Anda di halaman 1dari 14

PRAKTIKUM II

PENGENALAN SITUS BIOINFORMATIKA NCBI DAN PENGGUNAANNYA


DALAM MEMAHAMI PROSES EKSPRESI GEN

I. Tujuan

1. Menelusuri identitas suatu gen berdasarkan seken nukleotida menggunakan gene


bank database.

2. Mahasiswa memahami prinsip ekspresi gen yang meliputi transkripsi dan


translasi serta regulasinya.

3. Mahasiswa dapat mengidentifikasi bagian gen yang berperan sebagai promoter,


coding sequence (CDS), intron dan ekson, start dan stop kodon, serta regulating
element.

4. Mahasiswa dapat memahami bagaimana suatu gen yang sama dapat


menghasilkan protein yang berbeda.

II. Dasar Teori

NCBI merupakan server yang memuat data base tentang informasi kesehatan dan
bioteknologi. Data base terus menerus di update sesuai dengan penemuan-penemuan
terkini yang menyangkut DNA, Protein, Senyawa aktif dan taksonomi. NCBI
merupakan salah satu bank data gen, protein dan literature khususnya dibidang
kesehatan yang terlengkap dan diacu oleh para peneliti di dunia. National Center of
Biotechnology Informatic adalah bagian dari Amerika Serikat National Library of
Medicine (NLM), sebuah cabang dariNational Institutes of Health . Para NCBI terletak
di Bethesda, Maryland dan didirikan pada tahun 1988 melalui legislasi disponsori oleh
Senator Claude Pepper. Untuk mengakses NCBI dapat dibuka di
http://www.ncbi.nlm.nih.gov/ (Widodo dan Miftahkhunnafisah, 2010).

Database dan software dalam situs bioinformatika ini terdiri dari berbagai aspek,
antara lain (Geneious, 2013) :
1. Entrez

Entrez merupakan sistem pencarian informasi dalam NCBI yang menyediakan


akses terintegrasi untuk melakukan sekuensing, pemetaan (mapping) , taksonomi dan
data struktural. Entrez juga menyediakan gambaran grafis untuk mapping sekuen dan
kromosom. Ciri khas dan keunggulan Entrez adalah kemampuan untuk pencarian
informasi terkait sekuen, struktur dan referensi. Literatur jurnal yang tersedia dapat
diakses melalui PubMed. PubMed merupakan alat penghubung pencarian di web yang
menyediakan akses ke lebih dari 11 juta sitasi jurnal di MEDLINE. Entrez Gene adapat
diakses pada www.ncbi.nlm.nih.gov/gene.

2. Nucleotide Database

Database nukleotida merupakan suatu koleksi sekuen dari beberapa sumber,


termasuk diantaranya GenBank, Reference Sequence (RefSeq), Third Party Annotation
(TPA) dan Protein Data Bank (PDB).

3. Blast

BLAST (Basic Local Alignment Search Tool) merupakan suatu program untuk
pencarian kemiripan sekuen (sequence similarity) dan merupakan alat dalam
identifikasi gen dan karakter genetik. Blast dapat melakukan pencarian sekuen melalui
perbandingan dengan database DNA dalam waktu singkat (kurang dari 15 detik).
Keterangan lengkap mengenai program BLAST dapat dilihat pada :
http://www.ncbi.nlm.nih.gov/blast/producttable.shtml# (Altschul, et al., 1990).

Ada 5 program utama dalam BLAST, yaitu (Altschul, et al., 1990) :

a. nucleotide blast (blastn) : membandingkan suatu sekuen nukleotida meragukan


(query sequence) yang kita miliki dengan database sekuen nukleotida.

b. protein blast (blastp) : membandingkan suatu sekuen asam amino yang kita
miliki dengan database sekuen protein.

c. blastx : membandingkan produk translasi konsep 6frame sebuah sekuen


nukleotida (translated nucleotide) yang kita miliki dengan database sekuen protein.
d. tblastn : membandingkan suatu sekuen protein yang kita miliki dengan
database sekuen nukleotida yang secara dinamis ditranslasi pada semua pembacaan 6
frame.

e. tblastx : membandingkan suatu translasi 6 frame dari nukleotida.

III. Alat dan Bahan

A. Alat

1. Komputer 1 set

2. Jaringan Internet 1 set

B. Bahan

1. Nucleotida query :

ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGT
CTTACCCCGAGTCGCTGCCCCTTACCGTCAACCACGACTTGCAG
AGGGGGAAGGTGGAGGCTGACATCCCAGGCCATGGGCAGGAAG
TCCCCCTTCCACCTCCGACTGTAGGGTCCGGTACCCGTCCTTCAC
CTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGG
GAGTAGTCCGAGAAATTCCCAGTGGGTCTTCGAGACCTCTTCTT
TGACAAGTTCAAGCACCTGAAGTCAGAGGACGAGATGAAGGAA
ACTGTTCAAGTTCGTGGACTTCAGTCTCCTGCTCTACTTCCCGTC
TGAGGACTTAAAGAAGCATGGTGCCACCGTGCTCACCGCGCAG
ACTCCTGAATTTCTTCGTACCACGGTGGCACGAGTGGCGCCTGG
GTTGCATGCTTAAGAAGAAGGGGCATCATGAGGCAGAGGGACC
CACCGTAGGAATTCTTCTTCCCCGTAGTACTCCGTCTCATTAAGC
CCCTGGCACAGTCGCATGCCACCAATCACAAGATCCTAATTCGG
GGACCGTGTCAGCGTACGGTGGTTCGTGTTCTAGGCCGTGAAGT
ACCTGGAGTTCATCTCGGAATCCATCATCCAGGTGGCACTTCATG
GACCTCAAGTAGAGCCTTACGTAGTAGGTCCATCTGCAGAGCAA
GCATCCCGGGGACTTTGGTGCTGATGCCCAGAGACGTCTCGTTC
GTAGGGCCCCTGAAACCACGACTACGGGTCGGGGCCATGAACA
AGGCCCTGGAGCTGTTCCGGAAGGACATGGCCCCGGTACTTGTT
CCGGGACCTCGACAAGGCCTTCCTGTACCCCTCCAACTACAAGG
AGCTGGGCTTCCAGGGCTAGGGAGGTTGATGTTCCTCGACCCGA
AGGTCCCGATC

IV. Cara Kerja

1. Membuka situs www.ncbi.nlm.nih.gov/blast

2. Setelah tampilan muncul, pilih blastn dan masukan sekuen nucleotide query
yang akan dicari

3. Pilih setingan pencarian dari database others; dan pilih program megablast
4. Klik BLAST untuk memulai proses searching

5. Klik accession gen terpilih pada NM_005368.2

6. Identifikasi informasi dari data yang didapatkan, seperti Locus, Definition,


Summary, Features (CDS & Exon), Origin (Promotor, Start dan Stop kodon).
V. Hasil dan Pembahasan

Praktikum kering berjudul Pengenalan Situs Bioinformatika NCBI dan


Penggunaanya Dalam Memahami Proses Ekspresi Gen ini bertujuan untuk Menelusuri
identitas suatu gen berdasarkan seken nukleotida menggunakan gene bank database,
memahami prinsip ekspresi gen yang meliputi transkripsi dan translasi serta
regulasinya, dapat mengidentifikasi bagian gen yang berperan sebagai promoter, coding
sequence (CDS), intron dan ekson, start dan stop kodon, serta regulating element dan
dapat memahami bagaimana suatu gen yang sama dapat menghasilkan protein yang
berbeda. Dalam percobaan ini, untuk memenuhi ketuntasan dari tujuan dilaksanakanny
praktikum kering ini, digunakan situs bioinformatika bertaraf internasional yang
dikenal sebagai NCBI.

NCBI merupakan server yang memuat data base tentang informasi kesehatan dan
bioteknologi. Data base terus menerus di update sesuai dengan penemuan-penemuan
terkini yang menyangkut DNA, Protein, Senyawa aktif dan taksonomi. NCBI
merupakan salah satu bank data gen, protein dan literature khususnya dibidang
kesehatan yang terlengkap dan diacu oleh para peneliti di dunia. National Center of
Biotechnology Informatic adalah bagian dari Amerika Serikat National Library of
Medicine (NLM), sebuah cabang dariNational Institutes of Health . Para NCBI terletak
di Bethesda, Maryland dan didirikan pada tahun 1988 melalui legislasi disponsori oleh
Senator Claude Pepper. Untuk mengakses NCBI dapat dibuka di
http://www.ncbi.nlm.nih.gov/ (Widodo dan Miftahkhunnafisah, 2010).
NCBI sendiri memiliki 3 software unggulan dengan fasilitas tertentu, diantaranya
ialah BLAST. BLAST (Basic Local Alignment Search Tool) merupakan suatu program
untuk pencarian kemiripan sekuen (sequence similarity) dan merupakan alat dalam
identifikasi gen dan karakter genetik. Tools ini terdiri atas lima program utama, yaitu :

1. nucleotide blast (blastn) : membandingkan suatu sekuen nukleotida meragukan


(query sequence) yang kita miliki dengan database sekuen nukleotida.

2. protein blast (blastp) : membandingkan suatu sekuen asam amino yang kita
miliki dengan database sekuen protein.

3. blastx : membandingkan produk translasi konsep 6frame sebuah sekuen


nukleotida (translated nucleotide) yang kita miliki dengan database sekuen protein.

4. tblastn : membandingkan suatu sekuen protein yang kita miliki dengan database
sekuen nukleotida yang secara dinamis ditranslasi pada semua pembacaan 6 frame.

5. tblastx : membandingkan suatu translasi 6 frame dari nukleotida.

NCBI dimanfaatkan dalam proses identifikasi nukleotida hasil dari ekspresi


gen. Ekspresi gen merupakan proses bagaimana informasi yang ada di dalam DNA
bisa di copy melalui proses traskripsi dalam organisme eukariot. Hasil proses
transkripsi adalah mRNA (transkrip primer). Di dalam organisme eukariot ada
tahapan proses tertentu sebelum menghasilkan RNA, yaitu RNA processing.
Kemudian diikuti tahap translasi yang akhirnya menghasilkan polypeptida. Jika
dalam proses tersebut ada tahapan yang tidak terjadi, maka dalam hal ini tidak
termasuk dalam kategori bahwa gen tersebut telah terekspresi atau dengan akta lain
tidak terjadi ekspresi gen (Ernawati, 2007).

Berikut adalah gambaran proses ekspresi gen menurut Qiao, et al., 2002 :
2. Dalam praktikum kali ini, identifikasi dilakukan terhadap sekuen
nukleotida
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTTAC
CCCGAGTCGCTGCCCCTTACCGTCAACCACGACTTGCAGAGGGGGA
AGGTGGAGGCTGACATCCCAGGCCATGGGCAGGAAGTCCCCCTTCC
ACCTCCGACTGTAGGGTCCGGTACCCGTCCTTCACCTCATCAGGCTC
TTTAAGGGTCACCCAGAGACTCTGGAGAAGGGAGTAGTCCGAGAAA
TTCCCAGTGGGTCTTCGAGACCTCTTCTTTGACAAGTTCAAGCACCT
GAAGTCAGAGGACGAGATGAAGGAAACTGTTCAAGTTCGTGGACTT
CAGTCTCCTGCTCTACTTCCCGTCTGAGGACTTAAAGAAGCATGGTG
CCACCGTGCTCACCGCGCAGACTCCTGAATTTCTTCGTACCACGGTG
GCACGAGTGGCGCCTGGGTTGCATGCTTAAGAAGAAGGGGCATCAT
GAGGCAGAGGGACCCACCGTAGGAATTCTTCTTCCCCGTAGTACTCC
GTCTCATTAAGCCCCTGGCACAGTCGCATGCCACCAATCACAAGATC
CTAATTCGGGGACCGTGTCAGCGTACGGTGGTTCGTGTTCTAGGCCG
TGAAGTACCTGGAGTTCATCTCGGAATCCATCATCCAGGTGGCACTT
CATGGACCTCAAGTAGAGCCTTACGTAGTAGGTCCATCTGCAGAGCA
AGCATCCCGGGGACTTTGGTGCTGATGCCCAGAGACGTCTCGTTCGT
AGGGCCCCTGAAACCACGACTACGGGTCGGGGCCATGAACAAGGC
CCTGGAGCTGTTCCGGAAGGACATGGCCCCGGTACTTGTTCCGGGA
CCTCGACAAGGCCTTCCTGTACCCCTCCAACTACAAGGAGCTGGGC
TTCCAGGGCTAGGGAGGTTGATGTTCCTCGACCCGAAGGTCCCGATC
yang memberikan data hasil yang menggambarkan proses ekspresi gen dari
nukleotida terkait. Dimana hasil identifikasi dijabarkan dalam beberapa point
fokus yang menunjukan informasi pering terkait sampel nukleotida.

1. Locus, definition, dan organism

Locus selalu menempati baris pertama pada tampilan entry, yang menunjukan nama
sekuen pada GenBank, terdiri dari nama sekuen, panjang sekuen (pasang basa/base
pairs), molekul, bentuk molekul, dan tanggal update terakhir. Locus sendiri
menunjukan posisi gen yang diidentifikasi. Disamping locus, definition juga
melengkapi informasi yang mendeskripsikan sekuen terkait. Kolom definition didukung
dengan keberadaan kolom organism dimana kolom ini memberikan informasi terkait
organisme pemilik sekuen nukleotida terkait.
2. Summary

Pada kolom ini, dibeberkan beberapa informasi terkait sekuen nukleotida yang
diidentifikasi. Dari sampel yang digunakan, pada kolom ini diketahui bahwa gen terkait
mengkode anggota dari superfamili globin dan diekspresikan dalam otot rangka dan
juga otot jantung. Kode protein tersebut merupakan haemoprotein yang berperan untuk
penyimpanan oksigen intraseluler dan difusi oksigen transeluler terfasilitasi. Sekurang-
kurangnya terdapat tiga varian transkrip alternatif yang diketahui mengkode protein
yang sama.

3. Features
Pada kolom features ini diinformasikan mengenai catatan atau keterangan
mengenai ciri/karakter setiap sekuen. Dari data pada kolom ini, didapatkan data sebagai
berikut :

CDS 81...545

Exon 1...175

176...398
399...1078

4. Origin

Data pada kolom ini berhubungan dengan data yang diberikan pada kolom features,
dimana dilihat dari CDS (81...545) dapat memperkecil luas fokus identifikasi sekuen
nukleotida yang berarti sekuen terletak diantara data nomor 81 hingga 545. Dari
penelusuran terhadap origin, diawali dari baris 121 hingga 541, didapatkan data sebagai
berikut :

Promotor, menentukan di mana transkripsi dimulai dan juga menentukan


yang mana dari kedua untai heliks DNA yang digunakan sebagai cetakan,
ditemukan berupa GACA di 141 (pada baris 121).

Start kodon, kodon pertama yang diterjemahkan pada saat translasi atau
disebut juga kodon inisiasi, ditemukan berupa ATG di 154 (pada baris 121).

Stop kodon, merupakan triplet nukleotida dalam RNA yang bertanggung


jawab atas penghentian proses penerjemahan, ditemukan berupa TAG di 543
(pada baris 541).

VI. Kesimpulan

1. Gen dari hasil identifikasi mengkode anggota dari superfamili globin dan
diekspresikan dalam otot rangka dan juga otot jantung. Kode protein tersebut
merupakan haemoprotein yang berperan untuk penyimpanan oksigen intraseluler dan
difusi oksigen transeluler terfasilitasi. Sekurang-kurangnya terdapat tiga varian
transkrip alternatif yang diketahui mengkode protein yang sama.
2. Ekspresi gen merupakan proses bagaimana informasi yang ada di dalam DNA
bisa di copy melalui proses traskripsi dalam organisme eukariot. Hasil proses
transkripsi adalah mRNA (transkrip primer). Kemudian diikuti tahap translasi yang
akhirnya menghasilkan polypeptida.

3. Sekuen gen terletak pada CDS 81 hingga 545, dimana promotor GACA berapa
pada 141, start kodon ATG pada posisi 154, dan stop kodon pada posisi %$# beruppa
TAG.

4. Gen terkait diketahui mengkode tiga varian protein yang berbeda, dimana hal ini
di pengaruhi oleh beberapa faktor, salah satunya oleh enzim.

VII. Daftar Pustaka

Altschul SF., W. Gish., W. Miller et al. 1990. Basic Local Alignment Search Tool.

J. Mol. Biol. 215, 403410.

Ernawati. 2007. Pengaturan Ekspresi Gen. Jurnal Biomedis. Vol I (I) : 23-30.

Geneious. 2013. Accessing NCBI BLAST Through Geneious. New York :

Biomatters Ltd.

Qiao, Chunping., Wang, Bing., Zhu, Xiadong., Li, Juan., dan Xiao, Xiao. 2002. A

Novel Gene Expression Control System and Its Use in Stable, High-Titer 293

Cell-Based Adeno-Associated Virus Packaging Cell Lines. Journal of

Virology. Vol 76 (24) : 13025.

Widodo dan Miftahkhunnafisah. 2010. Pengenalan NCBI Untuk Analisis


DNA, Protein, dan Senyawa Kimia. Jurnal Biosistem. Vol 1 (I) : 1-22.

Surakarta, 5 April 2016


Mengetahui,

Asisten Praktikum Praktikan,

( ) ( Farah Nadia)