Anda di halaman 1dari 25

LAPORAN MATA KULIAH REKAYASA GENETIKA

STRATEGI KLONING GEN APOPTIN REKOMBINAN


KE VEKTOR pCU19 DENGAN HOST Escherichia
coli strain DH10

Oleh Kelompok 5:

Anggoro Wiseso

(1206212514)

Aulia Rahmi

(1206246731)

Etri Dian Kamila

(1206212533)

Farisa Imansari

(1206212426)

Jason Jonathan

(1206238904)

Jurusan Teknologi Bioproses


Departemen Teknik Kimia
Fakultas Teknik Universitas Indonesia
Depok, 2014

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

BLOCK FLOW DIAGRAM HASIL PEMBAHASAN STRATEGI KLONING GEN


APOPTIN

Escherichia coli strain


DH10

Chicken Anemia Virus


Amplifikasi - Replikasi
Virus

Isolasi DNA menggunakan


Ekstraksi Fenol-Chloroform

Isolasi Plasmid pUC19

Modifikasi Apoptin untuk


Tahapan Kloning

Pemilihan Situs Restriksi

Perancangan Reverse
Primer dan Forward Primer

Penyisipan Insert Gen Apoptin ke


dalam Vektor Plamid pUC19

Transformasi Gen Apoptin

Heat Shock Electropolation


Screening Test untuk Penyeleksian
sel inang dengan DNA rekombinan
yang membawa gen apoptin

Laporan Rekayasa Genetika: Teknik Kloning Sederhana


KATA PENGANTAR

2014

Pertama-tama, puji dan syukur kami panjatkan ke hadirat Tuhan Yang


Maha Esa sebab atas kehendak-Nyalah maka makalah ini dapat terselesaikan
dengan baik dan tepat waktu.
Tujuan utama dari penulisan makalah ini adalah untuk memenuhi tugas
mata kuliah Rekayasa Genetika. Meskipun begitu, kami, selaku tim penulis
melalui penulisan makalah ini memperoleh manfaat lain yaitu mampu memahami
topik yang dijabarkan dalam Pemicu 2 ini yaitu strategi dalam kloning gen apoptin
dan mampu melatih keterampilan kami dalam membuat suatu karya tulis.
Dalam penyelesaian makalah ini, penulis banyak mengalami kesulitan,
disebabkan topik yang sebenarnya masih terasa asing bagi kami yakni Kloning.
Namun, berkat bantuan dan kerja sama dari berbagai pihak, akhirnya makalah ini
dapat terselesaikan, meskipun masih terdapat banyak kekurangannya. Oleh
sebab itu, kami selaku tim penulis, ingin menyampaikan terima kasih kepada :
1. Dr. Eng. Muhamad Sahlan, S.Si.,M.Eng yang telah memberikan topik
berupa pemicu dan bimbingan dari awal membuat konsep makalah
hingga penulisannya.
2. Pihak-pihak lain yang memberikan bantuan baik secara langsung maupun
tidak langsung.
Kami menyadari bahwa makalah pertama kami ini masih memiliki banyak
kekurangan. Oleh sebab itu, kami mengharapkan adanya kritik dan saran yang
positif agar makalah-makalah kami berikutnya dapat mengalami peningkatan
kualitas dan manfaat.
Depok, 13 Oktober 2014
Penulis

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

BAB I
PENDAHULUAN
1.1 Latar Belakang
Kloning merupakan metode dari ilmu rekayasa genetika untuk
memproduksi fragmen DNA yang digunakan untuk memperbanyak suatu gen
atau protein menggunakan sel sebagai inang yang nantinya akan
mereplikasikan diri agar dapat menghasilkan gen atau protein dalam jumlah
banyak (tidak terbatas) dalam waktu relative lebih singkat dan efisiensi yang
lebih. Kloning, dimanfaatkan untuk menemukan obat untuk berbagai penyakit
mulai dari penyakit pada manusia, hewan maupun tumbuhan. Sekarang ini,
kloning sudah menghasilkan vaksin dan hormon. Teknik kloning membuat
kita dapat menggabungkan dua jenis sel (sel hewan dengan sel manusia)
untuk menghasilkan antibodi tertentu untuk melawan penyakit. Antibodi
kloning ini saat disuntikkan ke dalam darah dapat mencari dan menyerang
sel penyakit manapun dalam tubuh kita, bahkan dengan ditempelkannya
unsur pelacak antibodi ini dapat menyerang sel kanker yang tersembunyi
sekalipun.
Gen apoptin adalah gen yang didapatkan dari Chicken Anemia Virus
(CAV). CAV dapat berfungsi sebagai pembunuh sel kanker pada tubuh
manusia, tanpa harus membunuh sel sehat lainnya. Sebagai obat kanker,
dibutuhkan gen apoptin dalam jumlah yang banyak. Namun, untuk
membiakkan virus CAV, membutuhkan waktu yang lebih lama, dikarenakan
penyebaran virus yang lebih jauh. Oleh karena itu, metode cloning digunakan
agar gen apoptin dapat diperbanyak tanpa menunggu lebih lama. Selain itu
proses kloning ini membuat gen apoptin yang kita gunakan dapat dimodifikasi
dengan histidin dan arginine pada host cell E.coli. Pada pemicu kali ini,
penulis akan merekayasa kloning apoptin ke dalam E. coli, dimana untuk
mempermudah proses pemurnian ujung C-terminal apoptin ditambahkan
histidin dan untuk mempermudah penetrasi akan ditambahkan 8 arginin pada
N-terminal. Dalam makalah ini, akan dijelaskan lebih lanjut mengenai strategi
strategi yang akan dipakai dalam mengkloning apoptin pada E. Coli, dimulai
dari tahap pengisolasian apoptin hingga replikasinya, serta kelebihan dan
kekurangannya.
1.2 Rumusan Masalah
a. Vektor apa yang digunakan pada proses kloning untuk apoptin?
b. Situs restriksi apa yang diipilih pada proses kloning untuk apoptin?
Metode apa yang digunakan untuk modifikasi gen apoptin ?
c. Bagaimana proses modifikasi yang digunakan untuk menambahkan
histidin dan arginin pada gen apoptin?
d. Bagaimana cara penyisipan gen apoptin yang telah dimodifikasi ke dalam
vektor ?
e. Apa jenis E.coli yang digunakan pada proses kloning gen apoptin?
f. Bagaimana cara men-transformasi vektor dengan gen apoptin ke dalam
host cell ?
g. Jenis screening apa yang digunakan pada kloning gen apoptin kali ini?
a. Bagaimanakah tahapan kloning gen apoptin dengan menambahkan 10
histidin pada N-Terminal dan 8 Arginin pada C-Terminal, menggunakan
plasmid pUC19 pada E.coli DH10?

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

1.3 Tujuan Makalah


b. Mempelajari prinsip kloning dan prosesnya
c. Mengetahui cara memilih vektor untuk proses kloning.
d. Mengetahui jenis modifikasi yang dapat dilakukan pada gen yang akan
diklon.
e. Mengetahui jenis-jenis host cell yang dapat digunakan dalam proses
kloning.
f. Mengetahui jenis-jenis screening untuk membuktikan keberadaan vektor
dengan gene of interest pada host cell.
g. Mengetahui prosedur yang dilakukan untuk melaksanakan kloning
h. Mengkaji tahapan kloning gen apoptin dengan menambahkan 10 histidin
pada N-Terminal dan 8 Arginin pada C-Terminal, menggunakan plasmid
pUC19 pada E.coli DH10.

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

BAB II
PEMBAHASAN

2.1 Deskripsi Apoptin


Apoptin adalah protein yang mampu menginduksi kematian sel
spesifik pada sel tumor dan terdiri dari 121 macam asam amino yang terdiri
terutama dari prolin, serin, threonin dan asam amino dasar lainnya dan
terdeteksi pada 14 kDa. Karena kemampuannya yang dapat menginduksi
kematian sel secara spesifik pada sel tumor (apoptosis) tanpa menginduksi
sel normal yang dapat membelah dengan cepat, telah dikembangkan banyak
usaha untuk mengkulturkan apoptin agar mampu menjadi metode
pengobatan alternatif dalam pengobatan tumor/ kanker.
Gen apoptin dikodekan oleh Chicken Anemia Virus (CAV) yang
termasuk Famili Gyrovirus. Chicken Anemia Virus adalah virus DNA yang
menyebabkan anemia dan atropi organ pada ayam. Chicken Anemia Virus
adalah virus yang memiliki materi genetik single-stranded DNA. Chicken
Anemia Virus diambil dari jaringan hati ayam broiler yang terinfeksi Chicken
Anemia Virus mampu mengkodekan 3 macam protein virus yaitu : VP1, VP2,
dan VP3. Protein VP1 berperan dalam menyusun kapsid. Protein VP1
memiliki massa 51 kDa. Protein VP2 adalah protein yang memiliki spesifitas
terhadap fosfatase dan memiliki masa 30 kDa. Sementara protein VP3
adalah protein apoptin, yang mampu menginduksis apoptosis pada sel limosit
pada ayam dan beberapa jalur sel pada sel tumor, tetapi tidak menginduksi
lisis pada sel normal. Protein apoptin memiliki massa 13 kDa.

Gambar 1. Kaspid Chicken Anemia Virus (CAV)


Sumber: ictvdb.bio-mirror.cn, diakses pada 3 Oktober pukul 9.03 PM

Apoptin mengandung sinyal Bipartite-type Nuclear Localization


Sequence (atau NLS1 dan NLS2) pada rentang asam amino 82-88 untuk
NLS1 dan pada rentang asam amino 111-121 untuk NLS2 atau pada ujung cterminalnya, serta Nuclear Export Signal (NES) yang mempunyai rentang
asam amino 97-105 yang menunjukkan adanya potensi perpindahan dari
nukleus ke sitoplasma dan sebaliknya. NLS1, NLS2, dan NES merupakan
sequence yang memungkinkan Apoptin untuk keluar dan masuk ke dalam

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

nukleus. Struktur sekuens (sequence) asam amino dari Apoptin dapat dilihat
pada ilustrasi berikut.

Gambar 2. Struktur sekuens asam amino dari apoptin


Sumber: Los M, S , Paniraghi 2009

Apoptin memiliki kemampuan untuk menginduksi terjadinya apoptosis


pada sel kanker manusia namun tidak pada sel normal. Sel memicu
apoptosis dengan cara intrinsik mitokondrial yang memerlukan caspase-3
dan caspase-9. Belum ada mekanisme yang jelas mengapa apoptin dapat
spesifik membunuh lini sel dari sel kanker. Tetapi salah satu sebabnya
adalah karena pada sel kanker apoptin berlokalisasi di nukleus sementara
pada sel normal umumnya diekspresikan di sitoplasma. Bentuk apoptin
sangat stabil, multimerik aktif biologis terdiri dari 30-40 monomer dan
nukleoprotein kompleks tingkat tinggi dengan konformasi DNA ditemukan
dominan dalam aktif transkripsional replikasi dan DNA rusak.
2.2 Strategi Pengisolasian Gen Apoptin Melalui Purifikasi DNA CAV
Teknik isolasi gen yang digunakan adalah metode pemisahan
ekstraksi fenol kloroform. Teknik ini dapat memberikan hasil DNA yang lebih
murni, jika dibandingkan dengan metode lain. Hal ini dikarenakan
kemampuan fenol untuk memisahkan fasa lebih baik dibandingkan
pengikatan kovalen pada proses adsorpsi. Umumnya fenol-kloroform
disiapkan dalam bentuk campuran fenol-kloroform-isoamil alkohol dengan
perbandingan volume 25:24:1. Campuran fenol-kloroform adalah campuran
yang homogen. Fenol-kloroform dan air tidak dapat bersatu sehingga akan
terbentuk dua fase yakni fase air (fase aqueous) dan fase fenol-kloroform.
Tahapan isolasi gen dari apoptin adalah melakukan pemisahan dari
DNA CAV dari komponen virus lain. DNA CAV memiliki ukuran sekitar 2,3 kb.
Langkah pertama yang harus dilakukan adalah mengambil virus CAV yang
ingin di kultur, dengan cara menginjeksi hati ayam broiler yang terinfeksi oleh
virus CAV menggunakan injector. Berikut adalah ilustrasi dari sample yang
mengandung Chicken Anemia Virus.

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Gambar 3. Sample yang mengandung Chicken Anemia Virus


Sumber: http://ictvdb.bio-mirror.cn/WIntkey/Images/vsd12_c.jpg, diakses pada tanggal 3 Oktober
2014, pukul 9.18 PM

Sampel dari jaringan hati kemudian dipanaskan untuk mengurai


jaringan-jaringan yang kompleks pada suhu 650C selama 20 menit.
Selanjutnya, dilakukan penambahan buffer phenol jenuh dengan volume
yang sama seperti sampel dan dikocok selama 3 menit, sebelum akhirnya
disentrifugasi pada 14000 RPM selama 5 menit. Penambahan fenol berfungsi
untuk memisahkan fasa-fasa pada virus. Fasa organik akan terikat pada fenol
dan kloroform. Fasa organik akan lebih berat dan mengikat protein-protein
berat seperti kapsid yang menyusun virus. Kemudian komponen DNA akan
terikat pada fasa cair yang lebih ringan. Fenol dipilih karena memiliki
kelarutan yang buruk sehingga protein yang larut dalam fenol akan terpisah
dari cairan.
Fenol akan berada dibagian bawah tabung, hal ini disebabkan karena
ketika dicampurkan dengan fenol, protein terekspos dengan pelarut yang
kurang polar, sehingga pola pelipatannya protein berubah. Pada dasarnya
dalam kondisi tersebut residu-residu asam amino dari protein akan bertukar
tempat. Residu yang kurang polar yang tadinya tersembunyi di sisi dalam
protein ketika berada dalam pelarut air, kini mendesak menuju ke sisi luar
untuk berinteraksi dengan pelarut fenol. Tahap selanjutnya adalah
memisahkan lapisan atas dari lisat dan dicampurkan dengan kloroform pada
volume yang sama dengan sampel, dan kembali disentrifugasi pada 14000
RPM selama 5 menit. Bagian atas dari hasil sentrifugat dipisahkan.
Langkah berikutnya adalah menambahkan NaAc 3M pada sampel
sebanyak 1/10 dari volume sampel dan kemudian menambahkan juga 100%
EtOH sebanyak 2 kali volum sampel. Setelah mengocok sampel selama
beberapa detik, sampel didinginkan pada suhu -200C selama 30 menit.
Setelah pendinginan selesai, sentrifugasi kemudian dilakukan kembali lagi
pada 14000 RPM selama 5 menit hingga terbentuk pelet. Jika pelet tidak
terbentuk dalam waktu 5 menit, maka perlu dilakukan sentrifugasi ulang
selama 5 menit.
Pemisahkan pelet dari supernatan kemudian dilakukan dengan pipet
secara perlahan-lahan. Penambahan etanol ditujukan untuk mengendapkan
DNA. Karena DNA memiliki sifat yang sangat polar akibat muatan yang
dimiliki struktur fosfatnya. Untuk itu, etanol yang memiliki sifat tidak polar
dapat menyebabkan adanya atraksi elektrik antara gugus fosfat dan ion
positif yang ada dalam larutan sampel sehingga membentuk ikatan ion dan
mengendapkan DNA. Ion yang nantinya berikatan dengan DNA untuk
diendapkan adalah ion natrium yang berasal dari Natrium asetat.
Setelah itu pelet dibiarkan kering sehingga tidak ada cairan lagi
didalam sampel. Pelet kemudian disuspensikan didalam air. Sampel tersebut
merupakan hasil isolasi gen yang mengandung DNA Chicken Anemia Virus

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

murni untuk kemudian dilakukan tahapan selanjutnya dalam melakukan


teknik kloning apoptin.
2.3 Strategi Modifikasi Gen Apoptin Untuk Mengkloning Gen Apoptin
2.3.1 Pemilihan Vektor pUC19 untuk Kloning Gen Apoptin
Vektor yang akan digunakan ialah pUC19 yang diambil dari
bakteri E.Coli. Vektor pUC19 merupakan vektor yang memiki circular
double stranded DNA dan mempunyai 2686 bp (base pairs). Plasmid
vektor ini sangat mudah ditransfeksikan kedalam E coli dengan metode
yang sederhana dan relatif murah (seperti heat shock) serta dapat
dengan cepat bereplikasi dan amat mudah diseleksi dengan metode
white/blue color selection (Yanisch-Perron, 1985; Chung, et al., 1989).
Vektor pUC19 lazim digunakan dalam teknik kloning sederhana.
Keunggulannya adalah mudah dibedakan dari non rekombinannya
berdasarkan perbedaan warna koloni pada media pertumbuhan.
Dalam teknik kloning, vektor ini bisa gunakan karena beberapa
alasan, yakni:
a. Memiliki origin of replication, sebagai syarat replikasi. Vektor pUC19
memiliki yang namanya oriV.
b. Mempunyai dua gen marker yang dapat menandai masuk tidaknya
plasmid ke dalam sel inangnya nanti. Gen marker ini dapat ditandai
dengan amphicilin dan blu-white screening.
c. Ukuran yang sesuai, memiliki ukuran yang relatif kecil dibandingkan
dengan pori dinding sel inang sehingga dapat dengan mudah
melintasinya.
d. Memiliki multiple cloning site (MCS) dalam menjalankan fungsinya.
Sekuen Multiple cloning site berada pada bagian 5 dari lacZ gene
yang mengkodekan untuk amino, bagian N terminal dari betagalactosidase (LacZ) dari E.coli. Daerah MCS berada dalam lacZ
gene (kodon 6 7 lac Z digantikan oleh MCS), dimana bermacam
jenis sisi restriksi untuk beberapa restriksi endonuklease itu ada.
2.3.2 Pemilihan Situs Restriksi pada Plasmid
Untuk melakukan cloning DNA insert ke dalam vector cloning,
dibutuhkan dua enzim restriksi yang berbeda untuk membentuk ujung
yang kompatibel. Enzim yang digunakan menghasilkan ujung yang
kohesif atau sticky ends untuk memastikan bahwa penggabungan insert
berada pada arah yang benar. Enzim yang dipilih diusahakan agar tidak
menghasilkan potongan yang komplemen satu sama lainnya (compatible
end) sehingga arah penyisipan fragmen dapat terbalik. Pada kasus ini,
dipilih dua situs restriksi yang akan digunakan, yakni BamHI dan HindIII.
Kami ingin menyisipkan gen apoptin pada situs restriksi BamHI pada
ujung 5 dan HindIII pada ujung 3. Kami memilih ujung BamHI
(GGATCC) dan HindIII (AAGCTT) dikarenakan kedua enzim ini memiliki
ujung sticky end (kohesif).
2.3.3 Perancangan Primer untuk PCR
Gen apoptin yang ada pada DNA CAV kemudian di sekuens
menggunakan metode sanger. Setelah mengetahui sekuens dari apoptin,
kita bisa membuat primer yang sesuai untuk selanjutnya dilakukan
metode PCR. Ada dua jenis primer yang akan didesain, yaitu forward
primer (5-end) dan reverse primer (3-end).
2.3.3.1 Forward Primer
Forward primer overlap dengan 5-end dari gen of interest.
Primer harus mengandung elemen situs restriksi (yang

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

menyediakan sticky end/ujung lengket yang sama pada enzim


restriksi pada Multiple Clonning Site dari vektor yang dipilih),
Ekstensi 5 hingga situs restriksi (dapat mempengaruhi efisiensi
pemutusan oleh enzim restriksi), Kodon start ATG (harus
dimasukan ketika gen yang ingin disisipi, tidak diberi tag pada NTerminal atau fusion protein) dan Overlap dengan gen of interest
(Banyaknya basa pada primer yang saling tumpang tindih dengan
gen of interest hingga memberikan Tm = 60C atau lebih). Berikut
adalah prosedur proses desain dari forward primer pada gen
apoptin.
1. Ekstensi 5' (8 Arg Tag)
2. Situs restriksi BamHI (GGATCC)

Gambar4. Situs Restriksi BamHI


Sumber: Ilustrasi Penulis

3. Kodon Start (ATG)


4. Overlap primer dengan ujung 5' dari gen apoptin mulai dari
ATG kodon start.
Berikut adalah sequence hasil dari desain forward primer:
5 CCCGGG ATG AGG AGA AGG AGA AGG AGA AGG AGA AAC
GCT CTC CAA GAA GAA CT 3
2.3.3.2 Reverse Primer
Reverse primer (3-end) overlap dengan rantai DNA
komplemen sampai 3-end dari gen of interest. Reverse primer
harus mengandung, yakni situs restriksi (menyediakan sticky
end/ujung lengket, yang sama pada enzim restriksi pada Multiple
Clonning Site), Ekstensi 5 hingga situs restriksi, Kodon stop TAA,
TAG, dan TGA (harus ada ketika tidak ada tag pada C-Terminal),
dan Overlap dengan rantai DNA komplemen hingga ujung 3 dari
gene of interest (banyaknya basa yang tumpang tindih antara
primer dengan rantai DNA komplemen juga dihitung hingga Tm =
60C atau lebih). Berikut adalah prosedur proses desain dari
reverse primer pada gen apoptin.
1.
Ekstensi 5' (12 His Tag)
Ada dua cara dalam menyisipkan histidine, yakni
sebelum kodon start dan setelah kodon start. Pada kasus
ini, sebanyak 12 His tag disisipkan tepat sebelum kodon
start, dikarenakan bagian forward primer akan
disambungkan di C-Terminal gen apoptin.
2.
Situs restriksi HindIII (AAGCTT)

Gambar 5. Situs Restriksi HindIII


Sumber: Ilustrasi Penulis

3.
Komplemen kodon stop (TTA)
4.
Overlap primer dengan rantai komplemen hingga ujung 3
gen apoptin.

10

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Berikut adalah sequence hasil dari desain reverse primer:


3 - TTC CAC ATAT TCT GAC GTG GTC GTG GTC GTG GTC GTG GTC
GTG GTC GTG GTC ATT CTTAAG 5
Susunan harus dibalik karena susunan primer harus dari 5 ke 3
maka penulisan primer akhirnya menjadi :
5 - GAATCC - TTA CTG GTG CTG GTG CTG GTG CGT GTG CTG GTG
CTG GTG CAG TCT TATA CAC CTT 3
Dengan demikian, berakhirlah proses modifikasi atau
desain primer yang ada dengan sudah melakukan penambahan 8
arginin pada N Terminal dan 12 histidine pada C Terminal.
Selanjutnya, tinggal melakukan proses PCR biasa. Namun, kita
harus mengecek pada Tm (Melting temperature) dari primer,
dengan ketentuan Tm untuk kedua primer sama atau selisih 2-4 C
dan diatas 60C. Selain Tm, kandungan GC dalam primer harus
berjumlah antara 40 60%.
2.4 Strategi Penyisipan Insert Gen Apoptin ke dalam Vektor Plamid pUC19
2.4.1 Restriksi Gen Apoptin Modifikasi dan Restriksi pUC19
2.4.1.1 Site Restriksi Gen Apoptin Modifikasi dan Restriksi pUC19
Hasil dari proses modifikasi gen apoptin melalui PCR
dengan penambahan arginin pada N-terminal dan histidin pada Cterminal juga meliputi penambahan site restriksi pada amplikon
PCR yang terbentuk. Pemilihan enzim restriksi harus
menyesuaikan dengan site restriksi yang ada pada baik insert
kloning maupun vektor plasmid dan ketersediaan enzim restriksi
itu sendiri di pasaran. Modifikasi PCR gen apoptin menghasilkan
site restriksi BamHI dengan site restriksi GGATCC pada ujung 5
dan HindIII dengan site restriksi AAGCTT pada ujung 3.
5 - Restriction Site (BamHI) Start Kodon 8 Arginin Kode apoptin 12
Histidin Stop Kodon Restriction Site (HindIII) 3
5 - GGATCC ATG AGGAGAAGGAGAAGGAGAAGGAGA Kode Apoptin
GTGGTCGTGGTCGTGGTCGTGGTCGTGGTCGTGGTC TAA AAGCTT
3

Gambar 6. Peta Plasmid pUC19 beserta Site Restriksinya


Sumber: http://ictvdb.bio-mirror.cn/WIntkey/Images/vsd12_c.jpg, diakses pada tanggal 3 Oktober
2014, pukul 9.18 PM

2.4.1.2 Langkah-Langkah Restriksi


Tahapan restriksi adalah sebagai berikut.
a. Pemilihan Enzim Restriksi

11

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Dalam penelitian ini, enzim resktriksi yang digunakan


adalah BamHI dan HindIII.
b. Pemilihan Buffer
Fungsi buffer adalah untuk mempertahankan pH pada
nilai tertentu agar DNA tidak terdegradasi dengan
penambahan bahan lainnya. Pemilihan buffer yang sesuai
diperlukan karena masing-masing enzim restriksi memiliki
optimasi kondisi reaksi yang berbeda sesuai dengan buffernya. Jika kita menggunakan enzim restriksi BamHI dan HindIII
dari diagram aktivitas enzim Viswagen Biotech, kita
menggunakan buffer M, karena pada buffer M, kedua enzim
restriksi memiliki aktivitas enzim 100.

Gambar 7. Diagram Aktivitas Enzim pada Beberapa Buffer


Sumber: http://www.viswagenbiotech.com/images/enzymeactivity.jpg, diakses pada tanggal 3
Oktober 2014, pukul 9.22 PM

c. Pencampuran
Setelah memilih enzim restriksi dan buffer, keduanya
dicampur dan ditambahkan dengan DNA yang hendak
dipotong, BSA, serta dH2O hingga volume total pada microtube
1,5 ml. DNA yang dipotong biasanya kurang lebih sekitar ~500
ng. Jumlah volume total reaksi bervariasi, dari 10 50 uL,
bergantung pada volume DNA potong. Volume DNA dihitung
dari pembagian 500 ng dan konsentrasi DNA yang telah diukur
sebelumnya (ng/uL). Sedangkan BSA (Bovine Serum
Albumine) digunakan untuk mencegah adhesi enzim pada
microtube dan permukaan tips pipet sehingga meminimalisir
enzim yang tertinggal pada permukaan tersebut. Semua
komponen kemudian dicampur perlahan dengan mikropipet.
d. Inkubasi dan Heat Kill
Setelah semua komponen dicampur, campuran
diinkubasi dalam temperatur suhu tubuh manusia, yakni 37oC
selama 1 jam. Untuk menginaktif enzim, heat kill pada 70oC

12

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

selama 15 menit dilakukan setelah inkubasi. Sebagai


gambaran, hasil restriksi pada site restriksi BamHI adalah
sebagai berikut.
A
TTCGA

AGCTT
A

Gambar 8. Hasil restriksi pada site restriksi BamHI


Sumber: Ilustrasi Penulis

2.4.2

Ligasi
2.4.2.1 Penambahan Alkaline Phosphatase ke dalam Larutan Vector
Penambahan alkalin fosfatase pada larutan vektor
(sebelum dicampur dengan insert) untuk menghilangkan gugus P
pada 5P sehingga menjadi 5OH (defosforilasi) sehingga dapat
meminimalisasi terjadinya kemungkinan vektor menyambung pada
vektor itu sendiri atau vektor menyambung dengan vektor lain
(terjadi ligasi antar vektor). Dengan berubahnya 5P menjadi 5OH
maka yang diharapkan terjadi yaitu vektor hanya berikatan dengan
insert, 3OH pada vektor akan menyambung pada 5P insert, akan
tetapi 3OH insert tidak dapat menyambung ke vektor karena 5P
vektor telah berubah menjadi 5OH sehingga terjadi nick atau
celah. Meskipun terjadi celah, insert dan vektor tetap berikatan
dan dapat ditransformasikan dimana celah ini nanti akan diperbaiki
di dalam sel apabila berhasil ditransformasikan.

Gambar 9. Mekanisme Efisiensi Ligasi


Sumber: Anam, Khairul. 2009. Laporan Praktikum Genetika Molekular: DNA
Rekombinasi. Sekolah Pascasarjana Bioteknologi, Institut Pertanian Bogor

2.4.2.2 Penambahan Buffer ke dalam Campuran


Fungsi buffer adalah mempertahankan pH pada nilai
tertentu agar DNA tidak terdegradasi dengan penambahan bahan
lainnya. Buffer yang digunakan mengandung ATP karena
umumnya enzim restriksi buffer akan bekerja jika dilengkapi ATP.
Buffer biasanya diberikan sebagai konsentrat 10X, setelah
pengenceran, konsentrasi ATP menghasilkan sekitar 0,25-1 mM.
Hal ini juga disesuaikan dengan penggunaan pelarut dan enzim
yang akan ditambahkan sehingga tercipta kondisi yang sesuai
untuk proses ligasi fragmen DNA (insert) dengan vektor.

13

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

2.4.2.3 Penambahan ddH2O ke dalam Campuran


Umumnya pelarut yang digunakan adalah ddH2O (doubledistilled water) karena dapat melarutkan DNA atau RNA dengan
baik. ddH2O atau disebut juga aqua bidestillata atau ultrapure
water, adalah air yang sangat murni, lebih murni dari aquadest
atau pun air reverse osmosis. Umumnya ddH2O dibuat dengan
melewatkan aquadest ke dalam suatu cartridge berisi resin-resin
filter dan deionisasi untuk menghilangkan ion-ion dari air, hingga
diperoleh nilai hantaran listrik yang sangat kecil (sekitar 5.5 106
Sm1 atau 18 M cm), terakhir air tersebut dilewatkan melalui
filter membran dengan pori-pori 0.22 l. Biasanya ddH2O tidak
perlu disterilkan lagi menggunakan autoclave.
Penambahan ddH2O adalah untuk pemurnian dan proses
vakum. Selain itu, penambahan ddH2O memiliki efek positif, yaitu
tidak mengandung EDTA seperti pelarut TE Buffer (campuran
antara larutan Tris-HCl dengan EDTA). EDTA merupakan
chelating agent yang dapat membentuk senyawaan kompleks
dengan ion logam seperti Mg2+ dan menghambat aplikasi
enzimatis. Namun penambahan ddH2O memiliki efek negatif yakni
timbul peluang untuk berubahnya pH. Ini dapat terjadi karena DNA
dan RNA memiliki sifat asam lemah. yang dalam waktu lama
dapat menyebabkan degradasi DNA/RNA, apalagi DNase juga
bekerja pada pH yang sedikit asam. Oleh karena itu dilakukan
penambahan buffer di awal.
2.4.2.4 Penambahan DNA Ligase ke dalam Campuran
DNA ligase ditambahkan paling akhir karena kondisi
larutan harus disesuaikan agar ligasi berjalan efektif. DNA ligase
merupakan enzim yang mengkatalisis pembentukan ikatan
fosfodiester antara ujung 5-fosfat dan 3-hidroksil pada DNA yang
mengalami nick. Nick pada DNA dapat terjadi pada saat replikasi
DNA, rekombinasi dan kerusakan.
Jenis DNA ligase yang digunakan pada kloning adalah T4
DNA Ligase, enzim ligase dari bakteri E. coli yang telah terinfeksi
virus T4. Enzim ini akan meligasi fragmen DNA yang
menggantung, memiliki ujung kohesif (lengket) maupun ujung
tumpul. Untuk meligasi fragmen DNA yang memiliki ujung tumpul,
diperlukan konsentrasi enzim yang lebih besar. Kofaktor T4 DNA
Ligase adalah ATP sehingga proses ligasi DNA T4 memerlukan
larutan penyangga (buffer) yang mengandung ATP dengan
konsentrasi 0.25-1 mM seperti yang telah ditambahkan
sebelumnya.
Mekanisme DNA ligase dimulai dari hidrolisis kofaktor,
yaitu ATP. Peristiwa ini menghasilkan kompleks enzim-adenylate
AMP yang berikatan kovalen dengan grup -amino residu lysin
pada sisi aktif dengan melepaskan pyrofosfat inorganik (PPi).
Kemudian sebagian AMP akan berpindah dari sisi aktif lysin ke
ujung bebas 5-fosfat yang berada pada nick utas DNA. Pada
akhirnya, ikatan fosfodiester akan terbentuk antara ujung 3-OH
yang berada di ujung nick dengan 5-fosfat dan melepaskan AMP
dan enzim adenylate.

14

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Gambar 10. Mekanisme DNA Ligase


Sumber: Anam, Khairul. 2009. Laporan Praktikum Genetika Molekular: DNA
Rekombinasi. Sekolah Pascasarjana Bioteknologi, Institut Pertanian Bogor

2.4.2.5 Inkubasi
Suhu optimum aktivitas DNA ligase adalah pada suhu
37C, tetapi pada suhu tersebut ikatan hidrogen yang terbentuk di
antara ujung lancip (lengket) menjadi tidak stabil dan kerusakan
akibat panas akan terjadi pada tempat ikatan tersebut dan
mengakibatkan denaturasi. Maka, alternatif yang baik dilakukan
dalam proses ini adalah inkubasi pada suhu yang diturunkan
dengan waktu inkubasi yang diperpanjang. Suhu inkubasi optimal
untuk T4 DNA ligase 160C. Namun, hal ini bdilakukan jika
diinginkan efisiensi yang tinggi dalam ligasi (contohnya dalam
membuat pustaka genom), tetapi jika ligasi bertujuan untuk kloning
umumnya ligasi dilakukan pada suhu 4 C semalaman, atau pada
suhu ruang selama 30 menit hingga beberapa jam. Pada akhirnya
terjadi transformasi dan fragmen DNA yang diinginkan (insert)
dapat disisipkan ke dalam molekul DNA (vektor).
2.5 Strategi Transformasi Gen Apoptin
2.5.1 Pemilihan Bakteri Escherichia Coli sebagai Sel Inang dalam Proses
Kloning Gen Apoptin
Escherichia coli merupakan bakteri berbentuk batang dengan
panjang sekitar 2 micrometer dan diameter 0.5 micrometer. Bakteri ini
umumnya hidup pada rentang 20- 400C, optimum pada 370. E. coli
ditemukan oleh Theodore Eschetrch pada tahun 1885. Hampir semua
rekayasa genetika di dunia bioteknologi selalu melibatkan E.coli,
termasuk dalam proses kloning. Pemilihan E.coli sebagai host cell
dikarenakan bakteri ini memiliki laju pertumbuhan yang cenderung lebih
cepat, dapat dikultivasi pada medium kultur biasa, berbagai gen asing
yang mengkode protein target dapat diterima dan diekspresikan dengan
baik oleh E.coli. Namun, terdapat kelemahan penggunaan E.coli yakni,
sinyal transkripsi dan translasi spesies lain tidak dikenali dengan baik oleh
inang E.coli, sehingga ekspresi gen-gen heterolog di E.coli lemah. Selain
itu, degradasi protein produk secara cepat dan seringkali protein
rekombinan justru terakumulasi dan membentuk agregat kompak, yang
bersifat inaktif tidak larut (sehingga menghambat proses purifikasi), yang
disebut dengan badan inklusi (inclusion bodies). Efek lebih buruk protein
dapat menjadi tidak aktif. Hal ini terjadi karena keterbatasan E.coli dalam
membentuk struktur tiga dimensi protein secara benar dalam proses
pelipatan pasca translasi.E.coli memiliki banyak strain yang digunakan

15

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

dalam tahapan rekayasa genetika. Setiap strain memiliki tingkat efisiensi


transformasi
yang
berbeda-beda
dan
kemampuan
untuk
mengekspresikan gen pengkode seperti Apoptin. Berikut adalah tabel
strain dari E.coli yang biasa digunakan untuk klona maupun untuk
ekspresi dari salah satu produsen (New England Biolabs):

Tabel 1. Karakter dari Strain Klona dan Ekspresi E.coli


Sumber: Competent Cell Clining and Protein Expression. New England Biolabs Inc.
http://www.neb.com, diakses pada 6 Oktober pukul 10.15 PM

Dalam teknik klona gen Apoptin, jenis strain E.coli yang dipilih
untuk klona adalah DH10 karena memiliki karakter efisiensi klona dari
plasmid yang tinggi dan tidak memiliki aktivitas endonuklease, sedangkan
untuk ekspresi dipilih BL21(DE3) karena karakter yang sesuai dengan
tujuan pemurnian protein. Strain DH10 merupakan turunan dari strain
K12. Strain ini memiliki efisiensi transformasi yang tinggi dan memiliki
kemampuan replikasi yang tinggi. Replikasi dari plasmid dengan tingkat
high-copy dapat terjadi dengan stabil. Seleksi dengan metode blue-white
juga bisa dilakukan pada strain ini. Gen recA1 pada DH10 juga
mencegah aktivitas endonuklease sehingga proses isolasi plasmid dapat
dilakukan dengan baik. Sedangkan strain BL21(DE3) mempunyai
efisiensi transformasi yang cukup tinggi dan memiliki gen DE3 pengkode
T7 RNA polimerase yang dapat mengekspresikan gen target pada vektor
ekspresi dengan induksi IPTG (Isopropil thiogalaktosida). Induksi dari T7
RNA polimerase pada E.coli BL21 (DE3) akan mensintesis mRNA dalam
jumlah yang tinggi. Dan pada sebagian besar penelitian, akumulasi

16

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

protein heterologus dalam jumlah tinggi juga dapat diperoleh. Strain


tersebut juga memiliki mutasi Ion dan OmpT protease sehingga dapat
meminimalisir degradasi protein rekombinan yang terekspresi.

2.5.2

2.5.3

Pembuatan sel kompeten


Sebelum proses transformasi, E.coli DH10 harus dibuat
kompetennya dahulu. Keadaan kompeten adalah keadaan saat bakteri
(host cell) siap untuk dimasukkan dengan materi genetik asing.
Pembuatan bakteri kompeten dilakukan dengan penambahan larutan
CaCl2, sehingga meningkatkan kemampuannya untuk mengambil DNA.
Larutan CaCl2 dalam keadaan dingin efektif untuk memperlemah dinding
sel dan meningkatkan permeabilitasnya sehingga mudah mengikat DNA.
Dinding sel yang dilindungi oleh lipoprotein dengan plasmid yang samasama bermuatan negatif akan sulit untuk menempel. Penambahan larutan
CaCl2 membantu mengubah sifat permeabilitas sel. Bakteri yang tadinya
terdapat pada bagian pelet kemudian diresuspensi kembali dengan
larutan MgCl2. Mg2+ dapat menurunkan kerapatan membran. Hal ini
dikarenakan adanya interaksi antara mineral tersebut dengan bagian
hidrofilik membran. Melalui hasil ini dapat diketahui bahwa penambahan
MgCl2 berperan dalam mengganggu kestabilan membran sel E.coli.
Transformasi gen apoptin rekombinan ke dalam E.coli DH10
Tahap memasukkan campuran reaksi ligasi ke dalam sel inang ini
dinamakan transformasi. Sel inang diharapkan akan mengalami
perubahan sifat setelah dimasuki oleh molekul DNA rekombinan. Molekul
CaCl2 menyebabkan sel-sel bakteri membengkak dan membentuk
sferoplas yang kehilangan protein periplasmiknya sehingga dinding sel
menjadi bocor. DNA yang ditambahkan ke dalam campuran, akan
membentuk kompleks resisten DNase dengan ion-ion Ca2+ yang terikat
pada permukaan sel. Kompleks ini, diambil oleh sel selama perlakuan
kejut panas diberikan. Pemberian kejutan panas (heat shock) yang diikuti
pendinginan akan menjadikan dinding sel kembali seperti semula.Secara
garis besar, ada dua teknik yang dapat digunakan untuk memasukkan
DNA rekombinan ke dalam sel inangnya, yakni chemical transformation,
menggunakan metode heat shock/ electroporation (kejutan listrik). Dalam
kasus ini, digunakan vektor plasmid dan E.coli DH10 sebagai host cell,
teknik transformasi yang digunakan adalah chemical tranformation.

2.6 Strategi Screening Test untuk Penyeleksian


Menemukan sel yang mengandung hasil insersi yang diinginkan
diantara semua sel perpustakaan genomik merupakan kerja yang sulit.
Proses tersebut melibatkan penelusuran semua sel rekombinan / fag yang
diperoleh dari transformasi atau transduksi untuk menemukan klon yang
diinginkan. Kemungkinan menemukan fragmen gen yang diinginkan dalam
sebuh perpustakaan gen tertentu bisa diestimasi melalui rumus berikut ini.
ln (1 )
=
1
1

, dimana N adalah jumlah rekombinan yang perlu discreening, n adalah rasio


ukuran genom organisme relatif terhadap ukuran fragmen rata-rata dalam
perpustakaan gen, P sama dengan probabilitas (apabila p = 0.95 berarti ada
95% kemungkinan untuk menemukan klon tersebut). Proses ini dinamakan

17

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

dengan proses screening. Proses screening dapat dilihat pada ilustrasi


berikut.

Gambar 11. Ilustrasi Proses Screening


Sumber: http://biochem.arizona.edu, diakses pada 11 Oktober 2014, pukul 00.07

Metode screening yang digunakan pada teknik kloning apoptin ini


adalah dengan blue-white screening. Alasan penggunaan metode ini adalah
karena vektor yang digunakan adalah plasmid pUC19 yang memiliki semua
elemen terkait metode ini. Plasmid jenis ini juga dinamakan plasmid ekspresi
karena plasmid ini mebawa promoter yang menghadap pada lokus cloning.
Plasmid berukuran 2.686 pasang basa dan membawa gen resisten terhadap
ampisilin: promoter dari operon lactosa dari E.coli: membawa gen lacZ,
sebagiian gen lacZ yaitu ujung asam amino dari -galaktosidase: bagian
yang dinamakan lokus untuk koning (EcoRI, SacI. KpnI, SmaI, XmaI, BamHI
dll). Dalam sel yang membawa vector ini dan ditumbhkan dengan
isopropyltiogalaktosida (IPTG) akan menginduksi ekspresi gen Lac Z karena
repressor LaCI tidak dapat menempel pada operator lac.

18

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Pada awalnya, yang harus dilakukan adalah memastikan apakah di


dalam E.coli DH10 hasil transformasi benar-benar memiliki hasil rekombinan
dari proses transformasi. Seperti yang kita ketahui, bakteri tidak dapat hidup
pada media yang mengandung antibiotik. Untuk itu, pada DNA plasmid
pUC19 yang ditranformasikan terdapat gen penyandi antibiotik resisten, yakni
gen ampicilin resisten (ampR) agar bakteri host [E.coli DH10 ] menjadi
tahan hidup di media yang mengandung antibiotik. Jadi bakteri yang tidak
disisipi plasmid akan mati dengan sendirinya. Permasalahan berikutnya
adalah bagaimana menentukan host cell yang plasmidnya memiliki gen
apoptin atau tidak. Tahapan ligasi tidak 100% berhasil menyambungkan
vektor dan insertnya. Bisa saja vektor tersebut berligasi sendiri (vector selfligation), atau insert yang berligasi sendiri (insert self-ligation).
Pada kasus ini, gen apoptin (insert) disisipkan di pertengahan gen
lacZ yang merupakan penyandi lacZ- subunit dari enzim -galaktosidase.
Enzim ini dapat memecah substrat seperti X-gal (suatu galaktosa yang
dimodifikasi) menjadi galaktosa dan pre-chromophore 5-bromo-4-chloro-3hydroxyindole, yang selanjutnya dioksidasi menjadi 5,5-dibromo-4,4dichloro-indigo yang berwarna biru.

Gambar 12. Mekanisme degradasi X-gal oleh -galaktosidase


Sumber: http://biochem.arizona.edu, diakses pada 11 Oktober 2014, pukul 00.14

Jika gen LacZ masih utuh, maka koloni bakteri E.coli DH10 akan
berwarna biru akibat pengaruh zat warna indigo yang dihasilkan. Tetapi jika
insert berhasil disisipkan (diligasikan) dengan vektor, otomatis gen lacZ-nya akan
terdisrupsi alias rusak dan ujung-ujungnya tidak mampu menghasilkan indigo
yang berwarna biru, sehingga koloni akan berwarna putih. Jadi hanya koloni
putih yang timbuh pada media yang mengandung antibiotik dan X-Gal saja yang
kemungkinan mengandung gen apoptin yang ditransformasikan. Inilah mengapa
proses ini dinamakan blue-white screening.

19

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Gambar 13. Proses ligasi insert-plasmid


Sumber: http://biochem.arizona.edu, diakses pada 11 Oktober 2014, pukul 00.14

Menurut Mangunwardoyo (2002) transforman yang dihasilkan ada yang


berwarna biru dan putih atau putih berubah menjadi biru, adanya warna biru
karena senyawa X-gal dalam medium. Hal ini terjadi karena adanya komplementasi di mana vektor plasmid pUC 19 pada bagian poli-lingkernya
masing-masing mengkode 146 asam amino dari galaktosidase (-gal),
sedangkan inangnya mengkode bagian C-terminal dan merupakan komplemen
dari -gal. Jika gen penyandi amino terminal -gal dari vektor plasmid dirusak
dengan adanya fragmen DNA, maka protein -gal tidak terbentuk, hal ini
menyebabkan koloni berwarna putih pada medium yang mengandung X-gal,
sedangkan koloni yang melakukan komplementasi berwarna biru. Davis et al.
(1994) menyebutkan terjadinya perubahan koloni yang berwarna putih menjadi
biru kembali, kemungkinan disebabkan adanya pergeseran kerangka baca
(frameshift) dari protein, atau mungkin disebabkan adanya aktivitas
eksonuklease yang memotong fragmen tersebut.
2.7 Strategi Harvesting dan Pemurnian Gen Apoptin Hasil Kloning
Setelah proses seleksi E.coli BL21(DE3) yang mengandung plasmid
rekombinan berhasil, maka dilakukanlah proses harvesting, dimana hasil dari
blue-white screening disentrifugasi. Dari hasil sentrigugasi ini, kemudian diambil
supernatannya untuk kemudian dimurnikan. Teknik pemurnian yang digunkan
adalah IMAC (Immobilized Metal Affinity Chromatography). Teknik ini cocok
dengan strategi kloning yang sebelumnya digunakan karena teknik ini
menggunakan senyawaa pengkelat yang terikat secara kovalen pada zat padat
pendukung kromatografi dan zat padat ini mengikat ion logam. Prinsip IMAC
yaitu interaksi reversible anatara beberapa ranatai samping asam amino dan
immobilized ion metal.
Gen apoptin yang direkayasa sebelumnya mengandung histidin pada
ujung N-terminalnya. Kehadiran His-Tag ini mengafilitasi proses pemurnian
protein berdasarkan afinitas selektif protein dengan polihistinin tersebut terhadap
adsorben yang dilengkapi pengkelat metal seperti Ni2+ atau Co2+. Interaksi anatra
residu histidin dengan ion logam ini bersifat reversibel dan protein yang terikat
dapat dielusi dengan imidazole atau dengan merendahkan nilai pH. Karena
imidazole indentik dengan rantai samping histidin, maka pada saat konsentrasi
imidazole ditingkatkan, imidazole akan menggantikan posisi pilihistidin pada

20

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

resin, dan polihistidin akan terleusi keluar. Sehingga diperolehlah protein gen
apoptin murni.

Gambar 14. Mekanisme permurnian protein dengan IMAC


Sumber. http://www.rsc.org/ej/AN/2008/b802355g/b802355g-s1.gif, diakses pada 14 Oktober
2014, pukul 9.51 AM

Sebagai pembanding, teknik lain yang dapat digunakan dalam proses


pemurnian adalah ion-exchange chromatography dengan prinsip ikatan ionik
antara asam amino dengan cation/anion exchange atau gel filtration
chromatography dengan prinsip trapping molekul protein di dalam sebuah gel
sebagai fase stasioner dari kolom kromatografi.

21

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

BAB III
PEMBAHASAN KELEBIHAN DAN KEKURANGAN STRATEGI

3.1 Pemilihan Vektor pUC19


Kelebihan dari penggunaan vektor pUC19 adalah sering digunakan dalam
teknik kloning sederhana sehingga data-data yang dibutuhkan dapat diperoleh
dengan tepat. Plasmid ini sangat mudah ditransfeksikan kedalam E. coli dengan
metode yang sederhana dan relatif murah seperti heat shock serta dapat dengan
cepat bereplikasi dan amat mudah diseleksi dengan metode white/ blue
screening.
3.2 Pemilihan Host atau Sel Inang E.coli
Dasar kami memilih bakteri Escherichia coli DH10 sebagai sel inang
adalah E.coli memiliki karakteristik ideal sebagai sel inang bagi gen yang akan
dikloning. Karakteristik tersebut antara lain mudah dimanipulasi, mampu tumbuh
dengan cepat dan stabil pada medium kultur biasa, non-patogen, serta dapat
ditransformasi DNA asing (Brock dkk. 1994:295). Strain ini memiliki gen de3
pengkode T7 RNA polimerase yang dapat mengekspresikan gen target pada
vektor ekspresi dengan induksi IPTG. Strain tersebut juga memiliki mutasi ion
dan OmpT protease sehingga dapat meminimalisir degradasi protein rekombinan
yang terekspresi.
Kekurangan dari sel inang jenis ini, pada umumnya sinyal transkripsi dan
translasi spesies lain tidak dikenali dengan baik oleh inang E.coli, sehingga
ekspresi gen-gen heterolog di E.coli lemah. Selain itu, degradasi protein produk
secara cepat dan seringkali protein rekombinan justru terakumulasi dan
membentuk agregat kompak, yang bersifat inaktif tidak larut (sehingga
menghambat proses purifikasi), yang disebut dengan badan inklusi (inclusion
bodies). Efek lebih buruk protein dapat menjadi tidak aktif. Hal ini terjadi karena
keterbatasan E.coli dalam membentuk struktur tiga dimensi protein secara benar
dalam proses pelipatan pasca translasi.
3.3 Pemilihan Teknik Isolasi Gen Apoptin
Pada kasus ini, kami menggunakan metode phenol-kloroform untuk
mempurifikasikan gen apoptin pada DNA CAV. Hal ini dikarenakan metode ini
memiliki kelebihan yakni DNA yang dihasilkan dari proses purifikasi metode ini,
hasilnya sangat murni. Namun, kekurangannya adalah waktu yang dibutuhkan
untuk proses ini lebih lama.
3.4 Metode Sekuensing DNA
Dalam melakukan sekuensing atau pemetaan DNA, digunakan metode
sanger atau Sekuensing dengan dideoksi. Metode Sanger pada dasarnya
memanfaatkan dua sifat salah satu subunit enzim DNA polimerase yang disebut
fragmen klenow. Kedua sifat tersebut adalah kemampuannya untuk menyintesis
DNA dengan adanya dNTP dan ketidakmampuannya untuk membedakan dNTP
dengan ddNTP. Jika molekul dNTP hanya kehilangan gugus hidroksil (OH) pada
atom C nomor 2 gula pentosa, molekul ddNTP atau dideoksi nukleotida juga
mengalami kehilangan gugus OH pada atom C nomor 3 sehingga tidak dapat
membentuk ikatan fosfodiester. Artinya, jika ddNTP disambungkan oleh fragmen
klenow dengan suatu molekul DNA, maka polimerisasi lebih lanjut tidak akan
terjadi atau terhenti. Basa yang terdapat pada ujung molekul DNA ini dengan
sendirinya adalah basa yang dibawa oleh molekul ddNTP.

22

Laporan Rekayasa Genetika: Teknik Kloning Sederhana

2014

Selain metode Sanger, dikenal juga metode Maxim Gilbert. Pada metode
ini fragmen-fragmen DNA yang akan disekuens harus dilabeli pada salah satu
ujungnya, biasanya menggunakan fosfat radioaktif atau suatu nukleotida pada
ujung 3. Metode Maxam-Gilbert dapat diterapkan baik untuk DNA untai ganda
maupun DNA untai tunggal dan melibatkan pemotongan basa spesifik yang
dilakukan dalam dua tahap.
3.5 Pemilihan Teknik Modifikasi Gen Apoptin
Kami memilih menggunakan PCR untuk memodifikasi gen apoptin agar
compatible dengan vektor dikarenakan PCR memiliki beberapa kelebihan
daripada cara manual (potong tempel) yaitu dapat mengcopy berjuta-juta DNA
dari sedikit fragmen DNA dalam waktu yang relatif singkat, sensitivitas dan
spesifitas tinggi, dapat mendeteksi dan membedakan varian mikroorganisme,
dan sebagainya. Dibandingkan dengan cara manual, satu unit enzim restriksi
akan memotong 1 ug DNA secara sempurna dalam 50 ul reaksi selama 1 jam.
Waktu tersebut tidak efisien.
3.5 Pembahasan Tahap Transformasi dan Screening Test
Transformasi gen apoptin ke dalam sel inang menggunakan teknik
chemical transformation. Metode ini digunakan karena lebih efisien. Terkait
dengan teknik screening, khususnya blue-white screening dengan antibiotik,
dipilih karena lebih sederhana dan lebih mudah dioperasikan (dilakukan) dan
sesuai dengan vektor. Selain itu, dengan adanya pengkombinasian dengan
antibiotik membuat akurasi pemilihan koloni sel rekombinan lebih tinggi.

23

Laporan Rekayasa Genetika: Teknik Kloning Sederhana


BAB IV
PENUTUP

2014

5.1 Kesimpulan
1. Vektor yang digunakan pada metode kloning dalam makalah kami yaitu
vektor pUC19 sebagai vektor kloning
2. Host cell yang digunakan adalan Escheticia coli DH10 untuk klona dan
BL21(DE3) untuk pemurnian Apoptin.
3. Metode modifikasi yang digunakan adalah metode PCR.
4. Enzim restriksi yang digunakan adalah: BamHI dan HimDIII.
5. Metode transformasi yang digunakan adalah metode Chemical
Transformation .
6. Metode screening yang digunakan adalah metode blue-white screening.
7. Tahapan modifikasi protein adalah sebagai berikut:
a. Memilih situs restriksi pada vektor pUC19.
b. Menambahkan arginin pada ujung N-terminal dan histidine pada ujung
C-terminal gen apoptin murni.
c. Memotong vektor pada situs yang direncanakan.
d. Meligasi protein pada vektor.
8. Hasil modifikasi yang didapat untuk apoptin dalah sebagai berikut:
5 - Restriction Site (BamHI) Start Kodon 8 Arginin Kode apoptin 12
Histidin Stop Kodon Restriction Site (HindIII) 3

24

Laporan Rekayasa Genetika: Teknik Kloning Sederhana


DAFTAR PUSTAKA

2014

AddGene. 2012. Restriction Digest of Plasmid DNA, [online], available at


<http://www.addgene.org/plasmid-protocols/restriction-digest/> [Accessed
12 October 2014, 8.38 PM]
Corkill, G., Rapley, R., 2008. The Manipulation of Nucleic Acids: Basic Tools and
Techiques in Molecular Biomethods Handbook Second Edition. Ed:
Walker, J.M., Rapley, R. Humana Press, NJ,USA.
Howe, Christopher. 2007. Gene Clonning and Manipulation 2nd edition. US :
Cambridge Universities press.
Khalid, R.I., 2012. Pemurnian Rekombinan Protein Apoptin dari Dua Sel Inang
Bacillus subtilis 168 dan Escheria coli BL21 StarTM. Depok: Departemen
Teknik Kimia, Universitas Indonesia.
Novita, H., dkk, 2007. Isolasi dan Karakterisasi Ekspresi Gen untuk Protein
Sucrose Transporter pada Tanaman Tebu (Saccharum officinarum.
Universitas Jember, Jurnal ILMU DASAR Vol. 8 No. 2, [e-journal] 118127,
available
at
<jurnal.unej.ac.id/index.php/JID/article/176/144>
[Accessed 3 October 2014, 9.46 PM]
Oswald, Nick. 2007. Choosing a Competent E.coli Strain, [online], available at
<http://bitesizebio.com/10292/choosing-a-competent-ecoli-strain/>
[Accessed 10 October 2014, 10.55 PM]
S.B. Primrose, R.M. Twyman, and R.W. Old. 2001.Principles of Gene
Manipulation 6th edition. UK : Blackwell publishing.
Suryawanshi, A,. et al, 2012. Apoptin Protein - A New Therapy of Cancer.
International Journal Of Research In Pharmacy And Chemistry, [e-journal]
541-551, available at <www.ijprec.com> [Accessed 3 October 2014, 9.49
PM]
Triastuti, J., 2007. Isolasi Pengklonan Gen: Prinsip Dasar. Universitas Airlangga,
[Online], available at <http://fpk.unair.ac.id/webo/kuliah-pdf/isolasi%20%20klon%20gen%20pertemuan%20vii%20%5BCompatibility%20Mode%
5D.pdf> [Accessed 3 October 2014, 9.42 PM]

25