intestine in both control and experimental groups. All photographs
have been created by
photographs havethebeen
digital superimposition
created by the digitalofsuperimposition
two color channels;of twoHucolor
C/D-positive—used
channels; Hu C/D- here as
positive—used
a pan-neuronal here(green),
marker as a pan-neuronal marker (red).
and VIP-positive (green),
The and VIP-positive
arrow (red). The arrow
shows perikaryon showsboth
containing
perikaryon
examined containing
substances. both examined
Myenteric substances.
plexus of Myenteric
the duodenum plexus
(A,D), of the duodenum
jejunum (B,E), and (A,D),
ileum jejunum
(C,F) under
(B,E), and ileum (C,F) under physiological condition (A–C) and after streptozotocin
physiological condition (A–C) and after streptozotocin administration (D–F). Outer submucosal plexus administration

of the duodenum (G,J), jejunum (H,K), and ileum (I,L) under physiological condition (G–I) and after
streptozotocin administration (J–L). Inner submucosal plexus of the duodenum (M,P), jejunum (N,R),
and ileum (O,S) under physiological condition (M–O) and after streptozotocin administration (P–S).
Int. J. Mol. Sci. 2020, 21, 2047 12 of 25

2.4.2. Jejunum
VIP-IR neurons were the most numerous in the MP in both groups (29.85 ± 2.87% in control
and 53.80 ± 3.32% in experimental animals) (Figures 5B and 6B,E). In the OSP, the number of VIP-IR
neurons was estimated at 20.82 ± 1.67% in the control group (Figures 5B and 6H) and increased in
experimental animals to 24.14 ± 1.64% (Figures 5B and 6K). A similar increase was described in the
ISP. Namely, in control animals, the population of VIP-IR neurons was estimated at 26.06 ± 2.09% and
increased to 31.42 ± 2.98% in the experimental group, respectively (Figures 5B and 6N,R).

2.4.3. Ileum
In turn, in the ileum, VIP-IR neurons in the MP of control animals were estimated at 29.57 ± 1.56%
(Figures 5C and 6C) and increased in diabetic animals to 46.41 ± 2.92% (Figures 5C and 6F). In the OSP,
the number of VIP-IR neurons constituted 19.17 ± 1.64% in control (Figures 5C and 6I) and did not
show statistically significant changes in the diabetic group (20.55 ± 1.50%) (Figures 5C and 6L). In turn,
in the ISP, the number of VIP-IR neurons was estimated at 19.71 ± 1.29% in control animals (Figures 5C
and 6O) and increased to the level 25.78 ± 3.06% in the experimental group (Figures 5C and 6S).

2.5. Calcitonin Gene-Related Peptide (CGRP) Distribution

2.5.1. Duodenum
Another exanimated substance was CGRP. CGRP-immunoreactive neurons (CGRP-IR) in control
animals inside MP were estimated at 21.83 ± 1.16% (Figures 7A and 8A), while, in hyperglycemic
animals, their number was statistically higher (35.84 ± 0.96%) (Figures 7A and 8D). Also, in submucosal
plexuses, we noted an increased number of CGRP-IR neurons. In the OSP, they constituted 11.12 ± 0.59%
in control animals (Figures 7A and 8G) and 17.27 ± 0.89% in experimental group (Figures 7A and 8J).
In turn, in the ISP, we noted 16.00 ± 0.66% of CGRP-IR neurons in control animals (Figures 7A and 8M)
and 21.80 ± 1.06% in the experimental group (Figures 7A and 8P).
Int. J. Mol. Sci. 2020, 21, 2047 13 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 13 of 25

Figure7.7.Schematic
Figure Schematicdiagram
diagramof ofthe
thenumbers
numbersof ofperikarya
perikaryaimmunoreactive
immunoreactiveto tocalcitonin
calcitoningene-related
gene-related
peptide
peptide(CGRP)
(CGRP)(A–C)
(A–C)of ofthe
thecontrol
control(blue
(bluebars)
bars)and
andexperimental
experimentalgroup
group(grey
(greybars)
bars)ininthe
theparticular
particular
parts
parts of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal plexus, MP
of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal plexus, MP ––
myenteric plexus. * p < 0.05, ** p < 0.01, *** p <
myenteric plexus. * p < 0.05, ** p < 0.01, *** p < 0.001 – indicate differences between all groups forthe
0.001 – indicate differences between all groups for the
same
sameneuronal
neuronalpopulations.
populations.
Int. J. Mol. Sci. 2020, 21, 2047 14 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 14 of 25

8. Immunofluorescent
Figure 8.
Figure Immunofluorescentstaining
stainingpresenting CGRP
presenting immunoreactivity
CGRP immunoreactivityin cellin
bodies
cell in the particular
bodies in the
intramuralintramural
particular plexuses in the small
plexuses inintestine
the smallinintestine
both control and control
in both experimental groups. All photographs
and experimental groups. All
have been created
photographs have by the digital
been createdsuperimposition
by the digital of two color channels;
superimposition Hu C/D-positive—used
of two color channels; Huhere C/D-as
a pan-neuronal marker (green), and CGRP-positive (red). The arrow shows perikaryon
positive—used here as a pan-neuronal marker (green), and CGRP-positive (red). The arrow shows containing both
examined substances.
perikaryon Myenteric
containing both plexus
examined of the duodenum
substances. Myenteric (A,D), jejunum
plexus of the(B,E), and ileum
duodenum (A,D),(C,F) under
jejunum
physiological condition (A–C) and after streptozotocin administration (D–F). Outer submucosal
(B,E), and ileum (C,F) under physiological condition (A–C) and after streptozotocin administration plexus
of the duodenum
(D–F). (G,J), jejunum
Outer submucosal plexus(H,K),
of theand ileum (I,L)
duodenum under
(G,J), physiological
jejunum (H,K), condition
and ileum (G-I)
(I,L)and after
under
streptozotocin administration (J–L). Inner submucosal plexus of the duodenum (M,P), jejunum (N,R),
and ileum (O,S) under physiological condition (M–O) and after streptozotocin administration (P–S).
Int. J. Mol. Sci. 2020, 21, 2047 15 of 25

2.5.2. Jejunum
In the MP, in control animals, CGRP-IR neuron constituted 25.96 ± 2.45% (Figures 7B and 8B) and
increased in diabetes animals to 37.45 ± 3.46% (Figures 7B and 8E). In turn, in the OSP, in both groups,
the number of CGRP-IR neurons was at a similar level (16.97 ± 0.99% vs. 16.91 ± 0.78%) (Figures 7B
and 8H,K). Regarding the ISP, the number of CGRP-IR cell bodies in the control group was estimated
at 18.56 ± 0.80% (Figures 7B and 8N), while, in experimental animals, the number of CGRP-IR neurons
was higher (20.63 ± 1.27%) (Figures 7B and 8R).

2.5.3. Ileum
In this part of the intestine, CGRP-IR neurons were estimated at 25.67 ± 2.78% in the MP in
control animals and increased at the level of 37.37 ± 2.90% in the experimental group (Figures 7C and
8C,F). While in the OSP, we had not observed statistically significant changes between control and
experimental groups (13.48 ± 0.98 vs. 15.07 ± 1.24%) (Figures 7C and 8I,L). In turn, in the ISP, we noted
18.39± 0.65% of CGRP-IR neurons in control animals (Figures 7C and 8O) and 21.78 ± 0.92% in the
experimental group (Figures 7C and 8S).

2.6. Vesicular Acetylcholine Transporter (VAChT)

2.6.1. Duodenum
The last investigated substance was VAChT. In control group, VAChT-immunoreactive (VAChT-IR)
neurons in the MP constituted 28.40 ± 0.94% (Figures 9A and 10A) and increased in experimental pig
to 38.12 ± 0.54% (Figures 9A and 10D). With regard to the OSP, VAChT-IR neurons in the control group
were estimated at 19.58 ± 1.87% (Figures 9A and 10G) and increased to 20.30 ± 1.78% in hyperglycemic
animals (Figures 9A and 10J). In turn, in the ISP, we had also observed an increased number of
VAChT-IR neurons (22.93 ± 2.98% in control and 32.83 ± 1.19% in experimental animals) (Figures 9A
and 10M,P).
Int. J. Mol. Sci. 2020, 21, 2047 16 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 16 of 25

A Duodenum
***
38,12
40

Frequency of VAChT-IR neurons

**
32,83
35
28,40
30
*
22,30 22,93
25
19,58
20
15
10
5
0
OSP ISP MP

Schematicdiagram
Figure9.9.Schematic
Figure diagramof ofthe
thenumbers
numbersof ofperikarya
perikaryaimmunoreactive
immunoreactiveto tovesicular
vesicularacetylcholine
acetylcholine
transporter(VAChT)
transporter (VAChT) (A–C)
(A–C) ofof the
the control
control (blue
(blue bars)
bars) and
and experimental
experimental group
group (grey
(grey bars)
bars) in
in the
the
particular parts of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal
particular parts of the small intestine. OSP – outer submucosal plexus, ISP – inner submucosal plexus, plexus,
MP––myenteric
MP plexus. **pp<<0.05,
myenteric plexus. 0.05,****pp<<0.01, ***p p< <
0.01,*** 0.001– –indicate
0.001 indicatedifferences
differencesbetween
betweenall
allgroups
groupsfor for
the same neuronal populations.
the same neuronal populations.
Int. J. Mol. Sci. 2020, 21, 2047 17 of 25
Int. J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 17 of 25

10. Immunofluorescent
FigureFigure 10. Immunofluorescent staining
stainingpresenting
presenting VAChT immunoreactivity
VAChT immunoreactivity in cell
in cell bodies
bodies in the
in the
particular intramural plexuses in the small intestine in both control and experimental
particular intramural plexuses in the small intestine in both control and experimental groups. groups. All
photographs have
All photographs have been
beencreated
createdby by
thethe
digital superimposition
digital of twoof
superimposition color
twochannels; Hu C/D- Hu
color channels;
positive—used here as a pan-neuronal marker (green), and VAChT-positive (red).
C/D-positive—used here as a pan-neuronal marker (green), and VAChT-positive (red). The arrowThe arrow shows
shows
perikaryon containing both examined substances. Myenteric plexus of the duodenum (A,D), jejunum
perikaryon containing both examined substances. Myenteric plexus of the duodenum (A,D), jejunum
(B,E), and ileum (C,F) under physiological condition (A–C) and after streptozotocin administration
(B,E), and ileum (C,F) under physiological condition (A–C) and after streptozotocin administration
(D–F). Outer submucosal plexus of the duodenum (G,J), jejunum (H,K), and ileum (I,L) under
physiological condition (G-I) and after streptozotocin administration (J–L). Inner submucosal plexus of
the duodenum (M,P), jejunum (N,R), and ileum (O,S) under physiological condition (M–O) and after
streptozotocin administration (P–S).
Int. J. Mol. Sci. 2020, 21, 2047 18 of 25

2.6.2. Jejunum
In the jejunum, the highest population and the highest increase of the number of VAChT-IR neurons
were visible in the MP (30.65 ± 3.04% in control animals (Figures 9B and 10B) and 43.67 ± 4.01% in the
experimental group (Figures 9A and 10E). In turn, in submucosal plexuses, only in the ISP, we observed
a statistically significant increase of VAChT-containing neurons (21.88 ± 1.32% vs. 27.97 ± 1.56%)
(Figures 9B and 10N,R). While in the OSP, the changes were statistically insignificant (21.38 ± 1.24% vs.
21.08 ± 2.22%) (Figures 9B and 10H,K).

2.6.3. Ileum
In the ileum, we noted a statistically significant increase of VAChT-IR neurons in all investigated
enteric plexuses. Namely, in the MP, in the control animals, the number of VAChT-IR neurons was
estimated at 28.00 ± 2.97% and 41.87 ± 3.04% in experimental pigs (Figures 9C and 10C,F). While, in the
OSP, we observed 24.55 ± 1.45% of VAChT- positive neurons in the control group and 30.81 ± 2.03%
in experimental animals (Figures 9C and 10I,L). In turn, in the ISP, VAChT-IR neurons constituted
28.98 ± 1.95% in control pigs and 39.08 ± 2.49% in diabetic animals, respectively (Figures 9C and
10O,S).

3. Discussion
Almost a hundred years ago, Canadian orthopedic surgeon Frederick G. Banting and his assistant
Charles Best discovered insulin [41]. This ground-breaking discovery saved the lives of millions of
people around the world. Unfortunately, the widespread use of insulin in diabetes therapy has not
eliminated the development of diabetes complications [30,32]. The above-mentioned complications are
a consequence of poor disease treatment, which leads to long episodes of elevated glucose levels [42].
Each organ and/or tissue can be damaged in the course of diabetes [42], particularly neural cells (both
peripheral and central) may be destroyed during diabetes. The alimentary tract, due to its rich central
innervation and a large number of neurons present in the wall, is often disabled due to increased
glucose serum level. Diabetes gastroenteropathy has shown a wide spectrum of side effects (heartburn,
diarrhea, fullness, delayed gastric emptying). Although these symptoms do not directly threaten life,
they significantly decrease its quality. The exact mechanism of diabetes gastrointestinal complications
is much less understood than even diabetic retinopathy or nephropathy [30,32,43].
The current study demonstrated the influence of chronically elevated glucose level, obtained as a
result of streptozotocin injection, on the number of enteric neurons in the small intestine expressing
selected neuropeptides in the pig as a model. This type of research is important because, as mentioned
above, knowledge of the pathomechanism of diabetes damage is scarce, and neuropeptides might also
be involved in these processes [33,44]. The most important question concerning diabetes research is
the choice of an appropriate animal model. Obviously, diabetes research includes a broad spectrum of
issues, starting with diabetes immunology [45], metabolism disorders [46,47], pharmacology treatment,
insulin resistance through to diabetes complications [47]. The last problem predominantly develops as
a result of high glucose level [47]. The available literature is predominated by experiments conducted
with rodent models [33,44]. The availability of genetically modified mouse and rat models, which
spontaneously develop diabetes, allows known molecular mechanisms of pancreatic insulin-producing
cells to be destroyed, especially with reference to type I diabetes. In these cases, a rodent model is
an irreplaceable tool for a better understanding of diabetes immunology [48]. To examine the side
effects of hyperglycemia, pancreatic β cells can be destroyed. Chemically-induced elevated blood
glucose concentration seems to be a safe and effective method of diabetes induction. It should be
added that this way of obtaining hyperglycemia is commonly used in rats and mice [49], although the
current study used the pig as a model to research diabetes gastrointestinal complications. It should
be emphasized that swine are becoming increasingly more often used as models in the biomedical
study [34]. In the current study, we achieved the intended goal. Firstly, streptozotocin was effective in
Int. J. Mol. Sci. 2020, 21, 2047 19 of 25

hyperglycemia induction in pigs. Secondly, besides an increased glucose level, we did not observe
abnormalities in the general health condition. However, it is very important that the obtained results
could be applied to humans. Without a doubt, the alimentary tract in pigs in terms of anatomical and
histological structure, as well as physiological processes, is more suitable to this type of research than
the rodent GI tract. Likewise, the length of the GI, particularly the small intestine in the pig, resembles
human GI properties. An important feature is also the fact that the pig, like humans, is an omnivorous
animal. Taking everything into consideration, the choice of the animal model in the current study was
reasonable and appropriate.
The appropriate function of the gastrointestinal tract is conducted by bilateral regulation between
both central and enteric nervous systems [1,5]. In turn, communications between each neuron are
fulfilled by a broad spectrum of neurotransmitters [9]. Moreover, neurotransmitters are also responsible
for sending information between neurons. One of the most important functions executed by neuronal
cells through synthesis and release of neurotransmitters is providing normal neuron functions under
unfavorable conditions during pathological processes [29,50]. Taking this into consideration, the current
work focused on changes in the number of enteric neurons synthesizing selected neurotransmitters in
response to hyperglycemia. Additionally, the domestic pig was used as an experimental animal model
for the first time. All examined biologically active substances were detected in the investigated area of
the GI tract. Naturally, the number of neurons immunoreactive to a particular neurotransmitter was
different, both in each segment of the GI tract as well as in individual plexuses. The first substance
assayed was CART. This anorectic peptide is widely expressed in nervous tissue and outside the
nervous system [15–17]. In the current study, its expression was confirmed inside enteric plexuses.
As a response to hyperglycemia, an increased number of neurons expressing CART were observed
in particular neurons within the myenteric plexuses. Previous studies also showed that CART was
involved in the control of many pathological conditions within the GI tract. For instance, axotomy [51]
(an overdose of acrylamide) has significantly enhanced the expression of CART in ENS structures in the
alimentary tract [50]. A characteristic feature of the above pathologies is the presence of inflammatory
conditions. In addition, diabetes, through chronically elevated glucose levels, has led to the activation
of the immune system [45]. It is not clear if CART plays a pro/or anti-inflammatory role, but this
peptide is certainly involved in pathological changes in the gut during diabetes.
During the present study, an increased number of VIP-containing neurons was noted in almost all
investigated areas. Notably, myenteric plexuses were places in which the augmentation of the number
of VIP-IR neurons was the most visible. Previous studies in diabetic rats, which were focused on the
ileum, are similar to the current data. Namely, in rats, an increase in VIP immunoreactivity also takes
place [52]. Generally, the distribution and number of VIP-IR neurons depend on the fragment of the
GI tract and animal species [53]. However, the function of VIP in the alimentary tract is less variable.
The most important role seems to be an inhibitory action [54]. This inhibitory action includes smooth
muscle relaxation and a decrease in gastric acid and intestinal fluid secretion [51]. Certain functions of
VIP are revealed only during pathological states. In the previous paragraph, inflammation during
diabetes was discussed. In this context, VIP might also be considered an anti-inflammatory agent.
Inflammation is usually associated with increased cytokine synthesis [55]. Previous studies have
shown that VIP is able to down-regulate this process through a decrease in macrophage activity [56].
Moreover, VIP may be responsible for changes in blood permeability, which is important in the
development of gastric complications [53]. An increased number of VIP-positive neurons can be
linked with the neuroprotective action of this peptide. Hyperglycemia often leads to severe neuron
damage, including enteric neurons [30]. In turn, VIP, through activation of glial cells and stimulatory
effect on anti-inflammatory mediator secretion, protects neurons and enables them to survive in
adverse environmental conditions [56]. In neuroprotection and anti-inflammatory processes, another
investigated peptide is also involved, mainly GAL [19]. Following diabetes induction, a significant
increase in GAL expression in all parts of the small intestine was observed. In rats, similar changes have
Int. J. Mol. Sci. 2020, 21, 2047 20 of 25

been observed in the ileum [57] and colon [58]. Moreover, GAL is also able to modulate the secretion
of other neurotransmitters, including VIP, and affect the motor activity of the intestines [20,21].
One of the more troublesome digestive tract complaints occurring as a complication of diabetes is
abdominal pain [5,59]. Nociception information is sent from the GI tract to the brain via a multistep
pathway. In the transmission of pain signals, different molecules are involved [60]. One of them is CGRP,
which is considered as a marker of primary afferent neurons in the alimentary tract and plays a crucial
role in the regulation of these processes. In the current study, an increased number of neurons coding
CGRP was observed. Alterations in the expression of CGRP have also been described in the gut of
diabetic rats [61,62]. Interestingly, in rodents, CGRP in the ileum has decreased following diabetes [63].
This discrepancy may be caused by a different threshold of pain stimuli in rodents and large animals.
Moreover, it cannot be assumed that this situation is permanent and immutable. It is well-established
that insulin supplementation can reverse neurochemical coding inside neurons [64]. The acute or/and
chronic episodes of hyperglycemia, during which toxic glucose action is revealed, translates into
appropriate changes in the number of neurons containing adequate biologically active substances.
The final substance examined in the study was VAChT. Acetylcholine is one of the most commonly
distributed neurotransmitters in the GI tract. It is found in different classes of enteric neurons, including
excitatory motoneurons, interneurons, and, finally, in sensory neurons [65]. In the current study, VAChT
was used as a marker of cholinergic neurons. It was dictated by the fact that VAChT-positive neurons
have been confirmed in the pig GI tract, and their number was higher than neurons immunoreactive
to another cholinergic marker, acetylcholine transferase (ChAT) [66]. The present study showed that
after six weeks, hyperglycemia led to an increase in the number of VAChT-containing neurons. These
results were in agreement with previous studies in which the density of cholinergic innervation was
reported to increase in diabetes in the jejunum, ileum (myenteric plexus), and muscularis propria of
the duodenum in rats and non-obese mice [67–69]. Since acetylcholine is a strong factor acting on
muscle contraction, it is highly probable that an increase in the number of VAChT-positive structures
(especially in the myenteric plexuses) may provoke disturbances of contractility observed in diabetes.
The present study revealed changes in the number of enteric neurons immunoreactive to selected
substances occurring in the small intestine following streptozotocin-induced diabetes in pigs. The
results, at least, partially corresponded with clinical symptoms of GI-tract disturbances in diabetes.
The increase in VAChT might be responsible for improper motor activity in the gut, which results
in disorders in the resorption and movement of digestive content. While increasing VIP and GAL
immunoreactivity, molecules showed neuroprotective and pro-inflammatory properties, confirming
that hyperglycemia leads to inflammatory conditions and damages autonomic neuronal cells. In
turn, CGRP probably induced current in sensory endings and potentiates pain stimuli. Moreover, the
current study confirmed the utility of the pig as a model for research into metabolic diseases. To date,
the type 1 STZ-induced hyperglycemic/diabetic swine model has been mostly validated in the research
of the cardiovascular complications of the disease [40], while neuronal complications in this model are
not fully elucidated. The use of pigs as a model for researching diabetic complications also results
from many similarities regarding anatomical and physiological aspects. Namely, the number of beta
cells in the pancreas of pigs is very similar to the amount observed in humans; also, the blood supply
in this organ is very similar between the pig and human. Such similarities do not occur in rodent
pancreas [34,44]. Moreover, in pigs, glucose metabolism and insulin secretion also remain at a very
similar level as in human diabetic patients [34]. Taking into account the above data and the fact that
the pig, like a human, is an omnivore animal, we can assume that the changes in the ENS that we
observed in this study may be related to humans.

4. Materials and Methods

Ten juvenile female pigs of the White Large Polish breed, weighing from 17 to 20 kg, were used in
the experiment. After acclimatization directly before diabetes induction, the animals were divided into
two groups: the diabetic group (D, n = 5) and the control group (C, n = 5). The treatment of animals
Int. J. Mol. Sci. 2020, 21, 2047 21 of 25

was conducted in compliance with the instructions of the Local Ethical Committee in Olsztyn (Poland)
(decision number 13/2015/DTN, 30. 10. 2015) and according to the Act for the Protection of Animals for
Scientific or Educational Purposes of 15 January 2015 (Official Gazette 2015, No. 266), applicable in the
Republic of Poland with special attention paid to minimizing any stress reaction.
After a week, diabetes was induced, as previously described [35–37]. Streptozotocin (STZ)
(Sigma-Aldrich, St Louis, MO, USA, S0130), 150 mg/kg of body weight, was dissolved in a freshly
prepared disodium citrate buffer solution (pH = 4.23, 1 g streptozotocin/10 mL solution). Animals
were anesthetized, and the solution was administrated via an intravenous needle inserted into an ear
with continuous infusion for approximately 5 min. To avoid gastrointestinal complications (mainly
nausea and vomiting after streptozotocin injection), animals fasted for 18 h before the experiment.
The control pigs were injected with equal amounts of the vehicle (citrate buffer). In order to avoid
severe episodes of hyperglycemia, 250 mL of 50% glucose solution per animal was administered.
After inducing diabetes, the animals were kept under standard laboratory conditions. They were
fed standard fodder and had free access to water. The blood glucose concentration was estimated
using an Accent-200 (Berlin, Germany) biochemical analyzer, with the colorimetric measurement at a
wavelength of 510 nm/670 nm. For this aim, capillary blood from the ear was collected. The plasma
glucose level was measured prior to the experiment initiation in both control and experimental groups.
The next measurement was made 48 h after the injection of streptozotocin. Subsequent measurements
of glucose levels were measured weekly until the end of the experiment.
Six weeks after streptozotocin injection, pigs were anesthetized via intravenous administration
of pentobarbital (Vetbutal, Biowet, Poland) and perfused transcardially via the ascending aorta with
freshly prepared 4% paraformaldehyde in 0.1 M (molar) phosphate buffer (pH 7.4). After perfusion,
the small intestines were removed. Approximately, 2 cm fragments of duodenum, jejunum, and ileum
were post-fixed by immersion in the same fixative for 10 min, then washed with 0.1 M PB (pH 7.4)
over 2 days and finally transferred and stored at 400◦ C in an 18% buffered sucrose solution (pH 7.4),
containing 0.001 % natrium azide. The tissues were then kept at -800◦ C until further processing. Frozen
samples were cut in a cryostat (Microm HM 560 cryostat (Carl Zeiss, Germany) into 12-µm-thick
sections and mounted on chrome alum-coated slides. Sections were processed by applying the routine
double immunofluorescence technique. After drying at 32◦ C for 45 min, the sections were rinsed in a
phosphate buffer containing 0.8% sodium chloride and 0.02% potassium chloride (PBS, 3 × 10 min.)
and incubated in 10% normal goat serum in PBS with 0.3% Triton X-100 (Sigma, St. Louis, MO, USA)
and 1% bovine serum albumin (BSA; Sigma, St. Louis, MO USA) for 20 min. The sections were then
incubated overnight at 4◦ C with primary antibodies diluted in PBS containing 0.3% Triton X-100 and 1%
BSA raised against Hu C/D (mouse polyclonal, Invitrogen, Waltham, MA, USA; Cat # A-212711:1.000;
working dilution 1: 1000) and/or GAL (rabbit polyclonal, Merck Millipore, Billerica, MA USA; Cat.
# AB 2233; working dilution 1:2000), VIP (rabbit polyclonal, Biomol, Hamburg, Germany; Cat #
VA1285; working dilution 1:5000), CGRP (rabbit polyclonal, Merck Millipore, Billerica, MA, USA;
Cat. # AB15360; working dilution 1:4000), CART (rabbit polyclonal, Phoenix Pharmaceuticals, Inc.,
Burlingame, Raleigh, NC, USA; Cat. # H-003-61; working dilution 1: 8000), VAChT (rabbit polyclonal,
Phoenix Pharmaceuticals, Inc., Burlingame, Raleigh, NC, USA Cat. # H-V006; working dilution 1:2000).
On the following day, the sections were rinsed (PBS, 5 × 15 min) and incubated with secondary
antibodies (in PBS containing 0.25% BSA and 0.1% Triton X-100) for 4 h (Alexa Fluor 488 nm donkey
anti-mouse, Invitrogen, Waltham, MA, USA; Cat # A21202; working dilatation; 1:1000 and Alexa
Fluor 546 nm goat anti-rabbit, Invitrogen, Waltham, MA,USA; Cat # A11010; working dilution 1:1000).
Next, the tissues were rinsed (PBS, 3 × 5 min) and covered with a polyethylene glycol/glycerine
solution containing DABCO (Sigma, St. Louis, MO, USA). Standard controls, i.e., pre-absorption for
the neuropeptide antisera (20 µg of appropriate antigen per 1 mL of the corresponding antibody at
working dilution), as well as omission and replacement of the respective primary antiserum with
the corresponding non-immune serum, completely abolished immunofluorescence and eliminated
specific staining.
Int. J. Mol. Sci. 2020, 21, 2047 22 of 25

Immunostained neurons were analyzed using an Olympus BX51 microscope equipped with
epi-illumination fluorescence filters. Photographs were taken by a digital monochromatic camera
(Olympus XM 10). The microscope was equipped with the cellSens Dimension Image Processing
software (Olympus, Hamburg, Germany). For determination of the percentage of VIP, CART, GAL,
CGRP, and VAChT-LI neurons, at least 500 perikarya with a clearly visible nucleus immunoreactive to
Hu C/D in the enteric plexuses from each animal were investigated. The obtained results were pooled
and presented as mean ± SEM. To avoid double-counting of the same perikarya, the investigated
sections of the intestine were located at least 100 µm apart. The data pooled from all animal groups
were statistically analyzed using Statistica 13 software (StatSoft Inc., Tulsa, OK, USA) and expressed as
a mean ± standard error (SEM) of the mean. Significant differences were evaluated using Student’s
t-test for independent samples (* p < 0.05, ** p < 0.01, and *** p > 0.001).

5. Conclusions
We concluded that streptozotocin in a single dose (150 mg/kg) was able to induce diabetes
in pig and suggested that STZ-injected pigs might serve as an essential model in early studies of
pathological changes under hyperglycemic conditions in the peripheral nerve system. In our study,
we supplied immunohistochemical evidence that six weeks of permanent hyperglycemia led to serve
changes in the chemical phenotyping of enteric neurons in the small intestine of a pig. The increase
of investigated peptides might be pivotal in the development of gastrointestinal complications. This
finding provided the background for more detailed research on neuropeptides participation in the
development of pathogenesis of intestinal changes, as well as reference data for further, pre-clinical
studies on hyperglycemia-related gastrointestinal disturbances in the species more closely related to
humans. Obviously, more detailed studies are needed to elucidate the precise mechanism and function
playing by neuropeptides in GI complication development.

Author Contributions: M.B. conceived of and designed the experiments; M.B. and K.P. performed the experiments;
M.B. and K.P. analyzed the data; M.B. wrote the paper; J.C. supervised the experiment and edited the manuscript.
All authors have read and agreed to the published version of the manuscript.
Funding: Project financially supported by Minister of Science and Higher Education in the range of the program
entitled “Regional Initiative of Excellence” for the years 2019–2022, Project No. 010/RID/2018/19, amount of
funding 12.000.000 PLN.
Acknowledgments: The authors wish to express their deep thanks to mgr. Andrzej Pobiedziński, for his skillful
technical assistance.
Conflicts of Interest: The authors declare no conflict of interest.

References
1. Furness, J.B.; Callaghan, B.P.; Rivera, L.R.; Cho, H.J. The enteric nervous system and gastrointestinal
innervation: Integrated local and central control. Adv. Exp. Med. Biol. 2014, 817, 39–71.
2. Furness, J.B. The enteric nervous system and neurogastroenterology. Nat. Rev. Gastroenterol. Hepatol. 2012, 9,
286–294. [CrossRef]
3. Furness, J.B. The enteric nervous system: Normal functions and enteric neuropathies. Neurogastroenterol.
Motil. 2008, 20 (Suppl. 1), 32–38.
4. Schemann, M.; Neunlist, M. The human enteric nervous system. Neurogastroenterol. Motil. 2004, 16 (Suppl. 1),
55–59.
5. Furness, J.B. The organisation of the autonomic nervous system: Peripheral connections. Auton Neurosci.
2006, 130, 1–5. [CrossRef]
6. Arciszewski, M.B.; Barabasz, S.; Skobowiat, C.; Maksymowicz, W.; Majewski, M. Immunodetection of
cocaine- and amphetamine-regulated transcript in the rumen, reticulum, omasum and abomasum of the
sheep. Anat. Histol. Embryol. 2009, 38, 62–67. [CrossRef] [PubMed]
Int. J. Mol. Sci. 2020, 21, 2047 23 of 25

7. Zacharko-Siembida, A.; Arciszewski, M.B. Co-expression patterns of cocaine- and amphetamine-regulated

transcript (CART) with neuropeptides in dorsal root ganglia of the pig. Anat. Histol. Embryol. 2014, 43, 48–55.
[CrossRef] [PubMed]
8. Furness, J.B. Intestinofugal neurons and sympathetic reflexes that bypass the central nervous system.
J. Comp. Neurol. 2003, 455, 281–284. [CrossRef] [PubMed]
9. Lomax, A.E.; Furness, J.B. Neurochemical classification of enteric neurons in the guinea-pig distal colon.
Cell Tissue Res. 2000, 302, 59–72. [CrossRef] [PubMed]
10. Clerc, N.; Furness, J.B.; Li, Z.S.; Bornstein, J.C.; Kunze, W.A. Morphological and immunohistochemical
identification of neurons and their targets in the guinea-pig duodenum. Neuroscience 1998, 86, 679–694.
[CrossRef]
11. Furness, J.B. Types of neurons in the enteric nervous system. J. Auton Nerv. Syst. 2000, 81, 87–96. [CrossRef]
12. Lomax, A.E.; Zhang, J.Y.; Furness, J.B. Origins of cholinergic inputs to the cell bodies of intestinofugal
neurons in the guinea pig distal colon. J. Comp. Neurol. 2000, 416, 451–460. [CrossRef]
13. Li, Z.S.; Furness, J.B. Immunohistochemical localisation of cholinergic markers in putative intrinsic primary
afferent neurons of the guinea-pig small intestine. Cell Tissue Res. 1998, 294, 35–43. [CrossRef] [PubMed]
14. Kristensen, P.; Judge, M.E.; Thim, L.; Ribel, U.; Christjansen, K.N.; Wulff, B.S.; Clausen, J.T.; Jensen, P.B.;
Madsen, O.D.; Vrang, N.; et al. Hypothalamic CART is a new anorectic peptide regulated by leptin. Nature
1998, 393, 72–76. [CrossRef]
15. Wierup, N.; Gunnarsdóttir, A.; Ekblad, E.; Sundler, F. Characterisation of CART-containing neurons and
cells in the porcine pancreas, gastro-intestinal tract, adrenal and thyroid glands. BMC Neurosci. 2007, 8, 51.
[CrossRef] [PubMed]
16. Ekblad, E. CART in the enteric nervous system. Peptides 2006, 27, 2024–2030. [CrossRef]
17. Ekblad, E.; Kuhar, M.; Wierup, N.; Sundler, F. Cocaine- and amphetamine-regulated transcript: Distribution
and function in rat gastrointestinal tract. Neurogastroenterol. Motil. 2003, 15, 545–557. [CrossRef] [PubMed]
18. Hökfelt, T.; Tatemoto, K. Galanin 25 years with a multitalented neuropeptide. Cell. Mol. Life Sci. 2008, 65,
1793–1795. [CrossRef]
19. Arciszewski, M.B.; Ekblad, E. Effects of vasoactive intestinal peptide and galanin on survival of cultured
porcine myenteric neurons. Regul. Pept. 2005, 125, 185–192. [CrossRef]
20. Lang, R.; Gundlach, A.L.; Kofler, B. The galanin peptide family: Receptor pharmacology, pleiotropic biological
actions, and implications in health and disease. Pharmacol. Ther. 2007, 115, 177–207. [CrossRef]
21. Sarnelli, G.; Vanden Berghe, P.; Raeymaekers, P.; Janssens, J.; Tack, J. Inhibitory effects of galanin on evoked
[Ca2+ ] responses in cultured myenteric neurons. Am. J. Physiol. Gastrointest Liver Physiol. 2004, 286,
G1009–G1014. [CrossRef]
22. Sundler, F.; Ekblad, E.; Grunditz, T.; Håkanson, R.; Uddman, R. Vasoactive intestinal peptide in the peripheral
nervous system. Ann. N. Y. Acad. Sci. 1988, 527, 143–167. [CrossRef]
23. Ekblad, E.; Sundler, F. Distinct receptors mediate pituitary adenylate cyclase-activating peptide- and
vasoactive intestinal peptide-induced relaxation of rat ileal longitudinal muscle. Eur. J. Pharmacol. 1997, 334,
61–66. [CrossRef]
24. Sandgren, K.; Lin, Z.; Fex Svenningsen, A.; Ekblad, E. Vasoactive intestinal peptide and nitric oxide promote
survival of adult rat myenteric neurons in culture. J. Neurosci. Res. 2003, 72, 595–602. [CrossRef] [PubMed]
25. Roza, C.; Reeh, P.W.; Substance, P. Calcitonin gene related peptide and PGE2 co-released from the mouse
colon: A new model to study nociceptive and inflammatory responses in viscera, in vitro. Pain. 2001, 93,
213–219. [CrossRef]
26. Grider, J.R. CGRP as a transmitter in the sensory pathway mediating peristaltic reflex. Am. J. Physiol. 1994,
266, G1139–G1145. [CrossRef] [PubMed]
27. Maggi, C.A.; Giuliani, S.; Zagorodnyuk, V. Calcitonin gene-related peptide (CGRP) in the circular muscle of
guinea-pig colon: Role as inhibitory transmitter and mechanisms of relaxation. Regul. Pept. 1996, 61, 27–36.
[CrossRef]
28. Holzer, P.; Barthó, L.; Matusák, O.; Bauer, V. Calcitonin gene-related peptide action on intestinal circular
muscle. Am. J. Physiol. 1989, 256, G546–G552. [CrossRef]
29. Palus, K.; Całka, J. Neurochemical Plasticity of the Coeliac-Superior Mesenteric Ganglion Complex Neurons
Projecting to the Prepyloric Area of the Porcine Stomach following Hyperacidity. Neural. Plast. 2016, 2016,
8596214. [CrossRef]
Int. J. Mol. Sci. 2020, 21, 2047 24 of 25

30. Callaghan, B.C.; Cheng, H.T.; Stables, C.L.; Smith, A.L.; Feldman, E.L. Diabetic neuropathy: Clinical
manifestations and current treatments. Lancet Neurol. 2012, 11, 521–534. [CrossRef]
31. Chandrasekharan, B.; Srinivasan, S. Diabetes and the enteric nervous system. Neurogastroenterol. Motil. 2007,
19, 951–960. [CrossRef]
32. Yarandi, S.S.; Srinivasan, S. Diabetic gastrointestinal motility disorders and the role of enteric nervous system:
Current status and future directions. Neurogastroenterol. Motil. 2014, 26, 611–624. [CrossRef]
33. Al-Awar, A.; Kupai, K.; Veszelka, M.; Szűcs, G.; Attieh, Z.; Murlasits, Z.; Török, S.; Pósa, A.; Varga, C.
Experimental Diabetes Mellitus in Different Animal Models. J. Diabetes Res. 2016, 2016, 9051426. [CrossRef]
[PubMed]
34. Wolf, E.; Braun-Reichhart, C.; Streckel, E.; Renner, S. Genetically engineered pig models for diabetes research.
Transgenic Res. 2014, 23, 27–38. [CrossRef] [PubMed]
35. Bulc, M.; Palus, K.; Zielonka, Ł.; Gaj˛ecka, M.; Całka, J. Changes in expression of inhibitory substances
in the intramural neurons of the stomach following streptozotocin- induced diabetes in the pig.
World J. Gastroenterol. 2017, 23, 6088–6099. [CrossRef] [PubMed]
36. Bulc, M.; Palus, K.; Dabrowski,
˛ M.; Całka, J. Hyperglycaemia-Induced Downregulation in Expression of
nNOS Intramural Neurons of the Small Intestine in the Pig. Int. J. Mol. Sci. 2019, 20, 1681. [CrossRef]
[PubMed]
37. Bulc, M.; Palus, K.; Całka, J.; Zielonka, Ł. Changes in Immunoreactivity of Sensory Substances within the
Enteric Nervous System of the Porcine Stomach during Experimentally Induced Diabetes. J. Diabetes Res.
2018, 24. [CrossRef] [PubMed]
38. Larsen, M.O.; Rolin, B. Use of the Goettingen Minipig as a Model of Diabetes with Special Focus on Type 1
Diabetes Research. ILAR 2004, 45, 303–313. [CrossRef]
39. Larsen, M.O.; Wilken, M.; Gotfredsen, C.F.; Carr, R.D.; Svendsen, O.; Rolin, B. Mild streptozotocin diabetes
in the Gottingen minipig. A novel model of moderate insulin deficiency and diabetes. Am. J. Physiol.
Endocrinol. Metab. 2002, 282, E1342–E1351. [CrossRef]
40. Fricker, J. The pig: A new model of diabetic atherosclerosis. Drug Discov. Today. 2001, 6, 921–922. [CrossRef]
41. Rosenfeld, L. Insulin: Discovery and controversy. Clin. Chem. 2002, 48, 2270–2288. [CrossRef]
42. Alberti, K.G.; Zimmet, P.Z. Definition, diagnosis and classification of diabetes mellitus and its complications.
Part 1: Diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med.
1998, 15, 539–553. [CrossRef]
43. Rodrigues, M.L.; Motta, M.E. Mechanisms and factors associated with gastrointestinal symptoms in patients
with diabetes mellitus. J. Pediatr (Rio J.) 2012, 88, 17–24. [CrossRef]
44. King, A.J. The use of animal models in diabetes research. Br. J. Pharmacol. 2012, 166, 877–894. [CrossRef]
[PubMed]
45. Schranz, D.B.; Lernmark, A. Immunology in diabetes: An update. Diabetes Metab. Rev. 1998, 14, 3–29.
[CrossRef]
46. Papatheodorou, K.; Papanas, N.; Banach, M.; Papazoglou, D.; Edmonds, M. Complications of Diabetes 2016.
J. Diabetes Res. 2016. [CrossRef] [PubMed]
47. Forbes, J.M.; Cooper, M.E. Mechanisms of diabetic complications. Physiol. Rev. 2013, 93, 137–188. [CrossRef]
[PubMed]
48. Xie, Z.; Chang, C.; Zhou, Z. Molecular mechanisms in autoimmune type 1 diabetes: A critical review.
Clin. Rev. Allergy Immunol. 2014, 47, 174–192. [CrossRef] [PubMed]
49. Like, A.A.; Rossini, A.A. Streptozotocin-induced pancreatic insulitis: New model of diabetes mellitus. Science
1976, 193, 415–417. [CrossRef]
50. Palus, K.; Bulc, M.; Całka, J. Changes in VIP-, SP- and CGRP- like immunoreactivity in intramural neurons
within the pig stomach following supplementation with low and high doses of acrylamide. Neurotoxicology
2018, 69, 47–59. [CrossRef]
51. Skobowiat, C.; Calka, J.; Majewski, M. Axotomy induced changes in neuronal plasticity of sympathetic chain
ganglia (SChG) neurons supplying descending colon in the pig. Exp. Mol. Pathol. 2011, 90, 13–18. [CrossRef]
52. Ballmann, M.; Conlon, J.M. Changes in the somatostatin, substance P and vasoactive intestinal polypeptide
content of the gastrointestinal tract following streptozotocin-induced diabetes in the rat. Diabetologia 1985,
28, 355–358. [CrossRef]
Int. J. Mol. Sci. 2020, 21, 2047 25 of 25

53. Nowak, T.V.; Chey, W.W.; Chang, T.M.; Weisbruch, J.P.; Fouquet, G. Effect of streptozotocin-induced diabetes
mellitus on release of vasoactive intestinal polypeptide from rodent small intestine. Dig. Dis. Sci. 1995, 40,
828–836. [CrossRef]
54. Whittaker, V.P. Vasoactive intestinal polypeptide (VIP) as a cholinergic co-transmitter: Some recent results.
Cell Biol. Int. Rep. 1989, 13, 1039–1051. [CrossRef]
55. Nasef, N.A.; Mehta, S.; Ferguson, L.R. Susceptibility to chronic inflammation: An update. Arch. Toxicol 2017,
91, 1131–1141. [CrossRef] [PubMed]
56. Brenneman, D.E.; Philips, T.M.; Hauser, J.; Hill, J.M.; Spong, C.Y.; Gozes, I. Complex array of cytokines
released by vasoactive intestinal pep-tide. Neuropeptides 2003, 37, 111–119. [CrossRef]
57. El-Salhy, M. Neuroendocrine peptides of the gastrointestinal tract of an animal model of human type 2
diabetes mellitus. Acta Diabetol. 1998, 35, 194–198. [CrossRef] [PubMed]
58. El-Salhy, M. Gastrointestinal transit in nonobese diabetic mouse: An animal model of human diabetes type 1.
J. Diabetes Complicat. 2001, 15, 277–284. [CrossRef]
59. Zawada, A.E.; Moszak, M.; Skrzypczak, D.; Grzymisławski, M. Gastrointestinal complications in patients
with diabetes mellitus. Adv. Clin Exp. Med. 2018, 27, 567–572. [CrossRef]
60. Heinricher, M.M. Pain Modulation and the Transition from Acute to Chronic Pain. Adv. Exp. Med. Biol. 2016,
904, 105–115.
61. Belai, A.; Calcutt, N.A.; Carrington, A.L.; Diemel, L.T.; Tomlinson, D.R.; Burnstock, G. Enteric neuropeptides
in streptozotocin-diabetic rats; effects of insulin and aldose reductase inhibition. J. Auton Nerv. Syst. 1996, 58,
163–169. [CrossRef]
62. Belai, A.; Lincoln, J.; Burnstock, G. Lack of release of vasoactive intestinal polypeptide and calcitonin
gene-related peptide during electrical stimulation of enteric nerves in streptozotocindiabetic rats.
Gastroenterology 1987, 93, 1034–1040. [CrossRef]
63. Belai, A.; Burnstock, G. Changes in adrenergic and peptidergic nerves in the submucous plexus of
streptozocin-diabetic rat ileum. Gastroenterology 1990, 98, 1427–1436. [CrossRef]
64. Marchand, L.; Kawasaki-Ogita, Y.; Place, J.; Fayolle, C.; Lauton, D.; Boulet, F.; Farret, A.; Renard, E. Long-Term
Effects of Continuous Subcutaneous Insulin Infusion on Glucose Control and Microvascular Complications
in Patients With Type 1 Diabetes. J. Diabetes Sci. Technol. 2017, 11, 924–929. [CrossRef] [PubMed]
65. Qu, Z.D.; Thacker, M.; Castelucci, P.; Bagyánszki, M.; Epstein, M.L.; Furness, J.B. Immunohistochemical
analysis of neuron types in the mouse small intestine. Cell Tissue Res. 2008, 334, 147–161. [CrossRef]
[PubMed]
66. Pidsudko, Z.; Wasowicz,
˛ K.; Kaleczyc, J.; Majewski, M.; Lakomy, M. Proliferative enteropathy induced
changes in expression of DβH, VAChT and NOS in the neurons on intramural ganglia of the porcain ileum.
Veterin Med. 2008, 53, 533–542. [CrossRef]
67. Monckton, G.; Pehowich, E. Autonomic neuropathy in the streptozotocin diabetic rat. Can. J. Neurol. Sci.
1980, 7, 135–142. [CrossRef]
68. Spangeus, A.; Suhr, O.; El-Salhy, M. Diabetic state affects the innervation of gut in an animal model of human
type 1 diabetes. Histol. Histopathol. 2000, 15, 739–744.
69. LePard, K.J. Choline acetyltransferase and inducible nitric oxide synthase are increased in myenteric plexus
of diabetic guinea pig. Auton. Neurosci. 2005, 118, 12–24. [CrossRef]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).
 Redox Biology 11 (2017) 51–59

Contents lists available at ScienceDirect

Redox Biology
journal homepage: www.elsevier.com/locate/redox

Research paper

Redox imbalance and mitochondrial abnormalities in the diabetic lung MARK

⁎
Jinzi Wu, Zhen Jin, Liang-Jun Yan
Department of Pharmaceutical Sciences, UNT System College of Pharmacy, University of North Texas Health Science Center, Fort Worth, TX 76107, United
States

A R T I C L E I N F O A BS T RAC T

Keywords: Although the lung is one of the least studied organs in diabetes, increasing evidence indicates that it is an
Diabetes inevitable target of diabetic complications. Nevertheless, the underlying biochemical mechanisms of lung injury
Lung injury in diabetes remain largely unexplored. Given that redox imbalance, oxidative stress, and mitochondrial
Mitochondrial abnormalities dysfunction have been implicated in diabetic tissue injury, we set out to investigate mechanisms of lung injury in
Oxidative stress
diabetes. The objective of this study was to evaluate NADH/NAD+ redox status, oxidative stress, and
Redox imbalance
mitochondrial abnormalities in the diabetic lung. Using STZ induced diabetes in rat as a model, we measured
redox-imbalance related parameters including aldose reductase activity, level of poly ADP ribose polymerase
(PAPR-1), NAD+ content, NADPH content, reduced form of glutathione (GSH), and glucose 6-phophate
dehydrogenase (G6PD) activity. For assessment of mitochondrial abnormalities in the diabetic lung, we
measured the activities of mitochondrial electron transport chain complexes I to IV and complex V as well as
dihydrolipoamide dehydrogenase (DLDH) content and activity. We also measured the protein content of NAD+
dependent enzymes such as sirtuin3 (sirt3) and NAD(P)H: quinone oxidoreductase 1 (NQO1). Our results
demonstrate that NADH/NAD+ redox imbalance occurs in the diabetic lung. This redox imbalance upregulates
the activities of complexes I to IV, but not complex V; and this upregulation is likely the source of increased
mitochondrial ROS production, oxidative stress, and cell death in the diabetic lung. These results, together with
the findings that the protein contents of DLDH, sirt3, and NQO1 all are decreased in the diabetic lung,
demonstrate that redox imbalance, mitochondrial abnormality, and oxidative stress contribute to lung injury in
diabetes.

1. Introduction polyol pathway converts NADPH to NADH when it transforms glucose

Diabetes is a problem of glucose metabolism and diabetes compli-
cations is the outcome of glucose toxicity, which is often manifested by
increased protein glycation, activation of the polyol pathway and poly
ADP ribose polymerase (PARP), and protein kinase C activation [1–5].
Mechanistically, all these hyperglycemia upregulated pathways can
eventually lead to production of reactive oxygen species (ROS) that
then induce oxidative stress, mitochondrial dysfunction, and cell death
[6,7]. Although the lung is one of the least studied organs in diabetes
complications, increasing evidence has indicated that the lung is a
target of diabetic injury [8–11]. Nevertheless, the underlying mechan-
isms remain largely unknown.
As glucose is one of the major sources of NADH, its excess can often
lead to excess NADH production and NAD+ deficiency, thereby causing
NADH/NAD+ redox imbalance [12]. The major source of this redox
imbalance is thought to come from the activation of the polyol pathway
and poly ADP ribose polymerase (PARP) [13–16]. On one hand, the
to fructose via a two–reaction mechanism [17], resulting in NADH
overproduction at the consumption of glucose [18,19]. On the other
hand, as PARP uses NAD+ as its substrate and is usually over-activated
by DNA oxidative damage in diabetes [20], cellular NAD+ could be
potentially depleted [21–23]. Therefore, the overall outcome of the two
activated pathways is NADH/NAD+ redox imbalance with diminished
levels of NAD+ and increased levels of NADH, leading to reductive
stress that gradually progresses to oxidative stress [24].
Oxidative stress occurs when cellular antioxidative system is
defeated by ROS that are overproduced under a variety of disease
conditions including diabetes [25]. As mitochondrion is a major source
of ROS and a target of ROS [26,27], its abnormalities have been
thought to contribute to diabetic pathogenesis [28]. However, whether
mitochondrial abnormalities also occur in the diabetic lung remains to
be evaluated. In the present study, using STZ induced diabetes in rat as
a model; we characterized pulmonary redox imbalance and its asso-
ciated pathways. Specifically, we measured the activities of mitochon-

⁎
Corresponding author.
E-mail address: liang-jun.yan@unthsc.edu (L.-J. Yan).

http://dx.doi.org/10.1016/j.redox.2016.11.003
Received 18 October 2016; Accepted 2 November 2016
Available online 17 November 2016
2213-2317/ © 2016 The Authors. Published by Elsevier B.V.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
J. Wu et al.
drial membrane complexes I to V. We also measured the enzyme
activities of mitochondrial dihydrolipoamide dehydrogenase (DLDH)
and its possible modifications by protein acetylation. Additionally, lung
mitochondrial ROS production and overall protein oxidative damage
were quantified. NAD(P)H: quinone oxidoreductase 1 (NQO1) protein
content and activity and sirtuin 3 (sirt3) protein content were also
evaluated in the context of redox imbalance and mitochondrial
abnormalities in the diabetic lung.
2. Materials and methods
2.1. Chemicals
Biotin-linked aldehyde reactive probe ARP) for protein carbonyl
assay was from Cayman Chemical (Ann Arbor, MI). Dihydrolipoamide
was synthesized from lipoamide in our own laboratory using sodium
borohydride as previously described [29,30]. ε-amino-N-caproic acid
was obtained from MP Biochemicals. Acrylamide/bisacrylamide, am-
monium persulfate, Bradford protein assay solution, coomassie bril-
liant blue (CBB) R-250, immunoblotting membrane, and an ECL
immunochemical detection kit were from Bio-Rad laboratories
(Richmond, CA, USA). NADH, BSA, lipoamide, EDTA, ATP, and NBT
chloride tablets were obtained from Sigma (St. Louis, MO, USA). Serva
Blue G was purchased from Serva (Heidelberg, Germany). Anti-PARP
antibody was purchased from Trevigen (Gaithers burg, MD). Anti-
NQO1 antibodies were from Sigma. Rabbit anti-DLDH polyclonal
antibodies (IgG) and goat anti-rabbit IgG conjugated with horseradish
peroxidase were purchased from US Biological (Swampscott, MA, USA)
and Invitrogen (San Diego, CA, USA), respectively. Other antibodies
were from Abcam (Cambridge, MA).
2.2. Diabetes induction in rats
Young adult male Sprague Dawley rats obtained from Charles River
were used in this study. Diabetes was induced by a single intraper-
itoneal injection of STZ (60 mg/kg body weight) into rats weighing
220–250 g after overnight fasting as previously described [31]. STZ
solutions were made fresh by dissolving in 0.1 M sodium citrate buffer
(pH 4.5) and control animals received sodium citrate buffer only. Blood
glucose concentration was monitored once a week using blood glucose
test strips (FreeStyle lite from Abbott Diabetes Care Inc., Alameda,
California). Rats with blood glucose contents exceeding 200 mg/dl
were deemed diabetic. Four weeks post STZ injections, rats were
sacrificed and tissues were collected. All animal studies procedures
were approved by the UNTHSC committee for research.
2.3. Isolation of lung mitochondria
Mitochondria from the lung were isolated according to a previously
described method [32] with slight modifications. Essentially, lung
tissues were homogenized (1g/10 ml isolation buffer) in mitochondrial
isolation buffer containing 15 mM MOPS (pH 7.2), 70 mM sucrose,
230 mM mannitol, and 1 mM K+-EDTA. The homogenates were cen-
trifuged at 800g for 10 min at 4 °C. The resulting supernatant was
further centrifuged at 8,000g for 10 min also at 4 °C. The resulting
pellet containing crude mitochondria was washed with 10 ml of the
isolation buffer followed by centrifugation under the same conditions.
The obtained mitochondrial pellet was either used immediately or
frozen at −80 °C until use.
2.4. Measurement of H2O2 and protein carbonyls
Lung tissue homogenate H2O2 was measured by the Amplex Red
method [33] using a kit purchased from Invitrogen (catalog number
A22188). Protein carbonyls of whole mitochondrial preparation were
measured by derivatization with biotin-linked aldehyde reactive probe
52
Redox Biology 11 (2017) 51–59
(ARP) [34] followed by SDS-PAGE resolution of the carbonylated
proteins and Western blot assay and densitometric quantification of
each gel lane.
2.5. Measurement of NAD+/NADH ratio, NADPH, and ATP
Lung tissue homogenate NAD+/NADH ratio was measured spectro-
photometrically by following the changes at 340 nm using a kit from
BioAssay (Hayward, CA). NADPH content was measured by a kit from
BioVision (Milpitas, CA, Catalog number: K347-100) according to the
manufacturer's instructions. ATP content was determined colorimetri-
cally by the ATP Colorimetric/Fluorometric Assay kit that is also from
BioVision (Milpitas, CA, catalog number K354-100). This method
quantifies phosphorylated glycerol that can be easily monitored at
570 nm.
2.6. Measurement of enzyme activities
Aldose reductase activity was measured spectrophotometrically by
following the decrease of NADPH's absorption at 340 nm as previously
described [35]. DLDH dehydrogenase activity was measured in the
forward reaction as previously described [36,37]. Measurement of
mitochondrial complexes I, IV and V activities was also conducted as
previously described using in-gel based assays or spectrophotometric
assays [38]. Activities for complexes II and III were measured spectro-
photometrically as previously described [39,40]. NQO1 activity was
measured according to the method of Lind et al. [41] and G6PD activity
was measured by monitoring NADPH production at 340 nm as
previously described [42]. Caspase-3 activity was measured using a
kit also from BioAssay (Hayward, CA). Mitochondrial membrane
potential was measured by a kit purchased from BioVision (Milpitas,
CA) according to the manufacturer's instruction manual.
2.7. Polyacrylamide gel electrophoresis and Western blot analysis
SDS-PAGE (typically 10% resolving gel) was performed according
to standard procedures [43]. One of the resulting gels was stained with
Coomassie colloid blue [38], and the other gel was subjected to
electrophoretic transfer to membrane for immunoblotting [44].
Signals on the immunoblotting membrane were visualized with an
enhanced chemiluminescence kit. Nongradient blue native gel electro-
phoresis (BN-PAGE) was performed as previously described [36]. All
images were scanned by an EPSON PERFECTION 1670 scanner. All
densitometric quantifications of gel images were analyzed by
AlphaEaseFC software.
2.8. Data analysis
Where appropriate, all values were presented as mean ± SEM.
Statistical data analysis was performed using GraphPad's 2-tailed
unpaired t-test (GraphPad, San Diego, CA). A p value less than 0.05
(p <0.05) was deemed statistically significant.
3. Results
3.1. Redox imbalance in the diabetic lung
In many diabetic tissues that have been well studied, redox
imbalance between NADH and NAD+ is the primary driving force for
ROS production and oxidative stress [12,13]. This redox imbalance is
believed to mainly originate from two enzyme systems activated by
persistent hyperglycemia. One reaction is the polyol pathway including
aldose reductase and sorbitol dehydrogenase [45]. This pathway
converts glucose to fructose and NADPH to NADH, resulting in
overproduction of NADH [46]. Another pathway is poly ADP ribose
polymerase (PARP) that uses NAD+ as its substrate [47]. This enzyme
J. Wu et al.
Fig. 1. : Redox imbalance parameters in the diabetic lung. When compared with the lungs from non-diabetic rats, the diabetic lungs show an increased aldose reductase activity (A), an
increased protein expression of PARP-1, a significantly decreased level of NAD+(C), a decreased level of NADPH (D), a decreased level of reduced from of glutathione (GSH) (E), and a
decreased activity of G6PD (F).
can be over-activated by hyperglycemia induced DNA oxidative da-
mage, resulting in potential depletion of NAD+[48]. Therefore an
overall outcome of NADH/NAD+ redox imbalance occurs in diabetic
tissues [13]. To test whether this redox imbalance mechanism takes
place in the diabetic lung, we measured aldose reductase activity and
the protein content of PARP-1, results in Fig. 1A demonstrate that the
activity of aldose reductase, the rate-limiting enzyme of the polyol
pathway [49], was indeed higher than that in the control lung.
Similarly, results in Fig. 1B demonstrate that PARP-1 protein content
was upregulated in the diabetic lung. Together, the upregulation of
these two pathways contributed to a much lower level of NAD+ in the
diabetic lung than in the healthy lung as observed in Fig. 1C. Moreover,
we also found that in the diabetic lung, NADPH content was lower, so
was GSH content, the normal level of the latter depends on a normal
level of NADPH that is used by glutathione reductase to make GSH
from GSSG [50]. Additionally, we also found that the activity of
glucose-6 phosphate dehydrogenase (G6PD) was also lower in the
diabetic lungs than in the healthy lungs, suggesting that a decreased
level of NADPH could be partly driven by a low activity of G6PD that is
responsible for NADPH production from glucose [51,52].
3.2. Increased activities of mitochondrial electron transport chain
complexes
The excess NADH in the diabetic lung as measured in Fig. 1C
suggests that there is an oversupply of electrons to mitochondrial
electron transport chain. Therefore we next determined the effects of
this excess NADH on the enzyme activities of mitochondrial electron
53
Redox Biology 11 (2017) 51–59
transport chain components complexes I to IV. Results shown in
Fig. 2(A-D) indicate that the enzyme activities of all the four complexes
were elevated in the diabetic lung, suggesting an enhanced electron
transport imposed by excess NADH on the mitochondrial electron
transport chain. We also measured complex V activity but did not
detect any different between control and diabetes (Fig. 2E).
Nonetheless, ATP content was much lower in the diabetic lung than
in the healthy lungs (Fig. 2F). These results suggested that the
upregulated electron transport chain activities (I to IV) are not for
ATP production. Rather, the increased electron transport chain func-
tion may contribute to increased ROS production, given that majority
of ROS can be produced by mitochondria in diabetes [53].
3.3. Increased oxidative stress in the diabetic lung
To test the above hypothesis that the upregulated mitochondrial
electron transport chain leads to increased ROS production, we then
measured hydrogen peroxide in the lung homogenate. A comparison
between control and diabetic lungs indicates that H2O2 content was
much higher in the diabetic lung than in the healthy lung (Fig. 3A).
Moreover, we also measured lung mitochondrial protein carbonylation
using western blot assay. Results indicate increased total protein
carbonylation in the diabetic group than in the control group (Fig. 3,
C and D). Moreover, we also measured the activity and content of
NQO1, a second phase antioxidant enzyme that is usually upregulated
by the Nrf2 transcription factor signaling pathway [54]. Result in
Fig. 3B indicates that both NQO1 content and activity were much lower
in the diabetic lung than in the control lung. Taken together, our results
J. Wu et al. Redox Biology 11 (2017) 51–59

Fig. 2. : Activities of mitochondrial membrane complexes. The activities of mitochondrial electron transport chain complexes I to IV (A to D) all exhibited decreases in the diabetic lung
when compared with those in the controls. No difference in complex V activity between control and STZ-diabetes could be detected (E). Cellular ATP content was lower in the diabetic
lung than in the non-diabetic lung (F).

Fig. 3. : Elevated level of oxidative stress and attenuated antioxidative capacity in the diabetic lung. (A) ROS production reflected by the level of H2O2 was increased in the diabetic lung.
(B) NQO1 protein content was lower in the diabetic lung than in the non-diabetic lung. (C) Lung mitochondrial protein carbonylation assessed by Western blot assay using aldehyde-
reactive probe as the labeling reagent. (D) Densitometric analysis of protein carbonyl content between control and diabetes. Data are derived from (C).

54
J. Wu et al. Redox Biology 11 (2017) 51–59

Fig. 4. : Evaluation of protein expression of NNMT and NDUFS3. (A) Increased expression of NNMT in the diabetic lung measured by Western blot assay. (B) Densitometric
quantitation of Western blot band intensity shown in (A). (C) Increased expression of NDUFS3 in the diabetic lung measured by Western blot assay. (D) Densitometric quantitation of
Western blot band intensity as shown in (C).

indicate that NADH/NAD+ redox imbalance in the diabetic lung diabetic lung than in the healthy lung. Moreover, data in Fig. 5C
induces oxidative stress that may be implicated in lung dysfunction indicates that DLDH content was remarkably decreased in the diabetic
in diabetes. lung, indicating that a lower DLDH activity in the diabetic lung is
contributed by a lower DLDH content. Furthermore, when the DLDH
activity bands on the blue native gel were analyzed by mass spectro-
3.4. Upregulation of complex I activity is likely mediated by increased
metry, 7 DLDH peptides were recovered in the control samples while
expression of nicotinamide N-methyltransferase (NNMT) and
none could be recovered in the STZ-treated samples (data not shown),
NDUFS3
confirming that DLDH is indeed down-regulated in the diabetic lung.
It should be pointed out that the low DLDH activity observed in A
As complex I is the entry point of electrons into the electron
and B could also be contributed by DLDH acetylation as DLDH from
transport chain, we next determine whether hyperglycemia upregulates
the diabetic lung was found to exhibit elevated levels of protein
complex I. While complex I upregulation could be an adaptive response
acetylation (Fig. 5D, upper panel). Interestingly, DLDH protein was
to excess NADH, this upregulation could also increase mitochondrial
not found to be damaged via carbonylation (Fig. 5D, lower panel), a
ROS production given that the more NADH oxidized by complex I, the
parameter used to quantitate protein oxidative damage [44,64]. This
more ROS produced by complex I [55,56]. Based on reports in the
finding is in agreement with our previous findings that DLDH is not an
literature that NNMT can be upregulated by overnutrition and
apparent target for carbonylation during aging [61], a process asso-
hyperglycemia and that this upregulation elevates the expression of
ciated with increased oxidative stress [65].
the complex I subunit NDUFS3 [57–59] thereby increasing complex I
activity, we measured by western blot methods the protein content of
both NNMT and NDUFS3 (Fig. 4A and C). Densitometric analysis of 3.6. Decreased mitochondrial sirtuin 3 (sirt3) content in the diabetic
these western blot results indicated that the protein content of both lung
NNMT and NDUFS3 were significantly increased (Fig. 4B and D),
demonstrating that NNMT upregulation by diabetic hyperglycemia can It has been well established that the level of NAD+ in a cell can
increase complex I activity by increasing the expression of complex I dictate the level of sirtuin proteins [66], which are deacetylation
NDUFS3 subunit. enzymes that are known to be involved in redox signaling and
metabolic control [67]. Our finding that NAD+ content is decreased
in the diabetic lung suggests that sirt3 level could be attenuated as well
3.5. Attenuated expression of dihydrolipoamide dehydrogenase
given that sirtuin protein expression is NAD+ dependent [66]. To test
(DLDH) in the diabetic lung
this likelihood, we measured mitochondrial sirt3 protein content by
western blot. Result in Fig. 6A demonstrates that sirt3 protein content
Dihydrolipoamide dehydrogenase (DLDH) is a component of three
was severely decreased in the diabetic lung than in the control lung.
mitochondrial alpha keto acid dehydrogenase complexes [37]. It is a
Consequently, total mitochondrial protein acetylation in the diabetic
key enzyme in the production of acetyl-CoA from pyruvate and
lung was greater than that in the control lung (Fig. 6B and C), which is
branched chain amino acids [60]. DLDH uses NAD+ as one of its two
in agreement with the observation that DLDH acetylation was in-
substrates and makes NADH [61]. It is known that the level of NAD+
creased in the diabetic lung (Fig. 5D, upper panel).
could affect either the level or the activity of DLDH [62,63]. To test
whether a low NAD+ content in the diabetic lung leads to an attenuated
DLDH function or a low DLDH protein content, we measured DLDH 3.7. Impaired mitochondrial membrane potential and increased cell
content and enzyme activity. Enzymatic activity was measured by both death in the diabetic lung
blue native gel electrophoresis and spectrometry. Results in Fig. 5A and
B indicate that DLDH activity was indeed significantly lower in the Our findings that enhanced mitochondrial electron transport did

55
J. Wu et al. Redox Biology 11 (2017) 51–59

Fig. 5. Comparison of DLDH activity and expression between control and diabetic lungs. (A) Decreased DLDH activity in the diabetic lung assessed by BN-PAGE. (B) Decreased DLDH
activity in the diabetic lung measured spectrophotometrically. (C) Decreased DLDH protein content in the diabetic lung assessed by Western bot assay. (D) DLDH acetylation (Upper),
but not DLDH protein carbonylation (lower) was increased in the diabetic lung. (For interpretation of the references to color in this figure, the reader is referred to the web version of this
article)

not lead to increased mitochondrial ATP production suggest that 4. Discussion

mitochondria in the diabetic lung are not well-coupled. Therefore, we
next measured mitochondrial membrane potential. Results in Fig. 7A
demonstrate that diabetic pulmonary mitochondrial membrane poten-
tial was lower than that in control, which could lead to enhanced
electron leakage and oxidative stress as shown in Fig. 5. Moreover, less
mitochondrial ATP production can also suggest an increased cell death.
Indeed, measurement of caspase-3 activity, a parameter reflecting the
magnitude of cell death, demonstrates an increased level of apoptosis
as caspase-3 activity was much higher in diabetes than in control
(Fig. 7B).
The major findings of the present study are the following: 1)
NADH/NAD+ redox imbalance occurred in the diabetic lung and was
likely contributed by activation of the polyol pathway and PARP. 2) The
activities of mitochondrial complexes I to IV were upregulated while
there were no changes in complex V activity. 3) Mitochondrial ATP
output was lower in the diabetic lung than in the non-diabetic lung. 4)
Mitochondrial ROS production and protein carbonylation were in-
creased, which was accompanied by decreased protein content and
activity of NQO1, an inducible antioxidant enzyme involved in cellular
defense against oxidative stress [68]. 5) Complex I upregulation by
diabetic hyperglycemia was likely achieved by upregulation of NNMT

Fig. 6. : (A) Sirt3 protein content was decreased in the diabetic lung. Anti-sirt3 antibodies were used for this evaluation with actin as the loading control. (B) Western blot detection of
mitochondrial protein acetylation; shown are lung mitochondria isolated from three control rats and 3 diabetic rats, respectively. (C) Densitometric quantification of mitochondrial
protein acetylation. Data were derived from (B).

56
J. Wu et al.
Fig. 7. : Determination of mitochondrial membrane potential and cell death. (A) Mitochondrial membrane potential in the diabetic lung was significantly lower than that in the healthy
lung. (B) Increased caspase-3 activity in the diabetic lung than in the healthy lung, indicating increased cell death in the diabetic lung (N =3 for each measurement).
that in turn upregulates NDUFS3, a key complex I subunit involved in
complex I assembly and function [69]. 6) DLDH protein content was
decreased in the diabetic lung, which impaired DLDH activity that may
also be accentuated by the observation that DLDH acetylation was
increased in the diabetic lung, a process that can be enhanced by down
regulation of mitochondrial sirt3 that is responsible for protein
deacetylation [70]. 7) Mitochondrial membrane potential in the
diabetic lung was decreased and cell death was increased. Taken
together, results of the present study shed insights into the biochemical
mechanisms of lung injury in diabetes. It should be pointed out that
one caveat of the study is that we did not study whether the redox
imbalance occurs to all the cellular populations in the lung that is
composed of nearly 40 different cell types.
Our study presents strong evidence that there occurs also redox
imbalance in the diabetic lung with NADH being in excess. Excess
NADH could over burden the electron transport chain and cause more
mitochondrial ROS production. As an adaptive response to handle
NADH pressure complex I was found to be upregulated (Fig. 2A),
together with other electron transport chain complexes II to IV
(Fig. 2B-D). The adverse effect of this upregulation, unfortunately,
would be increased ROS production given that the more NADH
oxidized by complex I, the more ROS produced by complex I [26,71].
Indeed, excess NADH appears to be used for ROS generation as
complex V was not upregulated and ATP output by mitochondria was
decreased (Fig. 2E and F), indicating an uncoupling effect of diabetic
hyperglycemia on pulmonary mitochondrial oxidative phosphorylation
as shown in Fig. 7A and increased cell death as shown in Fig. 7B. These
results demonstrate overall mitochondrial abnormalities in the pre-
sence of glucose oversupply in that excess NADH is not completely
used for ATP production but rather diverted for production of
mitochondrial ROS that could be involved in cell death and lung injury
in diabetes.
Our study also demonstrates that NADPH-related signaling path-
ways in the diabetic lungs were also compromised. Not only NADPH
level was found to be attenuated, activity of G6PD and levels of GSH
(reduced glutathione) were also found to be suppressed. It seems that
the decrease in NADPH content could be contributed by two pathways
that are deregulated in diabetes by hyperglycemia. One pathway is
NADPH consumption by the polyol pathway for the generation of
NADH; another pathway is functional impairment of G6PD that could
lead to less NADPH production. As NADPH is required for GSH
formation from GSSG by glutathione reductase [42,72], less NADPH
would lead to less GSH formation. This is indeed what we have found in
the diabetic lung whereby GSH content was low (Fig. 1E). Our results
are similar to what have been found in the diabetic kidneys in which
G6PD activity, NADPH and GSH levels were all found to be lower in
diabetic animals than in non-diabetic controls [73]. It should be noted
that the alterations in G6PD activities in diabetes are likely tissue
dependent. For example, in the brain of STZ diabetic rats, G6PD
activity was markedly increased [74]. G6PD activity was also found to
be increased in the liver of Zucker diabetic rats [75]. Similarly, NADPH
content in certain diabetic tissues has been reported to be elevated
57
Redox Biology 11 (2017) 51–59
when compared with that in non-diabetic conditions [76–78].
Nonetheless, in our present study, we found that NADPH level declined
in diabetic lung (Fig. 1D). It should be pointed out that the level of
NADH can increase dramatically in the presence of a decreased
NADPH content is due to the fact that cellular NADPH concentration
is usually much higher than that of NADH. For example, in red blood
cells, NDAPH content is approximately 10 times higher than that of
NADH [79].
In the present study, we also analyzed NAD+-dependent enzymes
such as NQO1, DLDH, and sirt3. Our results show that the functions of
all the three enzymes were impaired in the diabetic lung, either through
down regulation of protein expression or posttranslational modifica-
tions or both. With respect to NQO1, as its expression is controlled by
Nrf2 transcription factor [80], our observation that NQO1 content
showed a decrease in the diabetic lung suggests that the Nrf2 signaling
pathway is suppressed in the diabetic lung; which needs to be further
evaluated in future studies. Nonetheless it has been reported that the
Nrf2 signaling pathway is down regulated in other diabetic tissues such
as liver and heart [81, 82]. It should be noted, however, that how Nrf2
is regulated in diabetes may be tissue dependent as it has been shown
that in the kidney, Nrf2 could be upregulated by diabetic hyperglycemia
[83].
With respect to DLDH, this protein is also known to be able to
generate ROS [84–86]. This enzyme uses NAD+ as its substrate and
makes NADH that can be fed into the electron transport chain. In the
presence of excess NADH, DLDH can be inhibited via a feedback
inhibitory mechanism [87]. In the present study, we found that DLDH
in the diabetic lungs was down regulated with a diminished DLDH
protein content (Fig. 5C). This diminution would certainly impair the
role of DLDH in mitochondrial bioenergetics. Functional impairment
of DLDH in the diabetic lung could also partially originate from its
cysteine acetylation; a process regulated by sirt3 and is known to affect
protein functions [70,88,89]. Our findings that DLDH underwent
protein acetylation in the diabetic lung are in agreement with previous
reports that DLDH is a target of protein acetylation [88,90,91]. We
think that DLDH acetylation in diabetic lung could be governed by two
mechanisms. One is due to oversupply of acetyl-CoA that can chemi-
cally modify a protein cysteine residues [92–94], another mechanism
would be the down regulation of mitochondrial sirt3 (Fig. 6) detected
in the diabetic lung, which would lead to less deacetylation of DLDH.
Our data suggest that DLDH dysfunction might be a pathogenic
mechanism for diabetic lung injury.
With respect to sirt3, our observation that sirt3 is down regulated in
the diabetic lung mitochondria (Fig. 6) agrees with the results of
previous studies whereby sirt3 shows a decreased expression in
diabetic tissues [95–98]. The reason for this is likely due to the fact
that NAD+ is decreased in diabetes [99,100]. It is known that the level
of sirtuin expression is dependent on NAD+ content [66,101]. As sirt3
is responsible for protein deacetylation, its decreased expression would
certainly increase protein acetylation, as was in the case for DLDH and
other mitochondrial proteins (Fig. 6B and C). Therefore, impaired sirt3
signaling pathway could provide another mechanism of mitochondrial
J. Wu et al.
abnormalities associated with lung injury in diabetes.
5. Summary
In this study, we have presented evidence that in the diabetic lung,
NADH/NAD+ redox balance was perturbed with NADH being in excess
and NAD+ being deficient. Consequently, mitochondrial electron
transport chain could be under NADH electron pressure and was
indeed found to be upregulated in response to this pressure. However,
this upregulation does not seem to lead to enhanced mitochondrial
ATP production as complex V activity was not upregulated and ATP
content was suppressed. Conversely, the upregulation of electron
transport chain function was found to be associated with decreased
mitochondrial membrane potential, increased ROS generation, ele-
vated oxidative stress, and increased cell death. Moreover, the function
of NAD+-dependent enzymes such as NQO1, DLDH, and sirt3 were all
found to be impaired in the diabetic lung. Taken together, the present
study has elucidated mechanisms by which lung function can be
impaired in diabetes.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgements
This work was supported in part by a UNTHSC seed grant RI10015.
LJY was also supported in part by a National Institutes of Health grant
R01NS079792.
References
[1] M. Brownlee, Biochemistry and molecular cell biology of diabetic complications,
Nature 414 (2001) 813–820.
[2] M. Brownlee, The pathobiology of diabetic complications: a unifying mechanism,
Diabetes 54 (2005) 1615–1625.
[3] X. Luo, J. Wu, S. Jing, L.J. Yan, Hyperglycemic stress and carbon stress in diabetic
glucotoxicity, Aging Dis. 7 (2016) 90–110.
[4] H. Zheng, J. Wu, Z. Jin, L.J. Yan, Protein Modifications as Manifestations of
Hyperglycemic Glucotoxicity in Diabetes and Its Complications, Biochem Insights
9 (2016) 1–9.
[5] H. Zheng, J. Wu, Z. Jin, L.-J. Yan, Potential biochemical mechanisms of lung
injury in diabetes, Aging Dis. 8 (2017). http://dx.doi.org/10.14336/
AD.12016.10627.
[6] R.P. Robertson, Chronic oxidative stress as a central mechanism for glucose
toxicity in pancreatic islet beta cells in diabetes, J. Biol. Chem. 279 (2004)
42351–42354.
[7] A. Kassab, A. Piwowar, Cell oxidant stress delivery and cell dysfunction onset in
type 2 diabetes, Biochimie 94 (2012) 1837–1848.
[8] L.M. Kuitert, The lung in diabetes–yet another target organ?, Chron. Respir. Dis. 5
(2008) 67–68.
[9] Y. Hu, Z. Ma, Z. Guo, F. Zhao, Y. Wang, L. Cai, J. Yang, Type 1 diabetes mellitus is
an independent risk factor for pulmonary fibrosis, Cell Biochem Biophys. 70
(2014) 1385–1391.
[10] J. Yang, Y. Tan, F. Zhao, Z. Ma, Y. Wang, S. Zheng, P.N. Epstein, J. Yu, X. Yin,
Y. Zheng, X. Li, L. Miao, L. Cai, Angiotensin II plays a critical role in diabetic
pulmonary fibrosis most likely via activation of NADPH oxidase-mediated
nitrosative damage, Am. J. Physiol. Endocrinol. Metab. 301 (2011) E132–E144.
[11] D. Pitocco, L. Fuso, E.G. Conte, F. Zaccardi, C. Condoluci, G. Scavone, R.A. Incalzi,
G. Ghirlanda, The diabetic lung–a new target organ?, Rev. Diabet. Stud. 9 (2012)
23–35.
[12] J. Wu, Z. Jin, H. Zheng, L.J. Yan, Sources and implications of NADH/NAD(+)
redox imbalance in diabetes and its complications, Diabetes Metab. Syndr. Obes. 9
(2016) 145–153.
[13] D.M. Boesten, S.N. von Ungern-Sternberg, G.J. den Hartog, A. Bast, Protective
pleiotropic effect of flavonoids on nad(+) levels in endothelial cells exposed to high
glucose, Oxid. Med Cell Longev. 2015 (2015) 894597.
[14] W.H. Tang, K.A. Martin, J. Hwa, Aldose reductase, oxidative stress, and diabetic
mellitus, Front Pharm. 3 (2012) 87.
[15] M. Masutani, H. Suzuki, N. Kamada, M. Watanabe, O. Ueda, T. Nozaki, K. Jishage,
T. Watanabe, T. Sugimoto, H. Nakagama, T. Ochiya, T. Sugimura, Poly(ADP-
ribose) polymerase gene disruption conferred mice resistant to streptozotocin-
induced diabetes, Proc. Natl. Acad. Sci. USA 96 (1999) 2301–2304.
[16] A.A. Pieper, D.J. Brat, D.K. Krug, C.C. Watkins, A. Gupta, S. Blackshaw, A. Verma,
Z.Q. Wang, S.H. Snyder, Poly(ADP-ribose) polymerase-deficient mice are pro-
tected from streptozotocin-induced diabetes, Proc. Natl. Acad. Sci. USA 96 (1999)
3059–3064.
[17] P.F. Kador, J.H. Kinoshita, Role of aldose reductase in the development of
58
Redox Biology 11 (2017) 51–59
diabetes-associated complications, Am. J. Med 79 (1985) 8–12.
[18] C. Yabe-Nishimura, Aldose reductase in glucose toxicity: a potential target for the
prevention of diabetic complications, Pharm. Rev. 50 (1998) 21–33.
[19] A.D. Hodgkinson, K.L. Sondergaard, B. Yang, D.F. Cross, B.A. Millward,
A.G. Demaine, Aldose reductase expression is induced by hyperglycemia in
diabetic nephropathy, Kidney Int. 60 (2001) 211–218.
[20] I.G. Obrosova, V.R. Drel, P. Pacher, O. Ilnytska, Z.Q. Wang, M.J. Stevens,
M.A. Yorek, Oxidative-nitrosative stress and poly(ADP-ribose) polymerase
(PARP) activation in experimental diabetic neuropathy: the relation is revisited,
Diabetes 54 (2005) 3435–3441.
[21] C. Szabo, A. Zanchi, K. Komjati, P. Pacher, A.S. Krolewski, W.C. Quist,
F.W. LoGerfo, E.S. Horton, A. Veves, Poly(ADP-Ribose) polymerase is activated in
subjects at risk of developing type 2 diabetes and is associated with impaired
vascular reactivity, Circulation 106 (2002) 2680–2686.
[22] P. Puthanveetil, D. Zhang, Y. Wang, F. Wang, A. Wan, A. Abrahani, B. Rodrigues,
Diabetes triggers a PARP1 mediated death pathway in the heart through
participation of FoxO1, J. Mol. Cell Cardiol. 53 (2012) 677–686.
[23] L. Mouchiroud, R.H. Houtkooper, J. Auwerx, NAD(+) metabolism: a therapeutic
target for age-related metabolic disease, Crit. Rev. Biochem. Mol. Biol. 48 (2013)
397–408.
[24] L.J. Yan, Pathogenesis of Chronic Hyperglycemia: from Reductive Stress to
Oxidative Stress, J. Diabetes Res 2014 (2014) 137919.
[25] M.J. Jackson, S. Papa, J. Bolanos, R. Bruckdorfer, H. Carlsen, R.M. Elliott,
J. Flier, H.R. Griffiths, S. Heales, B. Holst, M. Lorusso, E. Lund, J. Oivind
Moskaug, U. Moser, M. Di Paola, M.C. Polidori, A. Signorile, W. Stahl, J. Vina-
Ribes, S.B. Astley, Antioxidants, reactive oxygen and nitrogen species, gene
induction and mitochondrial function, Mol. Asp. Med 23 (2002) 209–285.
[26] M.P. Murphy, How mitochondria produce reactive oxygen species, Biochem J. 417
(2009) 1–13.
[27] Z. Jin, J. Wu, L.J. Yan, Chemical Conditioning as an Approach to Ischemic Stroke
Tolerance: Mitochondria as the Target, Int J. Mol. Sci. 17 (2016).
[28] C. Koliaki, M. Roden, Alterations of Mitochondrial Function and Insulin
Sensitivity in Human Obesity and Diabetes Mellitus, Annu Rev. Nutr. (2016).
[29] M.S. Patel, N.N. Vettakkorumakankav, T.C. Liu, Dihydrolipoamide dehydrogen-
ase: activity assays, Methods Enzym. 252 (1995) 186–195.
[30] M.S. Patel, Y.S. Hong, Lipoic acid as an antioxidant: the role of dihydrolipoamide
dehydrogenase, in: D. Armstrong (Ed.)Free Radical and Antioxidant Protocols,
Humana Press, Totowa, NJ, 1998, pp. 337–346.
[31] J. Wu, X. Luo, L.J. Yan, Two dimensional blue native/SDS-PAGE to identify
mitochondrial complex I subunits modified by 4-hydroxynonenal (HNE), Front.
Physiol. 6 (2015).
[32] A. Navarro, C. Gomez, J.M. Lopez-Cepero, A. Boveris, Beneficial effects of
moderate exercise on mice aging: survival, behavior, oxidative stress, and
mitochondrial electron transfer, Am. J. Physiol. Regul. Integr. Comp. Physiol. 286
(2004) R505–R511.
[33] M. Zhou, Z. Diwu, N. Panchuk-Voloshina, R.P. Haugland, A stable nonfluorescent
derivative of resorufin for the fluorometric determination of trace hydrogen
peroxide: applications in detecting the activity of phagocyte NADPH oxidase and
other oxidases, Anal. Biochem 253 (1997) 162–168.
[34] L.J. Yan, Analysis of oxidative modification of proteins, Curr. Protoc. Protein Sci.
Chapter 14 (2009) (Unit14 14).
[35] S.M. Bagnasco, S. Uchida, R.S. Balaban, P.F. Kador, M.B. Burg, Induction of
aldose reductase and sorbitol in renal inner medullary cells by elevated extra-
cellular NaCl, Proc. Natl. Acad. Sci. USA 84 (1987) 1718–1720.
[36] L.J. Yan, S.H. Yang, H. Shu, L. Prokai, M.J. Forster, Histochemical staining and
quantification of dihydrolipoamide dehydrogenase diaphorase activity using blue
native PAGE, Electrophoresis 28 (2007) 1036–1045.
[37] L.J. Yan, N. Thangthaeng, M.J. Forster, Changes in dihydrolipoamide dehydro-
genase expression and activity during postnatal development and aging in the rat
brain, Mech. Ageing Dev. 129 (2008) 282–290.
[38] L.J. Yan, M.J. Forster, Resolving mitochondrial protein complexes using non-
gradient blue native polyacrylamide gel electrophoresis, Anal. Biochem. 389
(2009) 143–149.
[39] M.K. Tripathy, D. Mitra, Differential modulation of mitochondrial OXPHOS
system during HIV-1 induced T-cell apoptosis: up regulation of Complex-IV
subunit COX-II and its possible implications, Apoptosis 15 (2010) 28–40.
[40] A.M. Gusdon, T.V. Votyakova, I.J. Reynolds, C.E. Mathews, Nuclear and
mitochondrial interaction involving mt-Nd2 leads to increased mitochondrial
reactive oxygen species production, J. Biol. Chem. 282 (2007) 5171–5179.
[41] C. Lind, E. Cadenas, P. Hochstein, L. Ernster, DT-diaphorase: purification,
properties, and function, Methods Enzym. 186 (1990) 287–301.
[42] L.J. Yan, E.S. Christians, L. Liu, X. Xiao, R.S. Sohal, I.J. Benjamin, Mouse heat
shock transcription factor 1 deficiency alters cardiac redox homeostasis and
increases mitochondrial oxidative damage, EMBO J. 21 (2002) 5164–5172.
[43] L.J. Yan, R.L. Levine, R.S. Sohal, Oxidative damage during aging targets
mitochondrial aconitase, Proc. Natl. Acad. Sci. USA 94 (1997) 11168–11172.
[44] L.J. Yan, W.C. Orr, R.S. Sohal, Identification of oxidized proteins based on sodium
dodecyl sulfate-polyacrylamide gel electrophoresis, immunochemical detection,
isoelectric focusing, and microsequencing, Anal. Biochem. 263 (1998) 67–71.
[45] T.F. Ng, F.K. Lee, Z.T. Song, N.A. Calcutt, A.Y. Lee, S.S. Chung, S.K. Chung,
Effects of sorbitol dehydrogenase deficiency on nerve conduction in experimental
diabetic mice, Diabetes 47 (1998) 961–966.
[46] A.Y. Lee, S.S. Chung, Contributions of polyol pathway to oxidative stress in
diabetic cataract, FASEB J. 13 (1999) 23–30.
[47] P. Pacher, C. Szabo, Role of poly(ADP-ribose) polymerase-1 activation in the
pathogenesis of diabetic complications: endothelial dysfunction, as a common
underlying theme, Antioxid. Redox Signal 7 (2005) 1568–1580.
[48] C. Szabo, Roles of poly(ADP-ribose) polymerase activation in the pathogenesis of
diabetes mellitus and its complications, Pharm. Res. 52 (2005) 60–71.
[49] S.S. Chung, S.K. Chung, Aldose reductase in diabetic microvascular complications,
Curr. Drug Targets 6 (2005) 475–486.
J. Wu et al.
[50] M. Kirsch, H. De Groot, NAD(P)H, a directly operating antioxidant?, FASEB J. 15
(2001) 1569–1574.
[51] T. Sato, H. Sasaki, R. Watanabe, K. Yoshinaga, Enhancement of pentose
phosphate pathway in vascular intima from diabetic rabbit, Tohoku J. Exp. Med.
155 (1988) 97–100.
[52] M.M. Wamelink, E.A. Struys, C. Jakobs, The biochemistry, metabolism and
inherited defects of the pentose phosphate pathway: a review, J. Inherit. Metab.
Dis. 31 (2008) 703–717.
[53] S.K. Panigrahy, R. Bhatt, A. Kumar, Reactive oxygen species: sources, conse-
quences and targeted therapy in type-II diabetes, J. Drug Target (2016) 1–36.
[54] L. Baird, A.T. Dinkova-Kostova, The cytoprotective role of the Keap1-Nrf2
pathway, Arch. Toxicol. 85 (2011) 241–272.
[55] J.R. Treberg, C.L. Quinlan, M.D. Brand, Evidence for two sites of superoxide
production by mitochondrial NADH-ubiquinone oxidoreductase (complex I), J.
Biol. Chem. 286 (2011) 27103–27110.
[56] J.M. Cooper, V.M. Mann, D. Krige, A.H. Schapira, Human mitochondrial complex
I dysfunction, Biochim Biophys. Acta 1101 (1992) 198–203.
[57] D. Kraus, Q. Yang, D. Kong, A.S. Banks, L. Zhang, J.T. Rodgers, E. Pirinen,
T.C. Pulinilkunnil, F. Gong, Y.C. Wang, Y. Cen, A.A. Sauve, J.M. Asara,
O.D. Peroni, B.P. Monia, S. Bhanot, L. Alhonen, P. Puigserver, B.B. Kahn,
Nicotinamide N-methyltransferase knockdown protects against diet-induced
obesity, Nature 508 (2014) 258–262.
[58] R.B. Parsons, S. Aravindan, A. Kadampeswaran, E.A. Evans, K.K. Sandhu,
E.R. Levy, M.G. Thomas, B.M. Austen, D.B. Ramsden, The expression of
nicotinamide N-methyltransferase increases ATP synthesis and protects SH-SY5Y
neuroblastoma cells against the toxicity of complex I inhibitors, Biochem. J. 436
(2011) 145–155.
[59] Z.H. Milani, D.B. Ramsden, R.B. Parsons, Neuroprotective effects of nicotinamide
N-methyltransferase and its metabolite 1-methylnicotinamide, J. Biochem. Mol.
Toxicol. 27 (2013) 451–456.
[60] L.J. Yan, N. Thangthaeng, N. Sumien, M.J. Forster, Serum dihydrolipoamide
dehydrogenase Is a labile enzyme, J. Biochem. Pharm. Res. 1 (2013) 30–42.
[61] C.H. Williams Jr., Lipoamide dehydrogenase, glutathione reductase, thioredoxin
reductase, and mercuric ion reductase-a family of flavoenzyme transhydro-
genases, in: F. Muller (Ed.)Chemistry and Biochemistry of Flavoenzymes, CRC
Press, Boca Raton, 1992, pp. 121–212.
[62] G. Bajotto, T. Murakami, M. Nagasaki, Y. Sato, Y. Shimomura, Decreased enzyme
activity and contents of hepatic branched-chain alpha-keto acid dehydrogenase
complex subunits in a rat model for type 2 diabetes mellitus, Metabolism 58
(2009) 1489–1495.
[63] M.A. Moxley, D.A. Beard, J.N. Bazil, Global kinetic analysis of mammalian E3
reveals ph-dependent NAD+/NADH regulation, physiological kinetic reversibility,
and catalytic optimum, J. Biol. Chem. 291 (2016) 2712–2730.
[64] R.L. Levine, D. Garland, C.N. Oliver, A. Amici, I. Climent, A.G. Lenz, B.W. Ahn,
S. Shaltiel, E.R. Stadtman, Determination of carbonyl content in oxidatively
modified proteins, Methods Enzym. 186 (1990) 464–478.
[65] L.J. Yan, R.S. Sohal, Mitochondrial adenine nucleotide translocase is modified
oxidatively during aging, Proc. Natl. Acad. Sci. USA 95 (1998) 12896–12901.
[66] S. Vedantham, D. Thiagarajan, R. Ananthakrishnan, L. Wang, R. Rosario,
Y.S. Zou, I. Goldberg, S.F. Yan, A.M. Schmidt, R. Ramasamy, Aldose reductase
drives hyperacetylation of Egr-1 in hyperglycemia and consequent upregulation of
proinflammatory and prothrombotic signals, Diabetes 63 (2014) 761–774.
[67] B.J. Morris, Seven sirtuins for seven deadly diseases of aging, Free Radic. Biol.
Med. 56 (2013) 133–171.
[68] A.T. Dinkova-Kostova, P. Talalay, NAD(P)H: quinone acceptor oxidoreductase 1
(NQO1), a multifunctional antioxidant enzyme and exceptionally versatile cyto-
protector, Arch. Biochem Biophys. 501 (2010) 116–123.
[69] T.M. Jaokar, D.P. Patil, Y.S. Shouche, S.M. Gaikwad, C.G. Suresh, Human
mitochondrial NDUFS3 protein bearing Leigh syndrome mutation is more prone
to aggregation than its wild-type, Biochimie 95 (2013) 2392–2403.
[70] M.D. Hirschey, T. Shimazu, E. Jing, C.A. Grueter, A.M. Collins, B. Aouizerat,
A. Stancakova, E. Goetzman, M.M. Lam, B. Schwer, R.D. Stevens,
M.J. Muehlbauer, S. Kakar, N.M. Bass, J. Kuusisto, M. Laakso, F.W. Alt,
C.B. Newgard, R.V. Farese Jr., C.R. Kahn, E. Verdin, SIRT3 deficiency and
mitochondrial protein hyperacetylation accelerate the development of the meta-
bolic syndrome, Mol. Cell 44 (2011) 177–190.
[71] J. Hirst, M.S. King, K.R. Pryde, The production of reactive oxygen species by
complex I, Biochem Soc. Trans. 36 (2008) 976–980.
[72] X. Luo, R. Li, L.J. Yan, Roles of pyruvate, NADH, and mitochondrial complex I in
redox balance and imbalance in β cell function and dysfunction, J. Diabetes Res.
2015 (2015). http://dx.doi.org/10.1155/2015/512618.
[73] Y. Xu, B.W. Osborne, R.C. Stanton, Diabetes causes inhibition of glucose-6-
phosphate dehydrogenase via activation of PKA, which contributes to oxidative
stress in rat kidney cortex, Am. J. Physiol. Ren. Physiol. 289 (2005)
F1040–F1047.
[74] N.N. Ulusu, M. Sahilli, A. Avci, O. Canbolat, G. Ozansoy, N. Ari, M. Bali, M. Stefek,
S. Stolc, A. Gajdosik, C. Karasu, Pentose phosphate pathway, glutathione-
dependent enzymes and antioxidant defense during oxidative stress in diabetic
rodent brain and peripheral organs: effects of stobadine and vitamin E,
Neurochem. Res. 28 (2003) 815–823.
[75] R.S. Gupte, B.C. Floyd, M. Kozicky, S. George, Z.I. Ungvari, V. Neito, M.S. Wolin,
S.A. Gupte, Synergistic activation of glucose-6-phosphate dehydrogenase and
NAD(P)H oxidase by Src kinase elevates superoxide in type 2 diabetic, Zucker fa/
59
Redox Biology 11 (2017) 51–59
fa, rat liver, Free Radic. Biol. Med 47 (2009) 219–228.
[76] Y. Ido, J.R. Nyengaard, K. Chang, R.G. Tilton, C. Kilo, B.L. Mylari, P.J. Oates,
J.R. Williamson, Early neural and vascular dysfunctions in diabetic rats are largely
sequelae of increased sorbitol oxidation, Antioxid. Redox Signal 12 (2010) 39–51.
[77] I.G. Obrosova, Increased sorbitol pathway activity generates oxidative stress in
tissue sites for diabetic complications, Antioxid. Redox Signal 7 (2005)
1543–1552.
[78] J.R. Williamson, Y. Ido, Linking diabetic complications to sorbitol oxidation,
oxidative stress and metabolic suppression, J. Diabetes Metab. 3 (2012) 1000219.
[79] B.J. Sander, F.J. Oelshlegel Jr., G.J. Brewer, Quantitative analysis of pyridine
nucleotides in red blood cells: a single-step extraction procedure, Anal. Biochem.
71 (1976) 29–36.
[80] A.K. Jaiswal, Nrf2 signaling in coordinated activation of antioxidant gene
expression, Free Radic. Biol. Med 36 (2004) 1199–1207.
[81] S. Gao, Z. Yang, R. Shi, D. Xu, H. Li, Z. Xia, Q.P. Wu, S. Yao, T. Wang, S. Yuan,
Diabetes blocks the cardioprotective effects of sevoflurane postconditioning by
impairing Nrf2/Brg1/HO-1 signaling, Eur. J. Pharm. 779 (2016) 111–121.
[82] E. Bhakkiyalakshmi, D. Sireesh, M. Sakthivadivel, S. Sivasubramanian,
P. Gunasekaran, K.M. Ramkumar, Anti-hyperlipidemic and anti-peroxidative role
of pterostilbene via Nrf2 signaling in experimental diabetes, Eur. J. Pharm. 777
(2016) 9–16.
[83] X. Zhou, Y. Feng, Z. Zhan, J. Chen, Hydrogen sulfide alleviates diabetic
nephropathy in a streptozotocin-induced diabetic rat model, J. Biol. Chem. 289
(2014) 28827–28834.
[84] E.B. Tahara, M.H. Barros, G.A. Oliveira, L.E. Netto, A.J. Kowaltowski,
Dihydrolipoyl dehydrogenase as a source of reactive oxygen species inhibited by
caloric restriction and involved in Saccharomyces cerevisiae aging, FASEB J. 21
(2007) 274–283.
[85] Y. Bando, K. Aki, Mechanisms of generation of oxygen radicals and reductive
mobilization of ferritin iron by lipoamide dehydrogenase, J. Biochem. 109 (1991)
450–454.
[86] A.V. Kareyeva, V.G. Grivennikova, G. Cecchini, A.D. Vinogradov, Molecular
identification of the enzyme responsible for the mitochondrial NADH-supported
ammonium-dependent hydrogen peroxide production, FEBS Lett. 585 (2011)
385–389.
[87] S. Ide, T. Hayakawa, K. Okabe, M. Koike, Lipoamide dehydrogenase from human
liver, J. Biol. Chem. 242 (1967) 54–60.
[88] E.M. Sol, S.A. Wagner, B.T. Weinert, A. Kumar, H.S. Kim, C.X. Deng,
C. Choudhary, Proteomic investigations of lysine acetylation identify diverse
substrates of mitochondrial deacetylase sirt3, PLoS One 7 (2012) e50545.
[89] H. Kosanam, K. Thai, Y. Zhang, A. Advani, K. Connelly, E.P. Diamandis,
R.E. Gilbert, iabetes induces lysine acetylation of intermediary metabolism
enzymes in the kidney, Diabetes 63 (2014) 2432–2439.
[90] M.J. Rardin, J.C. Newman, J.M. Held, M.P. Cusack, D.J. Sorensen, B. Li,
B. Schilling, S.D. Mooney, C.R. Kahn, E. Verdin, B.W. Gibson, Label-free
quantitative proteomics of the lysine acetylome in mitochondria identifies
substrates of SIRT3 in metabolic pathways, Proc. Natl. Acad. Sci. USA 110 (2013)
6601–6606.
[91] E.J. Vazquez, J.M. Berthiaume, V. Kamath, O. Achike, E. Buchanan,
M.M. Montano, M.P. Chandler, M. Miyagi, M.G. Rosca, Mitochondrial complex I
defect and increased fatty acid oxidation enhance protein lysine acetylation in the
diabetic heart, Cardiovasc. Res. 107 (2015) 453–465.
[92] W.K. Paik, D. Pearson, H.W. Lee, S. Kim, Nonenzymatic acetylation of histones
with acetyl-CoA, Biochim Biophys. Acta 213 (1970) 513–522.
[93] G. Ramponi, G. Manao, G. Camici, Nonenzymatic acetylation of histones with
acetyl phosphate and acetyl adenylate, Biochemistry 14 (1975) 2681–2685.
[94] E. Verdin, M. Ott, 50 years of protein acetylation: from gene regulation to
epigenetics, metabolism and beyond, Nat. Rev. Mol. Cell Biol. 16 (2015) 258–264.
[95] E. Jing, B. Emanuelli, M.D. Hirschey, J. Boucher, K.Y. Lee, D. Lombard,
E.M. Verdin, C.R. Kahn, Sirtuin-3 (Sirt3) regulates skeletal muscle metabolism
and insulin signaling via altered mitochondrial oxidation and reactive oxygen
species production, Proc. Natl. Acad. Sci. USA 108 (2011) 14608–14613.
[96] X. Hou, H. Zeng, X. He, J.X. Chen, Sirt3 is essential for apelin-induced
angiogenesis in post-myocardial infarction of diabetes, J. Cell Mol. Med. 19
(2015) 53–61.
[97] P.W. Caton, S.J. Richardson, J. Kieswich, M. Bugliani, M.L. Holland, P. Marchetti,
N.G. Morgan, M.M. Yaqoob, M.J. Holness, M.C. Sugden, Sirtuin 3 regulates
mouse pancreatic beta cell function and is suppressed in pancreatic islets isolated
from human type 2 diabetic patients, Diabetologia 56 (2013) 1068–1077.
[98] K. Turkmen, A. Karagoz, A. Kucuk, Sirtuins as novel players in the pathogenesis of
diabetes mellitus, World J. Diabetes 5 (2014) 894–900.
[99] I.G. Obrosova, M.J. Stevens, H.J. Lang, Diabetes-induced changes in retinal NAD-
redox status: pharmacological modulation and implications for pathogenesis of
diabetic retinopathy, Pharmacology 62 (2001) 172–180.
[100] C. Canto, R.H. Houtkooper, E. Pirinen, D.Y. Youn, M.H. Oosterveer, Y. Cen,
P.J. Fernandez-Marcos, H. Yamamoto, P.A. Andreux, P. Cettour-Rose,
K. Gademann, C. Rinsch, K. Schoonjans, A.A. Sauve, J. Auwerx, The NAD(+)
precursor nicotinamide riboside enhances oxidative metabolism and protects
against high-fat diet-induced obesity, Cell Metab. 15 (2012) 838–847.
[101] J. Camacho-Pereira, M.G. Tarrago, C.C. Chini, V. Nin, C. Escande, G.M. Warner,
A.S. Puranik, R.A. Schoon, J.M. Reid, A. Galina, E.N. Chini, CD38 dictates Age-
Related NAD Decline and mitochondrial dysfunction through an SIRT3-depen-
dent mechanism, Cell Metab. 23 (2016) 1127–1139.
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60

REVIEW ARTICLE Open Access

Review of the mechanism of cell death resulting

from streptozotocin challenge in experimental
animals, its practical use and potential risk
to humans
Chinedum Ogbonnaya Eleazu1*, Kate Chinedum Eleazu2, Sonia Chukwuma1 and Udeme Nelson Essien2

Abstract
Streptozotocin (STZ) (2-deoxy-2-({[methyl(nitroso)amino]carbonyl}amino)-β-D-glucopyranose) is a naturally occurring
diabetogenic compound, produced by the soil bacterium streptomyces achromogenes, that exhibits broad spectrum of
antibacterial properties. Streptozotocin functions as a DNA synthesis inhibitor in both bacterial and mammalian cells. In
mammalian cells, the actual mechanism and metabolic targets of STZ toxicity that results in cell death is not known. This
review identifies four key areas that explain the mechanism of the cytotoxicity of STZ in mammalian cell lines, investigates
the practical aspects of using STZ in experimental animals and the potential risks of its exposure to human health.
Keywords: Streptozotocin, Animals, Diabetes, Humans, Cell death

Introduction
Streptozotocin (STZ) (2-deoxy-2-(3-methyl-3-nitrosourea)-
1-D-glucopyranose) is a naturally occurring compound,
produced by the soil bacterium streptomyces achromogenes,
that exhibits broad spectrum of antibacterial properties [1].
It is a mixture of α- and β-stereoisomers that appear as
pale yellow or off-white crystalline powder.
In terms of solubility, it is very soluble in water, ketones
and lower alcohols, but slightly soluble in polar organic
solvents [2]. Streptozotocin has a molecular formula of
C8H15N3O7, molecular weight of 265 g/mol and the struc-
ture is composed of nitrosourea moiety with a methyl
group attached at one end and a glucose molecule at the
other end [1].
STZ is a cytotoxic glucose analogue. After its discovery,
it was being used as a chemotherapeutic alkylating agent
in the treatment of metastasizing pancreatic islet cell tu-
mors and other malignancies [3].
In the year 1963, Rakieten and colleagues reported
that STZ is diabetogenic [4]. From that time of discovery
* Correspondence: eleazon@yahoo.com
1
Department of Biochemistry, National Root Crops Research Institute,
Umudike, Umuahia, Abia State, Nigeria
Full list of author information is available at the end of the article
till date, STZ has been one of the chemical agents for
the induction of diabetes in experimental animals [5].
Streptozotocin functions as a DNA synthesis inhibitor
in both bacterial and mammalian cells [6]. In bacterial
cells, a specific interaction with cytosine moieties leads to
the degradation of the bacterial DNA [7]. Streptozotocin
is cytotoxic to pancreatic β-cells and its effects can be seen
within seventy two hours after administration depending
on the dose administered [8].
In mammalian cells, the mechanism of action of STZ
that results in cell death was not fully identified, though
it was thought to be a result of DNA and chromosomal
damage brought forth by mechanisms involving free rad-
ical generation during STZ metabolism [6]. However, after
several years of research, the mechanism of action of STZ
that results in cell death has been elucidated. The chem-
ical properties of STZ are presented as follows:
A. It is a cytotoxic methyl nitrosourea moiety
(N-methyl-N-nitrosourea) attached to the glucose
(2-deoxyglucose) molecule.
B. It is a glucosamine derivative
C. It is a toxic beta cell glucose analogue
D. It is a hydrophilic compound
E. It is an alkylating agent

© 2013 Eleazu et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication
waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise
stated.
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
F. STZ is a toxic glucose (Glu) and N-acetyl glucosamine
(GlcNAc) analogue that is accumulated preferentially in
pancreatic β-cells via GLUT 2 transporter uptake [9].
G. It is relatively stable at pH 7.4 and 37°C at least for
up to I hr [10].
H. It has a biological half life of 5–15 minutes [11,12]
I. When reconstituted into a solution, it can be stored
at room temperature or refrigerator but must be
used within 12 hrs if stored at room temperature
and protected from sunlight.
Elucidation of the diabetogenic action of STZ
STZ induces diabetes in rats, mice, monkeys, hamsters,
rabbits and guinea pigs. The toxic action of STZ involves
its uptake into cells. Although nitrosourea compounds are
usually lipophilic which makes their uptake by cells very
quick, STZ on the contrary is a hydrophilic compound
due to hexose substitution which limits its uptake by cells.
The selective pancreatic beta cell toxicity and diabetic
condition, resulting from STZ induction, is related to
the glucose moiety in its chemical structure which en-
ables STZ to enter the beta cell via the low affinity glu-
cose 2 transporter in the plasma membrane [13] because
the β-cells of the pancreas are more active than other
cells in taking up glucose and so are more sensitive than
other cells to STZ challenge. This statement is validated
by the observation that insulin producing cells that do
not express this glucose transporter are resistant to STZ
toxicity [13] and only become vulnerable to the toxicity
of this compound after expression of the GLUT 2 trans-
porter protein in the plasma membrane [13]. Moreover,
other cells that express this GLUT 2 transporter such as
the hepatocytes and the renal tubular cells are also suscep-
tible to STZ. This explains why experimental animals,
inducted with STZ, tend to have renal and liver damage
[5,14]. In addition, non beta cells such as: α-cells as well as
the extra-pancreatic parenchyma remain intact after STZ
challenge, indicating the beta cell selective properties of
STZ [3]. STZ also causes cardiac and adipose tissue dam-
age and increases oxidative stress, inflammation, endothe-
lial dysfunction [15] with the concentrations of the drug or
its metabolites in the liver, kidney, intestine and pancreas
being consistently higher than those in the plasma.
STZ does not affect the pancreatic beta cells of humans
when used in the treatment of islet-cell carcinomas and
malignant carcinoid tumors in humans [1]. This resistance
of the human beta cells to STZ is attributed to the very
low level of the constitutive GLUT 2 transporter expres-
sion in the human beta cell [16-20].
Biochemical basis of the cytotoxicity of STZ that results in
cell death (apoptosis/necrosis)
STZ is a structural analogue of glucose (Glu) and N-
acetyl glucosamine (GlcNAc) (Figure 1). STZ is taken up
Page 2 of 7
by pancreatic β-cells via the GLUT 2 transporter where
it causes β-cell death by DNA fragmentation due to the
nitrosourea moiety as earlier mentioned. Three major
pathways associated with cell death are: (i) DNA methy-
lation through the formation of carbonium ion (CH3+)
resulting in the activation of the nuclear enzyme poly
ADP-ribose synthetase as part of the cell repair mechan-
ism and consequently, NAD+ depletion; (ii) Nitric oxide
production (iii) Free radical generation as hydrogen per-
oxide [9,21].
Methylation of DNA
The DNA methylating activity of the methylnitrosourea
moiety of STZ [22], especially at the O6 position of
guanine, leading to DNA damage with resultant necrosis
of the pancreatic beta cells, through the depletion of cel-
lular energy stores, is one explanation for the cell death
that results from STZ induction. The resultant activation
of polyADP-ribose polymerase (PARP), in an attempt to
repair the damaged DNA, depletes the cellular NAD+
and consequently, ATP stores as a result of overstimula-
tion of DNA repair mechanisms [23]. Although STZ also
methylates proteins, this DNA methylation is most re-
sponsible for beta cell death, though STZ methylation of
proteins could also contribute to its toxicity to the beta
pancreatic cells.
In addition, inhibitors of this poly ADP ribose poly-
merase such as nicotinamide, inhibit the methylation of
DNA by STZ. For example, administration of nicotinamide
prior to the induction of STZ in experimental rats, protects
the pancreatic cells from the toxic actions of STZ as well
as prevents the development of a diabetic state [24]. STZ
could also react at other sites of DNA such as the ring ni-
trogen and exocyclic oxygen atoms of DNA bases, pre-
dominantly producing 7-methylguanine, 3-methyladenine
which leads to DNA breaks, activates poly-ADP-ribose
polymerase and subsequently depletes NAD+.
Nitric oxide (NO) production
Another possible mechanism of the diabetogenic action of
streptozotocin that results in cell death has been attributed
to its ability to act as nitric oxide donor in pancreatic cells
[25] which inhibits aconitase activity, leading to DNA al-
kylation and damage [26]. Streptozotocin has been shown
to increase the activity of guanyl cyclase and the formation
of cGMP, which are characteristic actions of NO. β-cells
are particularly sensitive to damage by nitric oxide and free
radicals because of their low levels of free radical scaven-
ging enzymes [27].
Reactive Oxygen Species (ROS) Production in Oxidative Stress
Oxidative stress is defined as an imbalance between the
pro-oxidants and antioxidant defense system of the body
as a result of steady state reactive oxygen species. Oxidative
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
a CH2OH
b CH2OH
H O
H O H
OH
OH H
OH
OH OH
H NH
H OH
O O
d O
NO
H2N N
CH3
Figure 1 Structures of (a) glucose (b) N-acetyl glucosamine (c) Streptozotocin and (d) methylnitrosourea.
stress has recently been shown to be responsible, at least in
part, for pancreatic β-cell dysfunction caused by glucose
toxicity in hyperglycemia. Several reaction mechanisms are
thought to be involved in the genesis of oxidative stress in
both diabetic patients and diabetic animals and they in-
clude: glucose auto-oxidation, protein glycation, formation
of advanced glycation products and the polyol pathway
[28,29]. During these processes, ROS are produced and
cause tissue damage [30,31]. STZ treatment causes signifi-
cant increase in malonaldehyde but decreases antioxidant
enzymes such as: catalase, glutathione peroxidase and su-
peroxide dismutase activities when compared with control
animals in experiments. Decreases in antioxidant activities,
and simultaneous increases in malonaldehyde (MDA) ac-
tivities, indicate the susceptibility of pancreas to STZ’s in-
duction of oxidative stress [32,33].
One important involvement of ROS during STZ me-
tabolism is the production of uric acid as the final product
of ATP degradation by xanthine oxidase from hypoxan-
thine. This reaction generates ROS such as superoxide
and hydroxyl radicals emanating from H2O2 dismutation
during hypoxanthine metabolism, accelerating the process
of beta cell destruction. This is coupled with the fact that
the pancreatic beta cell is devoid of catalase and glutathi-
one peroxidase. The hydrogen peroxide subsequently gen-
erates free radicals such as O2- and OH-. These reactive
compounds can cause peroxidation of lipids, resulting
in the formation of hydroperoxy fatty acids and endo-
peroxides. This increases the formation of malonaldehyde
and thromboxane-B2 (TxB2). The accumulation of TxB2
along with thromboxane-A2 (TxA2) can cause platelet
Page 3 of 7
c CH2OH
H H O H
H OH H
OH OH OH
H NH
CH3 N N O
CH3
aggregation and promote thrombosis [34]. Increased ROS
production has also been reported to inhibit aconitase
which protects mitochondrial DNA (mtDNA) from deg-
radation [35].
Altered NF-κB (nuclear factor kappa-light-chain-enhancer of
activated B cells) based cell signaling
A fourth biochemical mechanism for the cytotoxicity of
STZ that results in cell death is through altered NF-κB
based cell signaling.
STZ selectively inhibits the activity of the glycoside
hydrolase O-GlcNAcase (enzyme O-GlcNAcase catalyzes
the cleavage of beta-O-linked GlcNAc (O-GlcNAc) from
modified proteins and is a member of the family 84 glyco-
side hydrolases) in the β-cell, which is responsible for re-
moving O-GlcNA from proteins. This causes irreversible
O-glycosylation of intracellular proteins resulting in β-cell
apoptosis [36,37]. STZ induces beta-cell dysfunction and
apoptosis at lower doses while causing beta-cell necrosis
at higher doses [38].
Doses (up to 15 mM) of STZ induce pancreatic beta-
cell death by inducing apoptosis followed by necrosis at
higher doses (up to 30 mM) [39]. Some other researchers
reported that STZ challenge (up to 20 mM) caused only
apoptotic cell death in other cellular systems [40]. In vitro
studies using insulin secreting insulinoma cells, keratino-
cytes and genetically engineered hepatocytes have also
shown that STZ (up to 20 mM) causes oxidative stress and
apoptosis [40].
However, the actual molecular mechanism and meta-
bolic targets of STZ toxicity in hepatocytes was not
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
known. The mechanism of antineoplastic action of STZ
in human hepatoma was also not clearly understood.
Using the mitochondrial dehydrogenase based cellular
viability MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-
tetrazolium bromide) assay to investigate the dose- and
time-dependent effects of STZ on human hepatoma
(HepG2 cells) in culture, Haider and Annie [38] showed
that STZ induced significant cell death after 48 h of in-
duction with 20 mM of the drug. They also reported
that 10 mM STZ resulted in about 40% cell death. At
this dose, HepG2 cells exhibit increased ROS and NO
production and an increase in lipid peroxidation. The in-
crease in oxidative stress was associated with increased
apoptosis of HepG2 cells as evidenced by an increase in
caspase-3 activity and reduction in the expression of
anti-apoptotic protein, Bcl-2. They further reported that
the increased oxidative stress, apoptosis and mitochondrial
dysfunction in human hepatoma (HepG2) cells might be
associated with altered NF-κB (nuclear factor kappa-light-
chain-enhancer of activated B cells, a protein complex that
controls the transcription of DNA found in all animal cell
types and is involved in cellular response to stimuli, free
radicals, oxidized LDL, bacterial or viral antigens) based
cell signaling as STZ increases the expression of iNOS (in-
ducible nitric oxide synthase) and translocation of NF-
κBp65 (RelA) transcription factor to the nucleus.
Practical aspects of using Streptozotocin in
experimental animals
Streptozotocin and induction of diabetes in animal species
STZ has proven to be a better diabetogenic agent than
alloxan with wider species effectiveness and greater re-
producibility. This could be attributed to the fact that
STZ is more stable in solution before and after injection
in animals than alloxan. In addition, alloxan causes a
decrease in hepatic glycogen within 24–72 hours, with
greater cytotoxicity due to its conversion to anionic radi-
cals [12] and pancreatic destruction, which insulin par-
tially reverses. Moreover, the STZ model mimics many
of the acute and chronic complications of human dia-
betes and given the established similarities of some of
the structural, functional and biochemical abnormalities
to human disease, it is an appropriate model to assess
the mechanism of diabetes.
When reconstituted into a solution, STZ can be stored
at room temperature or refrigerator but must be used
within 12 hrs if stored at room temperature and pro-
tected from sunlight. Due to streptozotocin’s alleged in-
stability in solution, the typical recommendation is to
administer it within 10 minutes after dissolution.
The American Diabetes Association [41] established an
etiologic classification of Diabetes mellitus and based on
their classification, four groups were proposed: 1) Type 1
(5–10%); 2) Type 2 (90–95%); 3) Other specific types and
Page 4 of 7
4) Gestational. Thus, STZ-induced diabetes belongs to the
category of other specific types or Drug (chemical) in-
duced diabetes. However, many researchers conclude that
STZ produces type I diabetes mellitus [42].
The type of diabetes induced by STZ is controversial
because STZ-hyperglycemia can be similar to either type
I or type II diabetes mellitus [42,43]. The dose of STZ
required for inducing diabetes depends on the animal
species, age of animal, route of administration, weight of
animal, nutritional status [44] and different responses to
xenobiotics. For injection in experimental animals and
for optimum results, it is best to be administered at fast-
ing state and freshly prepared, dissolved in citrate buffer
(pH 4.4-4.5).
Diabetogenic doses vary with species and the optimal
doses that have been reported to produce maximum dia-
betic conditions in various species are: rats (50 to 75 mg/kg
ip(intraperitoneal) [14,25,34,45,46], mice (175 to 200 mg/kg
ip or iv (intravenous) [11]; dogs (15 mg/kg for 3 days) [11].
At lower doses, STZ-induced diabetes is not stable, since
spontaneous recovery occurs.
In the study carried out by Ventura et al. [9], they re-
ported that a single high dose of 130 or 150 mg/kg bwt
or multiple doses of 40 mg/kg bwt produced hypergly-
cemia similar to type I diabetes and three administra-
tions of multiple low dose generated mild hyperglycemia
(250–450 mg/dl), that is similar to type II diabetes in ex-
perimental mice.
When administered intravenously, the binding of STZ
to its target site is completed within a short time and
plasma levels of STZ rapidly decrease within 15 minutes
and concentrate in the liver and kidneys [47,48]. As much
as twenty percent of the drug (or metabolites containing
an N-nitrosourea group) is metabolized and/or excreted
by the kidneys [48]. Thus the biochemical changes ob-
served after 15 minutes of STZ induction are secondary
changes and not due to a direct effect of STZ [5]. Compli-
cations from any toxic effect of streptozotocin were mini-
mized by carrying out the experiments four to five weeks
after the initial streptozotocin injection [45].
Some authors [8] described a triphasic response in blood
glucose after streptozotocin administration. According to
their study, in the first two hours of STZ challenge, blood
glucose rises. This transient hyperglycemia is due to sud-
den breakdown of liver glycogen. The second phase, start-
ing at about 6 hours after STZ dosing, is a hypoglycemic
one, which may be severe enough to lead to death. The
third phase, that of permanent hyperglycemia, begins at
about 10 to 12 hours after STZ administration. Structural
alterations in pancreatic beta cells (total degranulation)
occur within 48 h after the administration of streptozocin
and last for up to four months [12].
However, in the study carried out by Eleazu et al. [14]
and Adeghate and Ponery [49], they reported that the
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
destruction of the insulin secreting β-cells starts three
days post STZ administration, reaching its peak at 2 to
4 weeks in rats, leaving less active cells that result in a
diabetic state.
In clinical research studies investigating the ameliorat-
ing actions of some medicinal plants in diabetic animals
induced with STZ, its best to commence administration
of the test plants about two weeks post STZ induction
or about 11 days after initial hyperglycemic levels since
some animals have the ability to return to normogly-
cemic levels even after initial hyperglycemic levels. Thus
if such measures are not taken, one will not know if the
transformation to normoglycemic level is as a result of
the test plants administered or the animal’s ability to
withstand the initial STZ challenge.
Streptozotocin administration at fasting state
Researchers using diabetic animals for research employ
16–24 hours fasting, but this fasting brings about im-
portant changes. These changes tend to affect internal
cellular biochemistry and one should therefore expect
differences in the effects of preparations on isolated cells,
tissue or organs removed from animals that have, or have
not been fasted. Fasting has pronounced effects on clinical
chemistry analysts and hematology in diabetic animal
models. Hypoglycaemia for instance, is more pronounced
in fasted animals, therefore STZ should be administered
to fed animals to avoid mortalities [50].
Thus researchers using diabetic animal models for their
research should consider the effect of fasting for interpret-
ation of their results.
Although, one major reason for subjecting laboratory
animals to fasting before blood collection is to reduce
variability of some clinical chemistry parameters between
feeding and fasting conditions, intestinal physiologic func-
tions and drug-metabolizing enzymes may have some dif-
ference under feeding and fasting conditions. Thus, the
fasting in animals should be decided on a case by case
basis, rather than made uniform for every study.
Administration of 5% glucose solution during the first
24 hours following STZ injection has been reported to
prevent early mortalities [51,52].
The role of high fat diet (HFD) and low STZ dose in the
induction of type 2 diabetes
Injection of STZ (45 and 55 mg kg-1 intraperitoneally)
after 2 weeks of dietary manipulation has been reported
to cause hyperglycemia both in rats fed both normal pel-
let diet (NPD) and high fat diet [53]. Such rats were re-
ported to be insulin-deficient as compared to the normal
rats and exhibited a drastic reduction in the body weight
and some of them died within 2 weeks of STZ administra-
tion. In addition, insulinotropic (glipizide) and insulin-
sensitizing (pioglitazone) agents failed to alter the PGL
Page 5 of 7
in these fat-fed/STZ (45 and 55 mg kg−1) diabetic rats.
Thus, these fat-fed rats with high dose of STZ (45 and
55 mg kg−1) resembled more like type I diabetes. The
materialization of the disease pattern was achieved by
combining the feeding of HFD which produced insulin
resistance and low dose of STZ treatment that caused
the initial beta cell dysfunction and subsequently the
frank hyperglycemia (pre-diabetic state) in non-genetic,
out-bred Sprague–Dawley rats. The rats fed with high-
fat diet developed obesity, hyperinsulinemia, and insulin
resistance, thus limiting the screening of agents on con-
trolling the blood glucose level [53]. Interestingly, the in-
traperitoneal dose of STZ (35 mg/kg) that produced frank
hyperglycemia in HFD-fed rats failed to produce the same
in NPD-fed rats. The HFD rat model with low dose of
STZ (35 mg kg−1) was therefore considered by the authors
to represent the pathophysiological state of type 2 diabetes
as it was accompanied by marginal increase in body weight
in contrast to the catabolic loss of body weight, character-
istic of diabetic condition produced by high dose of STZ.
Streptozotocin and hypernociception
Neuropathy is the most common chronic complication
of diabetes mellitus. One of the most elusive symptoms
in diabetic neuropathy is pain, characterized by mechan-
ical and thermal hyperalgesia [54]. Hypernociception in-
duced by systemic STZ administration has been widely
used as an animal model of diabetic neuropathy.
The pathophysiology of painful diabetes neuropathy is
unclear, although it has been associated with impaired
peripheral nerve conduction and degeneration of myelin-
ated and unmyelinated fibers [55]. To provide information
on underlying mechanisms and to evaluate potential ther-
apies, experimental research on diabetic neuropathy is
usually carried out using genetic or chemically induced
diabetic animal models. A systemic administration of STZ
has been reported to induce hyperalgesia to thermal, mech-
anical and chemical stimuli [56]. STZ induced hyperalgesia
is frequently associated with hyperglycemia because in
some studies its development was prevented by insulin
treatment [57,58]. STZ induced hyperalgesia is frequently
associated with hyperglycemia because in some studies its
development was prevented by insulin treatment [58,59].
Although these studies suggest that STZ induces painful
diabetic neuropathy, it is important to point out that the
majority of studies evaluating STZ-induced hyperalgesia
only include animals rendered hyperglycemic [60]. In the
study carried out by Cunha and colleagues [59], they re-
ported that administration of high dose (40 mg/kg bwt)
and low dose (10 or 20 mg/kg bwt) of Streptozotocin
produced mechanical hypernociception in all the STZ
challenged rats whereas the low dose failed to produce
hyperglycemia, suggesting that some other factor other
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
than hyperglycemia could be involved in STZ-induced
mechanical hypernociception.
STZ: human toxicity and care in handling
The interaction with DNA and STZ’s ability to produce
cytotoxic effects in animals makes exposure to STZ a sig-
nificant health and safety threat to laboratory staff, animal
handlers, and other personnel who may be subjected to
accidental exposure. Due to this health and safety threat,
the Institutional Biosafety Committee (IBC) has classified
STZ as a reportable hazardous chemical that must be re-
ported on Institutional Animal Care and Use Committee
(IACUC) protocols.
Streptozotocin is anticipated to be a human carcinogen.
When administered intravenously, STZ has been shown
to induce tumors in rat kidney, liver and pancreas as earl-
ier mentioned in addition to neoplastic transformation in
primary human kidney cells at doses of 1 mM [61-63].
There are also speculations that STZ can lead to acute
complications such as: irritation, nausea, headache, vomit-
ing and chronic complications such as: reproductive disor-
ders, general deterioration of health as well as blindness if
in contact with the eyes.
Although there is no scientific evidence to validate such
claims, the International Agency for Research on Cancer
(IARC) emphasizes that STZ should be regarded for prac-
tical purposes as if it were carcinogenic to humans [64]
and as such, special care must be taken in preparing STZ
for practical use and one of such precautionary measure is
to prepare it inside a certified chemical fume hood.
Conclusion
The cytotoxicity of streptozotocin that results in death can
be explained on the basis of DNA methylation through the
formation of carbonium ion, resulting in the activation of
the nuclear enzyme poly ADP-ribose synthetase and con-
sequently, NAD+ depletion; Nitric oxide production, Free
radical generation as hydrogen peroxide generation and
through altered NF-κB based cell signal transduction path-
way. Although there is paucity of information on the car-
cinogenic effect of STZ on humans, when being used, it
should be regarded for practical purposes as if it were car-
cinogenic to humans. Finally, researchers using diabetic
animal models for their research should consider the effect
of fasting for the interpretation of their results.
Competing interest
The authors declare that they have no competing interests.
Authors’ contributions
The study was designed and implemented by ECO, EKC, CS and EU. All
authors read and approved the final manuscript.
Author details
1
Department of Biochemistry, National Root Crops Research Institute,
Umudike, Umuahia, Abia State, Nigeria. 2Department of Biochemistry, Michael
Okpara University of Agriculture, Umudike, Umuahia, Abia State, Nigeria.
Page 6 of 7
Received: 16 September 2013 Accepted: 5 November 2013
Published: 23 December 2013
References
1. Dolan ME: Inhibition of DNA repair as a means of increasing the antitumor
activity of DNA active agents. Adv Drug Del Rev 1997, 26:105–118.
2. Vivek KS: Streptozotocin: an experimental tool in diabetes and
alzheimer’s disease (A- Review). Int J Pharma Res Dev 2010, 2(1):1–7.
3. Lenzen S: Alloxan and streptozotocin diabetes. Diabetologia 2007, 51:216–226.
4. Rakieten L, Rakieten ML, Nadkarni MV: Studies on the diabetogenic action
of Streptozotocin (NSC-37917). Cancer Chem Rep 1963, 29:91–98.
5. Rerup CC: Drugs producing diabetes through damage of the insulin
secreting cells. Pharmacol Rev 1970, 22:485–518.
6. Bolzan AD, Bianchi MS: Genotoxicity of Streptozotocin. Mutat Res 2002,
512:121–134.
7. Reusser F: Mode of Action of Streptozotocin. J of Bact 1971, 105:580–588.
8. Junod A, Lambert AE, Orci L, Pictet R, Gonet AE, REnold AE: Studies of the
diabetogenic action of streptozotocin. Proc Soc Exp Biol Med 1967,
126:201–205.
9. Ventura-Sobrevilla J, Boone-Villa VD, Aguilar CN, Román-Ramos R, Vega-Ávila E,
Campos-Sepúlveda E, Alarcón-Aguilar F: Effect of Varying Dose and
Administration of Streptozotocin on Blood Sugar in Male CD1 Mice.
Proc West Pharmacol Soc 2011, 54:5–9.
10. Povoski SP, McCullough PJ, Zhou H, Bell RH: Induction of diabetes mellitus
in Syrian golden hamsters using stored equilibrium solutions of
Streptozotocin. Lab Animal Sci 1993, 43:310–314.
11. Sharma S, et al: Experimental Models of Diabetes. Int J Res Ayurveda and
Pharm 2010, 1(2):292–301.
12. Joo HL, Si HY, Jung MOH, Myung GL: Pharmacokinetics of drugs in rats
with diabetes mellitus induced by alloxan or streptozocin: comparison
with those in patients with type I diabetes mellitus. J Pharm Pharmacol
2010, 62:1–23.
13. Elsner M, Guldbakke B, Tiedge M, Munday R, Lenzen S: Relative importance of
transport and alkylation for pancreatic beta-cell toxicity of streptozotocin.
Diabetolgia 2007, 43:1528–1533.
14. Eleazu CO, Iroaganachi M, Eleazu KC: Ameliorative Potentials of Cocoyam
(Colocasia esculenta L.) and Unripe Plantain (Musa paradisiaca L.) on the
Relative Tissue Weights of Streptozotocin-Induced Diabetic Rats.
J Diabetes Res 2013a 2013, 2013(160964):8. doi:10.1155/2013/1609640.
15. Valentovic MA, Alejandro N, Betts CA, Brown PI, Ramos K: Streptozotocin
(STZ) diabetes enhances benzo(alpha)pyrene induced renal injury in
Sprague Dawley rats. Toxicol Lett 2006, 164:214–220.
16. Ferrer J, Benito C, Gomis R: Pancreatic islet GLUT 2 glucose transporter
mRNA and protein expression in humans with and without NIDDM.
Diabetes 1995, 44:1369–1374.
17. Koehn J, et al: Multiple drug resistance associated with function of
ABC-transporters in diabetes mellitus: molecular mechanism and clinical
relevance. Infect Disord Drug Targets 2008, 8:109–118.
18. Xie W, et al: A new tactic to treat postprandial hyperlipidemia in diabetic
rats with gastroparesis by improving gastrointestinal transit.
Eur J Pharmacol 2005, 510:113–120.
19. Loannides C: Chapter 12. Expression of cytochrome P450 protein in
disease. In Cytochrome P450. Metabolic and toxicological aspects. Boca
Raton, New York, London, Tokyo: CRC Press; 1996:301–327.
20. Ryan JP, Irwin JA: Practical studies on urine demonstrating principles of
clinical and veterinary significance. Biochem Mol Biol Educ 2002, 30:98–100.
21. Tesch GH, Allen TJ: Nephrology 2007, 12:261–266.
22. Murata M, Takahashi A, Saito L: Takanishi, S: Site-specific DNA methylation
and apoptosis: induction by diabetogenic streptozotocin.
Biochem Pharmacol 1999, 57:881–887.
23. Piepper AA, Verma A, Zhang J, Snyder SH: Poly (ADP-ribose) polymerase,
nitric oxide and cell death. Trends Pharmacol Sci 1999, 20:171–181.
24. Stauffacher W, Burr I, Gutzeit I, Beaven D, Veleminsky J, Renold AE:
Streptozotocin diabetes: time course of irreversible β-cell damage;
further observations on prevention by nicotinamide. Proc Soc Exp Biol Med
1970, 133:194–200.
25. Som NS, Praveen V, Shoba S, Radhey S, Kumria MML, Ranganathan S,
Sridharan K: Effect of an anti-diabetic extract of Catharanthus roseus on
enzymic activities in streptozotocin induced diabetic rats.
J Ethnopharmacol 2001, 76:269–277.
Eleazu et al. Journal of Diabetes & Metabolic Disorders 2013, 12:60
http://www.jdmdonline.com/content/12/1/60
26. Friederich M, Hansell P, Palm F: Diabetes, oxidative stress, nitric oxide and
mitochondria function. Curr Diabetes Rev 2009, 5:120–144.
27. Spinas GA: The dual role of nitric oxide in islets β-cells. News Physiol Sci
1999, 14:49–54.
28. Atalay M, Laaksonen DE: Diabetes, oxidative stress and physical exercise.
J Sports Sci & Med 2002, 1:1–14.
29. West IC: Radicals and oxidative stress in diabetes. Diabet Med 2000,
7:171–180.
30. Hunt JV, Smith CC, Wolff SP: Auto-oxidative glycosylation and possible
involvement of peroxides and free radicals in LDL modification by
glucose. Diabetes 1990, 39:1420–1424.
31. Matsuoka T, Kajimoto Y, Watada H, Kaneto H, Kishimoto M, Umayahara Y,
Fujitani Y, Kamada T, Kawamori R, Yamasaki Y: Glycation-dependent,
reactive oxygen species-mediated suppression of the insulin gene
promoter activity in HIT cells. J Clin Invest 1998, 99:144–150.
32. Gul M, Laaksonen DE, Atalay M, Vider L, Hannien O: Effects of endurance
training on tissue glutathione homoestasis and lipid peroxidation in
streptozotocin-induced diabetic rats. Scand J Med Sci Sports 2002,
12:163–170.
33. Henriksen EJ: Invited review: Effects of acute exercise and exercise
training on insulin resistance. J Appl Physiol 2002, 93:788–796.
34. Pushparaj P, Tan CH, Tan BKH: Effects of Averrhoa bilimbi leaf extract on
blood glucose and lipids in streptozotocin-diabetic rats.
J Ethnopharmacol 2000, 72:69–76.
35. Vergani L, Floreani M, Russell A, Ceccon M, Napoli E, Cabrelle A, Valente L,
Bragantini F, Leger B, Dabbeni-Sala F: Antioxidant defences and homeostasis
of reactive oxygen species in different human mitochondrial DNA-depleted
cell lines. Eur J Biochem 2004, 271:3646–3656.
36. Konrad RJ, Mikolaenko I, Tolar JF, Liu K, Kudlow JE: The potential
mechanism of the diabetogenic action of streptozotocin: inhibition of
pancreatic beta-cell O-GlcNAc-selective N-acetyl-beta-D-glucosaminidase.
Biochem J 2001, 356:31–41.
37. Krentz AJ: Lipoprotein abnormalities and their consequences for patients
with type 2 diabetes. Diab Obes Metab 2003, 5:S19–S21.
38. Haider R, Annie J: Streptozotocin-Induced Cytotoxicity, Oxidative Stress
and Mitochondrial Dysfunction in Human Hepatoma HepG2 Cells.
Int J Mol Sci 2012, 13:5751–5767. doi: 10.3390/ijms13055751.
39. Saini KS, Thompson C, Winterford CM, Walker NI, Cameron DP:
Streptozotocin at low doses induces apoptosis and at high doses causes
necrosis in a murine pancreatic β-cells line, INS-1. Biochem Mol Biol Int
1996, 39:1229–1236.
40. Harel A, Bloch O, Vardi P, Bloch K: Sensitivity of HaCat keratinocytes to
diabetogenic toxins. Biochem Pharmacol 2002, 63:171–178.
41. ADA: American Diabetes Association. Diabetes Care 2002, 32:S62–S67.
42. Boroujeni NB, Hashemi SM, Khaki Z, Soleimani M: Tissue Cell 2011, 43:75–82.
43. Arias-Díaz J, Balibrea J: Nutr Hosp 2007, 22:160–168.
44. Etuk EU, Muhammed BJ: Evidence based analysis of chemical method of
induction of diabetes mellitus in experimental animals. Asian J Exp Biol
Sci 2010, 1(2):331–336.
45. Gajdošík A, Gajdošíkova A, Stefek M, Navarova J, Hozová R: Streptozotocin-
Induced Experimental Diabetes In Male Wistar Rats. Gen Physiol Biophys
1999, 18(Focus Issue):54–62.
46. Ar'Rajab A, Ahrén B: Long-term diabetogenic effect of streptozotocin in
rats. Pancreas 1993, 8:50–57.
47. Kennedy JK, Zochodne DW: The regenerative deficit of peripheral nerves
in experimental diabetes. Its extent, timing, possible mechanism.
Brain 2000, 123(10):2118–2212.
48. Pharmaceuticals S: Material Safety Data Sheet. Sicor Pharmaceuticals Inc:
Irvine CA; 2003.
49. Adeghate E, Ponery AS: GABA in the endocrine pancreas: cellular
localization and function in normal and diabetic rats. Tissue Cell 2002,
34:1.6.
50. Arindkar S: Mahesh kumar MJ, Juyal RC, Majumdar SS, Perumal N: The
Effect of Fasting on Haematology Serum Biochemistry Parameters on
STZ Induced CD1 Mice and Diabetic db/db Mice. J Drug Metab Toxicol
2012, 3:137. doi: 10.4172/2157-7609.1000137.
51. Suresh BP, Srmivasan K: Influence of dietary capsaicin and onion on the
metabolic abnormalities associated with streptozotocin induced
diabetes mellitus. Mol Cell Biochem 1997, 175:49–57.
Page 7 of 7
52. Kripa K, Vijayalakshmi NR, Helen A: Methanolic Extract of Costus Igneus
(N.E.Br.) Alleviates Dyslipidemia In Diabetic Rats Asian Journal of
Pharmaceutical and. Clin Res 2011, 4:1–4.
53. Srinivasan K, Patole PS, Kaul CL, Ramarao P: Reversal of glucose intolerance
by pioglitazone in high-fat diet fed rats. Methods Find Exp Clin Pharmacol
2004, 26:327–333.
54. Calcutt NA, Li L, Yaksh TL, Malmberg AB: Different effects of two aldose
reductase inhibitors on nociception and prostaglandin E. Eur J Pharmacol
1995, 285:189–197.
55. Dyck PJ, Zimmerman BR, Vilen TH, Minnerath SR, Karnes JL, Yao JK, et al:
Nerve glucose, fructose, sorbitol, myoinositol, and fiber degeneration and
regeneration in diabetic neuropathy. N Engl J Med 1988, 319:542–548.
56. Courteix C, Eschalier A, Lavarenne J: Streptozocin-induced diabetic rats:
behavioural evidence for a model of chronic pain. Pain 1993, 53:81–88.
57. Malcangio M, Tomlinson DR: A pharmacologic analysis of mechanical
hyperalgesia in streptozotocin/diabetic rats. Pain 1998, 76:151–157.
58. Aley KO, Levine JD: Rapid onset pain induced by intravenous
streptozotocin in the rat. J Pain 2001, 2:146–150.
59. Sasaki T, Yasuda H, Maeda K, Kikkawa R: Hyperalgesia and decreased
neuronal nitric oxide synthase in diabetic rats. Neuroreport 1998,
9:243–247.
60. Cunha JM, Funez MI, Cunha FQ, Parada CA, Ferreira SH: Streptozotocin-
induced mechanical hypernociception is not dependent on
hyperglycemia. Braz J Med Biol Res 2009, 42:197–206.
61. Robbiano L, Mereto E, Corbu C, Brambilla G: DNA damage induced by
seven N-nitroso compounds in primary cultures of human and rat
kidney cells. Mutat Res 1996, 368:41–47.
62. Eleazu CO, Eleazu KC: Ameliorating Potentials of 3 Medicinal Plants on
Relative Pancreatic Weights in Streptozotocin Induced Diabetic Rats.
J Diabetes Metab 2013, 4:264. doi: 10.4172/2155-6156.1000264.
63. Eleazu CO, Iroaganachi M, Okafor PN, Ijeh II, Eleazu KC: Ameliorative
Potentials of Ginger (Z. officinale Roscoe) on Relative Organ Weights in
Streptozotocin induced Diabetic Rats. Int J Biomed Sci 2013, 9(2):82–90.
64. IARC: Some N-Nitroso Compounds: IARC Monographs on the Evaluation of
Carcinogenic Risk of Chemicals to Humans. Lyon, France: International
Agency for Research on Cancer; 1978:17–365.
doi:10.1186/2251-6581-12-60
Cite this article as: Eleazu et al.: Review of the mechanism of cell death
resulting from streptozotocin challenge in experimental animals, its
practical use and potential risk to humans. Journal of Diabetes &
Metabolic Disorders 2013 12:60.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit