Anda di halaman 1dari 28

LANGKAH – LANGKAH MENGIDENTIFIKASI IDENTITAS DAN

MEMBUAT POHON FILOGENI EUKARIOT

1. Alat
Alat-alat yang digunakan pada praktikum ini yaitu laptop, modem atau wifi,
software BioEdit, microsoft word, software mega dan website NCBI-Blast.
2. Bahan
 Forward Sequence (Eukariot)
CGTCGTTTGACGCATATCGCAGTCCATGCTGTTATGTACTTTAATT
AATTTTATAGTGCTGCTTGGACTACATATGGTTGAGGGTTGTAAG
ACTATGCTAATTAAGTTGCTTATAAATTTTTATAAGCATATGGTA
TATTATTGGATAAATATAATAATTTTTATTCATAATATTAAAAAA
TAAATGAAAAACATTATCTCACATTTGAATGTGAAAAACGAAGA
GAAATATTTTCTTTTTCAATCAAATAATACTGAGAAATGTCTAGC
ATAAAAAATTGAAATATTTTTCATCTAGAATTGTCTCTTATTAAT
GATTCGGAAATAGAAAAATCTTGGTTATGTTATTATTCTTCGTTG
GTTCGTTAAAAATGGATAAATAAAAACTTTGCATACAAGAATTA
ATAAAAATGTTATAACGAATTTAATTAAATGTTTTATCATTATAT
ATAAAGAATTTATGGCAAGATAAAGTTATATACAACCTCAACTC
ATATGGGACTACCCCCTAAATTTAAGCATAAAAGATGA
 Reverse Sequence (Eukariot)
CCAAGACTTCGTGTATATACTTTATCTTGCCATAAATTCTTTATAT
ATAATGATAAAACATTTAATTAAATTCGTTATAACATTTTTATTA
ATTCTTGTATGCAAAGTTTTTATTTATCCATTTTTAACGAACCAAC
GAAGAATAATAACATAACCAAGATTTTTCTATTTCCGAATCATTA
ATAAGAGACAATTCTAGATGAAAAATATTTCAATTTTTTATGCTA
GACATTTCTCAGTATTATTTGATTGAAAAAGAAAATATTTCTCTT
CGTTTTTCACATTCAAATGTGAGATAATGTTTTTCATTTATTTTTT
AATATTATGAATAAAAATTATTATATTTATCCAATAATATACCAT
ATGCTTATAAAAATTTATAAGCAACTTAATTAGCATAGTCTTACA
ACCCTCAACCATATGTAGTCCAAGCAGCACTATAAAATTAATTAA
AGTACATAACAGCATGGACTGCGATATGCGTTCAAAATGTCGAT
GTTCATGTGTCTGCAAGTTTCACAAAAAAATTTTA
3. Metode Kerja
Langkah–langkah mengidentifikasi identitas eukariot dari sekuens DNA
dan pembuatan pohon filogeni pada software mega:
1) Buka file forward sequence eukariotik menggunakan software BioEdit.

2) Salin forward sequence dengan cara mengklik bar menu edit dan pilih
copy sequence as a raw text.

3) Paste ke microsoft word.


4) Lakukan editing dengan cara memblock dari awal sampai ke titik pik nya
yang sudah jelas lalu salin sequence dengan cara mengklik bar menu edit
lalu memilih copy selection.

5) Tekan tombol Ctrl+f dan paste-kan pada microsoft word maka akan
muncul seperti ini.
6) Delete bagian yang terblock.

7) Lakukan editing pada bagian yang diinginkan pada sequence dengan cara
memblock bagian yang diinginkan hingga kode sequence akhir lalu copy
sequence tersebut.
8) Tekan tombol Ctrl+f dan paste-kan pada microsoft word maka akan
muncul seperti ini.

9) Delete bagian yang terblock. Pengeditan selesai untuk forward sequence.


10) Buka file Reverse Sequence.

11) Salin reverse sequence dengan mengklik bar menu edit dan pilih copy
sequence as a raw text.
12) Paste ke microsoft word.

13) Lakukan editing dengan cara memblock dari awal sampai ke titik pik
nya yang sudah jelas lalu salin sequence dengan cara mengklik bar
menu edit lalu memilih copy selection.
14) Tekan tombol Ctrl+f dan paste-kan pada microsoft word maka akan
muncul seperti ini.

15) Delete bagian yang terblock.


16) Lakukan editing pada bagian yang diinginkan pada sequence dengan
cara memblock bagian yang diinginkan hingga kode sequence akhir lalu
copy sequence tersebut.

17) Tekan tombol Ctrl+f dan paste-kan pada microsoft word maka akan
muncul seperti ini.
18) Delete bagian yang terblock. Pengeditan selesai untuk reverse sequence.

19) Klik file new aliment di bio edit.


20) Copy forward sequence di microsoft word.

21) Masukkan copy data forward sequence dari microsoft word ke BioEdit
dengan cara mengklik file pada bar menu lalu klik import from
clipboard.
22) Ganti namanya menjadi forward dengan mendouble klik namanya.

23) Copy reverse sequence di microsoft word.


24) Masukkan copy data reverse sequence dari microsoft word ke BioEdit
dengan cara mengklik file pada bar menu lalu klik import from
clipboard.

25) Ganti namanya menjadi reverse dengan mendouble klik namanya.


26) Blok nama reverse lalu klik sequence pada bar menu kemudian pilih
Nucleic Acid dan klik Reverse Complement.

27) Sejajarkan forward sequence dan reverse sequence dengan cara


memblok pada nama forward dan reverse. Setelah itu klik sequence
pada bar menu kemudian pilih Painwise alignment lalu klik Align two
sequence (Allow ends to slide).
28) Buatlah consensus sequencenya dengan cara mengklik Alignment pada
bar menu kemudian klik Create Consensus Sequence.
29) Salin consensus sequence ke microsoft word dengan cara mengklik
consensus lalu pilih edit kemudian klik copy sequences to clipboard
(fasta format).

30) Paste ke Microsoft word.


31) Buka browser lalu ketik https://blast.ncbi.nlm.nih.gov/Blast.cgi.

32) Pilih Nucleotide BLAST kemudian copy consesnsus sequence di


microsoft word dan paste ke kolom sequence(s) pada BLAST.
33) Pilihlah 16s ribosomal RNA sequences pada kolom Database. Lalu klik
BLAST.

34) Hasil identifikasi sequence eukariot dijelaskan.


35) Setelah didapatkan jenis organismenya, lalu diambil 5 jenis organisme
yang lain. Setelah itu, diklik fasta dan dicopy sequence DNA masing-
masing organisme di note pad lalu disimpan dalam bentuk file .fasta.
36) Dilanjutkan dengan membuka aplikasi mega.6

37) Kemudian diblok semua sequence DNA, lalu diklik Alignment,


ClustalW lalu Klik OK.
38) Setelah itu diklik menu Phylogeny dan dipilih Tes UPGMA Tree.

39) Hasil pohon filogeni eukariot drosophila melanogaster.


LANGKAH – LANGKAH MEMBUAT POHON FILOGENI PROKARIOT
PADA SOFTWARE MEGA

1. Alat
Alat-alat yang digunakan pada praktikum ini yaitu laptop, modem atau wifi,
software BioEdit, microsoft word, software mega dan website NCBI-Blast.
2. Bahan
 Consensus Sequence (Prokariot)
GGCAGCTACCATGCAGTCGACGATGATGCCCGAGCTTGCTCGGGTGGATTAGTGGCGA
ACGGGTGAGTAACACGTGAGTAACCTGCCCTTCACTCTGGGATAAGCCTGGGAAACTGG
GTCTAATACTGGATATGACGGCGCACTGCATGGTGTGTTGTGGAAAGATTTTTTCGGTG
AAGGATGGGCTCGCGGCCTATCAGCTTGTTGGTGGGGTAGTGGCCTACCAAGGCGGTG
ACGGGTAGCCGGCCTGAGAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGAC
TCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGA
CGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGCCATTGACGAAGCCC
TTCGGGGTGACGGTAGGTGGAGAAGAAGCACCGGCTGACTACGTGCCAGCAGCCGCGG
TAATACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGT
TTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACTCCGGGTCTGCAGTGGGTACGGGCA
GACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGGTGTAGCGGTGAAATGCGCAGATA
TCAGGAGGAACACCGATGGCGAAGGCAGGTCTCTGGGCCATTACTGACGCTGAGAAGC
GAAAGCATGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCATGCCGTAAACGTTGG
GCGCTAGGTGTGGGATCCATTCCACGGGTTCCGTGCCGCAGCTAACGCATAAGC
3. Metode Kerja
Langkah–langkah mengidentifikasi identitas eukariot dari sekuens DNA
dan pembuatan pohon filogeni pada software mega:
1) Buka browser lalu ketik https://blast.ncbi.nlm.nih.gov/Blast.cgi.
2) Pilih Nucleotide BLAST kemudian copy consesnsus sequence di
microsoft word dan paste ke kolom sequence(s) pada BLAST.

3) Pilihlah 16s ribosomal RNA sequences pada kolom Database. Klik


BLAST.
4) Hasil identifikasi sekuens prokariot menunjukkan beberapa sekuens
DNA dari beberapa bakteri.
5) Setelah didapatkan jenis organismenya, lalu diambil 5 jenis organisme
yang lain. Setelah itu, diklik fasta dan dicopy sequence DNA masing-
masing organisme di note pad lalu disimpan dalam bentuk file .fasta.

6) Dilanjutkan dengan membuka aplikasi mega.6


7) Kemudian diblok semua sequence DNA, lalu diklik Alignment, ClustalW
lalu Klik OK.

8) Setelah itu diklik menu Phylogeny dan dipilih Tes UPGMA Tree.
9) Hasil pohon filogeni prokariot.