PAPER REPRODUKSI

Delayed Puberty

Oleh

Moscatia Tobilolon Muda (2209020017)

PENDIDIKAN PROFESI DOKTER HEWAN

FAKULTAS KEDOKTERAN DAN KEDOKTERAN HEWAN
UNIVERSITAS NUSA CENDANA
2022
 Delay pubertas atau keterlambatan pubertas merupakan salah satu gangguan reproduksi
yang menyebabkan infertilitas pada sapi. Menurut Talib, (2002) idealnya sapi Bali mencapai
pubertas pada usia 18 – 24 bulan, dan beranak pertama kali pada usia 30 sampai 38 bulan,
sehingga pubertas yang belum dicapai pada usia tersebut dapat menjadi salah satu indikasi
adanya delay pubertas. Awal pubertas dimulai dengan pelepasan hormon gonadotropin dari
kelenjar adenohipofisa anterior yang menstimulasi perkembangan serta pematangan folikel.
Sehingga perubahan pada status metabolisme akan diikuti perubahan metabolisme hormon akan
memicu onset pubertas (Evans et al., 1995). Terdapat beberapa faktor yang mempengaruhi
pubertas pada sapi, diantaranya nutrisi dan komposisi berat tubuh, faktor genetik, serta
manajemen kandang yang semuanya berpengaruh terhadap regulasi hormon dalam induksi
ovulasi (Budiyanto et al., 2016; Perry, 2016).
Faktor nutrisi berpengaruh ketika terjadi kekurangan nutrisi pada masa pre pubertas yang
menghambat perkembangan sistem endokrin reproduktif. Pada ovarium, feed intake yang rendah
akan menunda pubertas yang disertai penurunan perkembangan folikel ovarium sehingga pada
sapi betina feed intake yang rendah dapat menyebabkan ukuran folikel dominan lebih kecil
(Yendraliza, 2013). Dilaporkan bahwa kurangnya nutrisi mempengaruhi produksi Insulin-Like
Growth Factor 1 (IGF-1), yang jika mengalami penurunan akan mempengaruhi hipotalamus dan
hipofisis dalam pelepasan Gonadotropin Releasing Hormon (GnRH) (Chandra et al., 2022).
Sumber lain menyebutkan pernanan IGF-1 sebagai salah satu substansi faktor pertumbuhan
perkembangan folikel serta proliferasi sel selama folikulogenesis. Sehingga kekurangan faktor
pertumbuhan ini bepengaruh terhadap atresia sel. Pada penelitian yang dilakukan oleh Gupta et
al., (2016) menyebutkan diet dengan konsentrasi protein dan energy yang tepat membantu proses
pertumbuhan serta pubertas. Sumber lain menerangkan kekurangan nutrisi berpengaruh terhadap
produksi serum leptin, dimana serum ini akan menghambat sekresi LH yang menginduksi
terjadinya ovulsi (Heryani & Laksmi, 2018). Dijelaskan leptin pada ruminansia bertindak
sebagai sinyal metabolic yang berhubungan dengan respon sekresi gonadotropin (Machiel et al.,
2004). Lebih lanjut dikatakan bahwa total lemak tubuh berpengaruh terhadap kesuksesan
pubertas sapi. Dimana rasio lemak tubuh dipengaruhi oleh asam linoleat yang menyebabkan
reduksi adiposa serta leptin, diikuti dengan keterlambatan pubertas (Garcia et al., 2003). Pakan
sapi yang 100% berasal dari rumput alam akan mengalami defisiensi mineral yang dapat
menurunkan reproduktivitas. Penelitian yang dilkukan oleh Utomo et al., (2013) melaporkan
defisiensi mineral Cu pada sapi Katingan pra pubertas diduga mempengaruhi pencapaian awal
umur pubertas, karena peranan mineral Cu dalam metabolisme estrogen sehingga menyebabkan
gangguan ovarium. Dari uraian ini dapat dijelaskan bahwa kekurangan nutrisi pada masa
prepubertas berpengaruh terhadap perkembangan organ reproduksi hingga penurunan fungsi
ovarium yang selanjutnya mempengaruhi pubertas sapi, sehingga nutrisi seimbang diperlukan
untuk mencapai pubertas yang maksimal (Faidiban, 2018).
Tidak hanya nutrisi, dilaporkn oleh Wiltbank et al.(1969) anak sapi yang diberikan
rumput gandum sebanyak 1.3-1.8 kg dan 0.2 kg dari 40 % suplemen protein per ekor per hari
mengalami masa pubertas lebih lambat yakni hari ke 527 dibandingkan dengan hasil persilangan
mereka. Sehngga dapat dikatakan meskipun nutrisi yang diberikan tercukupi namun ada
pengaruh genetik yang menyebabkan keterlambatan pubertas. Pada penelitian oleh Laster et al.,
(1972) menyebutkan hasil persilangan sapi Hereford dan Angus mencapai pubertas yang lebih
cepat sekitar 19.5 hari yakni pada hari ke 510 dibandingkan keturunan murni dari sapi Hereford
dan Angus. Faidiban, (2018) menyatakan breed sapi yang berat seperti Bos Taurus mencapai
waktu pubertas lebih cepat dibanding breed sapi yang ringan seperti Bos indicus dan Bos
sondaicus.

Gambar 1. Usia pubertas sapi betina berbagai spesies dan antar spesies (Sumber; Faidiban,
2018)
 Faktor manajemen perkandangan, diungkapkan oleh Schubach et al., (2017) bahwa
manajemen kandang membantu dalam optimalisasi masa pubertas sapi karena berpengaruh
terhadap respon stress dan fisiologis sapi dara. Respon stress kemudian mempengaruhi produksi
neurotransmitter dalam regulasi hormon proses reproduksi. Dalam sumber ini manajemen
kandang yang dibahas berhubungan dengan populasi sapi dalam satu kandang dimana terjadi
penurunan aktifitas fisik serta peningkatan stress kemungkinan besar dipengaruhi oleh
banyaknya sapi dalam satu kandang.

Gambar 2. Persentasi progesterone plasma yang diukur pada sapi dara. Garis warna abu pada
kepadatan tebar rendah dan garis hitam sapi dara pada kepadatan tebar tinggi
(sumber; Schubach et al., 2017)

Keterlambatan pubertas bersifat reversible yang artinya dapat diperbaiki atau

disembuhkan. Perbaikan kondisi ini dimulai dari perbaikan manajemen kandang, serta nutrisi
sebagai salah satu faktor pemicu pubertas, dan terapi hormon. Keseimbangan nutrisi harus
terpenuhi seperti kebutuhan protein, energi, serta mineral, dimana seperti dijelaskan diatas bahwa
kekurangan zat ini terbukti berpengaruh terhadap produksi hormon. Kesemuaan faktor ini
menurut Cooke, (2017) masuk kedalam faktor yang mempengaruhi efisiensi reproduksi ternak
sapi. Selain perbaikan nutrisi untuk mencegah keterlambatan pubertas, terapi hormon terbukti
mampu menangani kasus ini. Diantaranya pemberian GnRH yang dapat menginduksi pelepasan
FSH dan LH di hipofisa anterior untuk kepentingan pertumbuhan folikel. Pemberian GnRH
dengan dosis 100 μg/ekor secara intra muskular terbukti mampu mengatasi keterlambatan
pubertas, dengan meningkatkan perkembangan folikel, intensitas estrus, serta munculnya estrus
pada 16 ekor sapi berumur 24 bulan atau lebih dan belum pernah menunjukkan tanda tanda
estrus (Chandra et al., 2022). Selain GnRH penggunaan kombinasi GnRH, PGF2α dan estrogen
pada metode Heatsynch terbukti mampu mengatasi masalah keterlambatan pubertas pada sapi
dara dengan waktu pubertas lebih cepat 99 hari dibanding sapi dengan kontrol negatif atau tanpa
perlakuan (Fausiah, 2017). Dalam sumber ini, penggunaan PGF2α dilakukan terhadap sapi
anestrus yang memiliki Corpus Luteum Persisten, dan penggunaan hormon dikombinasikan
dengan GnRH serta estrogen. Namun pada penelitian oleh Chaudhary et al., (2018) efek
penggunaan Doublesynch dan Estradoublesynch mampu menginduksi estrus pada sapi dara yang
berusia 30-42 bulan, dengan metode yang disarankan ialah Estradoublesynch karna dinilai lebih
efektif. Adapun pada protokol Doublesynch sapi dara diinjeksi IM dengan GnRH analog
sebanyak 20 µg pada hari kedua dimulainya penelitian, serta protokol Estradoublesynch
dilakukan dengan kombinasi estradiol benzoate 1 mg pada hari ke 10 dan injeksi GnRH pada
hari ke 11.
 DAFTAR PUSTAKA

Budiyanto A, Thopianong TC, Triguntoro, Dewi HK. 2016. Gangguan reproduksi sapi bali pada
pola pemeliharaan semi intensif di daerah sistem integrasi sapi kelapa sawit. Acta Vet.
Indon. 4(1): 14- 18.

Chandra, A. A. A., Trilaksana, I. G. N. B., & Pemayun, T. G. O. (2022). Penggunaan

Gonadorelin dalam Penanganan Keterlambatan Pubertas pada Sapi Bali. Buletin Veteriner
Udayana, 158, 572. https://doi.org/10.24843/bulvet.2022.v14.i05.p17

Chaudhary, N. J., Patel, D. M., Dhami, A. J., Vala, K. B., Hadiya, K. K., & Patel, J. A. (2018).
Effect of Doublesynch and Estradoublesynch protocols on estrus induction, conception rate,
plasma progesterone, protein, and cholesterol profile in anestrus Gir heifers. Veterinary
World, 11(4), 542–548. https://doi.org/10.14202/vetworld.2018.542-548

Cooke, R. F. (2017). Nutritional and Management Considerations to Minimize Stress and

Optimize Production Efficiency in Cow-Calf Systems.

Faidiban, O. R. (2018). Puberty in Beef Heifers: A Review. Jurnal Ilmu Peternakan Dan
Veteriner, 5(1), 20–27. https://doi.org/10.30862/jipv.v5i1.759

Fausiah, A. (2017). Upaya Meningkatkan Efisiensi Reproduksi pada Sapi Perah Dara yang
Mengalami Keterlambatan Pubertas dengan Menggunakan Metode Heatsynch.

Garcia, M. R., Amstalden, M., Morrison, C. D., Keisler, D. H., & Williams, G. L. (2003). Age at
puberty, total fat and conjugated linoleic acid content of carcass, and circulating metabolic
hormones in beef heifers fed a diet high in linoleic acid beginning at four months of age.
Journal of Animal Science, 81(1), 261–268. https://doi.org/10.2527/2003.811261x

Gupta, S. K., Singh, P., Shinde, K. P., Lone, S. A., Kumar, N., & Kumar, A. (2016). Strategies
for attaining early puberty in cattle and buffalo: A review. Agricultural Reviews, 37(2).
https://doi.org/10.18805/ar.v37i2.10741

Heryani, L. G. S. S., & Laksmi, D. N. D. I. (2018). RELATIONSHIP BETWEEN THE

ESTABLISHMENT OF FIRST ESTRUS ( PUBERTY ) AND LEPTIN LEVELS IN BALI
 CATTLE. SENASTEK UDAYANA UNIVERSITY, 20018.00328.

Perry, G. A. (2016). Factors affecting puberty in replacement beef heifers. Theriogenology,

86(1), 373–378. https://doi.org/10.1016/j.theriogenology.2016.04.051

Schubach, K. M., Cooke, R. F., Brandão, A. P., Lippolis, K. D., Silva, L. G. T., Marques, R. S.,
& Bohnert, D. W. (2017). Impacts of stocking density on development and puberty
attainment of replacement beef heifers. Animal, 11(12), 2260–2267.
https://doi.org/10.1017/S1751731117001070

Talib, C. (2002). Sapi Bali di Daerah Sumber Bibit dan Peluang Pengembangannya. Wartazoa,
12(3), 100–107.

Utomo, B., Noor, R., Sumantri, C., Supriatna, I., & Gurnardi, E. (2013). Pubertas Sapi Katingan
Betina Dikaitkan dengan Konsentrasi Mineral Cu dan Lingkungan. JITV, 18(2), 123–130.

Yendraliza. (2013). Pengaruh Nutrisi dalam Pengelolaan Reproduksi Ternak (Studi Literatur).
Kutubkhanah, 16(1), 20–26.

Wiltbank, J.N., C.W , Kasson, & J.E. Ingalls. 1969. Puberty in crossbred and straight-bred beef
heifers on two levels of feed. J. Anim. Sci., 29: 602-605
ACTA VETERINARIA INDONESIANA
ISSN 2337-3202, E-ISSN 2337-4373 Vol. 4, No. 1: 14-18, Januari 2016

Penelitian
Gangguan Reproduksi Sapi Bali pada Pola Pemeliharaan Semi Intensif
di Daerah Sistem Integrasi Sapi - Kelapa Sawit
(Bali Cattle Reproductive Disorders of Semi Intensive Management in the Area of Cattle - Oil Palm
Integration System

Agung Budiyanto1*, Tarsisius Considus Tophianong2, Triguntoro3, Henny Kusuma Dewi4

Bagian Reproduksi dan Kebidanan Fakultas Kedokteran Hewan Universitas Gadjah Mada Yogyakarta
1

2
Bagian Klinik, Reproduksi dan Patologi Fakultas Kedokteran Hewan Universitas Nusa Cendana, Kupang
3
Balai Veteriner Lampung
4
Puskeswan Kampung Melayu Kotamadya Bengkulu
*
Penulis untuk korespondensi:agung_bd2004@yaho.com
Diterima 16 Oktober 2015, Disetujui 12 Desember 2015

ABSTRAK
Pemeliharaan sapi Bali di Kotamadya Bengkulu dengan Sistem Integrasi Sapi - Kelapa Sawit (SISKA)
sudah berjalan beberapa tahun. Salah satu parameter keberhasilan program ini adalah performa
reproduksi sapi Bali. Performa reproduksi sapi Bali menggambarkan kualitas dari sistem manajemen
pemeliharaan yang telah dilakukan. Kajian performa reproduksi sapi Bali tersebut sudah dilakukan
dengan pemeriksaan reproduksi secara per rektal dan analisa data recording peternak dan petugas.
Tujuan utama dari program manajemen reproduksi adalah mendapatkan produksi yang optimal
dan keuntungan yang maksimal. Efisiensi reproduksi menentukan produktivitas, profitabilitas dan
keberlanjutan dari setiap usaha peternakan. Adanya gangguan reproduksi menyebabkan inefisiensi
reproduksi. Kondisi ini akan menyebabkan kerugian ekonomi. Tujuan penelitian ini adalah untuk
mengetahui kondisi gangguan reproduksi dan respon kesembuhannya. Sebanyak 333 ekor sapi Bali
betina dengan umur minimal 2 tahun dilakukan pemeriksaan reproduksi. Metode penelitian dilakukan
melalui beberapa tahap yaitu anamnesa, pemeriksaan klinis dan pemeriksaan reproduksi secara per
rektal. Penanganan gangguan reproduksi dinyatakan sembuh apabila timbulnya respon klinis berupa
estrus. Data yang diperoleh kemudian dicatat dan dianalisa secara deskriptif. Berdasarkan hasil
pemeriksaan diketahui bahwa 193 (57,95 %) sapi betina mengalami gangguan reproduksi yang meliputi
delayed pubertas, hipofungsi ovarium, metritis, endometritis dan anestrus postpartum. Sedangkan
sebanyak 80 (41,45 %) sapi sudah menunjukan gejala estrus. Adanya interaksi yang kompleks antara
faktor lingkungan atau manajemen (nutrisi), respon individual, jenis gangguan reproduksi dan derajat
keparahan gangguan reproduksi akan menimbulkan respon kesembuhan yang bervariasi dari setiap
penanganan gangguan reproduksi.
Kata kunci: gangguan reproduksi, sapi bali, estrus, Bengkulu

ABSTRACT

The maintenance of Bali cattles in Bengkulu regency with Cattle - Oil Palm Integration System
(SISKA) has been running several years. The one parameters of the success this program is the
reproductive performance of Bali cattle. Bali cattle reproductive performance describe the quality of
the maintenance management system that has been done. Bali cattle reproductive performance study
has been conducted with reproductive rectal examination and analysis of the data recording breeders
and farmer. The main purpose of the reproductive management program was getting the optimal
production and maximum benefit. Reproductive efficiency determines the productivity, profitability
and sustainability of each farm. The inefficiency reproductive was caused by existence of reproductive
disorders. These conditions cause economic losses. The purpose of this study was to determine the
condition of reproductive disorders and recovery response. A total of 333 cows Bali females with at
least 2 years of age has been reproductive examination. The research methods were done through clas-

© 2016 Fakultas Kedokteran Hewan IPB http://www.journal.ipb.ac.id/indeks.php/actavetindones

 Gangguan Reproduksi Sapi Bali | 15

sification for several stages, anamnesis, clinical examination and reproductive examination by rectally
palpation. Treatment of reproductive disorders declared cured if the onset of clinical response in the
form of estrus. The data obtained then were recorded and analyzed descriptively. Based on the results
of the examination reported that 193 (57.95%) of female Bali cattles experiencing reproductive disorders
which include delayed puberty, ovarian hypofunction, metritis, endometritis and postpartum anestrus.
While as many as 80 (41.45%) of female Bali cattles were showing signs of estrus. The existence of
complex interactions between environmental factors or management (nutrition), individual responses,
the type and severity of reproductive disorders were affected of varies healing response from each
treatment of reproductive disorders.
Keywords: reproductive disorders, bali cattle, oestrus, Bengkulu

PENDAHULUAN faktor penting pada kejadian gangguan reproduksi

Kebutuhan pangan asal hewan (daging) di In-
donesia semakin meningkat, sementara ketersedi-
aannya terbatas. Keterbatasan pangan asal hewan
(daging) disebabkan oleh menurunnya angka ke-
lahiran yang menyebabkan penurunan populasi
ternak di Indonesia. Fakta dilapangan dan bebe-
rapa hasil kajian ilmiah telah membuktikan bah-
wa kondisi ini disebabkan oleh adanya penurunan
performance reproduksi ternak, akibat gangguan
reproduksi. Tujuan utama dari program manajemen
reproduksi adalah mendapatkan produksi yang op-
timal dan keuntungan yang maksimal (Gitonga,
2010). Kinerja reproduksi menentukan produkti-
vitas, profitabilitas dan keberlanjutan dari setiap
usaha peternakan, dapat dikatakan bahwa tanpa
reproduksi tidak akan terjadi produksi dan profita-
bilitas. Menurut Gitonga (2010), dikatakan bahwa
jika seekor sapi tidak mengalami siklus estrus seca-
ra regular dengan calving interval 12 sampai 15 bu-
lan, maka produktifitas, profitabilitas dan keberlan-
jutan usaha peternakan tidak akan tercapai.
Gangguan reproduksi secara langsung mengaki-
batkan kegagalan fertilisasi dan secara tidak lang-
sung mengakibatkan estrus postpartum > 90 hari,
days open > 85 – 110 hari, calving interval > 12 – 15
bulan, conception rate < 60 %, servis per concepti-
on > 1,5 dan angka kelahiran pedet menurun. Kon-
disi ini akan memberi dampak kerugian ekonomi
berupa adanya biaya tambahan untuk pengobatan
dan perkawinan, panjangnya masa tidak produktif,
meningkatnya jumlah ternak yang diafkir dan me-
nurunnya populasi (Gitonga, 2010; Budiyanto et al.,
2013).
Fakta di lapangan dan beberapa hasil penelitian
membuktikan bahwa inefisiensi reproduksi sapi da-
pat disebabkan oleh berbagai faktor diantaranya
nutrisi, penyakit, gangguan reproduksi dan manaje-
men pemeliharaan termasuk manajemen pemeli-
haraan postpartum. Nutrisi merupakan salah satu
sapi potong didaerah tropis. Nutrisi dan cadangan
energi tubuh dibutuhkan dalam proses metabo-
lisme, sintesis hormon reproduksi, pertumbuhan,
laktasi dan aktivitas reproduksi. Defisiensi nutri-
si mengakibatkan delayed pubertas, penurunan
fungsi ovarium atau hipofungsi ovarium dan dalam
jangka waktu lama dapat menjadi atropi ovarium
yang bersifat irreversible serta panjangnya durasi
anestrus postpartum > 60 – 90 hari. Selain faktor
nutrisi adanya infeksi pada uterus postpartum se-
perti metritis puerpuralis, dan endometritis secara
lansung mengakibatkan delayed involusi, dan seca-
ra tidak langsung mengakibatkan estrus postpar-
tum > 60-90 hari, kegagalan fertilisasi dan kawin
berulang atau repeat breeding, servis per concep-
tion > 1,5 dan calving interval > 12-15 bulan (Ahuja &
Montiel, 2005; Azawi, 2008; Gitonga, 2010).
Fakta dilapangan membuktikan bahwa ± 90 %
sapi potong pada peternakan rakyat di Bengkulu
adalah bangsa sapi Bali dengan sistem pemeliha-
raan semi intesif “Sistem Integrasi Sapi - Kelapa
Sawit” (SISKA), sedangkan sistem perkawinannya
adalah perkawinan alami atau inseminasi buatan.
Berdasarkan hasil pengamatan dilapangan diketa-
hui bahwa adanya keterlambatan pubertas atau
delayed pubertas pada sapi Bali yang sudah menca-
pai umur > 2 tahun, adanya infeksi uterus postpar-
tum dan anestrus yang panjang. Kondisi demikian
menyebabkan inefisiensi reproduksi sapi potong di
Bengkulu.
Dari uraian diatas dapat diketahui bahwa gang-
guan reproduksi sapi potong masih banyak terjadi
pada peternakan rakyat di Kecamatan Kampung
Melayu Kotamadya Bengkulu. Penanganan gang-
guan reproduksi dan penerapan teknologi repro-
duksi, seperti sinkronisasi estrus dan inseminasi
buatan akan mampu meningkatkan reproduktivitas
dan produktivitas sapi. Tujuan penelitian ini adalah
untuk mengetahui kondisi gangguan reproduksi
pada sapi Bali dan respon kesembuhannya.

http://www.journal.ipb.ac.id/indeks.php/actavetindones
16 | Budiyanto et al.
BAHAN DAN METODE
Bahan
Sebanyak 333 ekor sapi Bali betina dengan umur
minimal 2 tahun dilakukan pemeriksaan reproduk-
si pada peternakan rakyat di Kecamatan Kampung
Melayu Kotamadya Bengkulu Provinsi Bengkulu.
Penelitian ini dilakukan pada tanggal 17 sampai 22
September 2015. Penentuan umur sapi pada pene-
litian ini berdasarkan anamnesa, estimasi gigi atau
lingkar tanduk. Sistem pemeliharaan sapi Bali ter-
sebut adalah sistem semi intesif “Sistem Integrasi
Sapi Kelapa Sawit” (SISKA). Sistem ini merupakan
pola pemeriharaan sapi Bali dengan cara pada wak-
tu pagi 10.00 WIB sapi ditambat atau dilepas di
perkebunan kelapa sawit dan pada sore hari 18.00
WIB sampai pagi hari sapi ditambat dalam kandang
disekitar rumah pemilik. Sapi Bali tersebut mempe-
roleh pakan berupa rumput dan daun kelapa sawit
di area perkebunan. Air minum dibawakan oleh pe-
ternak atau peternak membawa sapi ke sumber air
pada saat-saat tertentu di siang hari. Bahan yang
digunakan adalah hormon, antara lain prostaglan-
din (Lutalyse), GnRH (Fertagyl), vitamin ADE, ka-
pas, alkohol 70 %, albendazole, povidone iodine,
aquades steril, veterinary examination glove, plas-
tik sheat, spuit sisposable, jarum 18 G dan tisu. Alat
yang digunakan adalah insemination gun.
Metode
Pelaksanaan pemeriksaan sapi Bali dalam pene-
litian ini dilakukan dengan beberapa tahapan yaitu
dengan metode anamnesa untuk pengisian kuisio-
ner, pemeriksaan klinis, pemeriksaan kondisi repro-
duksi secara per rektal dan penanganan gangguan
reproduksi. Pemeriksaan klinis meliputi body con­
dition score (BCS), tingkah laku, leleran abnormal
pada vulva dan warna mukosa vagina. Pemeriksaan
kondisi reproduksi dilakukan secara per rektal ter-
hadap cervix, corpus dan cornu uterus serta ovari-
um. Penentuan kondisi gangguan reproduksi ber-
dasarkan hasil anamnesa, pemeriksaan klinis dan
pemeriksaan per rektal. Penanganan gangguan
reproduksi sapi Bali tersebut dilakukan kasus per
kasus dari individu per individu berdasarkan pro-
Tabel 1 Hasil pemeriksaan gangguang reproduksi sapi Bali di Kecamatan Kampung Melayu Kotamadya
Bengkulu Provinsi Bengkulu
Total Jumlah sapi yang diperiksa Jumlah kasus Gangguan Reproduksi
(ekor)
333
© 2016 Fakultas Kedokteran Hewan IPB
sedur standar yang sudah umum dilakukan. Pena­
nganan gangguan reproduksi dinyatakan sembuh
apabila timbulnya respon klinis berupa estrus. Data
yang diperoleh pada pemeriksaan dan respon klinis
dari penanganan gangguan reproduksi tersebut ke-
mudian dicatat dan dianalisa secara deskriptif.
HASIL
Berdasarkan hasil penelitian yang disajikan pada
Tabel 1 dapat diketahui bahwa 193 ekor mengala-
mi gangguan reproduksi atau sebesar 57,95% yang
meliputi delayed pubertas, hipofungsi ovarium,
metritis, endometritis dan anestrus postpartum.
Sedangkan sebanyak 80 ekor sapi telah sembuh
dengan menunjukan gejala klinis estrus atau sebe-
sar 41,45%.
PEMBAHASAN
Keterlambatan pubertas atau delayed pubertas
pada seekor betina dapat dipengaruhi oleh berba-
gai faktor antara lain genetik, nutrisi dan faktor ma-
najemen reproduksi. Idealnya sapi Bali mencapai
pubertas pada usia 18 sampai 24 bulan dan beranak
pertama kali pada usia 30 sampai 38 bulan (Talib,
2002). Di daerah tersebut tersedia rumput namun
kekurangan konsentrat sehingga keseimbangan
nutrisi masih rendah. Asupan nutrisi dan cadangan
energi tubuh mempengaruhi aktivitas dan respon
ovarium. Kurangnya asupan nutrisi akan mempe­
ngaruhi senyawa metabolisme dan hormon seperti
insulin dan insulin-like growth factor-I yang mem-
pengaruhi hipotalamus dan hipofisis terhadap res-
pon pada ovarium dan sensitifitas gonadotropin
hormon pada hipofisis sehingga energi tubuh akan
menekan pelepasan gonadotropin releazing hor-
mone (GnRH) dan mempengaruhi frekuensi pulsa-
til luteinizing hormone (LH) yang diperlukan untuk
pertumbuhan folikel. Kondisi ini akan menyebab-
kan delayed pubertas akibat folikel tidak berkem-
bang menjadi folikel dominan atresia maupun do-
minan ovulasi, selain itu menyebabkan penurunan
Hasil kesembuhan post treatment
(Estrus)
193 80

fungsi ovarium atau hipofungsi ovarium yang bersi-
fat reversible. Hipofungsi ovarium yang tidak sege-
ra ditangani akan melanjut menjadi atropi ovarium
yang bersifat irreversible (Gutierrez, 2005; Gitonga,
2010).
Di daerah ini lama pedet menyusui menyebab-
kan kekurusan turut yang berakibat kejadian hipo-
fungsi ovarium. Manifestasi klinis pada sapi yang
mengalami hipofungsi ovarium adalah anestrus.
Menyusui pedet dalam jangka waktu lama akan
menunda ovulasi dan memberikan kontribusi terha-
dap panjang periode anestrus postpartum, sehing-
ga efisiensi reproduksi menurun (Gitonga, 2010).
Anestrus postpartum adalah periode setelah kela-
hiran di mana sapi tidak menunjukkan gejala atau
perilaku estrus. Anestrus pada sapi postpartum
adalah periode anestrus normal. Anestrus postpar-
tum dianggap sebagai abnormal bila melampaui
rata-rata 90 hari (Ahuja & Montiel, 2005; Peter et
al., 2009; Gitonga, 2010).
Anestrus postpartum yang panjang di daerah ini
merupakan faktor utama yang membatasi efisiensi
reproduksi pada sapi-sapi di daerah tropis, karena
menyebabkan calving interval (CI) yang panjang
yaitu > 12-15 bulan. Selama anestrus, ovulasi tidak
terjadi meskipun ada perkembangan folikel ovari-
um, namun folikel tersebut tidak tumbuh dan ber-
kembang menjadi folikel dominan atresia maupun
folikel dominan ovulasi. Menurut pendapat para
ahli sebelumnya diketahui bahwa meskipun banyak
faktor mempengaruhi periode anestrus postpar-
tum, nutrisi, menyusui dalam waktu lama dan infek-
si uterus postpartum adalah faktor-faktor utama
yang mempengaruhi dimulainya kembali aktivitas
ovarium postpartum (Ahuja & Montiel, 2003). Me-
kanisme utama adalah penundaan aktivitas ovari-
um melalui penghambatan sekresi GnRH sehingga
mengurangi pelepasan pulsatil dari LH yang diper-
lukan untuk pertumbuhan folikel (Schillo, 1992).
Selain faktor nutrisi adanya infeksi pada uterus
postpartum seperti metritis puerpuralis, dan endo-
metritis secara lansung mengakibatkan panjang-
nya anestrus postpartum (Foldi et al., 2006; Azawi
2008; Sheldon et al., 2008). Penyuntikan vitamin
ADE akan memberikan respon pada perkembangan
folikel untuk mencapai ukuran folikel dominan, se-
dangkan penyuntikan GnRH akan memberikan res-
pon pada perkembangan folikel mencapai ­ukuran
ovulasi. Terapi ini akan memberikan hasil yang mak-
simal pada sapi yang memiliki BCS ≥ 2.
Metritis adalah kondisi peradangan akibat in-
feksi pada myometrium. Metritis umumnya terjadi
segera setelah partus atau pada masa puerpureum
sampai hari ke-20 postpartum. Persentase kejadian
Gangguan Reproduksi Sapi Bali | 17
metritis tertinggi yaitu pada hari ke-10 postpartum
yaitu 40%. Sedangkan kejadian endometritis klinis
sering terjadi pada hari ke-15 sampai 60 atau 70
hari postpartum. Persentase kejadian endometritis
klinis pada sapi adalah 20% pada hari ke-15 sampai
40 hari postpartum (Sheldon et al., 2008). Endome­
tritis adalah kondisi peradangan pada uterus yang
paling umum ditemukan. Endometritis merupakan
suatu proses inflamasi yang mencakup endomet-
rium dan merupakan salah penyebab penting dari
kejadian infertilitas pada sapi (Azawi, 2008; Le­
Blanc, 2008)
Metritis dan endometritis di daerah ini cukup
tinggi hal ini dapat disebabkan oleh kontaminasi
bakteri non spesifik saat perkawinan (alami, insemi-
nasi buatan), distokia, kebuntingan kembar, retensi
plasenta, metritis puerpuralis dan penurunan atau
kegagalan mekanisme aktivitas fagositosis oleh
leukosit pada uterus seperti yang dikemuakakan
oleh Azawi, (2008) dan LeBlanc, (2008). Karakte-
ristik gejala klinis metritis pada sapi adalah adanya
leleran cair hingga kental (viscous) berwarna merah
kecoklatan sampai putih purulent keluar melalui
vulva. Endometritis dapat dibedakan menjadi endo-
metritis subklinis yang sering terjadi segera setelah
partus dan tanpa menunjukan gejala klinis (Azawi,
2008; LeBlanc, 2008; Sheldon et al., 2008).
Karakteristik klinis dari endometritis klinis ada-
lah adanya leleran purulent berwarna putih keruh
kekuningan sampai mucopulent yang keluar me-
lalui vulva dengan volume leleran bervariasi dan
berbau busuk (Azawi, 2008; LeBlanc, 2008). Status
nutrisi, menyusui dan infeksi uterus postpartum
mempengaruhi hipotalamus dan hipofisis terha-
dap aktivitas ovarium. Aktivitas ovarium meliputi
sintesis dan sekresi hormon steroid (estrogen dan
progesterone) yang mempengaruhi pertumbuhan,
perkembangan dan pematangan folikel ovarium
(Burke, 2003; LeBlanc, 2008; Gitonga, 2010).
Fakta di lapangan dan beberapa penelitian telah
membuktikan bahwa faktor nutrisi merupakan fak-
tor yang lebih kritis, dalam arti baik pengaruh lang-
sung maupun pengaruh tidak langsung terhadap fe-
nomena reproduksi dibanding faktor lainnya. Jadi,
nutrisi yang cukup dapat mendorong proses bio-
logis untuk mencapai potensi genetiknya, mengu-
rangi pengaruh negatif dari lingkungan yang tidak
nyaman dan meminimalkan pengaruh-pengaruh
­
dari teknik manajemen yang kurang baik. Nutrisi
yang kurang baik tidak hanya akan mengurangi per-
formans dibawah potensi genetiknya, tetapi juga
memperbesar pengaruh negatif dari lingkungan.
Kekurangan pakan khususnya untuk daerah tropis
yang panas termasuk di Indonesia, merupakan sa-
http://www.journal.ipb.ac.id/indeks.php/actavetindones
18 | Budiyanto et al.
lah satu penyebab penurunan efisiensi reproduksi
karena selalu diikuti oleh adanya gangguan repro-
duksi yang menyebabkan timbulnya kemajiran
pada ternak betina (Budiyanto, 2012).
Pakan sebagai faktor yang menyebabkan gang-
guan reproduksi dan kemajiran sering bersifat ma-
jemuk, artinya kekurangan suatu zat dalam ransum
pakan diikuti oleh kekurangan zat pakan yang lain
(Arthur, 2001). Aktivitas ovarium postpartum di-
pengaruhi oleh status nutrisi dan keseimbangan
energi. Status nutrisi dan cadangan energi tubuh
dapat dievaluasi secara klinis melalui BCS. Perbaik­
an nutrisi yang meliputi kualitas dan kuantitas harus
dilakukan pada sapi yang memiliki BCS < 2 sebelum
terapi hormonal. Faktor genetik, lingkungan dan
manajemen yang baik akan meningkatkan efisiensi
reproduksi, produktivitas, profitabilitas dan keber-
lanjutan suatu usaha peternakan. Adanya interaksi
yang kompleks antara faktor lingkungan atau ma-
najemen (nutrisi), respon individual, jenis ganggu-
an reproduksi dan derajat keparahan gangguan
reproduksi akan menimbulkan respon kesembuhan
yang bervariasi dari setiap penanganan gangguan
reproduksi.
Terjadinya inefisiensi reproduksi sapi Bali pada
peternakan rakyat di Kecamatan Kampung Melayu
Kotamadya Bengkulu Provinsi Bengkulu akibat
gangguan reproduksi. Gangguan reproduksi meli-
puti delayed pubertas, hipofungsi ovarium, metri-
tis, endometritis dan anestrus postpartum. Adanya
interaksi yang kompleks antara faktor lingkungan
atau manajemen (nutrisi), respon individual, jenis
gangguan reproduksi dan derajat keparahan gang-
guan reproduksi akan menimbulkan respon ke-
sembuhan yang bervariasi dari setiap penanganan
gangguan reproduksi.
”Penulis menyatakan tidak ada konflik kepen­
tingan dengan pihak-pihak terkait dalam penelitian
ini”.
DAFTAR PUSTAKA
Ahuja C, Montiel F. 2005. Body condition and suck-
ling as factors influencing the duration of post-
partum anestrus in cattle: a review. Journal of
Animal Science 85: 1-26.
© 2016 Fakultas Kedokteran Hewan IPB
Arthur’s H, David EN, Parkinson TJ, England CW.
2001. Endogenous and exogenous control of
ovarian cyclicity. In Veterinary Reproduction and
Obstetrics.8th ed. Saunders.
Azawi OI. 2008. Postpartum Uterine Infection In
Cattle. Animal Reproduction Science 105: 187-
208.
Budiyanto A. 2012. Peningkatan tingkat kebuntin-
gan dan kelahiran sapi di Indonesia dan masalah-
masalah yang terkait. seminar Updating Penya-
kit Gangguan Reproduksi dan Penanganannya
pada Ruminansia Besar, 8 Maret 2012.
Budiyanto A, Tophianong TC, Dalimunthe NW.
2013. Perbandingan Calving Interval (CI) Sapi
Bali Pada Peternakan Dikandangkan dan Semi
Dikandangkan Di Daerah Kupang Nusa Tengga-
ra Timur. Proceeding Seminar Nasional Peran
Rumah Sakit Hewan Dalam Penanggulangan Pe­
nyakit Zoonosis. Yogyakarta, 23 November 2013.
Burke CR. 2003. Regulation of ovarian follicular de-
velopment with estradiol in cattle. PhD. Diserta-
tion.The Ohio State University.
Foldi J, Kulcs´ar M, P´ecs A, Huygheb B, de Sab C,
Lohuis JACM, Cox P, Huszenicza GY. 2006. Bac-
terial complications of postpartum uterine in-
volution in cattle. Animal Reproduction Science
96: 265-281.
Gitonga PN. 2010. Pospartum reproductive perfor-
mance of dairy cows in medium and large scale
farms in Kiambu and Nakuku Districts of Kenya.
Thesis. University of Nairobi Faculty of Veterina-
ry Medicine.
Gutierrez IR. 2005. Effect of postpartum nutrition
on the onset of ovarian activity in beef cows. Di-
sertation. Oklahoma State University.
LeBlanc JS. 2008. Postpartum Uterine Disease and
Dairy Herd Reproductive Performance : A Re-
view. The Veterinary Journal 176: 102-114.
Peter AT, Vos PLAM, Ambrose DJ. 2009. Review
Postpartum anestrus in dairy cattle. Therioge-
nology 71: 1333-1342.
Sheldon I, Erin M, Williams J, Aleisha N, Miller A, De-
borah M, Nash, Shan H. 2008. Uterine diseases
in cattle after parturition. The Veterinary Journal
176: 115-121.
Talib C. 2002. Sapi Bali di daerah sumber bibit dan
peluang pengembangannya.Wartazoa 12: 3.
Buletin Veteriner Udayana Volume 14 No. 5: 572-577
pISSN: 2085-2495; eISSN: 2477-2712 Oktober 2022
Online pada: http://ojs.unud.ac.id/index.php/buletinvet DOI: 10.24843/bulvet.2022.v14.i05.p17
Terakreditasi Nasional Sinta 4, berdasarkan Keputusan Direktur Jenderal
Pendidikan Tinggi, Riset, dan Teknologi No. 158/E/KPT/2021

Penggunaan Gonadorelin dalam Penanganan Keterlambatan Pubertas

pada Sapi Bali
(USE OF GONADORELIN IN HANDLING DELAYED PUBERTY IN BALI CATTLE)

Anak Agung Adhitya Chandra1, I Gusti Ngurah Bagus Trilaksana2*,

Tjok Gde Oka Pemayun2
¹Mahasiswa Program Studi Magister Kedokteran Hewan, Fakultas Kedokteran Hewan,
Universitas Udayana, Jl. PB. Sudirman, Denpasar Bali;
²Laboratorium Reproduksi Veteriner Falkultas Kedokteran Hewan Universitas Udayana, Jl.
PB. Sudirman, Denpasar Bali;
*Email: agunglaksana@unud.ac.id

Abstrak
Keterlambatan pubertas merupakan salah satu masalah yang dihadapi oleh peternak sehingga
menyebabkan keterlambatan dalam produksinya. Beberapa hormon telah digunakan dalam penanganan
kasus keterlambatan pubertas. Penelitian ini bertujuan untuk mengetahui peranan gonadorelin dalam
penanganan keterlambatan pubertas pada sapi bali. Sapi bali yang digunakan adalah sapi bali betina
yang telah berumur 24 bulan atau lebih yang belum menunjukkan tanda estrus untuk pertama kali
(pubertas). Sapi bali betina dibagi menjadi 2 kelompok masing masing terdiri dari 16 ekor. Kedua
kelompok diberi perlakuan berupa injeksi gonadorelin dengan dosis untuk kelompok 1 (P1) 50 μg/ekor
dan kelompok 2 (P2) 100 μg/ekor. Pengamatan untuk diameter folikel dilakukan dengan USG sebelum
injeksi gonadorelin dan sesudah munculnya estrus. Pengamatan terhadap munculnya estrus dan
intensitas estrus dilakukan 2 kali sehari yaitu pukul 06.00 - 08.00 WITA dan pukul 17.00 - 19.00 WITA.
Hasil penelitian menunjukkan bahwa rata rata diameter folikel sebelum injeksi gonadorelin untuk P1 =
4,38 mm dan P2 = 4,41 mm sedangkan saat munculnya estrus rata rata diameter folikel untuk P1 = 7,68
mm dan P2 = 10,83 mm. Rata rata waktu munculnya estrus pada P1 = 6,38 hari sedangkan P2 = 4 hari,
sedangkan intensitas estrus pada P1 = 1,5 dan P2 = 2,56. Secara statistik perbedaan diameter sebelum
perlakuan tidak bermakna (p>0,05) sedangkan saat estrus terjadi perbedaan yang bermakna (p<0,05)
diantara kedua perlakuan. Waktu munculnya estrus dan intensitas estrus secara statistik tidak terdapat
perbedaan yang bermakna (p>0,05) diantara kedua perlakuan. Dari penelitian ini dapat disimpulkan
bahwa pemberian gonadorelin dapat merangsang perkembangan folikel dan menyebabkan munculnya
estrus pada sapi bali betina yang mengalami keterlambatan pubertas.
Kata kunci: Diameter folikel; gonadorelin; intensitas estrus; keterlambatan pubertas; munculnya estrus;

Abstract
Delayed puberty is one of the problems faced by breeders, causing delays in production. Several
hormones have been used in handling cases of delayed puberty. Purpose of this research was to
determine the use of gonadorelin in dealing with delayed puberty in balinese cattle. Balinese cattle used
in this reasearch are female balinese cattle age 24 month or more which havent showed any sign of the
first estrus (puberty). Female balinese cattle was divided into 2 groups each consist 16 cattles. Both
groups given the treatment which is gonadorelin injection dose 50 μg/cattle (P1/Group 1) and 100
μg/cattle (P2/Group 2). Observations for follicular diameter were made by ultrasound before
gonadorelin injection and after the signs of estrus were showed. Observation for the estrus signs and its
intensity were done twice a day which are at 06.00 – 08.00 WITA and 17.00 – 19.00 WITA. The results
showed that the average follicular diameter before the gonadorelin injection were P1 = 4,38mm and P2
= 4,41mm meanwhile after the estrus showed up, the average follicular diameter became P1 = 7,68mm
and P2 = 10,83mm. The average time of emergence of estrus at P1 = 6,38 days while P2 = 4 days, while
the intensity of estrus at P1 = 1,5 days and P2 = 2,56 days. Statistically the difference in diameter before
treatment was not significant (p> 0.05) while during estrus there was a significant difference (p <0.05)

572
Buletin Veteriner Udayana Volume 14 No. 5: 572-577
pISSN: 2085-2495; eISSN: 2477-2712 Oktober 2022
Online pada: http://ojs.unud.ac.id/index.php/buletinvet DOI: 10.24843/bulvet.2022.v14.i05.p17

between the two treatments. At the time of emergence of estrus and estrus intensity there were no
statistically significant differences (p> 0.05) between the two treatments. For the conclusion,
administration of gonadorelin can stimulate follicular development and cause the emergence of estrus
in Balinese Cattle that experience delayed puberty.
Keywords: Delayed puberty; emergence of estrus; estrus intensitity; follicular diameter; gonadorelin;

PENDAHULUAN lebih dari 2 tahun, yang ditandai tidak

adanya aktivitas ovarium ketika dilakukan
Kebutuhan protein hewani bagi
palpasi per rektal. Idealnya sapi Bali
manusia semakin meningkat seiring
mencapai pubertas pada usia 18 – 24 bulan,
pertambahan populasi penduduk di
dan beranak pertama kali pada usia 30
Indonesia setiap tahunnya (Agustina et al.,
sampai 38 bulan (Budiyanto et al., 2016).
2017). Kondisi peternakan sapi potong saat
Keterlambatan pubertas pada seekor betina
ini masih mengalami kekurangan pasokan
dipengaruhi oleh faktor genetik, nutrisi dan
sapi lokal karena lambatnya laju populasi
manajemen pemeliharaan. Memperbaiki
sapi potong, khususnya sapi bali dimana
nutrisi adalah faktor penting yang perlu
merupakan sumber protein hewani yang
diperhatikan dalam meningkatkan
sangat penting bagi masyarakat. Sapi bali
adalah sapi potong lokal yang sangat ideal efisisensi reproduksi. Kurangnya asupan
nutrisi akan mempengaruhi senyawa
ditinjau dari aspek produksi daging, karena
metabolisme dan hormon seperti insulin
memiliki angka fertilitas yang tinggi (rata-
dan insulin-like growth factor-I. Hormon
rata 83%), serta memiliki kadar lemak yang
tersebut selanjutnya mempengaruhi
rendah, dan juga memiliki daya adaptasi
hipotalamus dan hipofisis sehingga energi
yang cukup baik terhadap lingkungan yang
tubuh akan menekan pelepasan
baru (Laksmi et al., 2019). Sapi bali juga
Gonadotropin Releasing Hormon (GnRH).
memiliki kekurangan yang menjadi kendala
Penundaan aktivitas ovarium melalui
utama dalam perkembangbiakannya seperti
penghambatan sekresi GnRH di
ada beberapa penyakit yang dapat
hipotalamus merupakan mekanisme utama
menyebabkan kurang optimalnya fungsi
sehingga mengurangi pelepasan pulsatil
sistem reproduksi, salah satunya anestrus
dari FSH dan LH di hipofisa anterior, yang
postpartum (Guntoro, 2002; Besung et al.,
diperlukan untuk pertumbuhan folikel
2019).
(Schillo, 1992). Kondisi itu akan
Budiyanto et al. (2016) menyatakan
menyebabkan penurunan fungsi ovarium
bahwa dari hasil pemeriksaan sapi bali yang
atau hipofungsi ovarium yang bersifat
dipelihara di areal sawit menunjukkan 56,8
reversible. Pemberian GnRH dapat
% mengalami gangguan reproduksi, yang
meningkatkan sekresi FSH dan LH di
berdampak pada kerugian ekonomi bagi
pituitari, yang akan menstimulasi
peternak. Dampak ekonomi disebabkan
perkembangan folikel dan ovulasi serta
oleh kecilnya angka kelahiran, tingginya
pembentukan korpus luteum (Pemayun,
biaya produksi, biaya kesehatan dan
2010). Penyuntikan GnRH pada sapi
pengafkiran ternak / culling ternak.
potong dilaporkan akan dapat merangsang
Beberapa hal yang dapat digunakan sebagai
aktivitas ovarium pada kasus anestrus
indikator kurang optimalnya fungsi
postpartum karena hipofungsi ovarium
reproduksi sapi bali, yaitu keterlambatan
(Hafez, 2000). Penyuntikan GnRH pada
pubertas (delayed puberty) (Budiyanto et
sapi potong juga dilaporkan dapat
al., 2016).
menginduksi pelepasan FSH dan LH
Keterlambatan pubertas merupakan
(Yavas and Walton, 2003). Tolihere (1997)
suatu keadaan dimana sapi belum
mengalami dewasa kelamin (belum pernah menyatakan bahwa penyuntikan hormon
GnRH dapat memperbaiki aktivitas
estrus) walaupun umurnya sudah mencapai
ovarium dalam penanganan kasus

573
Buletin Veteriner Udayana
keterlambatan pubertas, hipofungsi
ovarium, memperpendek anestrus
postpartum dan meningkatkan performa
reproduksi pada sapi. Pemberian
gonadorelin diharapkan dapat mengatasi
kejadian keterlambatan pubertas pada sapi
bali.
METODE PENELITIAN
Rancangan Penelitian
Penelitian ini merupakan penelitian
eksperimental dengan menggunakan
rancangan acak lengkap (RAL) yang terdiri
dari dua kelompok perlakuan. Sapi yang
dijadikan sebagai penelitian adalah 32 ekor
sapi bali betina yang dipelihara di
kelompok tani ternak di Desa Sobangan,
Kecamatan Mengwi, Kabupaten Badung.
Sapi bali betina yang mengalami
keterlambatan pubertas dibagi menjadi 2
kelompok yaitu kelompok I (16 ekor)
penanganan dengan injeksi gonadorelin
dosis 50 µg/im/ekor, dan kelompok II (16
ekor) penanganan dengan injeksi
gonadorelin dosis 100 µg/im/ekor.
Gonadorelin yang digunakan adalah
gonadorelin dalam bentuk asetat dengan
nama dagang Gonasyl® (Syva, distributor
Kalbe Farma).
Penentuan Keterlambatan Pubertas
Penentuan keterlambatan pubertas
dilakukan dengan cara melakukan
wawancara pada petani untuk mengetahui
apakah sudah pernah menunjukkan tanda
tanda estrus yang pertama. Penentuan umur
dilakukan dengan pemeriksaan gigi sapi
Bila sapi telah berumur 24 bulan atau lebih
dan belum pernah menunjukkan tanda
tanda estrus selanjutnya dilakukan
pemeriksaan terhadap warna dan
kebengkakan vulva yang selanjutnya
dilakukan pemeriksaan per rektal untuk
meraba kondisi ovarium. Pemeriksaan
aktivitas ovarium dilakukan dengan
ultrasonografi menggunakan real-time
transrectal (KX 5200, KAIXIN) untuk
melihat gambaran ovarium serta adanya
aktivitas ovarium.
574
Chandra et al.
Analisis Data
Data yang diperoleh selanjutnya
ditabulasi dan dianalisis secara statistik dan
diuji menggunakan uji t-test. Pengujian
statistik dilakukan menggunakan program
SPSS 25.0 for windows.
HASIL DAN PEMBAHASAN
Hasil
Rata rata diameter perlakuan sebelum
dan sesudah penyuntikan gonadorelin,
waktu munculnya estrus dan intensitas
estrus disajikan pada tabel 1 berikut ini.
Sementara pengamatan terhadap intensitas
estrus dilakukan secara visual pada alat
kelamin luarnya. Hasil pengamatan
intensitas estrus ditampilkan pada gambar 1
dan 2.
Analisis secara statistik dan pengujian
dengan menggunakan t-test, menunjukkan
bahwa diameter folikel sebelum dilakukan
pemberian gonadorelin tidak terdapat
perbedaan yang bermakna (p>0,05)
diantara kedua kelompok. Diameter folikel
setelah pemberian Gonadorelin tampak
berbeda secara bermakna (p<0,05) diantara
kedua kelompok. Waktu munculnya estrus
nampak terjadi perbedaan, namun secara
statistik perbedaannya tidak bermakna
(p>0,05) diantara kedua perlakuan.
Intensitas estrus yang ditunjukkan oleh
kedua perlakuan juga secara statistik tidak
menunjukkan perbedaan yang bermakna
(p>0,05) walaupun nampak intensitas
estrus pada kelompok perlakuan 2 yang
diberi gonadorelin 100 µg lebih jelas
dibandingkan kelompok perlakuan 1 yang
diberi gonadorelin 50 µg.
Pembahasan
Aktivitas ovarium setelah melahirkan
merupakan hal yang sangat penting harus
diperhatikan untuk bisa meningkatkan
perfoman reproduksi. Berkembang dan
berfungsinya organ reproduksi setelah
melahirkan tergantung dari kadar LH dan
FSH dari hipofisa anterior yang dikontrol
oleh GnRH yang diskresikan oleh
Buletin Veteriner Udayana
pISSN: 2085-2495; eISSN: 2477-2712
Online pada: http://ojs.unud.ac.id/index.php/buletinvet
hypothalamus dan selain itu status pakan
setelah melahirkan sangat berpengaruh
terhadap sekresi hormon gonadotropin
(Bauer-Donton et al., 1995).
Pada penelitian ini, pemberian
gonadorelin 50 µg/ekor dan 100 µg/ekor
intra muskular pada kasus keterlambatan
pubertas pada sapi bali menyebabkan
terjadinya peningkatan perkembangan
folikel. Rata-rata ukuran diameter folikel
ovarium sapi bali yang mengalami
keterlambatan pubertas pada penelitian ini
adalah 4.38 - 4.41 mm. Setelah pemberian
gonadorelin dosis 50 µg/ekor menyebabkan
peningkatan ukuran rata-rata diameter
folikel 7.68 mm sedangkan pada pemberian
gonadorelin dosis 100 µg/ekor
menyebabkan peningkatan ukuran rata-rata
diameter folikel 10.83 mm. Dengan
demikian pemberian gonadorelin
menyebabkan terjadinya peningkatan
ukuran diameter folikel secara bertahap
sampai munculnya estrus pada sapi bali
yang mengalami keterlambatan pubertas.
Pengaruh penyuntikan hormon
gonadorelin terhadap timbulnya estrus pada
sapi yang mengalami keterlambatan
pubertas menunjukkan bahwa kelompok
sapi yang diinduksi gonadorelin 50 µg/ekor
menyebabkan munculnya estrus rata-rata
6.38 hari setelah pemberian. Sedangkan
pada kelompok sapi yang diinduksi
gonadorelin 100 µg/ekor menyebabkan
munculnya estrus rata-rata 4 hari setelah
pemberian. Hal ini sesuai dengan yang
dilaporkan oleh Pemayun (2009),
pemberian GnRH sekali dengan dosis 500
µg/ml (lebih tnggi) pada sapi perah dapat
menginduksi munculnya estrus rata-rata
7,17 ± 3,24 hari dengan kisaran hari 5-10
hari. Panjang pendeknya waktu munculnya
estrus sangat dipengaruhi oleh peningkatan
perkembangan folikel dimana faktor nutrisi
sangat berperan penting dalam
metabolisme dan sintesis hormon.
Pada penelitian ini menunjukkan bahwa
sapi dengan keterlambatan pubertas yang
diberikan injeksi gonadorelin 50 µg/ekor
menunjukkan intensitas estrus rata-rata 1.5
sedangkan sapi yang diberikan injeksi
575
Volume 14 No. 5: 572-577
Oktober 2022
DOI: 10.24843/bulvet.2022.v14.i05.p17
gonadorelin 100 µg/ekor menunjukkan
menunjukkan intensitas estrus rata-rata
2.56. Intensitas estrus dipengaruhi oleh
ukuran folikel dan kadar estrogen yang
diproduksi oleh folikel.
SIMPULAN DAN SARAN
Simpulan
Pemberian gonadorelin mampu
meningkatkan perkembangan folikel,
mempercepat munculnya estrus dan
meningkatkan intensitas estrus pada sapi
bali betina yang mengalami keterlambatan
pubertas. Dosis gonadorelin yang terbaik
adalah 100 μg/ekor secara intra muskular.
Saran
Perlu dilakukan penelitian lebih lanjut
dengan pemberian gonadorelin pada sapi
bali betina yang mengalami keterlambatan
pubertas dengan Body Condition Score
(BCS) yang berbeda.
UCAPAN TERIMAKASIH
Penulis mengucapkan terimakasih
kepada Pusat Kesehatan Hewan Sobangan
Kecamatan Mengwi Badung atas
dukungannya dalam memfasilitasi
penelitian ini.
DAFTAR PUSTAKA
Agustina KK, Cahya IMRD, Widyantara
GM, Swacita IBN, Dharmayudha
AAGO, Rudyanto MD. 2017. Nilai gizi
dan kualitas fisik daging sapi bali
berdasarkan jenis kelamin dan umur.
Bul. Vet. Udayana. 9(2): 156-163.
Bauer-Donton AC, Weiss J, Jameson. 1995.
Roles of estrogen, progesteron and Ngr.
In the control of pituitary Ngr. Receptor
gene expression at the time of the
preovulotary gonadotropin surges. J.
Endrocinol. 136: 1014-1019.
Besung INK, Watiniasih NL, Mahardika
GNK, Agustina KK, Suwiti NK. 2019.
Mineral levels of Bali cattle (Bos
javanicus) from different types of land
in Bali, Nusa Penida, and Sumbawa
Buletin Veteriner Udayana Chandra et al.

Islands (Indonesia). Biodiversitas. anestrus postpartum. Bul. Vet.

20(10): 2931-2936.
Budiyanto A, Thopianong TC, Triguntoro,
Dewi HK. 2016. Gangguan reproduksi
sapi bali pada pola pemeliharaan semi
intensif di daerah sistem integrasi sapi
kelapa sawit. Acta Vet. Indon. 4(1): 14-
18.
Guntoro S. 2002. Membudidayakan Sapi
Bali. Kanisius. Yogyakarta.
Hafez ESE. 2000. Reproduction in Farm
Animal. 7th Ed. Lippncott Williams &
Wilkins. Maryland. USA.
Laksmi DNDI, Trilaksana IGNB,
Darmanta RJ, Darwan M, Bebas IW,
Agustina KK. 2019. Correlation
between body condition score and
hormone level of Bali cattle with
postpartum anestrus. Indian J. Anim.
Res. 53(12): 1599-1603.
Pemayun TGO. 2009. Induksi estrus
dengan pmsg dan gnrh pada sapi perah
Udayana. 1(2): 83-87.
Pemayun TGO. 2010. Kadar progesteron
akibat pemberian pmsg dan gnrh pada
sapi perah yang mengalami anestrus
postpartum. Bul. Vet. Udayana. 2(2):
85-91.
Schillo KK. 1992. Effects dietary energyon
control of luteinizing hormone
secretion in cattlr and sheep. J. Anim.
Sci. 70: 1271-1282.
Toelihere MR. 1997. Peran Bioteknologi
reproduksi dalam pembinaan produksi
peternakan di Indonesia. Makalah
disampaikan pada pertemuan teknis dan
koordinasi Produksi Peternakan
Nasional. Cisarua, 4-6 Agustus 1997.
Yavas Y, Walton J. 2003. Postpartum
acyclicity in suckled beef cows: A
review Theriogenol. 54(1): 25-55.

Tabel 1. Diameter folikel sebelum dan sesudah pemberian Gonadorelin, waktu munculnya
estrus dan intensitas estrus
Diameter Diameter Muncul Intensitas
Perlakuan
sebelum (mm) Sesudah (mm) Estrus (hari) Estrus
Gonadorelin 4.38a 7.68a 6.38a 1.5a
50 µgram
Gonadorelin 4.41a 10.83b 4a 2.56a
100 µgram
Huruf superskrip yang sama dalam satu kolom menunjukkan tidak ada perbedaan yang
bermakna (p>0,05)

Gambar 1. Gambar ultrasonografi diameter folikel sebelum dan sesudah perlakuan

576
Buletin Veteriner Udayana Volume 14 No. 5: 572-577
pISSN: 2085-2495; eISSN: 2477-2712 Oktober 2022
Online pada: http://ojs.unud.ac.id/index.php/buletinvet DOI: 10.24843/bulvet.2022.v14.i05.p17

a b c
Gambar
a 2. a. Intensitas estrus 1, b.a Intensitas estrus 2, c. Intensitas
a estrus 3.
a a

577
Veterinary World, EISSN: 2231-0916 RESEARCH ARTICLE
Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf Open Access

Effect of Doublesynch and Estradoublesynch protocols on estrus

induction, conception rate, plasma progesterone, protein, and
cholesterol profile in anestrus Gir heifers
N. J. Chaudhary1, D. M. Patel1, A. J. Dhami1, K. B. Vala2, K. K. Hadiya1 and J. A. Patel1

1. Department of Animal Reproduction, Gynaecology and Obstetrics, College of Veterinary Science and Animal
Husbandry, Anand Agricultural University, Anand - 388 001, Gujarat, India; 2. Department of Animal Reproduction,
Gynaecology and Obstetrics, College of Veterinary Science and Animal Husbandry, Junagadh Agricultural University,
Junagadh - 362 001, Gujarat, India.
Corresponding author: A. J. Dhami, e-mail: ajdhami@aau.in
Co-authors: NJC: omnitesh999@gmail.com, DMP: dmpatel@aau.in, KBV: drkkvala@gmail.com,
KKH: kamleshhadiya@yahoo.co.in, JAP: japatel@aau.in
Received: 10-11-2017, Accepted: 31-03-2018, Published online: 27-04-2018

doi: 10.14202/vetworld.2018.542-548 How to cite article: Chaudhary NJ, Patel DM, Dhami AJ, Vala KB, Hadiya KK, Patel JA
(2018) Effect of Doublesynch and Estradoublesynch protocols on estrus induction, conception rate, plasma progesterone,
protein, and cholesterol profile in anestrus Gir heifers, Veterinary World, 11(4): 542-548.

Abstract
Aim: This study aimed to evaluate the efficacy of Doublesynch and Estradoublesynch protocols on estrus induction,
conception rates, plasma progesterone, protein, and cholesterol profile in anestrus Gir heifers.
Materials and Methods: In this study, 50 pubertal anestrus Gir heifers were selected from the field and farm conditions.
The heifers were dewormed (injection ivermectin, 100 mg, s/c) and supplemented with minerals and vitamins (injection
organic phosphorus 800 mg and injection Vitamin AD3E and Biotin 10 ml i/m) and multi-mineral bolus at 1 bolus daily
for 7 days. The heifers were randomly divided into three groups: Doublesynch (n=20), Estradoublesynch (n=20), and
control (n=10). The animals were monitored for estrus response, estrus interval, behavioral signs, and conception rates after
induced/first, second, and third cycle post-treatment. Blood samples were obtained on day 0, day 9, day 12, and on day 12
post-artificial insemination (AI) for determination of plasma progesterone, protein, and cholesterol profile.
Results: The estrus response rate between Doublesynch and Estradoublesynch protocols was similar between treated heifers
(85% and 95%). The interval from the second prostaglandin F2α (PGF2α) injection to estrus induction did not differ between
the groups (63.87±4.19 vs. 58.27±3.83 h). The conception rates following induced estrus (20% vs. 30%), at the second
cycle (23.07% vs. 16.66%), at the third cycle (22.22% vs. 30.00%), and the overall conception rate (45% and 55%) within
27.89±5.75 and 26.45±5.48 days were the same across the treatment groups. The mean plasma progesterone concentrations
were significantly (p<0.01) higher on day 9 (second PGF2α injection) and day 12 post-AI compared to day 0 (first PGF2α
injection) and the day of fixed-timed artificial insemination. The concentrations were also significantly (p<0.05) higher in
conceived than non-conceived heifers on day 9 of treatment and day 12 post-AI in both the protocols. The mean plasma
cholesterol concentrations were significantly higher during peak follicular and luteal phases compared to the initial anestrus
phase in both the protocols. The values were also higher in non-conceived than conceived animals in both the protocols. The
plasma protein profile was not influenced by the sampling days or conceived and non-conceived status.
Conclusion: The results showed that both Doublesynch and Estradoublesynch protocols resulted in similar estrus induction
and conception rates with modulation of plasma progesterone and cholesterol profile in anestrus Gir heifers.
Keywords: cholesterol, conception rate, estrus synchronization, Gir heifers, progesterone, proteins, pubertal anestrus.
Introduction having attained pubertal age and body weight, a large
Gir cattle, the famous Indian milch breed native percentage of Indian zebu heifers fail to commence
to Gir forest in Gujarat, is the hardiest of high yield- cyclicity [3].
ers in the world [1]. It is one of the best native milch Delayed onset of puberty necessitates exogenous
breeds of zebu cattle adapted to the hot, humid cli- intervention to induce ovarian activity. Several hor-
mate and diseases of tropics in India and even abroad. monal preparations and protocols have been used to
However, they are slow breeders and have extended induce estrus in acyclic cattle [4-7]. Estrus synchroni-
post-pubertal and postpartum anestrus periods com- zation protocols involve the sequential administration
pared to their temperate counterparts [2]. Despite of of reproductive hormones to manipulate the estrous
cycle to provide a fertile oocyte for insemination at a
Copyright: Chaudhary, et al. Open Access. This article is predictable moment. The new protocols have incor-
distributed under the terms of the Creative Commons Attribution
4.0 International License (http://creativecommons.org/licenses/ porated strategies to adjust the endocrine milieu and
by/4.0/), which permits unrestricted use, distribution, and consequently support specific portions of the syn-
reproduction in any medium, provided you give appropriate credit
to the original author(s) and the source, provide a link to the chronization [5,8,9]. Further, evaluating plasma pro-
Creative Commons license, and indicate if changes were made. gesterone and biochemical constituents of blood has
The Creative Commons Public Domain Dedication waiver (http://
creativecommons.org/publicdomain/zero/1.0/) applies to the data
a great value in evaluating the reproductive and phys-
made available in this article, unless otherwise stated. iological statuses of the animal, as these have been
Veterinary World, EISSN: 2231-0916 542
 Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf
reported to affect fertility status of bovines [10]. The
progesterone hormone is responsible for stimulation
of cyclicity, follicular development, and maintenance
of pregnancy. Protein deficiency retards the develop-
ment of reproductive organs and is considered to be a
factor responsible for failure or delay in the onset of
postpartum estrus [11]. Cholesterol, the most import-
ant sterol, is an essential precursor of steroid hor-
mones in the body.
However, studies on the use of recently developed
estrus synchronization protocols, namely Ovsynch,
controlled internal drug release (CIDR), Doublesynch,
and Estradoublesynch in pubertal anestrus heifers of
zebu cattle breeds are meager in the literature [12].
Even whether plasma protein and cholesterol lev-
els are altered by these protocols of estrus synchro-
nization is also scarce in cattle [13]. Moreover, the
estrus response and conception rates with the use of
Doublesynch and Estadoublesynch protocols in both
cyclic and acyclic bovines were quite encouraging in
earlier studies [14-17]. Hence, this study was aimed
to evaluate if Doublesynch and Estradoublesynch pro-
tocols induce successful ovulatory estrus, modulate
plasma progesterone, protein, and cholesterol profile,
and enhance fertility in pubertal anestrus Gir heifers
under field conditions.
Materials and Methods
Ethical approval
The prior approval from the Institutional Animal
Ethics Committee was obtained for the use of farm
animals in this study.
Selection and pre-synchronization treatment of
animals
The study was carried out during August 2016
to May 2017 on 50 pubertal anestrus Gir heifers of
Baroda District Milk Union, Vadodara, as well as from
villages of Junagadh district in Gujarat. The anestrus
heifers selected were in the age group of 30-42 months
and having average body condition score (BCS, 2.5-
3.5) with smooth, small inactive ovaries that were
confirmed by twice rectal palpation 10 days apart. All
these animals were initially injected once with 100 mg
ivermectin s/c, injection organic phosphorus 800 mg,
and multivitamins AD3E 10 ml i/m, and were supple-
mented with multimineral bolus at 1 bolus daily for
7 days only to control parasitism, improve nutritional
status, and thereby to improve response to hormone
therapy. They were then randomly divided into 2 equal
groups of 20 heifers each and were subjected to the
following two estrus synchronization protocols, keep-
ing one group of 10 animals as an untreated control.
Synchronization protocols
Under Doublesynch protocol, the heifers received
i/m injection of Cloprostenol sodium 500 µg on day
0, injection buserelin acetate, a GnRH analog 20 µg
on day 2, second injection of Cloprostenol sodium
500 µg on day 9 and 10 µg GnRH on day 11, followed
by fixed-timed artificial insemination (FTAI) twice at
Veterinary World, EISSN: 2231-0916
16 and 24 h later, while in Estradoublesynch protocol,
the cows received an injection of estradiol benzoate
1 mg on day 10, in place of the second GnRH injection
on day 11 in Doublesynch with FTAI twice at 48 and
60 h post-estradiol injection. Ten anestrus heifers kept
without any hormonal intervention and followed for
spontaneous estrus served as control. Animals insemi-
nated at induced/spontaneous estrus, if not conceived,
were followed for the next two cycles. In non-return
cases, pregnancy was confirmed by per-rectal exam-
ination 60 days of the last AI. Among non-pregnant
animals, the ovarian status was also checked as to
whether the animal was cyclic or has turned out to be
anestrus again.
Blood sampling and assay procedure
Blood samples were collected from jugular veins
in heparinized vacutainers on day 0 – just before treat-
ment, day 9 – at the time of PGF2α administration,
day 12 – induced estrus/FTAI, and on day 12 post-AI.
The blood samples were centrifuged at 3000 rpm for
15 min. The plasma separated out was stored in a deep
freezer at −20°C with a drop of sodium merthiolate
(0.1%). The plasma progesterone concentrations were
measured by employing standard radioimmunoas-
say technique of Kubasic et al. [18]. Labeled anti-
gen (I125), antibody-coated tubes, and standards were
procured from Immunotech-SAS, Masrsielle-13009,
Cedex, France. The plasma total protein and total cho-
lesterol concentrations were determined by Biuret and
CHOD/PAP method, respectively, using standard pro-
cedures and assay kits with the help of a chemistry ana-
lyzer (Mindray, BS 120, Nanshan, Shenzhen-518057,
China).
Statistical analysis
The data on estrus induction response and con-
ception rates were analyzed using Chi-square test,
and those of plasma progesterone, total cholesterol,
and total protein profile using ANOVA and Duncan’s
multiple range test or “t-” test employing Statistical
Package for Social Sciences (SPSS, USA) software
version 20.00 to know the variations between sam-
pling days, treatment groups, and conceived/non-con-
ceived status [19].
Results and Discussion
Estrus induction response and conception rates
The behavioral estrus induced in pubertal anestrus
Gir heifers under Doublesynch and Estradoublesynch
protocols (85 vs. 95%) and the mean intervals from
the second PGF2α injection to estrus (63.87±4.19 vs.
58.27±3.83 h) did not differ significantly. The inten-
sity of signs of induced estrus under Doublesynch
and Estradoublesynch protocols was prominent in
50% and 65%, moderate in 25% and 25%, and weak
in 10% and 5% heifers, respectively, while 15% and
5% animals under respective protocols did not show
any behavioral estrus signs. Among the control group,
only two animals (20%) exhibited spontaneous estrus
543
 Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf

during the period of 90-day follow-up (Table-1).

Initiation of treatment
The estrus synchronization rates achieved with

Table-1: Effect of Doublesynch and Estradoublesynch protocols on estrus induction response, estrus induction intervals, and conception rates in pubertal anestrus Gir heifers.

to conception 
Doublesynch and Estradoublesynch protocols con-

27.89±5.75

26.45±5.48
curred well with previous reports in crossbred anestrus

(days)

83.00*
cattle [13] and in acyclic buffaloes [14,20], but were
higher than 70% each reported by Parida et al. [21] in
buffaloes. Moreover, the mean estrus induction inter-
vals recorded with both the protocols corroborated
well with earlier reports on anestrus cattle [13] and
buffaloes [20,21].
The conception rates in heifers at induced/first,

heifers at 60‑day

Anestrus
Status of NP Gir
second, third cycle, and overall of 3 cycles following

8
Doublesynch (20.00%, 23.07%, 22.22%, and 45.00%,

post‑AI

NP=Non‑pregnant, PGF2α: Prostaglandin F2α. *From the initiation of the experiment. Statistically, the values were similar between protocols
respectively) and Estradoublesynch protocols
(30.00%, 16.66%, 30.00%, and 55.00%, respectively)
were statistically same across the treatments (Table-1).

Cyclic
Moreover, among the 11 and 9 non-conceived Gir heif-

1
ers under Doublesynch and Estradoublesynch proto-
cols, 7 and 6 remained cyclic, while 4 and 3 turned out

55.00 (11/20)
45.00 (9/20)

10.00 (1/10)
to be anestrus by 60 days of estrus induction/FTAI as

Overall of
3 cycles
revealed by ovarian status. Overall 50% success rate
of fertility was achieved in just average 27 days from
the start of two treatment protocols, which was much
higher than only 10% found in control group.

30.00 (3/10)
The conception rates obtained at induced estrus

Third cycle

22.22 (2/9)

00.00 (0/1)
Conception rate (%)
with Doublesynch and Estradoublesynch protocols
were in accordance with the reports of Roodbari
et al. [16] as 18.7% and 26.2% in Holstein Friesian
cows and with the reports of Prajapati et al. [13] as 40%
and 30% in crossbred cows. However, other research- 23.07 (3/13)

16.66 (2/12)

0.00 (0/1)
Second

ers found much higher conception rates of 43.00% and

cycle

59.45% at induced estrus in anestrus cattle following

the use of Doublesynch [17] and Estradoublesynch [22]
protocols, respectively. Further, the present conception
rate at FTAI under Doublesynch protocol is comparable
20.00 (4/20)

30.00 (6/20)
first estrus

50.00 (1/2)
Induced/

to 28.57% recorded in cattle [15], but it is much lower

than 55-58% reported in acyclic buffaloes [20,23].
The present overall conception rate of 45% with
Doublesynch protocol is also much lower than 80.00%,
72.80% and 71.43% obtained in anestrus cattle by
PGF2α injection

interval (h)

Prajapati et al. [13], Abubaker et al. [15], and Ozturk

63.87±4.19

58.27±3.83
induction
to estrus

et al. [17], respectively. The present overall concep-

‑

tion rate of 55% with Estradoublesynch protocol is,

however, comparable with 55% and 60% obtained
with Doublesynch and Estradoublesynch protocols in
an earlier study in cattle [24]. In two more studies, the
response (%)

conception rate with Estadoublesynch protocol was

induction

(n=17)

(n=19)
Estrus

found to be 60%, and 64% in anestrus crossbred cattle

(n=2)
85.00

95.00

20.00

and buffaloes, respectively [13-14], Our results for the

first service and overall 3 cycles’ conception rates with
Doublesynch and Estadoublesynch protocols were also
comparable with those of Patel et al. [25] in anestrus
No.

20

20

10

buffaloes from middle Gujarat. The present relatively

lower and same conception rates found across treat-
Anestrus control
Estradoublesych

ments could be attributed to identical estrus response,

Doublesynch

the subject being heifers of just average BCS with small

Treatment

cervix, frightening and struggle while catching for AI

groups

from loose housing paddock, and AI being performed

by semi-skilled inseminators under field conditions.
Veterinary World, EISSN: 2231-0916 544
 Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf
Plasma progesterone profile
In bovines, corpus luteum (CL) or luteinized
follicle is the principal source of progesterone
hormone in vivo, and it is responsible for the stimu-
lation of cyclicity, follicular development, and main-
tenance of pregnancy. Its estimation in blood or milk
reflects the ovarian response to gonadotropins and/
or prostaglandins and thereby ovarian dynamics or
pregnancy. The overall mean plasma progesterone
concentrations were low or basal on the day of ini-
tiation of treatment in both the protocols. This sug-
gested the true anestrus status of Gir heifers selected
for the study. Further, the mean concentrations on
day 9 of treatment, i.e., just before the second PGF2α
injection, were found to be significantly higher than
on day 0 under Doublesynch (1.23±0.12 ng/ml) and
Estradoublesynch (1.40±0.20 ng/ml) protocols. This
might be due to luteinization of some of the grow-
ing follicles and/or ovulation of dominant folli-
cle and formation of CL under the influence of the
first GnRH injection. Thereafter, within 2-3 days
of the second PGF2α injection, the concentrations
dropped significantly to the basal levels with induced
estrus, when FTAIs were done. These levels again
increased significantly (p<0.05) on day 12 post-AI in
both the groups with mean values of 2.41±0.38 and
2.55±0.41 ng/ml, respectively. This could be due to
ovulatory-induced estruses with development and
maintenance of CL and establishment of pregnancy in
varying number of animals in each group (Table-2).
Further, in Estradoublesynch protocol, the estradiol
benzoate injected on day 10 might have triggered pos-
itive feedback effect on hypothalamus and pituitary
glands resulting in ovulatory luteinizing hormone
surge and thereby improved conception rate in that
group. The present trend of plasma progesterone com-
pared well with the earlier reports on cattle [26-27]
and buffaloes [25].
The mean plasma progesterone concentrations
were higher (p<0.05) in conceived than non-con-
ceived cows on day 12 post-AI in both Doublesynch
and Estradoublesynch protocols with values of
5.30±0.56 versus 1.69±0.21 and 5.02±0.49 versus
1.49±0.17 ng/ml, respectively. Further, signifi-
cant differences were also found in conceived and
non-conceived animals on day 9 of treatment (Table-2),
indicating better luteal activity before induced estrus
in conceived animals. Significantly lower plasma
progesterone profile seen on day 12 post-AI in
non-conceived cows under both the protocols proved
that these were the cases of anovulatory estrus and/
or luteal insufficiency. Earlier workers [12,28-29]
observed significantly (P<0.05) higher plasma pro-
gesterone values on day 20-21 post-AI in conceived
than non-conceived anestrus zebu cattle with Ovsynch
and CIDR protocols. Oyedipse et al. [30] observed
nonsignificantly higher plasma progesterone values
for the pregnant than non-pregnant heifers following
synchronization of estrus and AI. The trend and mean
Veterinary World, EISSN: 2231-0916
plasma progesterone concentrations found in the pres-
ent study for the effect of sampling days and conceived
and nonconceived statuses of animals closely collabo-
rated with previous reports [4,25,29,31] following use
of various estrus induction/synchronization protocols
in anestrus cattle and buffaloes.
Plasma total protein profile
In heifers under Doublesynch protocol, the
overall mean plasma protein concentrations did not
differ significantly between sampling days. A simi-
lar non-significant variation in mean plasma protein
levels in anestrus Gir [28] and crossbred [32] cattle
treated with Ovsynch and CIDR protocols have been
reported earlier. In Estradoublesynch protocol, the
mean plasma protein levels on the day of FTAI and
day 12 post-AI were significantly (p<0.05) higher
compared to day 0 and 9 of the protocol. Recent
studies [13,33-34] also reported similar findings
with different synchronization protocols in postpar-
tum anestrus crossbred cows. Further, the overall
mean protein concentrations did not differ signifi-
cantly between the two protocols at day 0 and day 9.
However, heifers under Estradoublesynch protocol
had significantly (p<0.05) higher values on the day of
FTAI and day 12 post-AI as compared to Doublesynch.
Similar findings were reported by Ammu et al. [28]
in Ovsynch- and CIDR-treated anestrus Gir cows
and by Patel et al. [32] in crossbred cows. The
overall pooled mean plasma total protein concen-
tration was significantly lower in anestrus heifers
under Doublesynch than Estradoublesynch protocol
(7.22±0.09 vs. 7.58±0.07 g/dl). However, in a recent
study [24], an inverse trend was observed with higher
value in crossbred cattle under Doublesynch proto-
col than Estradoublesynch protocol (8.19±0.27 vs.
7.31±0.69 g/dl).
Further, the protein profile did not differ signifi-
cantly between conceived and non-conceived groups
at any of the days in any of the protocols. These obser-
vations were in close agreement with those in anestrus
crossbred cattle with the same protocols [13], and in
normal cows [35] that conceived than those did not
conceive (6.86±0.10  vs. 6.04±0.10  g/dl ). Plasma
protein levels change with different stages of repro-
duction, depending on the feed intake of the animal.
Protein deficiency retarded the development of repro-
ductive organs and was considered to be a factor
responsible for failure or delay in the onset of postpar-
tum estrus [11]. However, Gentile et al. [36] reported
that serum protein level was not related to fertility in
dairy cows.
Plasma total cholesterol profile
Significant differences were observed in the
overall mean plasma cholesterol concentrations
between sampling days in heifers under Doublesynch
protocol. The values on day 12 post-AI and day of
FTAI were significantly higher as compared to those
of day 0 and day 9. Similar results were also found
545
 Table-2: Plasma progesterone, total protein, and total cholesterol concentrations in pubertal anestrus Gir heifers on different days of various estrus induction/synchronization
protocols and day 12 post‑AI.

Plasma profile Synchronization Status No. of Days from treatment/AI

protocol heifers
D‑0 D‑9 D‑12, FTAI D‑12 post‑AI Overall

Veterinary World, EISSN: 2231-0916

Progesterone (ng/ml) Doublesynch Conceived 4 0.72±0.08 1.80±0.31q 0.48±0.02 5.30±0.56q 2.08±0.52q
Non‑concd 16 0.53±0.06 1.09±0.11p 0.56±0.05 1.69±0.21p 0.96±0.08p
Overall 20 0.56±0.05x 1.23±0.12y 0.54±0.04x 2.41±0.38z 1.19±0.13

Estradoublesynch Conceived 6 0.44±0.04 2.46±0.40q 0.53±0.05 5.02±0.49q 2.11±0.42q

Non‑concd 14 0.58±0.05 0.95±0.07p 0.54±0.05 1.49±0.17p 0.89±0.07p
Overall 20 0.54±0.04x 1.40±0.20y 0.53±0.04x 2.55±0.41z 1.25±0.15

Protein (g/dl) Doublesynch Conceived 4 7.20±0.09 7.27±0.10 7.32±0.12 7.25±0.12 7.26±0.05

Non‑concd 16 7.02±0.24 7.27±0.27 7.28±0.22 7.25±0.22 7.21±0.12
Overall 20 7.06±0.19 7.27±0.21 7.29±0.18a 7.26±0.18a 7.22±0.09a

Estradoublesynch Conceived 6 7.41±0.26 7.47±0.25 7.85±0.20 8.09±0.28 7.70±0.13

Non‑concd 14 7.17±0.20 7.44±0.18 7.72±0.17 7.76±0.16 7.52±0.09
Overall 20 7.24±0.16x 7.45±0.14×y 7.76±0.13by 7.86±0.14by 7.58±0.07b

Cholesterol (mg/dl) Doublesynch Conceived 4 117.88±8.56 120.10±7.40 137.6850±6.08 142.98±10.31 129.67±4.63p

Non‑concd 16 127.45±3.68 134.83±3.33 145.8113±4.23 149.97±3.92 139.51±2.17q
Overall 20 125.53±3.41x 131.88±3.25ax 144.19±3.61y 148.58±3.68y 137.54±2.00a

Estradoublesynch Conceived 6 120.88±4.41p 131.75±3.79p 143.79±2.34p 137.41±1.24p 133.46±2.30p

Non‑concd 14 134.40±3.17q 147.47±3.54q 158.84±4.57q 160.88±4.91q 150.39±2.45q
Overall 20 130.34±2.89x 142.76±3.14by 154.32±3.60z 153.83±4.21z 145.32±2.03b
Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf

D‑0=Day of starting the treatment, D‑9=Day of PG injection, While D‑12=Fixed‑timed artificial insemination, Non‑concd=Non‑conceived. Means of a trait bearing uncommon
superscripts within the row (x, y, z), column (a, b), and conceived and non‑conceived (p, q) subgroups within the protocol differ significantly (p<0.05). FTAI=Fixed‑timed
artificial insemination

546
 Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf
in Estradoublesynch protocol with significantly
higher value on day 9 compared to day 0. The mean
plasma cholesterol concentration was lowest at initial
anestrus phase (day 0), but reached a peak on the day
of induced estrus/FTAI (follicular phase) and day 12
post-AI (luteal phase) in both the protocols (Table-2).
Bora et al. [33] observed higher plasma cholesterol
concentrations on the day of induced estrus and on day
20 than day 10 or 0 of treated respondent postpartum
anestrus crossbred cows. However, in earlier studies
employing Ovsynch, Cosynch, PRID, etc., the plasma
cholesterol levels were not influenced significantly
between sampling days in anestrus cattle [4,32,34].
There were no significant differences in protein
profile between conceived and non-conceived heifers
at any of the sampling days, although the values were
apparently higher in non-conceived than conceived
animals with significant difference in pooled val-
ues (139.51±2.17 vs. 129.67 ±4.63 mg/dl) in heifers
under Doublesynch protocol, while in heifers under
Estradoublesynch protocol, the concentrations were
significantly (p<0.01) higher in non-conceived than
conceived animals at all days including overall pooled
mean (Table-2). Similar findings were also noted ear-
lier [13] with both these protocols in anestrus cows.
The increase in circulatory cholesterol level at estrus
induction was opined to be due to the mechanism by
which estrogens affect the complex interrelationships
of pituitary–thyroid–adrenal functions and the estro-
gens had an effect on the carbohydrate metabolism
that in turn caused an increased production of cho-
lesterol in endocrine gland tissue from acetate [37].
Steroid hormones have a direct relationship with cho-
lesterol metabolism. The higher cholesterol level in
the cycling animals is indicative of more secretion of
steroids during estrus induction due to increased ovar-
ian activity [38]. Kavani et al. [39] opined that the low
cholesterol level might have resulted in inadequate
synthesis of sex steroid hormones leading to anestrus
condition.
Conclusion
From the study, it can be concluded that both
Doublesynch and Estradoublesynch protocols resulted
in almost similar estrus induction and conception
rates, with modulation of plasma progesterone and
cholesterol profile. It is, therefore, suggested to use
Estradoublesynch protocol due to its cost-effective-
ness in the successful treatment of anestrus in pubertal
Gir heifers.
Authors’ Contributions
DMP and AJD planned and designed the study.
The experiment was conducted by NJC, KBV, KKH,
and JAP. NJC did laboratory work. AJD and DMP
carried out interpretation of results. All authors par-
ticipated in data analysis, preparation of a draft of
the manuscript, and read and approved the same. All
authors read and approved the final manuscript.
Veterinary World, EISSN: 2231-0916
Acknowledgments
We are grateful to Dean of the faculty for the
facilities provided, Baroda dairy, and farmers for
kind cooperation in blood sampling of their animals,
and ICAR for financial support through sanctioning
“AICRP on Nutritional and Physiological Interventions
for Enhancing Reproductive Performance in Dairy
Animals” to the College (BH 2028) with Dr. A J
Dhami as the principal investigator.
Competing Interests
The authors declare that they have no competing
interests.
References
1. Kumar, P. and Singhal, L.K. (2006) Gir: Important milch
cattle of Western India. Indian Cow, 1: 67-68.
2. Gaur, G.K., Kaushik, S.N. and Garg, R.C. (2003) The Gir
cattle breed of India–Characteristics and present status.
Anim. Gen. Resources Info., 33: 21-30.
3. Singh, U., Khurana, N.K. and Inder, J. (1998) Plasma pro-
gesterone profiles and fertility status of anoestrus zebu cat-
tle treated with norgestomet response estradiol-eCG regi-
men. Theriogenology, 50: 1191-1199.
4. Dhami, A.J., Nakrani, B.B., Hadiya, K.K., Patel J.A. and
Shah, R.G. (2015) Comparative efficacy of different estrus
synchronization protocols on estrus induction response, fer-
tility and plasma progesterone and biochemical profile in
crossbred anestrus cows. Vet. World, 8: 1310-1316.
5. Cirit, U., Ak, K. and Ileri, I.K. (2007) New strategies to
improve the efficiency of the Ovsynch protocol in primipa-
rous dairy cows. Bull. Vet. Inst. Pulawy, 51: 47-51.
6. Sirmour, S., Nema, S.P., Singh, B.K. and Shukla, S.P.
(2006) Induction of estrus in delayed pubertal crossbred
heifers. Indian J. Anim. Reprod., 27: 55-58.
7. Masoumi, R., Badiei, A., Shahneh, A., Kohram, H.,
Dirandeh, E., Colazo, M.G. (2017) A short presynchroniza-
tion with PGF2α and GnRH improves ovarian response and
fertility in lactating Holstein cows subjected to a Heatsynch
protocol. Ann. Anim. Sci., 17: 169-177.
8. Dirandeh, E., Roodbari, A.R., Gholizadeh, M., Deldar, H.,
Masoumi, R., Kazemifard, M. and Colazo, M.G. (2015)
Administration of prostaglandin F2α 14 d before initiat-
ing a G6G or a G7G timed artificial insemination protocol
increased circulating progesterone prior to artificial insem-
ination and reduced pregnancy loss in multiparous Holstein
cows. J. Dairy Sci., 98: 5414-5421.
9. Mario, B., Roberto, S., Jose, L.M., Leopoldo, J.M.,
Marcos, H. and Roney, S.R. (2016) Evolution in Fixed-
time, from Synchronization of Ovulation to Improve
Fertility. Available from: http//www.researchgate.net/publi-
cation/268506071. Last accessed on 14-07-2017.
10. Jain, G.C. (1994) Mineral profiles during anoestrus and
repeat breeding in bovines. Int. J. Anim. Sci., 9: 241-245.
11. Roberts, S.J. (1986) Veterinary Obstetrics and Genital
Diseases. 3rd ed. Ithaca, New York, USA.
12. Khade, N.B., Patel, D.M., Naikoo, M., Dhami, A.J.,
Sarvaiya, N.P. and Gohel, M.M. (2011) Estrus induction in
pubertal anoestrus Gir heifers using different hormone pro-
tocols. Indian J. Field Vets., 7: 4-8.
13. Prajapati, A.R., Dhami, A.J., Hadiya, K.K. and Patel, J.A.
(2018) Influence of estrus synchronization protocols on
plasma profile of progesterone, protein and cholesterol in
acyclic Holstein Friesian crossbred cows. Indian J. Vet. Sci.
& Biotech., 13(4): 5-11. .
14. Mirmahmoudi, R., Souri, M. and Prakash, B.S. (2014)
Comparison of endocrine changes, timing of ovulations,
ovarian follicular growth, and efficacy associated with
547
 Available at www.veterinaryworld.org/Vol.11/April-2018/21.pdf
Estradoublesynch and Heatsynch protocols in Murrah buf-
falo cows. Theriogenology, 82: 1012-1020.
15. Abubaker, P.S., Kurien, M.O., Ghosh, K.N., Simon, S.,
Anil, K.S. and Becha, B.B. (2013) Ovulation synchroni-
sation for improving fertility in postpartum cows. J. Vet.
Anim. Sci., 44: 42-45.
16. Roodbari, A.R., Dirandeh, E. and Colazo, M.G. (2015) A New
Ovulation Synchronization Protocol (Estradoublesynch)
Improves Fertility in Heat-stressed Lactating Holstein
Cows. 3rd  Int. Congr. Large Animal Practitioners, Tehran,
Iran, Feb 2015.
17. Ozturk, O.A., Cirit, U., Baran, A. and Ak, K. (2010) Is
Doublesynch protocol a new alternative for timed artifi-
cial insemination in anestrous dairy cows. Theriogenology,
73: 568-576.
18. Kubasic, N.P., Hallauer, G.D. and Brodows, R.G. (1984)
Evaluation of direct solid-phase RIA for progesterone, use-
ful for monitoring luteal function. Clin. Chem., 30: 284-286.
19. Snedecor, G.W. and Cochran, W.G. (1986) Statistical
Methods. 8th ed. Iowa State University Press, Ames, Iowa,
USA.
20. Mirmahmoudi, R. and Prakash, B.S. (2012) The endocrine
changes, the timing of ovulation and the efficacy of the
Doublesynch protocol in the Murrah buffalo (Bubalus bub-
alis). General Comp. Endocrinol., 177: 153-159.
21. Parida, P.K., Mishra, P.C., Mohanty, D.N., Swain, R.K.,
Barik, A.K. and Das, S. (2015) Successful use of Different
Synch Protocols for Estrus Induction in Buffaloes. Proc.
XXXI Annual Convention of ISSAR, Veterinary College,
Hebbal, Bengaluru, Dec., 3-5. p28.
22. Shravanan, V., Kulasekar, K., Krishnakumar, K. and
Venkantaramanna, S. (2016) Synchronization of Ovulation
using Ovsynch and Estradoublesynch Protocols in
Crossbred Cattle. Proc. 32nd Annual Convention of ISSAR
and National Seminar. Dec. 6-8, Tirupati (AP), India. p29.
23. Dhindsa, S.S., Honparkhe, M., Grewal, R.S. and Brar, P.S.
(2016) Fertility enhancement through Doublesynch pro-
tocol in buffalo during summer season. Indian Vet. J.,
93: 17-19.
24. Sahoo, J.K., Das, S.K., Sethy, K., Mishra, S.K., Swain, R.K.,
Mishra, P.C. and Sahoo, S.P. (2017) Comparative evalua-
tion of hormonal protocol on the performance of crossbred
cattle. Trop. Anim. Health Prod., 49: 259-263.
25. Patel, A.J., Patel, J.A., Dhami, A.J., Prajapati, J.P. and
Parmar, S.C. (2018) Estrus induction, fertility and biochem-
ical profile in true anoestrus Surti buffaloes primed with
different estrus synchronization protocols. Indian J. Anim.
Reprod., 39(2): 36-39.  females. Indian J. Anim. Reprod., 12: 28-29.
26. Diaz, T. (1986) Plasma progesterone levels during the
estrous cycle of Holstein and Brahman cows, Carora type
and crossbred heifers. Theriogenology, 26: 419-432.
27. Bhoraniya, H.L., Dhami, A.J., Naikoo, M., Parmar, B.C.
********
Veterinary World, EISSN: 2231-0916
and Sarvaiya, N.P. (2012) Effect of oestrus synchroniza-
tion protocols on plasma progesterone profile and fertility
in postpartum anoestrus Kankrej cows. Trop. Anim. Health
Prod., 44: 1191-1197.
28. Ammu, R., Dhami, A.J., Ankita, K. and Pande, A.M. (2012)
Postpartum plasma progesterone and metabolic profile in
pregnant and non-pregnant Gir cows following estrus syn-
chronization. Indian J. Anim. Prod. Mgmt., 24: 40-44.
29. Desmukh, Y.D., Markandeya, N.M., Chaudhari, R.J. and
Deshmukh, V.V. (2010) Progesterone profile in two differ-
ent protocols of estrus synchronization in postpartum Red
Kandhari cows. Indian J. Anim. Reprod., 31: 37-39.
30. Oyedipe, E.O., Vohjr, A.A., Marire, B.N. and Pathiraja, N.
(1986) Plasma progesterone concentrations during the oes-
trous cycle and following fertile and non-fertile insemina-
tions of zebu heifers. Br. Vet. J., 142: 41-46.
31. Naikoo, M., Dhami, A.J. and Ramakrishnan, A. (2016)
Effect of estrus synchronization on plasma progester-
one profile and fertility response in postpartum suck-
led anestrous Kankrej cows. Indian J. Anim. Res.,
50: 460-465.
32. Patel, K.R., Dhami, A.J., Hadiya, K.K., Savalia, K.K. and
Sarvaiya, N.P. (2013) Effect of CIDR and Ovsynch proto-
cols on estrus response, fertility and plasma progesterone
and biochemical profile in true anoestrus crossbred cows.
Indian J. Anim. Prod. Mgmt., 29: 50-58.
33. Bora, B., Perumal, P., Bonia, K. and Biswas, R.K. (2014)
Effect of non-hormonal treatments on postpartum true
anoestrus crossbred dairy cows. Int. J. Bio-Resour. Stress
Mgmt., 5: 249-255.
34. Borakhatariya, D.N., Panchal, M.T., Dhami, A.J.,
Hadiya, K.K. and Kalasariya, R.M. (2017) Efficacy of
estrus synchronization protocols during summer and winter
seasons together with biochemical and minerals profile in
anestrus cows. Indian J. Vet. Sci. Biotech., 13: 9-16.
35. Srivastava, S.K. and Sahni, K.L. (2000) Blood mineral level
affecting pregnancy rates in cows and buffaloes. Indian. J.
Anim. Sci., 70: 33-34.
36. Gentile, G., Moretti, M., Gaiani, R. and Giordani, L. (1978)
Correlation between some biochemical constituents and
low fertility in Moderice province. Clin. Vet., 101: 17-24.
37. Purohit, M.K. and Kohli, I.S. (1977) Variations in the blood
serum cholesterol level in Rathi cow during estrus. Indian
Vet. J., 54: 268-270.
38. Pal, S.K., Mohanty, B.N., Ray, S.K.H. and Mohanty, S.N.
(1991) Studies on serum protein, cholesterol and cer-
tain enzymes in relation to reproductive status in bovine
39. Kavani, F.S., Sharma, V.K., Siddiquee, G.M. and
Vadodaria,  V.P. (1987) Serum proteins, ascorbic acid and
total cholesterol in anoestrus Kankrej heifers. Indian J.
Anim. Reprod., 8: 148-150.
548
 Nutritional and Management Considerations to Minimize Stress and
Optimize Production Efficiency in Cow-Calf Systems
Reinaldo Fernandes Cooke1
Department of Animal Science, Texas A&M University

Introduction

Stress response is defined as the reaction(s) of an animal to internal and external

factors that influence its homeostasis and wellbeing (Moberg, 2000), whereas animals
unable to cope with these factors are classified as stressed (Dobson and Smith, 2000).
Within beef production systems, cattle are inevitably exposed to stress during their
productive lives (Carroll and Forsberg, 2007), including psychologic, physiologic, and
physical stressors associated with routine management practices (Cooke, 2017). In cow-
calf systems, stressors may emerge from housing management, dietary and
environmental changes, inadequate or excessive nutrition, disease, and cattle
disposition. Hence, management to prevent and/or alleviate stressors is critical for optimal
productive efficiency in cow-calf and beef production enterprises.

Although the physiologic consequences of stress are still not fully elucidated
(Pacak and Palkovits, 2001), it has been demonstrated that stressors impact the immune
system, as well as different responses within the body, mainly via the hypothalamic-
pituitary-adrenal (HPA) axis (Elenkov, et al., 2000). Elevated cortisol is one of the main
outcomes of the HPA reaction, independently if the stressor is from psychological,
physiological, or physical nature (Cooke, 2017). This is the reason to why cortisol is
generally considered the paramount to the neuroendocrine stress response (Sapolsky et
al., 2000), and a major link between stress and productive functions (Cooke, 2017).
Despite playing crucial roles in several body functions, cortisol degrades muscle and
adipose tissues to increase the availability of energy to the animal. Cortisol has also been
shown to impair physiological reactions associated with reproduction (Dobson et al.,
2001). Supporting the negative impacts of stress + HPA axis in beef production systems,
our group demonstrated a negative relationship between plasma cortisol concentrations
and reproductive performance in beef females (Figure 1; Cooke, 2014, Cooke et al., 2017;
Cooke et al., 2018).

Stocking Density

High stocking density is perceived as a major stressor by livestock (Grandin,

2014). However, stocking density has been overlooked by US cow-calf producers due to
the extensive nature of these operations (Asem-Hiablie et al., 2016). Yet, there are

1 Contact at: Department of Animal Sciences, Texas A&M University, College Station, TX; E-mail:
reinaldocooke@tamu.edu.
specific segments within cow-calf production where cattle are exposed to intensive
management and housing, particularly replacement heifers. In typical US spring-calving
herds (≥ 70% of the nation’s cow-calf operations; NASS, 2016), replacement heifers are
weaned in the fall (~7 months of age) and exposed to their first breeding season the
following spring (~15 months of age). During late fall and winter, heifers may be reared in
drylot systems to ensure adequate feeding for growth (Olson et al., 1992; NASS, 2016)
without specific considerations for stocking density. Moreover, intensifying cow-calf
production by placing beef females in drylots during most or all of the year has been
gaining attention (Lardy et al., 2017), as availability of grazing areas becomes limited by
environmental challenges (e.g. drought), conversion to crop grounds, and use for non-
agricultural purposes (e.g. accommodate urban expansion).

Despite the increasing number of beef females reared in drylots within the US cow-
calf industry, our research group (Schubach et al., 2017) was the first to investigate and
portray the potential adversities resultant from this management scheme to heifer welfare
and reproductive development. We compared growth, physical activity, stress-related and
physiological responses, and puberty attainment in beef heifers reared on high (14
m2/heifer, drylot; HIDENS) or low (25,000 m2/heifer, paddocks; LOWDENS) stocking
densities from weaning until their first breeding season. The HIDENS was designed within
the recommended stocking density for growing cattle reared in drylots (FASS, 2010).
Heifers from both treatments received similar dietary regimens given that paddocks had
no forage available for grazing, and a variety of stress-related, physical activity, and
developmental responses were evaluated.

Physical activity: Heifers from HIDENS took fewer steps/week compared with
LOWDENS (Table 1), given the larger area that LOWDENS heifers had available for
movement. Hence, high stocking density reduced the opportunity for heifers to exercise.

Physiological responses. Cortisol concentration in hair from the tail switch is a

validated biomarker of chronic stress in cattle (Burnett et al., 2014; Moya et al., 2015),
given that cortisol is gradually accumulated in the emerging tail hair and its concentration
represents long-term adrenocortical activity (Moya et al., 2013). Accordingly, cortisol
concentration in hair from the tail switch were greater in HIDENS compared with
LOWDENS heifers during the majority of the experimental period (Figure 2), corroborating
that high stocking density chronically stimulated heifer adrenocortical activity. Mean
expression of heat shock protein (HSP) 70 and HSP72 mRNA in whole blood during the
experiment were greater in LOWDENS vs. HIDENS heifers (Table 1). Although HSP
mRNA expression can also be used as diagnostic marker of stress, exercise upregulates
and increases circulating concentrations of these HSP (Milne and Noble, 2002). Exercise
activates the HSP response via several mechanisms including increased muscle
temperature, exercise-related production of reactive oxygen species, and muscle ATP
depletion (Noble et al., 2008). Hence, treatment effects detected for whole blood mRNA
expression of HSP70 and HSP72 were also associated with the increased physical
activity of LOWDENS heifers throughout the experiment, including prior to and during
handling for sampling.
 Growth responses: Elevated physical activity increases maintenance
requirements in cattle (NRC, 2000). According to physical activity and space available to
LOWDENS, their maintenance energy requirements were estimated to be 15% greater
compared with that of HIDENS heifers (NRC, 2000). However, LOWDENS and HIDENS
heifers had similar body weight (BW) gain during the experiment (Table 1), despite
receiving the same diets and calculated differences in nutritional needs. Alternatively, the
chronic stress experienced by HIDENS heifers likely increased their basal metabolism and
maintenance requirements to the same level that physical activity increased these
parameters in LOWDENS heifers.

Reproductive development: Puberty attainment was delayed in HIDENS

compared with LOWDENS heifers (Table 1; Figure 3). Within heifers that reached puberty
during the experiment, HIDENS were heavier and older at puberty compared with
LOWDENS heifers (Table 1). Although age at puberty in cattle is highly determined by
BW and growth rate (Schillo et al., 1992), high stocking density hindered puberty
attainment despite similar growth between HIDENS and LOWDENS heifers. It is also
important to note that heifers from both treatments achieved the recommended BW for
puberty attainment during the experimental period (60-65% of mature BW; Patterson et
al., 2000).
Results from Schubach et al. (2017) were novel and indicate that rearing heifers
in drylots with a high stocking density is detrimental to welfare aspects including physical
activity and chronic stress, resulting in delayed puberty despite adequate age and body
development. Puberty attainment defines reproductive development, and regulates
lifetime reproductive efficiency of beef females (Schillo et al., 1992). In turn, physical
activity modulates circulating concentrations of endogenous opioids (Harber and Sutton,
1984), which impact secretion of gonadotropins required for a successful ovulation and
puberty achievement in cattle (Mahmoud et al., 1989). Chronic stress and resultant
increase in adrenocortical activity also impair gonadotrophin synthesis and reduce the
sensitivity of the brain to estrogen (Dobson and Smith, 2000). Therefore, Schubach et al.
(2017) exposed the need for research to investigate management and stocking density
guidelines for beef heifers reared in drylots, which will contribute to enhancing welfare
conditions and overall efficiency in US cow-calf systems.

Stress from Change in Environment and Diet

Grazing and dietary habits are learned early in life, resulting in motor skills
necessary to harvest and ingest forages (Provenza and Balph, 1987). Moreover, such
skills learned between weaning and breeding have been reported to carry through to the
next grazing season (Olson et al., 1992). Young ruminants consume small amounts of
novel food and gradually increase the amount ingested if no adverse effects occur
(Chapple and Lynch, 1986). Hence, replacement heifers often spend more time and
energy foraging while ingesting less food when introduced to novel environments and
feed sources (Osuji, 1974; Curll and Davidson, 1983). Accordingly, heifers that grazed
forage from weaning to breeding rather than being placed in drylots retained better
grazing skills and had increased average daily gains into the subsequent grazing season
(Olson et al., 1992).
 Following this rationale, Perry et al. (2013) compared BW change and pregnancy
rates to artificial insemination (AI) in replacement beef heifers that were weaned into
drylots and moved to pastures after breeding, compared with cohorts that were
maintained on pasture since breeding. These authors reported less BW gain after AI in
heifers originated from drylots, as well as reduced pregnancy rates to AI compared with
those with previous grazing experience (Table 2). Hence, the stressors elicited by change
in environment, associated with inadequate forage intake, contributed to decreased
reproductive efficiency in drylot heifers moved to pastures upon AI (Perry et al., 2013).

Excitable Temperament Also Is a Stressor

As mentioned above, stress response is defined as the reaction of an animal to

internal and external factors that influence its homeostasis, and cattle unable to cope with
these factors are classified as stressed (Dobson and Smith, 2000; Moberg, 2000). Based
on this concept, the fearful and/or aggressive responses expressed by excitable cattle
during human handling can be attributed to their inability to cope with this situation;
therefore, classified as a stress response. Accordingly, excitable cattle typically
experience changes in their neuroendocrine system and HPA axis that culminates with
increased synthesis of cortisol. Several research studies reported that cattle with
excitable temperaments have greater circulating cortisol concentrations during handling
compared to cohorts with adequate temperament (Cooke, 2014). It is worth mentioning
that the aforementioned studies evaluated B. taurus- and B. indicus-influenced cattle from
different ages, genders, and across intensive and extensive systems. Hence, excitable
temperaments have been positively associated with neuroendocrine stress reactions
independent of breed type, age category, and production system.

As an initial attempt to associate temperament and reproduction in beef females,

Plasse et al. (1970) classified B. indicus heifers according to temperament score (1 =
calm, 2 = moderate, and 3 = excitable temperament) and reproductive score (heifers with
inadequate reproductive performance received the greatest scores). These authors
reported that temperament score was positively correlated with reproductive scores and
negatively correlated with length of estrus, and suggested that consideration of
temperament in selection programs might have a positive influence on the reproductive
efficiency of the cowherd. However, the practical effects of excitable temperament on
reproductive function of beef females still needed further investigation. Hence, our
research group recently assessed the impacts of temperament on reproductive
performance of B. taurus and B. indicus-influenced cows (Cooke et al., 2009; Cooke et
al., 2011; Cooke et al., 2012).

Cooke et al. (2009) evaluated temperament at the beginning of the breeding

season in Braford cows exposed to a 90-d bull breeding, and Brahman x British cows
assigned to fixed-time AI followed by a 90-d bull breeding. Probability of pregnancy during
the breeding season was negatively associated with temperament score, independently
of breed and reproductive management (Figure 4). Similarly, Cooke et al. (2011)
evaluated temperament in Nelore cows assigned to a fixed-time AI protocol, and reported
that cows with excitable temperament had reduced pregnancy rates compared to cohorts
with adequate temperament (Table 3). More recently, Cooke et al. (2012) evaluated
temperament at the beginning of the breeding season in Angus × Hereford cows assigned
to 50-d bull breeding only, or fixed-time AI followed by a 50-d bull breeding. Cows with
excitable temperament had reduced pregnancy rate, calving rate, weaning rate, and kg
of calf weaned/cow exposed compared to cows with adequate temperament (Table 3),
indicating that excitable temperament not only impairs reproductive performance, but also
overall production efficiency in cow-calf systems.

Collectively, these results demonstrated that cows with excitable temperament had
reduced reproductive performance compared to cohorts with adequate temperament.
Such outcomes were independent of breed type (B. taurus and B. indicus-influenced
cattle), reproductive management (AI, natural breeding, or both), and perhaps nutritional
status because cow BCS at the beginning of the breeding season was not affected by
temperament (Cooke et al., 2009; 2011; 2012). Plasma cortisol concentrations were
greater in cows with excitable temperament (Cooke et al., 2009; 2012), which indicates
that their decreased pregnancy rates could be attributed to neuroendocrine stress
responses stimulated by handling for estrus synchronization and AI (Dobson et al., 2001).
However, the same decrease in reproductive performance was observed in excitable
cows assigned to natural breeding only, with no human interaction or handling to stimulate
neuroendocrine stress responses during the breeding season. Therefore, additional
mechanisms associating temperament and reproduction in beef females, including post-
conception effects and potential genetic and innate deficiencies within the reproductive
system of excitable cows, warrant further investigation (Cooke et al., 2012).

Conclusions

Stress has direct implications to beef cattle production systems, including

reproductive efficiency of beef females within cow-calf operations. These impacts are
mediated, at least partially, by neuroendocrine stress reactions that hinder ovulation and
pregnancy success. Moreover, stressors from different natures (physical, physiological,
and psychological) stimulate similar negative responses to cattle welfare and production.
Many of these stressors are elicited by routine production practices including stocking
density, nutrition, transport, and cattle responses to human handling. Therefore,
management that prevents or mitigate these stressors are warranted for optimal
production efficiency of cow-calf operations.

References

Asem-Hiablie, S., C. A. Rotz, R. Stout, and K. Stackhouse-Lawson. 2016. Management

characteristics of beef cattle production in the Northern Plains and Midwest regions
of the United States. Prof. Anim. Sci. 32:736–749.
Burnett, T. A., A. M. L. Madureira, B. F. Silper, A. Nadalin, A. M. Tahmasbi, D. M. Veira,
and R. L. A. Cerri. 2014. Short communication: Factors affecting hair cortisol
concentration in lactating dairy cows. J. Dairy Sci. 97:7685–7690.
Carroll, J. A., and N. E. Forsberg. 2007. Influence of stress and nutrition on cattle
immunity. Vet. Clin. North Am. Food. Anim. 23:105-149.
Chapple, R. S., and J. J. Lynch. 1986. Behavioral factors modifying acceptance of
supplementary foods by sheep. Res. Dev. Agric. 3: 113-120.
Cooke, R. F. 2014. Temperament and acclimation to human handling influence growth,
health, and reproductive responses in Bos taurus and B. indicus cattle. J. Anim.
Sci. 92:5325:5333.
Cooke, R. F. 2017. Invited paper: nutritional and management considerations for beef
cattle experiencing stress-induced inflammation. Prof. Anim. Sci. 33:1-11.
Cooke, R. F., D. W. Bohnert, B. I. Cappellozza, C. J. Mueller, and T. DelCurto. 2012.
Effects of temperament and acclimation to handling on reproductive performance
of Bos taurus beef females. J. Anim. Sci. 90:3547-3555.
Cooke, R. F., D. W. Bohnert, M. Meneghetti, T. C. Losi, and J. L. M. Vasconcelos. 2011.
Effects of temperament on pregnancy rates to fixed-timed AI in Bos indicus beef
cows. Livest. Sci. 142:108-113.
Cooke, R. F., J. D. Arthington, D. B. Araujo, and G. C. Lamb. 2009. Effects of acclimation
to human interaction on performance, temperament, physiological responses, and
pregnancy rates of Brahman-crossbred cows. J. Anim. Sci. 87:4125-4132.
Cooke, R. F., K. M. Schubach, R. S. Marques, R. G. Peres, L. G. T. Silva, R. Carvalho,
R. S. Cipriano, D. W. Bohnert, A. V. Pires, and J. L. M. Vasconcelos. 2017. Effects
of temperament on physiological, productive, and reproductive responses in Bos
indicus beef cows. J. Anim. Sci. 95:1-8.
Cooke, R.F., P. Moriel, B.I. Cappellozza, V.F.B. Miranda, L.F.D. Batista, E.A. Colombo,
V.S.M. Ferreira, M.F. Miranda, R.S. Marques, and J.L.M. Vasconcelos. 2018.
Effects of temperament on growth, plasma cortisol concentrations and puberty
attainment in Nelore beef heifers. Animal 10.1017/S1751731118002628.
Curll, M.L., and J.L. Davidson. 1983. Defoliation and productivity of a Phalaris-
subterranean clover sward, and the influence of grazing experience on sheep
intake. Grass Forage Sci. 38:159-167.
Dobson, H. and R.F. Smith. 2000. What is stress and how does it affect reproduction?
Anim. Repro. Sci. 60-61:743-752.
Dobson, H., J.E. Tebble, R.F. Smith, and W.R. Ward. 2001. Is stress really all that
important? Theriogenology 55:65-73.
Elenkov, I.J., R.L. Wilder, G.P. Chrousos, and E.S. Vizi. 2000. The sympathetic nerve -
An integrative interface between two supersystems: the brain and the immune
system. Pharmacol. Rev. 52:595–638.
FASS. 2010. Guide for the care and use of agricultural animals in agricultural research
and teaching. 3rd ed. Federation of Animal Science Societies, Savoy, IL.
Grandin, T. 2014. Livestock handling and transport. 4th edition. Wallingford: CABI
Publishing.
Harber, V. J., and J. R. Sutton. 1984. Endorphins and exercise. Sports Med. 1:154-171.
Lardy, G. P., S. L. Boyles, and V. L. Anderson. 2017. Dry lot beef cow/calf production.
AS-974 - North Dakota State University Experimental Station, Fargo, ND.
Mahmoud, A. I., F. N. Thompson, D. D. Peck, K. M. Mizinga, L. S. Leshin, L. A. Rund, J.
A. Stuedemann, and T. E. Kiser. 1989. Difference in luteinizing hormone response
to an opioid antagonist in beef heifers and cows. Biol. Reprod. 41:431-437.
Milne, K.J., and E. G. Noble. 2002. Exercise-induced elevation of HSP70 is intensity
dependent. J. Appl. Physiol. 93: 561–568.
Moberg, G. P. 2000. Biological response to stress: Implications for animal welfare. In: G.
P. Moberg and J. A. Mench (ed.) The Biology of Animal Stress: Basic Principles
and Implications for Animal Welfare. pp 1–21. CAB International, Oxon, UK.
Moya, D., K. S. Schwatzkopf-Genswein, and D. M. Veira. 2013. Standardization of a non-
invasive methodology to measure cortisol in hair of beef cattle. Livest. Sci.
158:138–144.
Moya, D., M. L. He, L. Jin, Y. Wang, G. B. Penner, K. S. Schwartzkopf-Genswein and T.
A. McAllister. 2015. Effect of grain type and processing index on growth
performance, carcass quality, feeding behavior, and stress response of feedlot
steers. J. Anim. Sci. 93:3091–3100.
NASS. 2016. Overview of the United States cattle industry. Available at
https://usda.mannlib.cornell.edu/usda/current/USCatSup/USCatSup-06-24-
2016.pdf.
Noble, E. G., K. J. Milne, and C. W. J. Melling. 2008. Heat shock proteins and exercise:
a primer. Appl. Physiol. Nutr. Metab.33:1050-1065.
NRC. 2000. Nutrient Requirements of Beef Cattle. 7th ed. Natl. Acad. Press, Washington,
DC.
Olson, K. C., J. R. Jaeger, and J. R. Brethour. 1992. Growth and reproductive
performance of heifers overwintered in range or drylot environments. J. Prod.
Agric. 5:72–76.
Osuji, P. O. 1974. The physiology of eating and the energy expenditure of the ruminant
at pasture. J. Range Manage. 27:437– 443.
Pacak, K., and M. Palkovits. 2001. Stressor specificity of central neuroendocrine
responses: implications for stress-related disorders. Endocr. Rev. 22:502–548.
Patterson, D. J., S. L. Wood, and R. F. Randle. 2000. Procedures that support
reproductive management of replacement beef heifers. J. Anim. Sci. 77:1-15.
Perry, G. A., B. L. Perry, J. A. Walker, C. L. Wright, R. R. Salverson, and H. H. Patterson.
2013. Evaluation of prior grazing experience on reproductive performance in beef
heifers. Prof. Anim. Sci. 29: 595-600.
Plasse, D., A.C. Warnick, and M. Koger. 1970. Reproductive behavior of Bos indicus
females in a subtropical environment. IV. Length of estrous cycle, duration of
 estrus, time of ovulation, fertilization and embryo survival in grade Brahman
heifers. J. Anim. Sci. 30:63-72.
Provenza, F.D., and D.F. Balph. 1987. Diet learning by domestic ruminants: Theory,
evidence and practical implications. Appl. Anim. Behav. Sci. 18:211–232.
Sapolsky, R.M., L. M. Romero, A. U. Munck. 2000. How do glucocorticoids influence
stress responses? Integrating permissive, suppressive, stimulatory, and
preparative actions. Endocr. Rev. 21:55-89.
Schillo, K. K., J. B. Hall, and S. M. Hileman. 1992. Effects of nutrition and season on the
onset of puberty in the beef heifer. J. Anim. Sci. 70:3994-4005.
Schubach, K.M., R.F. Cooke, A.P. Brandão, K.D. Lippolis, L.G.T. Silva, R.S. Marques,
and D.W. Bohnert. 2017. Impacts of stocking density on development and puberty
attainment of replacement beef heifers. Animal 11:2260-2267.
Table 1. Physical and physiological responses in beef heifers reared in low stocking density (25,000
m2/heifer; LOWDENS) or high stocking density (14 m 2/heifer; HIDENS)
Item LOWDENS HIDENS P-value
Physical activity, steps/week 19,709 3,148 < 0.01

Growth parameters
Initial weight, kg 211 212 0.82
Final weight, kg 356 358 0.84
Growth rate, kg/day 0.777 0.783 0.82

HSP mRNA expression

HSP70, fold effect 3.72 2.39 0.09
HSP72, fold effect 3.48 2.77 0.04

Puberty attainment
Total pubertal heifers, % 65.4 31.9 < 0.01
Age at puberty, days 331 364 0.04
BW at puberty, kg 324 372 < 0.01
Adapted from Schubach et al. (2017).

Table 2. Reproductive performance of heifers that were weaned and developed on pasture compared to
heifers weaned and developed in a drylot. All heifers were moved to pasture following artificial
insemination (AI)
Item Pasture Drylot P-value
Number of heifers 207 2014 --
Puberty status at AI, % 93.6 97.3 0.93
BW gain after AI, kg 0.94 0.13 < 0.01
Adapted from Perry et al. (2013).

Table 3. Reproductive performance of beef cows according to temperament

Item Adequate Excitable P-value
Bos indicus
Pregnancy rate to AI, % 42.8 35.3 0.05

B. taurus
Pregnancy rate (breeding season), % 94.6 88.7 0.03
Calving rate, % 91.8 85.0 0.04
Weaning rate, % 89.9 83.9 0.09
Calf weaning BW, kg 248 247 0.71
Calf BW weaned/cow exposed, kg 223 207 0.08
Adapted from Cooke et al. (2014).
 Probability of pregnancy, % 60

50

40

30

20

10

0
0 10 20 30 40 50 60 70 80 90 100 110 120
Serum cortisol, ng/mL
Figure 1. Probability of pregnancy to fixed-time artificial insemination (AI) in beef cows according serum
cortisol concentrations at the time of AI. Pregnancy status was verified 30 d after AI via transrectal
ultrasonography. A linear effect was detected (P < 0.01). Adapted from Cooke et al. (2017)

10
Hair cortisol, pg/mg of hair

9 HIDENS LOWDENS **
8
**
7
6 **
5
4
3
2
1
0
0 49 98 147 182
Day of the experiment
Figure 2. Cortisol concentrations in tail switch hair from heifers reared in low (25,000 m 2/heifer; LOWDENS)
or high stocking density (14 m 2/heifer; HIDENS). ** P < 0.01 and * P ≤ 0.05. Adapted from Schubach
et al. (2017).
 80
HIDENS **
70 **
Pubertal heifers, %

**
60 LOWDENS **
**
50
40 ** **
**
30 ** ** ** ** **
* * * * *
20
10
0
0 14 28 42 56 70 84 98 112 126 140 154 168 182
Day of the experiment

Figure 3. Puberty attainment in heifers reared in low stocking density (25,000 m 2/heifer; LOWDENS) or
high stocking density (14 m 2/heifer; HIDENS). Within days, * P ≤ 0.05 and ** P ≤ 0.01. Adapted from
Schubach et al. (2017).

100
Probability of pregnancy, %

95
90
85
80
75
70
65
60
55
50
1 2 3 4 5
Temperament score
Figure 4. Probability of pregnancy in beef cows according temperament score (1 = calm, 5 = excitable) at
the beginning of the breeding season. A linear effect was detected (P < 0.01). Adapted from Cooke et
al. (2009).
SESSION NOTES
Jurnal Ilmu Peternakan, Juni 2010, hal. 20 – 27 Vol. 5 No.1
ISSN 1907 – 2821

Puberty in Beef Heifers: A Review

(Pubertas pada Sapi Potong Dara:suatu Review)

Faidiban Oktofianus Rudolf

Staf Pengajar Jurusan Produksi Ternak FPPK UNIPA
Jalan Gunung Salju Manokwari 98314

ABSTRAK

Performans reproduksi optimum dari ternak betina adalah faktor yang sangat penting dalam suatu usaha
peternakan sapi potong, sebab sebuah perusahaan peternakan sapi potong hanya dapat berlangsung dengan baik jika
ada cukup pedet yang dilahirkan, bertumbuh dengan baik sampai dipasarkan. Pubertas adalah salah satu kriteria
reproduksi yang harus dipenuhi oleh ternak sebelum ternak itu dapat bereproduksi. Berbagai penelitian telah
dilakukan dan telah diketahui bahwa umur dan bobot saat pubertas pada sapi betina sangat ditentukan oleh bangsa
sapi, bobot badan, nutrisi dan musim. Oleh sebab itu, faktor-faktor tersebut perlu diketahui dan dipahami sehingga
ternak sapi yang dipelihara dapat diatur untuk bereproduksi seperti yang diharapkan oleh peternak.

Kata kunci: pubertas, sapi dara, reproduksi

INTRODUCTION (1980) defined puberty in Bos indicus heifers in

Optimum reproductive performance of hei-
fers and cows is of paramount importance. The
financial viability of an operation depends prima-
rily on numbers of calves born compared to cows
mated and the percentage of calves weaned per
year. Therefore, the reproductive performance of
the female unit in the breeding herd is one of the
major determining factors (Azzam and Nielsen,
1987; Bourdon and Brinks, 1987).
Heifers can only be bred when they reach
sexual maturity (puberty); therefore factors that
influence puberty must be known and under-
stood.
PUBERTY
Puberty is the time when young animals are
first capable of a fertile mating. Heifers are con-
sidered to have reached puberty when they expe-
riences the spontaneous ovulation accompanied
by obvious signs of oestrus (Hartigan, 1995).
Kinder et al. (1978) defined puberty in heifers as
the first standing heat followed by development
of functional corpus luteum. Post and Reich
Australia as the age at which plasma progeste-
rone levels reach 1.0 ng/ml.
Age and Weight at Puberty
Age at puberty is an important trait because
it determines lifetime reproductive performance.
Ferrell (1982) stated that age at puberty has a sig-
nificant effect on beef production, specifically
when heifers are bred to calve as two years old in
a restricted breeding season. Lesmeister et al.
(1973) found that heifers that conceive early (2-
year-olds) have greater lifetime productivity than
those that conceive later (3-year-olds). For exam-
ple, Meaker et al. (1980) showed that, Africander
heifers calving first as 2 years old produced 0.6
more calves over their productive lifetime than
those calving first as 3 year olds, while Pinney et
al. (1962) estimated the increase to be 0.8 of a
calf.
Young (1974) stated that first oestrus occurs
when animals have grown to a certain minimum
live weight rather than at a particular age. Puber-
ty attainment usually occurs when animal live
weight reaches 45-55% of the mature weight.
Depending on breed, this will be between 320
21 FAIDIBAN
and 600 days of age (Roy et al.,1975). For exam-
ple, under similar management, 16% of Hereford
heifers reached puberty at 360 days of age com-
pared to 82% of Red Poll heifers (Dow et al.,
1982).
Short and Bellows (1971) found that there
was a relationship between age at puberty and
growth rates. Similarly Gardner et al. (1977) re-
ported a correlation between weight gain and age
at puberty, where increased growth rate of heifers
reduced the age at puberty. During the pre and
post-weaning period, growth rate in beef heifers
was inversely correlated with the age at puberty
(Arije and Wiltbank, 1971; 1974). Heifers which
are weaned at heavier weights (204.3 kg) and
grow faster (350 g/d) reach puberty earlier (348
days of age) compare to those that weaned at
lighter weights (190.5 kg) which grew slower
(310 g/d) and reached puberty at 392 days of age
(Arije and Wiltbank, 1974).
These data suggest that the age and the
weight at puberty is determined by breed, weight,
environment, health and management.
Breed
The genetic influence on age at puberty is
determined by heterosis, breed differences, and
sire and dam effects within breed (Wiltbank et
al., 1969; Short et al.,1990). Koots et al. (1994)
showed that the age at puberty is highly heritable
Table 1. Heritability of Female Reproduction Traits
Traits
Heifer Age at Puberty
Age at First Calving
Heifer Conception Rate
Cow Conception Rate
Heifer Inter-calving Interval
Calving Date
Calving Rate
Cow Calving Ease
Heifer Calving Ease
Source: Koots et al. (1994)
Jurnal Ilmu Peternakan
(Table 1.). Therefore selecting a breed with
younger age at puberty, or crossing them with a
breed that has a similar or younger age at puberty
will decrease age at puberty (Short et al., 1990).
For example Reynolds et al. (1963) estimated the
average age at puberty in Brahman heifers in
Louisiana, USA, to be 27.2 months, compared
with 14.4 months for Angus heifers, and the
estimate for Angus x Brahman crosses was 15.3
months.
The impact of breed differences on the age at
puberty is very distinct (Table 2.). On average,
the zebu reaches puberty 6 to 12 months later
than Bos taurus cattle (Warnick, 1965; Wiltbank
et al., 1969). Temperate Bos taurus breeds of
dairy cattle reach puberty at 30-40% of their
adult body weight, compared with 45-55% for
beef cattle (Hafez, 1980).
In addition, Laster et al. (1972) found that
100 % of Hereford-Angus crosses had reached
puberty by 510 days of age compared to 92 % of
Hereford and Angus straight-breed.The Here-
ford-Angus crosses also reached puberty 19.5
days earlier than the average for straight-breed. It
is clear that heavier breeds and/or temperate Bos
taurus breeds reach puberty earlier than lighter
breeds and/or Bos indicus and Bos sondaicus
breeds.
Heritability
0,47
0,06
0,05
0,17
0,06
0,08
0,17
0,13
0,10
Vol. 5, 2010 PUBERTY IN BEEF HEIFERS 22

Table 2. Female Age at Puberty in Different Breeds and Within Breed

Breed Age at Puberty (day) Source

Bali cattle 660 Copland, 1974

Bali cattle 730-912 Talib et al., 2002
Angus 370 Laster et al., 1972
Hereford 390 Laster et al., 1972
Charolais x Hereford 366 Laster et al., 1972
Jersey x Hereford 319 Laster et al., 1972
South Devon x Hereford 371 Laster et al., 1972
Simental x Hereford 369 Laster et al., 1972
Limousin x Hereford 359 Laster et al., 1972
Red Poll 355 Ferrell, 1982
Simmental 348 Ferrell, 1982
Romosinuano 427 Chase et al., 1997
Senepol 481 Chase et al., 1997
Hereford x Senepol 384 Chase et al., 1997
Senepol x Hereford 427 Chase et al., 1997
Senepol x Angus 475 Chase et al., 1997
Tuli x Angus 466 Chase et al., 1997
Brahman x Angus 478 Chase et al., 1997
Hereford x B. taurus 358 Lammoglia et al., 2000
Limousin x B. taurus 379 Lammoglia et al., 2000
Piedmontese x B. taurus 338 Lammoglia et al., 2000

Body Weight al., 1966). In contrast, Arije and Wiltbank (1971)

Body weight and growth are the major fac-
tors controlling age at puberty (Joubert, 1963;
Laster et al.,1972). Generally, non-pubertal hei-
fers are lighter than pubertal heifers at the same
age (Maueon, 1978). Heifers that reached puber-
ty by 15 months of age were heavier (293.9 kg)
than those that did not reach puberty (257.6 kg)
(Laster et al., 1972).
Negative correlations between gains in body
weight and age at puberty indicates that increased
growth rate of heifers results in reduce age at pu-
berty (Smith et al., 1976; Gardner et al.,1977;
Oyedipe et al., 1982). Pre-weaning growth has a
greater influence on puberty in heifers than post-
weaning growth (Joubert, 1954; Dufour, 1975;
Swierstra et al.,1977; Little et al., 1981; and
Clanton et al.,1983). Heifers that experienced
slower pre-weaning rates of growth (200 g/d)
reached puberty at older ages and lighter weight
than those that grew faster (400 g/d) (Wiltbank et
found that rapid post-weaning growth rates
(610g/d) were associated with delayed puberty
attainment. This is supported by Grass et al.
(1982) who stated that the faster growing heifers
after weaning tend to be heavier but not neces-
sary younger at puberty. Based on these pheno-
mena it can be seen that, growth, as a result of
nutrition availability and quality will determine
the age heifers reach puberty rather than weight
determining the age of puberty (Joubert, 1963).
It can be concluded that heifers can only at-
tain puberty if significant weight gains are made,
but fast post-weaning growth may in fact retard
puberty attainment.
Nutrition
Pre-pubertal nutrition may have a lifetime
impact on reproduction and production of a cow
(Short et al.,1972; Reid, 1960; Day et al., 1986).
Studies by Lamond (1970) showed that under-
23 FAIDIBAN Jurnal Ilmu Peternakan

nutrition post-pubertal heifers may cause repro-
ductive failure. In Zebu (Oyedipe et al., 1982) as
well as in Bos taurus (Short and Bellows, 1971),
showed that poor nutrition significantly delays
puberty. In Indonesia, poor growth rate pre and
post-weaning, and the late maturity of Bali cattle
is largely due to poor nutrition (Putra and Suka-
rini, 1998; Sutaryono et al., 1998; Jelantik and
Nikolaus, 1998). As in Papua Province where
farmers rarely mostly on low nutritive value na-
tive pasture, the impact for the reproductive per-
formance of the cow may be greater.
Studies by Corah et al. (1975) showed that
the age at puberty of off-spring from heifers fed a
low energy diet (47.70 MJ/d) was 19 days later
than those off-spring from heifers fed high ener-
gy diets (73.64 MJ/d). Wiltbank et al. (1969)
found that straight breed (Hereford and Angus)
heifers that were fed 40% beet pulp, 60% ground
shelled corn plus 1.3 to 1.8 kg crested or interme-
diate wheat grass hay (high nutritional level), re-
ached puberty 191 days earlier than those fed and
200 g of 40% protein supplement plus 1.3 to 1.8
kg of crested or intermediate wheat grass hay per
head per day (low nutritional level).
In addition, Wiltbank et al.(1969) found that
straight breed heifers (Hereford and Angus) fed
1.3 to 1.8 kg of wheat grass hay and 0.2 kg of 40
% protein supplement per head per day (low le-
vel nutrient) were older at puberty (572 days)
compared to their crosses (424 days of age).
These data suggest that although nutritional
management of heifers is extremely important,
the genetic impact on replacement heifers should
not be over looked and will show an even greater
role when nutritional resources are limited. The
effect of nutritional level on the occurrence of
first oestrus in heifers is shown in Table 3.
Heifers fed a high level of protein (150% of
estimated requirements) grew faster and attained
puberty at a younger age and heavier body
weight, and had a higher fertility compared to
those fed a low level of protein (41% of estima-
ted requirements) (Oyedipe et al., 1982). Mose-
ley et al. (1977) found that dietary monensin
carrying in 20% natural protein fed produced
increased propionate levels that initiate an en-
docrine response that may speed up onset of pu-
berty and improve conception rate. On the co-
trary, Rhodes et al. (1978) found that metabo-
lisable energy levels attained by protein protected
feedstuffs from rumen fermentation processes are
not effective in enhancing the onset of puberty.
In a study in Nebraska (USA), Arije and
Wiltbank (1971) reported that Hereford heifers
that run under grazing conditions with protein
supplement reached puberty at 434 days of age in
year 1 and 438 days of age in year 2 of the stu-
dy. On the other hand, a study at Clay Center by
Laster et al. (1972) found that Hereford heifers
reach puberty at 390 days of age. These heifers
were younger at puberty than those in the pre-
vious example most likely because of the diffe-
rences in feeding management. In Indonesia,

Table 3. The Effect of Level of Energy on Occurrence of First Oestrus

Feed Approx Age (mo)
Level Breed Gain (kg) 11 12 13 14 15 16 17

Angus 0,9 0 0 0 33 82 90 100

Low Hereford 0,6 0 11 22 33 38 50 100
Crossbred 1 0 0 12 68 85 100 100
Angus 1,6 8 33 58 100 100 100 100
High Hereford 1,3 0 12 50 100 100 100 100
Crossbred 1,9 0 18 75 94 100 100 100
Adapted from Wiltbank et al., 1969
Vol. 5, 2010
Bali cattle that run under grazing conditions
reach puberty at 540 to 660 days of age (Pane,
1990 and Darmadja, 1980).
Poor nutrition during the pre-pubertal pe-
riod inhibits the development of a mature repro-
ductive endocrine system (Day et al., 1986), and
hence delays puberty attainment. However, very
high levels of feeding do not necessarily result in
earlier puberty attainment. Maintaining feed ava-
ilability and quality therefore is a major concern
in a cow-calf program.
Season
Season contributes significantly to animal's
lifetime reproductive performance since sexual
development occurs over several seasons. Arije
and Wiltbank (1971) found that in the Northern
Hemisphere, heifers born in mid-February to
May (later in the calving season) were lighter and
younger at puberty. Animals exposed to winter
conditions during the pre-pubertal period demon-
strated delayed puberty (Grass et al., 1982). Ha-
user (1984) found that Heifers born in September
were younger (307 vs 334 days) and lighter (287
vs 300 kg) at puberty compare to those that born
in March. In other experiment, heifers which
were born in September and March that expose
to spring to fall environment chamber were 25
days younger and 38 kg lighter compared to
those that exposed to fall to spring environment
chamber (Hauser, 1984).
The mechanism of how season affect the pu-
berty is not well understood. The effect may be
through the direct effect such as the change in
photoperiod, temperature, humidity or through
the availability of feed.
CONCLUSION
1. Beef heifers Age and weight at puberty is
determined by breed, body weight, nutrition
and season.
2. Heavier breeds and/or temperate Bos taurus
breeds reach puberty earlier than lighter
breeds and/or Bos indicus and Bos sondaicus
breeds.
PUBERTY IN BEEF HEIFERS 24
3. Heifers can only attainment puberty if sig-
nificant weight gains are made, but fast post
weaning growth may in fact retard puberty
attainment.
4. Poor nutrition during the pre-pubertal period
delays puberty attainment. However, very
high levels of feeding do not necessarily re-
sult in earlier puberty attainment. Maintain-
ing feed availability and quality therefore is a
major concern in a cow-calf program.
5. Even though the season affect on the puberty
of heifers was not well documented and ex-
plained, it may affect heifers puberty through
the direct effect such as the change in photo-
period, temperature, humidity or indirect ef-
ect through the availability of feed.
REFERENCES
Arije, G.F., and J. N. Wiltbank. 1971. Age and
weight at puberty in hereford heifers. J.
Anim. Sci. 33: 401-406.
Arije, G.F., and J. N. Wiltbank. 1974. Prediction
of age and weight at puberty in beef heifers.
J. Anim. Sci. 38: 803-810.
Azzam, S.M., and M.K. Nielsen. 1987. Genetic
parameters for gestation length, birth date
and first breeding in beef cattle. J. Anim.
Sci., 64: 348-356.
Bourdon, R.M., and J.S. Brinks. 1987. Simula-
ted efficiency of range beef production ii.
Fertility traits. J. Anim. Sci., 65: 956-962
Chase, C.C., Jr., A.C. Hammond, M.J. Williams,
and T.A. Olson. 1997. Effect of source of
winter supplement on growth and puberty
among breeds of beef heifers. J. Anim. Sci.
75 (Suppl. 1): 248 (Abstr.)
Clanton, D.C., L.E. Jones, and M.E. England.
1983. Effect of rate and time of gain after
weaning on development of replacement
beef heifers. J. Anim. Sci., 56: 280-285.
25 FAIDIBAN
Copland, R.S. 1974. Observation on banteng
cattle in sabah. Trop. Anim. Hlth. Prod., 6:
89-94.
Corah, L.R.,T.G. Dunn and C.C. Kaltenbach.
1975. Influence of pre-partum nutrition on
the reproductive performance of beef fe-
males and the performance of their progeny.
J. Anim. Sci., 41: 819-828.
Darmadja, S.G.N.D.1980. Setengah Abad Pe-
ternakan Sapi Tradisional dalam Ekosistem
Pertanian di Bali. Disertasi. Universitas Pad-
jajaran, Bandung.
Day, M. L., K. Imakawa, D.D. Zalesky, R. J.
Kittok, J.E. Kinder. 1986. Effects of res-
triction of dietary energy intake during the
pre-pubertal period on secretion of luteini-
zing hormone and responsiveness of the
pituitary to luteinizing hormone-releasing
hormone in heifers. J. Anim. Sci., 62: 1641-
1648.
Dow, J.S., J.D., Moore, C.M. Bailey, and W.D.
Foote. 1982. Onset of puberty in heifers of
diverse beef breeds and crosses. J. Anim.
Sci., 55: 1041-1047.
Dufour, J.J. 1975. Influence of post-weaning
growth rate on puberty and ovarian activity
in heifers. Can. J. Anim. Sci. 55: 93-100.
Ferrell, C.L. 1982. Effect of postweaning rate of
gain on onset of puberty and productive
performance of heifers of different breeds. J.
Anim. Sci., 55: 1272-1283.
Gardner, R.W., J.D. Schuh, and L.B. Vargus.
1977. Accelerated growth and early breed-
ing of holstein heifers. J. Dairy. Sci., 60:
1941-1948.
Grass, J.A., P.J., Hansen, J.J. Rudledge and E.R.
Hauser. 1982. Genotype x environmental
interactions on reproductive traits of bovine
females. I. Age at puberty as influenced by
Jurnal Ilmu Peternakan
breed, breed sire, dietary regimen and sea-
son. J. Anim. Sci., 55: 1441-1457.
Hafez, E.S.E. 1980. Reproduction in Farm Ani-
Mals. Lea and Febiger, Philadelphia. 627 pp.
Hartigan, P.J. 1995. Cattle Breeding and Inferti-
lity. in Animal Breeding and Infertility. Me-
redith, M.J. Blackwell Science. p. 86-168.
Hauser, E.R. 1984. Seasonal Effect on Female
Reproduction in The Bovine (Bos taurus)
(European Breeds). Theriogenology, 21:
150-169.
Jelantik, I.G.N. and T.T. Nikolaus. 1998. Nutri-
tional Status and Post-partum Reproductive
Performance of Bali Cows Grazing Native
Pasture Supplemented With Urea-Treated
Corn Stover With or Without Combination
With Leucaena. Proc. of Seminar on Bali
Cattle in Regional Agriculture. Indonesia-
Australia Eastern Universities Project. Uda-
yana University Bali. Indonesia. p.105-114.
Joubert, D.M. 1954. The influence of high and
low nutritional planes on the oestrus cycle
and conception rate of heifers. J. Agric Sci.,
45: 164-172.
Joubert, D.M. 1963. Puberty in Female Farm
Animals. Anim. Breed. Abstr., 31: 295-306.
Koots, K.R., J.P. Gibson, C. Smith and J.W.
Wilton. 1994. Analyses of Published Gene-
tic Parameters Estimates for Beef Produc-
tion Traits.1. Heritability. Anim. Breed.
Abstr., 62: 309-338.
Lammoglia, M.A., R.A. Bellows, E.E. Grings,
J.W. Bergman, S.E. Bellows, R.E. Short,
D.M. Hallford, and R.D. Randel. 2000. Ef-
fects of dietary fat and sire breed on pu-
berty, weight, and reproductive traits of f1
beef heifers. J. Anim. Sci. 78: 2244-2252.
Vol. 5, 2010
Lamond, D.R. 1970. The Influence of Un-
dernutrition on Reproduction in The Cow.
Anim. Breed. Abstr., 38: 359-372.
Laster, D.B., H.A. Glimp, and K.E. Gregory.
1972. Age and weight at puberty and con-
ception in different breeds and breeds-
crosses of beef heifers. J. Anim. Sci., 34:
1031-1036.
Lesmeister, J.L., P.J. Burfening, and R.L. Black-
well. 1973. Date of first calving in beef cows
and subsequent calf production. J. Anim.
Sci., 36: 1-6.
Little, W., C.B. Mallison, D.M. Gibbons, and
G.J. Rowlands. 1981. Effects of Plane Nu-
trition and Season of Birth on The Age and
Body Weight at Puberty of British Friesian
Heifers. Anim. Prod., 33: 273-279.
Mauleon, P. 1978. Ovarian Development in
Young Mammals. In Control of Ovulation.
D.B. Crighton Eds. Butterworths, London
pp. 141–158.
Moseley, W.M., M.M. McCartor and R.D. Ran-
dal. 1977. Effects of monensin on growth
and reproductive performance of beef cattle.
J. Anim. Sci. 45: 961-968
Oyedipe, E.O., D.I.K. Osori, O. Akerejola, and
D. Saror. 1982. Effect of Level of Nutrition
on Onset of Puberty and Conception Rates
in Zebu Heifers. Theriogenology. 18: 525-
539.
Pane, I. 1990. Upaya Peningkatan Mutu Genetik
Sapi Bali P3 Bali. In Proc. Seminar Nasional
Sapi Bali. Fakultas Peternakan, Universitas
Udayana, Bali.
Pinney D O. Pope L S. Stephens D F and Waller
G R. 1962. Winter nutrition and age at cal-
ving on lifetime performance of beef cows.
J. Anim. Sci., 21: 1009 (Abstr.).
PUBERTY IN BEEF HEIFERS 26
Putra, S. and I.A. Sukarini. 1998. Peningkatan
Kinerja Sapi Bali Bunting Pertama, Laktasi,
dan Pertumbuhan Pedetnya Melalui Bioma-
nipulasi Proses Nutrisi. Proc. of Seminar on
Bali Cattle in Regional Agriculture. Indone-
sia-Australia Eastern Universities Project.
Udayana University Bali. Indonesia. p.146-
155.
Reid, J.T. 1960. Effect of energy intake upon
reproduction farm animals. J. Dairy Sci., 43
(suppl): 103-122.
Reynolds, W.L., T.M. DeRouen, and J.W. High,
Jr. 1963. The age and weight at puberty of
angus, brahman and zebu cross heifers. J.
Anim. Sci., 22: 243 (Abstr.)
Rhodes, R.C., M.M. McCartor and R.D. Randel.
1978. Effect of feeding protein-protected
lipid upon growth and reproductive deve-
lopment of yearling heifers. J. Anim. Sci.,
46: 769-777.
Roy, J.H.B.,C.M. Giles, and S.M. Shotton. 1975.
Factors Affecting First Oestrus in Cattle and
Their Effect on Early Breeding. In: J.C. Tay-
ler (Ed), The Early Calving of Heifers and
Its Impact on Beef Production. Commission
of The European Communities, Brussels, p.
128-142.
Short, R.E., and R.A. Bellows. 1971. Relation-
ship Among Weight Gains, Age at Puberty
and Reproductive Performance in Heifers. J.
Anim. Sci., 32: 127-131.
Short, R.E., R.A. Bellows, E.L. Moody and B.E.
Howland. 1972. Effects on suckling and ma-
sectomy on bovine postpartum reproduc-
tion. J. Anim. Sci., 34: 70-74.
Short, R.E., R.B. Staigmiller, R.A. Bellows, and
R.C. Greer. 1990. Breeding Heifers on One
Year of age: Biological and Economic Con-
siderations. In: Proc. 39th Annu. Beef Cattle
Short Course. Univ. of Florida. p, 93-106.
27 FAIDIBAN
Sutaryono, Y.A., T. Sutardi, Syamsuhaidi, and
Sofyan. 1998. Manipulasi Nutrisi untuk Me-
ningkatkan Pertumbuhan Sapi Bali. Indone-
sia-Australia Eastern Universities Project.
Udayana University Bali. Indonesia. p. 115-
124.
Swierstra, E.E., G.W. Rahnfeld, R.L. Cliplef, and
J.H. Strain. 1977. Age and weight at puberty
of crossbred heifers sired by charolais, li-
mousin and simmental bulls. Can. J. Anim.
Sci., 57: 697-703.
Talib, C. 2002. Productivity and Reproductivity
of Bali Cattle. PhD Thesis, University of
New England, Australia.
Jurnal Ilmu Peternakan
Warnick, A.C. 1965. Reproduction and Fertility
in Beef Cattle. In: T J Cunha and G N Rho-
des (eds), Beef Cattle in Florida. Florida De-
partment of Agriculture. pp. 59-68.
Wiltbank, J.N., K.E. Gregory, L.A. Swiger, J.E.
Ingalls, J.A. Rothlisberger, and R.M. Koch.
1966. Effect of heterosis on age and weight
at puberty in beef heifers. J. Anim. Sci. 25:
744-751.
Wiltbank, J.N., C.W , Kasson, & J.E. Ingalls.
1969. Puberty in crossbred and straight-bred
beef heifers on two levels of feed. J. Anim.
Sci., 29: 602-605.
Young, J.S. 1974. Reproduction and Nutrition in
The Beef Herd. Proc. A.S.A.P., 10: 45
 TESIS

UPAYA MENINGKATKAN EFISIENSI REPRODUKSI PADA SAPI PERAH

DARA YANG MENGALAMI KETERLAMBATAN PUBERTAS
DENGAN MENGGUNAKAN METODE HEATSYNCH

EFFORTS TO IMPROVE REPRODUCTIVE EFFICIENCY IN DAIRY HEIFERS

EXPERIENCING LATE PUBERTY USING HEATSYNCH METHOD

ANDI FAUSIAH

SEKOLAH PASCASARJANA
UNIVERSITAS HASANUDDIN
MAKASSAR
2017
 ii 
 

UPAYA MENINGKATKAN EFISIENSI REPRODUKSI PADA SAPI PERAH

DARA YANG MENGALAMI KETERLAMBATAN PUBERTAS
DENGAN MENGGUNAKAN METODE HEATSYNCH

Tesis
Sebagai Salah Satu Syarat untuk Mencapai Gelar Magister

Program Studi
Ilmu dan Teknologi Peternakan

Disusun dan diajukan oleh

ANDI FAUSIAH

Kepada

SEKOLAH PASCASARJANA
UNIVERSITAS HASANUDDIN
MAKASSAR
2017
TESIS
 iii 
 
 iv 
 
 v 
 

PRAKATA

Alhamdulillah, atas rahmat dan taufik-Nya sehingga penulis dapat

menyelesaikan makalah hasil penelitian tesis dengan judul Upaya

meningkatkan efesiensi reproduksi pada sapi perah dara (heifers) yang

mengalami keterlambatan pubertas dengan menggunakan metode

Heatsynch (induksi berahi) Penulis dengan rendah hati mengucapakan

terima kasih kepada semua pihak yang telah membantu dan membimbing

dalam menyelesaikan makalah hasil penelitian ini utamanya kepada :

1. Bapak Prof.Dr.Ir. H. Abd.Latief Toleng, M.Sc sebagai komisi

pembimbing utama dan Bapak Dr. Muhammad Yusuf, S.Pt selaku

komisi pembimbing anggota yang telah banyak meluangkan waktu

untuk membimbing, mengarahkan dan memberikan nasihat serta

motivasi.

2. Bapak Prof.Dr.Ir. Herry Sonjaya, DEA DES, Prof. Dr.Ir H. Ambo

Ako, M.Sc dan Ibu Prof.Rr. Sri Rachma Aprilita Bugiwati, Ph.D

selaku Dosen Pembahas dan Bapak Prof. Dr. Ir. Djoni Prawira

Rahardja, M. Sc. selaku Ketua Program Studi S2 Peternakan yang

bersedia meluangkan waktu dan memberikan saran-saran untuk

perbaikan hasil penelitian ke depannya.

3. Bapak Dekan Fakultas Peternakan beserta Wakil Dekan I, Wakil

Dekan II dan Wakil Dekan III, Bapak Ketua Prodi Teknologi Hasil

Ternak, Bapak dan Ibu Dosen serta seluruh Pegawai Fakultas

Peternakan UNHAS.
 vi 
 

4. Kedua orang tua Andi Mudirman dan Dra. Rahmatiah serta

saudara-saudara penulis atas segala doa, motivasi, teladan,

pengetahuan dan dukungan penuh kasih sayang terbesar dan

selamanya kepada penulis.

5. Kepada Kepala dan Staf Dinas Peternakan dan Perikanan

Kabupaten Enrekang yang telah banyak memberikan bantuan

kepada penulis selama menjalani penelitian.

6. Kepada Keluarga besar L10N, teman kelas ITP angkatan 2015,

sahabat serta rekan-rakan yang telah memberikan bantuan dan

banyak menjadi inspirasi bagi penulis.

Penulis menyadari bahwa penyusunan makalah hasil ini masih jauh

dari kesempurnaan, karena itu penulis memohon saran untuk

memperbaiki kekurangan tersebut. Saran dan kritik yang membangun dari

pembaca akan membantu kesempurnaan dan kemajuan ilmu

pengetahuan. Semoga Tesis ini bermanfaat bagi pembaca terutama bagi

saya sendiri. Amin.

Makassar, Agustus 2017

Penulis
 vii 
 

ABSTRAK

ANDI FAUSIAH. Upaya Meningkatkan Efisiensi Reproduksi pada Sapi

Perah Dara yang Mengalami keterlambatan Pubertas dengan
Menggunakan Metode Heatsynch. Dibimbing oleh Abd. Latief Toleng dan
Muhammad Yusuf.

Tujuan penelitian ini adalah untuk mengetahui aplikasi metode

Heatsynch dalam mengatasi keterlambatan pubertas pada ternak sapi
perah dara yang mengalami infertilitas. Penelitian ini dilakukan di
peternakan sapi perah rakyat di Kecamatan Cendana, Kabupaten
Enrekang. Penelitian ini dilakukan dengan dua tahap. Pada tahap
pertama, sebanyak 50 ekor sapi perah dara digunakan untuk mengetahui
persentase ternak yang mengalami keterlambatan pubertas. Pada tahap
kedua sebanyak 20 ekor sapi perah dara yang mengalami keterlambatan
pubertas dibagi kedalam dua kelompok. Kelompok pertama sebanyak 10
ekor diberi perlakuan Heatsynch dan 10 ekor lainnya digunakan sebagai
kontrol negatif (tanpa perlakuan Heatsynch). Untuk kontrol positif,
digunakan 10 ekor ternak yang tidak mengalami keterlambatan pubertas.
Pada perlakuan Heatsynch, GnRH diinjeksikan pada hari ke-0, kemudian
dilanjutkan pemberian PGF2α pada hari ke-7, pada hari ke-8 dilanjutkan
dengan pemberian estradiol dan kemudian dilakukan inseminasi buatan
pada hari ke-9. Hasil penelitian menunjukkan bahwa persentase ternak
yang mengalami keterlambatan pubertas di Kecamatan Cendana
Kabupaten Enrekang adalah sebesar 44%. Rata-rata umur pertama kali
bunting setelah perlakuan Heatsynch yaitu 545 hari, lebih pendek
dibandingkan pada kelompok ternak kontrol negatif (644 hari). Persentase
ternak sapi dara yang berhasil bunting setelah diberi perlakuan Heatsynch
adalah sebesar 80%, lebih tinggi dibandingkan dengan ternak yang
mengalami keterlambatan pubertas tetapi tidak diberi perlakuan (50%).
Dapat disimpulkan bahwa keterlambatan pubertas pada ternak sapi perah
dara masih tinggi. Metode Heatsynch dapat menjadi salah satu cara yang
dapat digunakan untuk mengatasi masalah keterlambatan pubertas pada
ternak sapi perah dara dan meningkatkan efisiensi reproduksi.
Kata kunci : Sapi Perah dara, Pubertas, Metode Heatsynch, Enrekang
 viii 
 

ABSTRACT

ANDI FAUSIAH. Efforts to Improve Reproductive Efficiency in Dairy

Heifers Experiencing Delayed Puberty Using Heatsynch Method.
Supervised by Abd. Latief Toleng and Muhammad Yusuf.

The aim of this study was to find out the application of Heatsynch
method in overcome the delayed puberty of dairy heifers that suffered from
infertility. This study was conducted at small dairy farms in Sub-district of
Cendana, Enrekang Regency. This study was conducted in two stages. In
the first stage, a total of 50 dairy heifers were used to determine the
percentage of heifers that experienced delay in puberty. In the second
stage, 20 dairy heifers with delayed puberty were divided into two groups.
The first group, 10 dairy heifers were treated with Heatsynch and the other
10 dairy heifers were used as control negative (without Heatsynch). For
control positive, 10 dairy heifers that did not suffered from delayed puberty
were used. In Heatsynch treated dairy heifers, GnRH were injected on
day-0, followed by PGF2α, estradiol injections on day-7 and day-8,
respectively, and inseminated artificially on day-9. The results of this study
showed that the percentage of dairy heifers that experienced in delayed
puberty in Sub-district of Cendana, Enrekang Regency was 44%. The
mean age at first pregnant after treated with Heatsynch was 545 days,
shorter than those heifers in control negative (644 days). The percentage
of dairy heifers become pregnant after treating with Heatsynch was 80%,
higher than those untreated delayed puberty heifers (50%). It can be
concluded that the incidence of delayed puberty dairy heifers was still
high. Heatsynch method can be one way that can be used to overcome
the problem of delayed puberty in dairy heifers and to improve
reproductive efficiency.

Keywords: Dairy heifers, Puberty, Heatsynch, Enrekang

 ix 
 

DAFTAR ISI

Halaman

PRAKATA v

ABSTRAK vi

DAFTAR ISI vii

DAFTAR TABEL viii

DAFTAR GAMBAR ix

DAFTAR LAMPIRAN x

BAB I PENDAHULUAN 1

A. Latar Belakang 1
B. Rumusan Masalah 4
C. Tujuan Penelitian 4
D. Kegunaan Penelitian 4

BAB II TINJAUAN PUSTAKA 5

A. Infertilitas Pada Sapi Dara 5

B. Faktor-faktor Terjadinya Infertilitas 7
C. Upaya-upaya yang Dilakukan Untuk Mengatasi Infertilitas 13
D. Faktor-faktor yang mempengaruhi Pubertas 16
E. Metode Heatsynch dan Cara Kerja Hormon
F. Kerangka Pikir 24
G. Hipotesis 26

BAB III METODE PENELITIAN 27

A. Waktu dan Tempat 27

B. Materi Penelitian 27
C. Tahapan Penelitian 28
D. Skema Penyuntikan Hormon dengan Metode Heatsynch 29
E. Parameter yang Diukur 29
 x 
 

F. Alur Penelitian 30
G. Rancangan Penelitian dan Analisi Data 31

BAB IV HASIL PENELITIAN 32

A. Infertilitas Ternak Sapi Perah Dara 32

B. Efektifitas Metode Heatsynch pada Ternak Sapi Dara
yang Mengalami Infertilitas 33

BAB V DISKUSI UMUM 40

BAB VI PENUTUP 43

A. Kesimpulan 43
B. Saran 43

DAFTAR PUSTAKA 44
 xi 
 

DAFTAR TABEL

Nomor Halaman

1. Efektifitas Metode Heatsynch pada Ternak Sapi Dara

yang Mengalami Keterlambatan Pubertas 34
 xii 
 

DAFTAR GAMBAR

Nomor Halaman

1. Kerangka Pikir 26

2. Induksi Berahi dengan Metode Heatsynch 29

3. Induksi berahi ternak sapi perah dara berdasarkan umur

Pubertas 30

4. Proporsi sapi perah dara yang normal dan sapi perah

yang mengalami keterlambatan pubertas 32

 xiii 
 

DAFTAR LAMPIRAN

Nomor Halaman

1. Analisis Uji-T Interval Antara Kelahiran

Sampai Bunting 51

2. Analisis Survival Interval Antara Kelahiran Sampai Bunting 53

3. Analisis Chis-quare Persentase Ternak Bunting 55

4. Analisis Chis-quare, Service per Conseption 56

 1 
 

BAB I

PENDAHULUAN

A. Latar Belakang

Kabupaten Enrekang merupakan salah satu Kabupaten yang

terkenal dengan peternakan sapi perah tradisional dengan hasil olahan

susu yaitu dangke. Data yang tercatat pada Januari 2008 menunjukkan

bahwa terdapat sekitar 256 unit usaha pembuat dangke dan berdasarkan

jumlah populasi yang ada sekarang.

Mencermati kondisi tersebut di atas, pihak pemerintah setempat terus

melakukan berbagai upaya dalam mengakomodasi permintaan pasar,

pertambahan populasi dan perbaikan sistem pemeliharaan terus

diintroduksi dan dikembangkan dalam kelembagaan peternak. Populasi

sapi perah di Kabupatan Enrekang hingga 2016 sebanyak 1249 ekor,

yang terdiri dari betina sebanyak 992 ekor, jantan sebanyak 257 ekor;

dara sebanyak 230 ekor, dengan produksi susu rata-rata sebesar 7,26

liter/hari (Dinas Peternakan, 2016).

Ketersediaan sumber daya dan teknologi merupakan potensi yang

mendukung tercapainya upaya pengembangan usaha sapi perah tersebut.

Akan tetapi di sisi lain, sampai saat ini usaha sapi perah rakyat masih

menghadapi berbagai kendala, terutama terkait dengan rendahnya

produktivitas ternak. Salah satu adalah kendala reproduksi (banyaknya

kasus gangguan reproduksi) pada sapi perah. Gangguan reproduksi

berakibat pada kemajiran ternak betina, ditandai dengan rendahnya angka

kelahiran (calving rate) pada ternak tersebut (Hardjopranjoto, 1995).

 
 
 2 
 

Perkembangbiakan ternak sangat dipengaruhi oleh angka kelahiran yang

berdampak terhadap pertambahan populasi, sehingga banyaknya

gangguan reproduksi yang mengakibatkan rendahnya efisiensi reproduksi

atau kesuburan serta kematian prenatal, yang pada akhirnya akan

mengakibatkan penurunan populasi (Toelihere, 1981).

Hambatan reproduksi salah satunya yang terjadi pada ternak sapi

dara yaitu keterlambatan pubertas, sebagaimana lazimnya pubertas

pertama berdasarkan status fisiologisnya pada sapi perah dara dimulai

pada 9-12 bulan sesudah lahir, tetapi umumnya di inseminasi sampai

umur 15 bulan (Royal et al., 2000) hal ini berarti bahwa sapi sudah dapat

melahirkan anak pertama kali umur 24 bulan dan selambat-lambatnya

pada umur 33 bulan. Pendapat lain mengatakan bahwa pubertas pertama

pada sapi perah dara pada umumnya umur 8-15 bulan dan berbeda

menurut spesies dan kualitas pakan yang diberikan (Anggraeni et al.,

2010). Kawin pertama pada sapi dara dapat dilakukan pada umur 14-25

bulan (Salisbury dan Van Demark, 2002). Prihatin et al (2007)

menyatakan sebaiknya kawin pertama pada sapi dara setelah sapi

melewati satu sampai tiga kali estrus agar hormonal optimal.

Efisiensi reproduksi merupakan suatu parameter yang kompleks

dan berhubungan secara holistik dengan berbagai aspek lingkungan

lainya. Saat ini belum terdapat gambaran nyata tentang manajemen

reproduksi peternak sapi perah di Kabupaten Enrekang. Diduga bahwa

efisiensi reproduksi ternak sapi perah di Kabupaten Enrekang rendah

yang disebabkan oleh beberapa faktor utama yang berasal dari peternak

 
 
 3 
 

sendiri, manajemen reproduksi dan dukungan lingkungan agroklimatik dan

agrososial peternakan sapi perah.

Fase reproduksi yang sangat essensial akan dimulai saat sapi dara

berahi pertama, kawin pertama, beranak pertama, hingga berahi kembali

dan bunting sampai beranak kembali. Pertumbuhan sapi dara sejak lahir

dapat mempengaruhi panjang pendeknya umur berahi pertama Sapi dara

dengan pertumbuhan yang lambat akan mengalami berahi pertama yang

tertunda, keterlambatan kawin dan beranak pertama (Phillips et al., 2001).

Salah satu hal yang dapat dilakukan dalam menangani

keterlambatan pubertas yaitu menginduksi berahi dengan cara

penggunaan kombinasi hormon gonadotropin, prostaglandin, danestradiol

benzoat, atau Heatsynch. Sinkronisasi berahi dengan metode Heatsynch

menggunakan substitusi GnRH dan Etradiol telah dilakukan pada sapi

perah yang dapat meningkatkan LH surge, menginduksi ovulasi sehingga

penentuan waktu berahi (IB) bisa tepat.

Hambatan reproduksi lainnya pada ternak sapi perah dara

dilatarbelakangi oleh kesalahan tatalaksana/manajemen, Apabila hal ini

tidak ditangani dengan baik, maka perkembangan usaha sapi perah dara

akan sulit dicapai, bahkan kemungkinan akan mengalami stagnasi atau

kemunduran. Oleh karena itu penelitian ini dilakukan untuk mengetahui

peningkatan efesiensi reproduksi ternak sapi perah dara yang mengalami

keterlambatan pubertas dengan metode Heatsynch di Kabupaten

Enrekang.

 
 
 4 
 

B. Rumusan Masalah

Pubertas Sapi perah dara normal adalah 9-13 bulan, akan tetapi

kondisi saat ini sulit dicapai dengan berbagai kondisi seperti tidak

sinkronnya mekanisme hormonal reproduksi pada ternak-ternak tersebut

sehingga menyebabkan infertilitas. Upaya mengatasi keterlambatan

pubertas yaitu dengan induksi hormon salah satunya Heatsynch, namun

seberapa besar pengaruh tingkat efektifitas Heatsynch (induksi berahi)

terhadap sapi perah dara.

C. Tujuan Penelitian

Tujuan dari penelitian ini adalah untuk mengetahui aplikasi metode

heatsynch dapat mengatasi keterlambatan pubertas pada ternak sapi

perah dara yang mengalami infertilitas.

D. Kegunaan Penelitian

Hasil penelitian yang diperoleh diharapkan dapat memberi

informasi kepada masyarakat mengenaipenyebab keterlambatan pubertas

pada sapi perah dara. Serta mengetahui tingkat keberhasilan induksi

berahi pada ternak sapi perah dara yang menggunakan metode

Heatsynch.

 
 
 5 
 

BAB II

TINJAUAN PUSTAKA

A. Infertilitas pada Sapi Dara

Infertilitas adalah menurunnya derajat kesuburan pada ternak

(Arthur et al., 2001). Infertilitas merupakan kegagalan reproduksi yang

bersifat sementara, tetapi jika tidak cepat ditanggulangi dapat bersifat

permanen atau steril (Toelihere, 1981). Masalah infertilitas ini lebih sering

dijumpai pada sapi perah daripada sapi potong dan kehidupan secara

berkelompok lebih sering dibandingkan dengan individual, sehingga makin

besar ternak yang dikelolah makin sering terjadi infertilitas (Toelihere,

1981).

Infertilitas pada ternak merupakan suatu masalah ekonomi yang

harus dihadapi oleh dokter hewan. Penyebab infertilitas bervariasi dan

kompleks. Penyebab sterilitas pada hewan bisa kongenital atau

diperoleh dengan kondisi yang bersifat sementara atau permanen.

Walaupun kasusnya bersifat sementara, biasanya menyebabkan

kerugian yang sangat besar karena faktor waktu dan rendahnya

produksi susu. Infertilitas biasanya dianalisa berdasarkan apakah

penyebabnya anatomis, fungsional atau karena sebab infeksi.

Sistematik pemeriksaan fisik produksi sapi betina dalam

menentukan fertilitas dan sterilitas, menurut Djojosoedarmo et al (1985)

yaitu dengan melakukan pemeriksaan khusus alat reproduksi,

pengambilan sampel, disamping riwayat kasus, pemeriksaan klinis khusus

meliputi pemeriksaan per-rektal dan per-vaginal. Abnormalitas yang ada

 
 
 6 
 

hubungannya dengan pengaruh Iingkungan meliputi hipofungsi ovari,

hipoplasia ovari, CLP (Corpus Luteum Persisten) dan sista ovari. Kasus

hipofungsi ovari merupakan yang terbanyak dijumpai pada tahun 1980,

dimana kasus hipofungsi dan hipoplasia ovari di Jawa Barat, Jawa

Tengah, dan Lampung rata-rata 27,61%. Sedangkan pada tahun 1981

kasus hipofungsi ovari di Bali, NTB rata-rata 38,1%. Dan pada tahun

1985, kasus hipofungsi ovari agak menurun di Jawa Tengah 7,4% pada

sapi perah dan 5,39% pada sapi potong, sedangkan di Jawa Timur

10,10%. Kejadian hipofungsi ovari di Indonesia terjadi pada sapi potong

yang kurus dan yang sedang menyusui sedangkan pada sapi gemuk

ovarium teraba pipih dan licin terbungkus lemak, sedangkan pada sapi

perah ditemukan pada sapi kurus yang sedang berlaktasi (Djojosoedarmo

et al., 1985).

Hipoplasia ovari atau hambatan pertumbuhan ovarium, umumnya

ditemukan pada sapi-sapi dara yang cukup umur, tetapi belum dewasa

kelamin. Jadi kemungkinannya masih dapat diharapkan adanya perbaikan

di kemudian hari, kecuali bila penyebabnya adalah faktor genetik maka

prognosanya adalah infausta. Ovarium yang kurang berkembang masih

dianggap dapat berfungsi walaupun tidak aktif untuk memanifestasikan

tanda-tanda berahi (anestrus) atau estrus yang tidak jelas (subestrus).

Disamping gejala anestrus dan subestrus pada sapi kemungkinan

lain adalah sapi menunjukkan gejala estrus atau berahi akan tetapi tidak

diamati secara cermat. Di Indonesia ternak sapi 60% digunakan sebagai

tenaga kerja (Robinson, 1977), dan tenaga kerja ini di daerah transmigrasi

 
 
 7 
 

merupakan fungsi utama (Siregar, 1983). Toelihere et al (1980)

melaporkan umumnya sapi dijadikan sebagai tenaga kerja di sawah dua

kali dalam setahun dan dikerjakan per harinya selama 5 jam dalam

beberapa hari, sehingga apabila sapi sedang bekeja gejala berahinya

kurang diperhatikan. Selain sebagai tenaga kerja di sawah juga sebagai

penarik pedati sewaktu mengangkut hasil panen. Jadi kesalahan

tatalaksana yang banyak dijumpai adalah akibat kegagalan mendeteksi

berahi karena sapi dibutuhkan sebagai tenaga kerja atau karena peternak

tidak dapat mendeteksi berahi dan mengawinkan pada saat yang tepat

B. Faktor-faktor terjadinya Infertilitas

a. Faktor Fungsional/Hormon

Infertilitas faktor hormonal dapat disebabkan karena faktor induk,

defisiensi nutrisi, dan stress karena produksi susu tinggi. Gangguan

karena faktor fungsional yang sering ditemukan adalah anestrus (13.5%),

subestrus (20.9%), sista ovari (37,1%), anovulasi atau ovulasi tertunda

(5,6%). Ditandai dengan tidak adanya aktivitas siklik yang disebabkan

karena ketidak cukupan produksi hormon gonadotropin atau ovari yang

tidak merespon terhadap hormon gonadotropin (Amiridis et al.,2009)

Selain faktor induk gangguan sistem hormonal dibagi menjadi dua

yaitu: faktor dari luar yang berhubungan dengan tingginya produksi susu

atau stress selama waktu laktasi. Faktor dari dalam, yaitu: ovarium yang

sistik, yang sering terjadi pada sapi-sapi perah karena faktor bergerak

yang kurang setelah· partus terutama pada puncak laktasi. Kejadian

 
 
 8 
 

ovarium yang sistik dipengaruhi oleh dua faktor yaitu faktor keturunan dan

kondisi lingkungan dalam hal ini produksi susu tinggi berkorelasi dengan

stress di musim dingin dan di daerah subtropis. Sebenarnya mekanisme

pembentukan sista ovari tidak diketahui dengan pasti, teori yang masuk

akal menerangkan etiologi kejadian sistem ini oleh karena kurangnya

sekresi LH dari hipofisa anterior pada saat menjelang ovulasi. Folikel yang

terbentuk terus membesar karena sekresi FSH yang cukup memadai

tetapi untuk berovulasi tidak didapatkan kandungan LH belum cukup.

(Toelihere, 1981).

Arthur et al (2001) memperlihatkan hubungan dampak Iingkungan

dengan faktor turunan terhadap kejadian nymphomania, sebagai gejala

dari ovarium yang sistik. Selain memperlihatkan gejala nymphomania

sekitar 25% dari sapi yang mengalami sista ovari dapat memperlihatkan

gejala anestrus dan Berahi tenang (subestrus/silent heat) yang sering

terjadi pada sapi-sapi pasca beranak, disebabkan karena defisiensi nutrisi,

P, Cobalt, dan berat badan yang rendah. Aktivitas ovarium normal tetapi

estrus tidak jelas, pada palpasi rektal biasanya teraba adanya aktifitas

ovarium.

Gejala hormonal selain gejala anestrus juga terjadi karena trauma

akibat partus penanganan distokia yang terlalu kasar dapat menyebabkan

trauma pada saluran kelahiran sehingga hewan menjadi steril.

Kejadiannya sering terjadi pada sapi dara atau sapi yang sudah pernah

beranak, gejala yang utama adalah anestrus. Palpasi secara rektal

menunjukan ovarium yang kecil, rata, dan halus terutama pada sapi dara.

 
 
 9 
 

Bila terjadi pertumbuhan folikel sampai diameter 1.5 cm, ovarium

akan teraba kasar. Kondisi ini juga sering terjadi pada sapi dengan

produksi susu tinggi (efeknya tidak langsung). Ternak pertama kali

beranak (feed back negative), pada sapi sapi perah yang menyusui

(energi dan berat badannya turun). Dan proses menyusui akan

menstimulasi sekresi prolaktin danmenyebabkan anestrus.

b. Faktor Infeksi

Adanya infeksi pada saluran reproduksi akan mempengaruhi

lingkungan uterus yang sering menyebabkan gangguan transport sperma,

kematian sperma, gangguan konsepsi, kematian fetus dan embrio, dan

pedet lahir lemah. Ada 2 bentuk infeksi yang menyebabkan infertilitas

yaitu infeksi non spesifik dan infeksi spesifik. Seperti pyometra pada sapi

didefinisikan sebagai pengumpulan eksudat purulen dalam lumen uterus

dan adanya korpus luteum parsisiten pada salah satu ovariumnya.

Adanya eksudat dalam lumen uterus mungkin menyebabkan

penghambatan sekresi prostaglandin dan endometrium, karena pengaruh

progesteron yang cukup lama aktivitas fagositik netrofil uterus akan

ditekan sehingga infeksi bertahan di dalam uterus. (Maidaswar, 2007)

c. Faktor Iklin dan Lingkungan

Gejala anestrus yang terjadi di Indonesia disebabkan oleh karena

sapi kekurangan makanan disamping faktor iklim tropis yang dapat

menurunkan intensitas dan lama estrus pada temperatur tinggi. Sapi FH

yang banyak dipelihara di Indonesia, periode berahinya 11 jam pada suhu

24-35°C (Gaafar et al., 2011). Hal tersebut dapat terjadi karena suhu di

 
 
 10 
 

Indonesia dataran rendah 23-35°C dan di dataran tinggi 20-30°C,

sehingga periode berahi pada sapi FH menjadi singkat. Sedangkan sapi

lokal seperti sapi Bali dapat menyesuaikan diri dengan lingkungan di

Indonesia, jadi kemungkinan anestrus atau subestrus disebabkan karena

kekurangan makanan. Kekurangan makanan dapat menurunkan daya

produksi dan pelepasan hormon hipofisa sehingga produksi hormon

ovarium khususnya estrogen juga akan terganggu, estrogen ini perlu

untuk memanifestasikan tanda-tanda berahi.

Iklim dapat mempengaruhi kegiatan reproduksi baik secara

Iangsung maupun tidak langsung. Pengaruh iklim secara langsung

misalnya oleh suhu dan keIembaban, sedangkan yang tidak langsung

dimana ikIim mempengaruhi mutu makanan dan prevalensi penyakit serta

parasit. Untuk mendeteksi secara langsung pengaruh iklim terhadap

reproduksi sapi agak sulit, karena jenis sapi dan rnakanan ikut

terpengaruh. Iklim dapat mempengaruhi waktu pubertas, lama estrus,

sistem hormonal, kejadian abnormalitas dari ovarium pada sapi betina.

Sedangkan pada sapi jantan mempengaruhi waktu libido,

spermatogenesis dan karakteristik dari pada semen (Payne, 1970).

Iklim dan pertumbuhan rumput di daerah tropis mempengaruhi

produksi dan reproduksi, terutama pada sapi dara dimana pada musim

hujan yang berkisar antara bulan Juli sampai Oktober banyak sapi yang

bunting, sedangkan pada musim kemarau aktifitas reproduksi menurun,

karena udara yang terlalu panas disamping jumlah makanan yang relatif

berkurang (Siebert, 1976). Kelly dan Hurst (dalam Payne, 1970)

 
 
 11 
 

mengemukakan, bahwa temperatur yang tinggi dan berlangsung secara

terus menerus dapat menekan fertilitas sapi jantan dan betina. Temperatur

yang meningkat di daerah subtropis terjadi pada musim panas sehingga

fertilitas menjadi rendah, yang dikenal dengan "Summer Infertility"

(Stevenson, 2001), mengemukakan temperatur yang tinggi di musim

panas di daerah subtropis sulit untuk mendeteksi estrus dibanding pada

musim dingin. Sedangkan di daerah tropis menurut Toelihere (1981)

periode berahi menjadi pendek pada sapi Eropa dan sapi Zebu, hal

tersebut terjadi karena iklim tropis yang panas akan memperpendek

waktuestrus. Periode berahi yang pendek ini tidak akan terobservasi

apabila hanya dilakukan satu kali dalam sehari (Tranter, 1982).

d. Faktor Manajemen

Kegagalan mendeteksi berahi, apabila sapi jantan dipisahkan dari

kelompok sapi betina untuk melakukan kontrol baik terhadap kawin alam

ataupun IB, ternyata cara ini sulit untuk mengetahui waktu berahi. Sering

kali sapi betina dinilai gagal untuk memperlihatkan berahi, sebagian besar

disebabkan oleh adanya CL (Corpus Luteum) pada ovarium dalam siklus

estrusnya. Apabila berahi tenang terjadi, terutama pada sapi dengan

produksi tinggi, ternyata kejadiannya selalu berbanding terbalik terhadap

intensitas dan efektifitas dari cara mendeteksi berahi (Tranter, 1982).

Dalam pola peternakan rakyat yang masih bersifat tradisional

seperti halnya di Indonesia, faktor makanan mungkin merupakan satu

faktor terpenting yang menjadi penyebab kegagalan reproduksi,

khususnya pada sapi. Sedangkan pada perusahaan-perusahaan sapi

 
 
 12 
 

perah yang besar pada umumnya kegagalan reproduksi disebabkan oleh

pemberian makanan yang berlebihan atau tidak berimbang antara hijauan

dengan makanan penguat (konsentrat). Menurut Hafez (1969) di Australia

dan Afrika Selatan sistem pemeliharaan sapi dilepas di padang

pengembalaan (ekstensif), untuk mengatasi kekurangan makanan,

disamping merekapun memperhatikan curah hujan dan suhu, agar

didapatkan sapi-sapi dengan pertumbuhan yang baik. Kekurangan

makanan dapat menyebabkan target berat badan menjadi terhambat,

pubertas terlambat, anestrus dan kebuntingan yang tidak stabil pada sapi

betina. (Ferguson, 2002). Kelebihan makanan menyebabkan sapi betina

kegemukan dengan ovarium kecil sehingga menyebabkan anestrus

(Toelihere, 1981).

Pada sapi yang dibesarkan dan dipelihara dengan makanan yang

berlebihan akan banyak mengalami kegagalan reproduksi dikemudian

hari, sehingga akan mempunyai masa produktif yang lebih singkat

dibandingkan sapi dipelihara dengan enersi rendah. Fricke (2004)

mengemukakan pubertas yang tertunda akibat kekurangan makanan atau

enersi yang menyebabkan tertundanya masa kebuntingan yang pertama.

Anestrus akibat kekurangan enersi menyebabkan tenggang waktu antar

kelahiran diperpanjang. Hal ini dapat disebabkan karena kesalahan

manajemen, dimana secara praktis dan ekonomis lebih sering terlihat

pada sapi perah dibandingkan sapi potong. Pengaruh dan manfaat enersi

yang jelas di USA, dimana sapi yang diberi enersi yang cukup dalam

 
 
 13 
 

makanannya, mempunyai ovarium yang besar, estrus postpartum yang

cepat dan nilai konsepsi yang baik (Campbell, 1979).

C. Upaya-upaya yang dilakukan untuk mengatasi Infertilitas.

Upaya yang dilakukan untuk mengatasi infertilitas pada ternak sapi

dara salah satu faktor yang perlu diperhatikan dalam pembangunan

peternakan adalah masalah kegagalan reproduksi. Kegagalan reproduksi

dapat disebabkan oleh beberapa faktor, seperti halnya faktor hormonal,

hormon yang berhubungan dengan reproduksi diantaranya adalah hormon

estrogen dan gonadotropin (FSH dan LH). Adanya gangguan pada sekresi

hormon-hormon tersebut, akan mengakibatkan terjadinya kegagalan

fertilisasi. Rendahnya kadar estrogen dalam darah terjadi karena adanya

defisiensi nutrisi β karotin, P, Co dan berat badan yang rendah. Hal ini

akan menyebabkan terjadinya silent heat dan sub estrus pada sapi. Pada

kasus silent heat, proses ovulasi berjalan secara normal dan bersifat

subur, tetapi tidak disertai dengan gejala birahi atau tidak ada birahi sama

sekali. Silent heat sering dijumpai pada hewan betina yang masih dara.

(Hunter, 1981).

Penanganan kasus silent heat dan sub estrus dapat dilakukan

dengan perbaikan manajemen pemeliharaan Penanganan kasus silent

heat dan sub estrus dapat dilakukan dengan perbaikan manajemen

pemeliharaan agar ternak mendapat cahayayang cukup, peningkatan

kualitas pakan agar ternak mendapat nutrisi yang cukup sehingga

mekanisme hormonal dalam tubuh dapat berjalan dengan baik.

Pemberian hormon progesteron yang diberikan pada sapi akan

 
 
 14 
 

memunculkan berahi 48-72 jam setelah pemberian PGF2α (Hafez, 2000).

Selain itu akan memberikan feed back negatif terhadap hipotalamus

dengan menghasilkan hormon GnRH untuk merangsang hipofise untuk

menghasilkan LH/FSH yang menstimulasi gonad untuk mensekresikan

estardiol.

Selain dari faktor hormonal, yang akan dikemukakan pengaruh dari

faktor Iingkungan Indonesia yang terletak antara 6° LU dan II° LS,

berpengaruh terhadap perbedaan iklim diantara pulau-pulau di Indonesia,

menurut letaknya dari dataran benua Asia dan Australia. Pengaruh utama

dibidang pengadaan makanan ternak ialah curah hujan, yang berlangsung

akibat hembusan angin barat laut antara bulan November sampai dengan

Maret, lalu diikuti oleh angin tenggara yang kering berasal dari padang

pasir gersang di Australia. Pulau-pulau disebelah barat menikmati hujan

sepanjang tahun, karena angin timur yang kering itu mengumpulkan

banyak uap air (Robinson, 1977). Pengaruh keadaan suhu terhadap

pengadaan rumput atau pertanian tidak seberapa dibandingkan curah

hujan, meskipun demikian dapat juga mengganggu aktifitas reproduksi.

Suhu di dataran rendah berkisar antara 23-35°C dan suhu di dataran

tinggi antara 20-30°C.

Indonesia sekarang berusaha meningkatkan mutu ternak dengan

mengimpor bibit sapi dari New Zealand dan Australia yang berbeda

Iingkungannya. Kemudian dengan dibukanya daerah-daerah transmigrasi,

diikuti juga dengan perpindahan sapi baik lokal maupun impor antar pulau

dengan lingkungan yang berbeda pula dan cara mengatasinya dengan

 
 
 15 
 

menempatkan sapi di tempat yang teduh, ventilasi kandang yang cukup

baik, beri banyak air segar dan makanan yang bergizi tinggi dengan kadar

yang rendah serat kasarnya

Faktor makanan berpengaruh langsung terhadap pertumbuhan

organ reproduksi, sehingga makanan dengan kualitas rendah dapat

menyebabkan hipoplasia ovari pada sapi-sapi dara dan hipoplasia testes

pada sapi jantan muda yang berakibat keterlambatan masa pubertas atau

dewasa kelamin. Faktor manajemen pemberian pakan perlu diperhatikan

seperti halnya protein Meskipun protein dan iodium tidak begitu penting

dalam masalah reproduksi seperti halnya pada kebutuhan enersi, tetapi

apabila kadar yang dibutuhkan dari protein rendah juga akan

mempermudah terjadinya infertilitas. Pada sapi dara defisiensi protein

akan memperlihatkan gejala anestrus, hipoplasi ovari dan uterus yang

tidak berkembang, apabila keadaan ini masih dini dapat dengan mudah

untuk diperbaiki dengan pemberian makanan yang baik dalam beberapa

minggu (Hafez, 1969). iodium akan menghalangi pertumbuhan organ

reproduksi, karena menghambat kerja thyroid. Hiperthyroidismus

menyebabkan sekresi hormon-hormon gonadotropin dari hipofisa

dihambat. Didaerah-daerah yang kekurangan iodium untuk mencukupi

mineral tersebut harus disediakan dalam bentuk pemberian garam dapur.

Kekurangan garam dalam waktu yang lama menyebabkan penurunan

berat badan dan anestrus (Rustamadji et al., 2007).

 
 
 16 
 

D. Faktor-faktor yang mempengaruhi pubertas

Pubertas merupakan batasan umur atau waktu hewan betina

secara fisik dan fisiologis siap untuk melakukan perkawinan dan

berkembang biak. Pada hewan betina pubertas ditandai dengan terjadinya

estrus/berahi dan ovulasi. Pubertas lebih jelas terlihat pada hewan betina

dibandingkan dengan hewan jantan. Pubertas atau dewasa kelamin terjadi

sebelum dewasa tubuh tercapai. Sebelum pubertas, saluran reproduksi

dan organ-organ reproduksi perlahan-lahan bertambah dalam ukuran dan

secara fisiologis belum berfungsi. Perkembangan dan pertumbuhan tubuh

hewan penting artinya bagi perkembangan fungsi kelamin hewan betina.

Apabila suatu umur atau bobot tubuh tertentu telah dicapai maka hewan

betina akan mengalami estrus dan ovulasi. Secara normal, pertumbuhan

dan perkembangan alat reproduksi adalah proses yang bertahap pada

individu baru. Williams, (1988) dalam Salisbury dan Van Demark (2002)

membagi perkembangan dan pendewasaan alat reproduksi sapi menjadi

tiga tingkatan. Tingkat pertama, pendewasaan kelenjar hipofise sebagai

penghasil hormon reproduksi pada umur 3-6 bulan. Kedua pendewasaan

ovarium sebagai pengasil sel telur dan hormon pada umur 6-12 bulan.

Tingkatan terakhir pendewasaan uterus sebagai tempat perkembangan

embrio pada saat bunting, perkembangan organ ini tidak pernah

sempurna sebelum mencapai umur tiga tahun atau lebih. Umur dan bobot

tubuh hewan pada saat timbulnya pubertas berbeda-beda menurut

spesiesnya.

 
 
 17 
 

Mekanisme timbulnya pubertas dikontrol secara fisiologis yang

melibatkan gonad dan kelenjar adenohipofisa, maka pubertas dipengaruhi

oleh hormon, nutrisi, dan lingkungan. Pertumbuhan dan perkembangan

organ-organ kelamin betina pada waktu pubertas dipengaruhi oleh

hormon-hormon gonadotropin. Pelepasan FSH ke dalam aliran darah

menjelang pubertas menyebabkan folikel-folikel pada ovarium mulai

tumbuh. Folikel yang tumbuh dari folikel primer menjadi folikel sekunder

dan folikel tersier, yang akhirnya matang menjadi folikel de Graaf. Ovarium

beratnya menjadi bertambah dan kemudian menghasilkan hormon

estrogen yang akan disekresikan ke dalam aliran pembuluh darah.

Estrogen akan menyebabkan saluran reproduksi tumbuh dan

berkembang, sedangkan pengaruh LH menyebabkan ovarium yang telah

matang akan diovulasikan ke uterus (Bishop et al., 2008)

Awal pubertas pada hewan betina disebabkan oleh pelepasan

hormon gonadotropin dari kelenjar adenohipofisa ke dalam pembuluh

darah dan bukan produksi hormon-hormon tersebut secara tiba-tiba. Pada

hewan yang belum dewasa kelamin terbukti mengandung hormon-hormon

gonadotopin pada hewan-hewan betina muda yang akan menyebabkan

ovarium dan saluran reproduksi memberikan respon dengan terjadinya

estrus dan ovulasi.

Penelitian tentang induksi berahi pada masa prapubertas dilakukan

pada sapi dara dengan umur rata-rata 8,5 bulan dan bobot tubuh 249 kg

dengan menggunakan estrogen dan progesteron. Hasilnya menunjukkan

sapi-sapi perlakuan mengalami estrus dan ovulasi dibandingkan dengan

 
 
 18 
 

sapi kontrol, namun tidak berbeda dalam hal tingkat kebuntingannya. Hal

ini berarti bahwa estrus dapat terjadi tetapi tidak mempengaruhi fertilitas

sapi. Penelitian lain adalah pemberian estrogen dan progesteron pada

sapi dara Angus dan Hereford dengan umur 12-14 bulan dan bobot tubuh

278 kg yang disilangkan dengan Charolais. Hasilnya memperlihatkan sapi-

sapi perlakuan mengalami estrus dan tingkat konsepsi yang berbeda

nyata dengan sapi-sapi kontrol.

Faktor lain yang mempengaruhi pubertas pada sapi dara periode

sapi betina muda sampai beranak pertama. (Boden, 2005; West, 1977)

Manajemen pemeliharaan sapi dara yang bagus akan mempengaruhi

tingkat pencapaian umur pubertasnya, seperti pendapat Tillman et al

(1991) bahwa faktor makanan memegang perananan penting dalam

berbagai peristiwa fisiologis yang terjadi dalam pencapaian dewasa

kelamin serta proses-proses reproduksi. Diperkuat dengan pernyataan

(Thalib et al., 2001) bahwa perkembangan organ reproduksi ditentukan

oleh proses pemberian nutrisi dan pemeliharaan semasa muda. Iskandar

(2011) juga menyatakan bahwa nutrisi yang rendah dapat mengakibatkan

pubertas terlambat. Pubertas pada sapi betina terjadi pada usia 7-18

bulan dengan rata-rata usia 10 bulan ketika menunjukkan tanda-tanda

estrus yang jelas. Pencapaian umur pubertas dapat bervariasi yang dapat

dipengaruhi oleh level nutrisi, musim, kedekatan interaksi dengan

pejantan, cuaca, dan penyakit yang dapat memperlambat pertumbuhan

(Noakes et al., 2001). Sapi dara yang diberi makanan dengan kualitas

 
 
 19 
 

tinggi sejak lahir akan lebih cepat mencapai pubertas dan permulaan

siklus estrusnya (Toelihere, 1981).

Umumnya pertumbuhan dan perkembangan menjadi prasyarat

penting untuk menuju pubertas (Rekwort et al., 2000). Menurut Getzewich

(2005) pada umumnya pubertas dicapai ketika mereka telah mencapai

40% dari bobot badan dewasa dan aspek pakan mempunyai pengaruh

yang besar. Beberapa penelitian menunjukkan bahwa ternak yang diberi

asupan pakan dengan kecukupan energi dan protein menyebabkan ternak

cepat tumbuh dan umur pubertas lebih awal bisa dicapai (Son et al.

,2001; Romano et al., 2005).

E. Metode Heatsynchdan cara kerja hormon

Metode Heatsynch merupakan metode sinkronisasi yang memakai

kombinasi GnRH, PGF2α dan estrogen dengan harapan terjadi estrus dan

ovulasi yang bersamaan dan dapat dipakai untuk aplikasi IB tanpa perlu

mendeteksi adanya tanda-tanda berahi dan IB dilakukan dengan waktu

yang terjadwal (Fixed Time AI). Tujuan Heatsynch adalah untuk

sinkronisasi berahi dan ovulasi setelah injeksi EB (Estrogen benzoat)

untuk kita melakukan IB (Yusuf et al., 2010). Kelebihan metode Heatsynch

diantaranya merangsang folikel yang tidak aktif, jika terdapat corpus

luteum dilisiskan, memaksimalkan LH melalui penigkatan feedback positif

dari kerja estrogen. Interval ovulasi setelah permulaan dari berahi tidak

dibedakan pada sapi Heatsynch, tanpa memperhatikan perombakan

progesteron sebelumnya. Interval dari penyuntikan PGF2α sampai ovulasi

sangat baik (P<0,01) pada perlakuan dengan ECP daripada sapi yang

 
 
 20 
 

mendapat perlakuan GnRH (Stevenson et al., 2004). Metode Heatsynch

menunjukkan keberhasilan 89,21% dalam meningkatkan efisiensi

reproduksi sapi perah betina (Stevenson et al., 2004).

1. Gonadotropin Releasing Hormone (GnRH)

GnRH merupakan suatu dekadeptida (10 asam amino) dengan

berat molekul 1183 dalton. Hormon ini menstimulasi sekresi follicle

stimulating hormon (FSH) dan Lutinizing Hormon (LH) dari hipofisis

anterior (Salisbury dan vandemark, 1985). Pemberian GnRH

meningkatkan FSH dan LH dalam sirkulasi darah selama 2 sampai 4 jam

(Chenault et al., 1990). Secara alamiah, terjadinya level tertinggi (surge)

LH yang menyebabkan ovulasi merupakan hasil kontrol umpan balik

positif dari sekresi estrogen dari folikel yang sedang berkembang. Berikut

ini adalah mekanisme kerja GnRH, hipotalamus akan mensekresi GnRH,

kemudian GnRH akan menstimulasi hipofisis anterior untuk mensekresi

FSH dan LH. FSH bekerja pada tahap awal perkembangan folikel dan

dibutuhkan untuk pembentukan folikel antrum. FSH dan LH merangsang

folikel ovarium untuk mensekresikan estrogen. Menjelang waktu ovulasi

konsentrasi hormon estrogen mencapai suatu tingkatan yang cukup tinggi

untuk menekan produksi FSH dan dengan pelepasan LH menyebabkan

terjadinya ovulasi dengan menggertak pemecahan dinding folikel dan

pelepasan ovum. Setelah ovulasi maka akan terbentuk korpus luteum dan

ketika tidak bunting maka PGF2α dari uterus akan melisiskan corpus

luteum.

 
 
 21 
 

2. Prostaglandin (PGF2α)

Pemberian PGF2α dapat dilakukan secara intramusculer,

pemberian secara intramuscular mudah dilakukan yaitu dengan cara

injeksi, namun dosis yang diperlukan cukup besar. Pemberian secara

intrauterin hanya diperlukan dosis yang jauh lebih rendah, namun

memerlukan keterampilan khusus (Solihati, 2005). Sariubang dan

Tambing (2006) menyatakan bahwa penggunaan PGF2α untuk program

sinkronisasi estrus ternak hanya efektif bila ternak tersebut telah memiliki

corpus luteum karena PGF2α bersifat luteolitik sehingga mampu

menginduksi terjadinya regresi CL yang mengakibatkan estrus.

Mukasa et al (1989) menyatakan bahwa PGF2α yang disuntikkan

akan memasuki aliran darah menuju ovarium, akibat aksi dari PGF2α

tersebut akan terjadi vasokonstraksi. Oleh karena itu, aliran darah yang

menuju ovarium lama-kelamaan akan terhenti. Terhambatnya aliran darah

yang menuju ovarium mengakibatkan suplai makanan yang dibutuhkan

ovarium akan berkurang bahkan terhenti, sehingga corpus luteum yang

fungsional regresi. Hancurnya corpus luteum tersebut menyebabkan

terhentinya sekresi hormon progesteron, yang akan diikuti dengan naiknya

FSH untuk merangsang pertumbuhan folikel. Dalam waktu tiga sampai

empat hari folikel menjadi masak dan siap diovulasikan dengan didahului

timbulnya gejala estrus.

Herdis et al (2007) pemberian PGF2α analog dapat menyebabkan

luteolisis melalui penyempitan vena ovari yang menyebabkan

berkurangnya aliran darah dalam ovarium. Berkurangnya aliran darah ini

 
 
 22 
 

menyebabkan regresi sel-sel luteal (Hafez, 2000). Regresi sel-sel luteal

menyebabkan produksi progesteron menurun menuju kadar basal

mendekati nol nmol/L, hal ini merupakan saat-saat terjadinya estrus.

Menurut Stevenson et al (2004), bahwa interval dari penyuntikan PGF2α

sampai ovulasi sangat baik pada perlakuan dengan ECP daripada sapi

yang mendapat perlakuan GnRH (88 ,2 vs 76 ,2 jam).

3. Estrogen

Hormon estrogen, utamanya dihasilkan oleh folikel ovarium, akan

menurun setelah proses ovulasi terjadi, sampai dengan fase praberahi,

kemudian kembali meningkat sampai terjadi ovulasi pada siklus

berikutnya. Estrogen diberikan dalam jumlah kecil maka dapat

menyebabkan terjadinya berahi dan ovulasi, alasannya, estrogen dalam

jumlah kecil secara umpan balik positif bekerja meningkatkan

pembebasan LH yang diperlukan untuk terjadinya ovulasi (Feradis, 2010).

Menurut Fricke dan Shaver, (2007) munculnya estrus disebabkan

karena pengaruh meningkatnya hormon estrogen dalam tubuh yang

dihasilkan oleh ovum. Injeksi estrogen bekerja untuk menimbulkan gejala

berahi dalam selang waktu yang pendek sehingga efektif diramalkan

berahi. Seiring pendapat Lopez et al (2000) dalam Stevenson et al (2004)

bahwa pemberian 2 ml ECP dapat menginduksi estrus, LH surge, ovulasi

dan pertumbuhan corpus luteum normal pada sapi-sapi perah dara.

Ditambahkan oleh Hafez (2000) bahwa sumber sintetis estrogen antara

lain yaitu Oestradiol Benzoat. (Azizah, 2014).

 
 
 23 
 

4. Intensitas Berahi

Intensitas merupakan tingkatan berahi yang meliputi waktu

mulainya berahi dengan memperlihatkan gejala berahi sebagai bentuk

respon. Adapun respon berahi yaitu gejala-gejala berahi yang muncul

pada ternak : (1) vulva merah, (2) vulva bengkak, (3) berlendir, (4) menaiki

temannya (Marawali et.al 2001).Skoring dilakukan berdasarkan gejala

berahi yang muncul :

 Skor 4 = keempat gejala berahi muncul

 Skor 3 = tiga dari empat gejala berahi yang muncul

 Skor 2 = dua dari empat gejala berahi yang muncul

 Skor 1 = satu dari gejala berahi yang muncul

Tanda-tanda berahi berdasarkan pengetahuan peternak antara

lain, sapi keluar lendir bening dari vulva, melenguh dan gelisah, berusaha

menaiki sapi lain, vulva bengkak berwarna merah, berusaha menaiki sapi

lain dan menggosokkan badannya ke sapi lain sesuai pendapat Galloway

and Parera (2003). Intensitas berahi yang tinggi pada sapi Bali membuat

tingkat kesuburan yang tinggi pula, yakni mencapai 80% (Darmadja,

1980). Partodihardjo (1992) menyatakan bahwa karena intensitas berahi

dipengaruhi oleh hormon-hormon reproduksi, maka secara tidak langsung

angka intensitas berahi (AIB) juga sangat dipengaruhi oleh status nutrisi

ternak itu sendiri.Intensitas berahi atau tingkatan berahi dilihat dari gejala

berahi yang ada. Intensitas berahi Bali (dara) paritas 0 memperlihatkan

intensitas berahi dengan jelas (skor 3). Hal tersebut menunjukkan bahwa

semua sapi paritas 0 mampu memperlihatkan gejala berahi dengan

 
 
 24 
 

intensitas yang jelas. Sapi Bali paritas 1 memperlihatkan intensitas berahi

dengan skor 1, skor 2, dan skor 3 berturut-turut 75 %, 25 %, dan 0 %. Hal

tersebut menunjukkan bahwa tidak semua sapi mampu memperlihatkan

gejala berahi dengan intensitas yang jelas. Sapi Bali paritas 2

memperlihatkan intensitas berahi dengan skor 1, skor 2, dan skor 3

berturutturut 0 %, 25 %, dan 75 % (Fitri, 2015).

F. KERANGKA PIKIR

Salah satu penyebab gangguan reproduksi adalah adanya

gangguan fungsional hormonal. infertilitas adalah salah satu bentuk

gangguan fungsional yang disebabkan oleh adanya kelainan hormonal.

Seperti Subestrus/berahi tenang, anestrus, dan ovulasi tertunda. Kelainan

hormonal juga di pengaruhi kondisi tubuh, penyakit dan faktor

lingkungan.Beberapa upaya yang dapat dilakukan untuk pencegahan

gangguan fungsional hormonal adalah perbaikan lingkungan, vaksinasi,

dan induksi hormon. berbagai macam hormon seperti Gonadothropin

Releasing Hormon (GnRH), PGF2α dan Estradiol benzoat berperan

penting bagi kecepatan sapi untuk berahi dan beranak. Oleh karena itu

suatu pengaturan terhadap kemampuan reproduksinya secara tertib dan

teratur perlu dilakukan sehingga efesiensi reproduksi dapat tercapai.

Partodihardjo (1987), menyatakan bahwa evaluasi keberhasilan

dibidang reproduksi ternak harus memperhatikan kartu ternak yang berisi

keterangan mengenai seekor ternak, umur pertama kali dikawinkan,

pengamatan terhadap deteksi berahi, deteksi kebuntingan, perkawinan

kembali setelah melahirkan, saat perkawinan yang tepat, fertilitas jantan

 
 
 25 
 

yang digunakan serta service per conception, non return rate, conception

rate, dancalving interval. Hal-hal tersebut digunakan untuk mendapatkan

hasil reproduksi yang baik.

Fenomena yang sering terjadi adalah khususnya pada sapi perah

dara yaitu keterlambatan pubertas dan sering juga mengalami silent heat

(berahi tenang) sehingga menyulitkan peternak dalam mendeteksi berahi.

Faktor terpenting dalam pelaksanaan perkawinan adalah ketepatan waktu

pemasukan semen pada puncak kesuburan ternak betina, (Intan 2009).

Puncak kesuburan ternak betina adalah pada waktu menjelang ovulasi

sehingga peternak dan petugas lapangan harus mengetahui dan

memahami kapan gejala berahi ternak terjadi sehingga tidak ada

keterlambatan IB. Agar inseminasi buatan berjalan optimal maka

dilakukan upaya untuk mensinkronkan berahi ternak dengan

menggunakan hormon (GnRH, PGF2α dan Estradiol benzoate) agar

terjadi berahi secara serentak sehingga mudah dilakukan deteksi berahi

untuk meningkatkan efesiensi reproduksi.Bagan kerangka pikir penelitian

tersebut dapat dilihat pada gambar 1.

 
 
 26 
 

Hormon Estrogen 

Hormon GnRH 
Pubertas
Lambat Hormon PgF2α 

Heatsynch Hormon FSH  

 GnRH Hormon LH 
 Estradiol
 PGF2α
Meningkatkan Efesiensi 
Reproduksi 

 Mempercepat 
Umur Pubertas 
 Meningkatkan 
Kebuntingan 

Gambar 1. Kerangka Pikir

G. Hipotesis

Diduga bahwa dengan metode Heatsynch dapat meningkatkan

infertilitas dengan cara mengatasi keterlambatan pubertas dan

meningkatkan kebuntingan pada sapi perah dara yang berada di

Kecamatan Cendana.

 
 
 Age at puberty, total fat and conjugated linoleic acid content of carcass,
and circulating metabolic hormones in beef heifers fed a diet
high in linoleic acid beginning at four months of age
M. R. Garcia*†, M. Amstalden*†, C. D. Morrison‡, D. H. Keisler‡, and G. L. Williams*†2
*Animal Reproduction Laboratory, Texas A&M University Agricultural Research Station, Beeville 78102;
†Department of Animal Science, Center for Animal Biotechnology and Genomics, Texas A&M University,
College Station 77843; and ‡Department of Animal Science, University of Missouri, Columbia 65211
ABSTRACT: In the current study, we hypothesized
that diets high in linoleic acid would increase conju-
gated linoleic acid (CLA) tissue content, reduce adipos-
ity and leptin production, and result in an increase in
the age at puberty in heifers. Heifers were weaned and
blocked by body weight (heavy, n = 10, and light, n
= 10) and allocated randomly within block to receive
isocaloric and isonitrogenous diets with either added
fat (HF, n = 10) or no added fat (C, n = 10) from 4 mo
of age until post-pubertal slaughter. Whole sunflower
seed (55% oil; 70% linoleic acid) was used as the fat
source in HF diets and provided 5% added fat from the
start of the study until heifers weighed 250 ± 8 kg, at
which time added fat was increased to 7% of dry matter
until slaughter. Body weights were recorded weekly,
and blood samples were collected weekly for total cho-
lesterol and hormone analyses. Puberty was confirmed
based on serum concentrations of progesterone and ul-
trasonographic confirmation of corpora lutea. Heifers
were slaughtered at 325 ± 10 d of age, and longissimus
muscle between the 9th and 11th rib was collected and
analyzed to estimate carcass composition. Subcutane-
ous and kidney, pelvic, and heart fat were collected at
Key Words: Cattle, Conjugated Linoleic Acid, Fat, Leptin, Puberty
2003 American Society of Animal Science. All rights reserved.
Introduction
Leptin, a potent satiety hormone synthesized and
secreted primarily by adipocytes, is highly correlated
with BW and adiposity and has been reported to be
1
Supported by funding from the Texas Agric. Exp. Stn. We acknowl-
edge with gratitude the careful animal care and assistance of R.
Franke, M. Davis, and T. Lopez. We are also grateful for the technical
assistance of S. Smith, G. Carstens, C. Gilbert, and C. Sanders.
2
Correspondence: 3507 Hwy 59 E (fax: 361-358-4930; E-mail:
glw@fnbnet.net).
Received July 15, 2002.
Accepted September 4, 2002.
261
Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876
by University of Massachusetts user
on 04 July 2018
slaughter for fatty acid analyses. The HF heavy group
tended (P < 0.10) to reach puberty later than all other
groups, and one HF light heifer did not reach puberty
during the study. Linoleic acid and cis-9, trans-11 CLA
tissue contents were higher (P < 0.03) in HF heifers than
controls, but neither total carcass fat nor percentage
of dry matter differed by dietary group, although the
percentage of protein tended (P < 0.10) to be lower in
HF heifers. Mean serum concentrations of leptin did
not differ due to diet; however, leptin increased (P <
0.01) linearly as puberty approached. Circulating con-
centrations of growth hormone and insulin-like growth
factor I increased or remained relatively constant be-
tween wk 2 to 10 of feeding, and then declined (P <
0.01) until the onset of puberty. Serum IGF-I was lower
(P < 0.01) in heifers receiving the HF diet. Mean serum
concentrations of insulin and total cholesterol increased
(P < 0.01) with time in both groups, but only total choles-
terol was increased by the HF diet (P < 0.05). Results
indicate that diets high in linoleic acid fed to growing
beef heifers beginning early in life have little or no
effect on total carcass fat, circulating leptin, or age at
puberty despite measurable increases in CLA accumu-
lation.
J. Anim. Sci. 2003. 81:261–268
essential for sexual maturation in rodents and humans
(Cunningham et al., 1999). Both serum leptin and leptin
gene expression increase as puberty approaches in heif-
ers (Garcia et al., 2002), whereas short-term fasting
reduces synthesis and secretion of leptin and frequency
of LH pulses (Amstalden et al., 2000). Exogenous treat-
ment with recombinant leptin increases LH secretion
in fasted cows and attenuates fasting-mediated reduc-
tions of LH in wethers (Nagatani et al., 2000; Amstal-
den et al., 2002a). Moreover, leptin enhances basal se-
cretion of LH in fasted cows (Amstalden et al., 2002b).
These and related observations suggest that leptin
could influence age at puberty in heifers.
One approach for studying the roles of adiposity and
leptin in pubertal development would be to reduce the
 262
ratio of fat to lean tissue during early growth and devel-
opment, thereby reducing leptin availability. In monog-
astric species, reductions in adipocyte proliferation and
circulating leptin may be accomplished by feeding con-
jugated linoleic acids (CLA), a generic term for conju-
gated isomers of linoleic (18:2) and linolenic (18:3) acids
(Parodi, 1999; Medina et al., 2000). Because CLA are
intermediate products of 18:2 and 18:3 biohydrogena-
tion in the rumen, their production and accretion can
be increased by feeding diets high in 18:2 and 18:3 to
cattle (Parodi, 1999). Importantly, diets high in linoleic
acid also increase serum lipoprotein cholesterol, insu-
lin, and GH, and positively modulate ovarian physiol-
ogy in mature cows (Williams et al., 1998; Williams
and Stanko, 2000). However, these effects appear to be
unrelated to adiposity or leptin. Herein, we hypothe-
sized that diets high in linoleic acid would increase
CLA production, reduce adiposity and serum leptin,
and delay puberty.
Materials and Methods
Animals and Experimental Design
Twenty spring-born, crossbred heifers (¹⁄₂ Red or
Black Angus × ¹⁄₄ Brahman × ¹⁄₄ Hereford), born within
a 30-d period, were utilized. Before weaning and assign-
ment to the study, all heifers received primary and
secondary immunizations against common respiratory
viruses, leptospirosis, vibriosis, and pasturella using
a combination of attenuated live and killed vaccines.
Heifers were weaned at approximately 3 mo of age and
stratified by age, BW, and breed of sire (Red vs Black
Angus) into four pens (five heifers/pen) each measuring
25.9 × 9.5 m2. Body weight stratification resulted in
two pens of heavier (heavy) and two pens of lighter
(light) heifers averaging (±SEM) 126 ± 4 and 103 ± 4
kg, respectively. At weaning, heifers were fed a diet
consisting of 1.3 kg of a concentrate containing 78%
sorghum, 20% cottonseed meal, and 1.4% limestone for-
tified with vitamins A, D, and E, and had ad libitum
access to coastal bermudagrass hay. At 4 mo of age,
pens of heavy and light heifers were each assigned ran-
domly to receive either a high fat (HF; n =10) or control
(C; n = 10) diet until slaughter. Complete mixed diets
were isocaloric and isonitrogenous and formulated ini-
tially to promote a gain of 0.9 kg/d utilizing NRC recom-
mendations (1984; Table 1). The HF diet contained
added fat equal to 5% of total DM intake, with whole
sunflower seed serving as the primary fat source and
source of linoleic acid (55% oil, Pope Testing Labora-
tories, Inc, Dallas, TX; 70% linoleic acid, National Sun-
flower Association). Diet composition and DM were ad-
justed for BW gain every 2 to 3 wk until heifers weighed
250 ± 8 kg, at which time diets were adjusted to reduce
rate of gain to 0.45 kg/d. At this time, total added fat
in the HF group was increased from 5 to 7% of total DM.
Coccygeal blood samples were collected weekly from
all heifers until slaughter and serum was harvested and
Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876
by University of Massachusetts user
on 04 July 2018
Garcia et al.
stored at −20°C. To examine dietary effects on metabolic
endocrinology and cholesterol metabolism, serum was
analyzed for circulating concentrations of total choles-
terol, insulin, GH, IGF-I, leptin, and progesterone as
described below. Puberty was confirmed based on se-
rum progesterone ≥1 ng/mL over two consecutive sam-
ples and twice weekly transrectal ultrasonagraphy to
visualize corpora lutea. Body weights were recorded
weekly until slaughter at 325 ± 10 d of age, at which
time all heifers except one in the HF group were puber-
tal. At slaughter, longissimus muscle between the ninth
and 11th rib was excised and analyzed for the percent
DM, percentage of protein, total fat (% ether extract),
and fatty acid composition. Subcutaneous fat, from the
tailhead region, and kidney, heart, and pelvic (KHP)
fat were also collected and analyzed for fatty acid com-
position.
RIA and Enzymatic Assays
Circulating concentrations of leptin and progesterone
were analyzed using a specific, highly sensitive ovine
leptin RIA validated for bovine serum (Delavaud et
al., 2000) and the Coat-a-Count assay kit (DPC, Los
Angeles, CA), respectively. Use of these assays has been
reported previously from our laboratory (Amstalden et
al., 2000; Fajersson et al., 1999). Serum insulin, GH,
and IGF-I were determined by RIA as described pre-
viously (Ryan et al., 1995), except that radiolabeled
[125I] porcine insulin (Peninsula Laboratories, Belmont,
CA) was utilized as tracer instead of bovine insulin.
The bovine insulin antiserum (ICN, Lisle, IL) has a
cross reactivity with other related peptides of <0.2%
and 100% with human and porcine insulin at 50% dis-
placement. Serum concentrations of total cholesterol
were determined by the enzymatic method of Allain et
al. (1974) utilizing total cholesterol kit reagents (Sigma-
Aldrich, St. Louis, MO) as reported previously (Wil-
liams et al., 1989). Intra- and interassay CV for all
assays averaged 5 to 9% and 11 to 17%, respectively.
Major Fatty Acid Composition
Adipose and muscle samples were analyzed for fatty
acid composition using a method described previously
by Folch et al. (1957). Total lipids were extracted from
1 g of muscle and adipose tissue using 2:1 (vol/vol) chlo-
roform:methanol solvent mixture. Total extracted lipids
were methylated with 14% boron trifluoride-methanol
by the method of Slover and Lanza (1979). Methylated
lipids were analyzed using a flame ionization detector
on a gas chromatograph using a Varian (Varian, Inc.
Walnut Creek, CA) model CP-800, fixed with a CP-
8200 (Varian, Inc) autosampler and a flame ionization
detector equipped with a 0.25-mm × 100-m fused-silica,
silver nitrate-impregnated capillary column (Chrom-
pack, Middelburg, The Netherlands). The injection port
and detector temperatures were maintained at 270 and
300°C, respectively. Gas pressures were 2.2 kg/cm2 for
 Puberty in heifers fed fat 263
Table 1. Representative compositions of control and high fat diets fed to heifers at
weights of 150 and 250 kg, respectively, during the study
Control High fat

5% 7%
150 kg 250 kg
Ingredients 150 kg 250 kg

Kleingrass hay, % 24.90 14.5 26.00 30.10

Cottonseed hulls, % 10.40 7.7 10.40 7.80
Ground corn, % 47.30 70.8 40.20 47.10
Soybean/cottonseed meal, % 14.10 6.8 11.30 1.10
Sunflower seed, % — — 9.10 12.70
Limestone, % 0.70 0.8 2.30 1.30
Dicalcium phosphate, % 2.50 — 0.67 —
Vitamin A premix, IU 83,600 28,600 83,600 28,600
Formulated chemical composition
Metabolizable energy, Mcal/kg 10.70 16.60 10.70 16.60
CP, % DM 13.50 11.10 13.50 11.10
Ether extract, % DM 2.90 3.00 7.40 9.50

the carrier gas (helium), 0.6 kg/cm2 for the make-up
gas (nitrogen), and 0.5 kg/cm2 for the combustion air.
Chromatograms were recorded with a computing integ-
rator (Shimazu Chromatopac C-R6A). Identification of
sample fatty acids were made by comparing the relative
retention times of standards previously validated by
Zembayashi et al. (1995).
Carcass Composition
Heifers were slaughtered at the Rosenthal Meat Sci-
ence Center, Texas A&M University, College Station
using standard methodology involving captive bolt
stunning followed by exanguination. Fat from the tail-
head and KHP region were collected at that time. Car-
casses were chilled for 48 h after slaughter, at which
time longissimus dorsi muscle between the ninth and
11th rib was collected, vacuum-packed, and stored at
−10°C until analyses for moisture and total fat content
as described previously by Hankins et al. (1946). Per-
cent protein was measured using a Leco N Analyzer
(St. Joseph, MI) model FP-2000.
Statistical Analyses
One heifer in the HF light group did not reach puberty
within the time allotted for the study (325 ± 10 d of
age); therefore, for the purpose of analyzing mean age
at puberty, this heifer was assigned the maximal value
using the date when the last pubertal heifer was slaugh-
tered. Main effects of diet, BW group, and BW group ×
diet on age at puberty, percentage of DM, protein, fat,
and fatty acid composition were determined with AN-
OVA using the MIXED procedure of SAS (SAS Inst.,
Inc., Cary, NC). Endocrine data were analyzed in two
ways using the MIXED procedure of SAS for repeated
measures: 1) from the onset of the study to slaughter
and 2) for 20 wk normalized to the wk of pubertal ovula-
tion (wk 0). Sources of variation were diet, BW group,
week, and interactions among the sources. Heifer
within diet and BW classification were used as the “sub-
ject” for the MIXED procedure for repeated measures
to account for correlated variation within animal. The
least squares means procedure was used to compare
means when a significant difference was detected in
the MIXED analysis. Pearson’s correlation coefficients
were determined among the described variables using
the CORR procedure of SAS.
Results
Age and Weight at Puberty and Slaughter
Heifers in both the heavy and light BW groups gained
0.88 ± 0.03 kg/d, and weighed 301 ± 7 and 300 ± 11 kg,
respectively, at puberty (Table 2). Heifers in the HF
heavy group tended (P < 0.10) to reach puberty at an
age (307 ± 14 d) older than the HF light, C heavy,
and C light groups (280 ± 5, 273 ± 9, and 289 ± 8 d,
respectively). One heifer in the HF group did not reach
puberty within the time allotted for completion of the
study. At slaughter, heifers in the heavy and light BW
groups weighed 337 ± 8 and 300 ± 11 kg, respectively.
No differences in carcass weight were detected between
the HF and C groups (Table 2). Diet did not affect per-
cent DM or fat of longissimus muscle; however, the
percentage of total protein tended to be lower in the
HF group (Table 2).
Tissue Fatty Acid Composition
Tissue fatty acid compositions are presented in Table
3. Heifers receiving the HF diet had a higher (P < 0.01)
percentage of linoleic acid (18:2) in all tissues analyzed.
The cis-9, trans-11 CLA, one of two common and abun-
dant isomers of CLA, was detected in KHP and subcuta-
neous fat. Content of CLA in KHP was not affected by
diet; however, cis-9, trans-11 CLA was higher (P < 0.01)
in subcutaneous fat from HF heifers. The second com-
mon isomer of CLA, trans-10, cis-12, was only detected

Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876

by University of Massachusetts user
on 04 July 2018
 264 Garcia et al.

Table 2. Effects of a high-fat diet on age and BW at puberty, carcass wt, and percent
fat (ether extract), protein, and DM of longissimus muscle between the 9th and 11th rib
Pubertal age, Pubertal BW, Carcass wt, Ether extract, Protein, DM,
Diet d ± SEM kg ± SEM kg ± SEM % ± SEM % ± SEM % ± SEM

Control
(n = 10) 281 ± 7 301 ± 7 178 ± 5 14.9 ± 0.8 17.1 ± 0.9a 22.7 ± 0.7
High Fat
(n = 10)c 294 ± 7 300 ± 11 172 ± 5 14.2 ± 0.9 13.1 ± 2.6b 23.1 ± 1.6
Means with different superscripts tend to differ (P < 0.10).
a,b
c
n = 10 for pubertal age and BW; n = 9 for all other variables.

in the subcutaneous fat of six heifers (HF = 2; C = 4)
and did not differ relative to diet. Diet had no effect
on linolenic acid (18:3) tissue content; however, heavy
groups of heifers had a higher percentage in KHP fat
than light groups (P < 0.05). Heifers receiving HF diets
had a higher (P < 0.05) percentage of stearic acid (18:0)
in both muscle tissue and KHP fat, but not in subcuta-
neous fat. Average decreases of 19 and 53%, respec-
tively (P < 0.03), in palmitic (16:0) and palmitoleic (16:1)
acids were detected in all tissues analyzed in the HF
heifers compared to controls. Myristic acid (14:0) did
not differ in longissimus muscle or subcutaneous fat;
however, percentage of 14:0 was higher (P < 0.01) in
KHP fat of the C heifers.
Metabolic Hormones
Mean serum concentrations of leptin were not af-
fected by diet; however, leptin increased (P < 0.01; Fig-
ure 1) linearly in all heifers as puberty approached.
Circulating leptin was positively correlated with BW
(P < 0.01), total cholesterol (P < 0.01), and insulin (P <
0.05), but negatively associated with serum GH and
IGF-I (P < 0.05; Table 4). In contrast to circulating
leptin, mean serum concentrations of GH and IGF-I
decreased (P < 0.01) beginning approximately 15 wk
before puberty (Figure 1). Moreover, circulating IGF-I
was lower (P < 0.01) in heifers receiving the HF diet
than those on the C diet (136 ± 5 and 183 ± 12 ng/mL,
respectively). Although diet did not influence overall
mean serum concentrations of GH, a higher (P < 0.02)
serum concentration of GH was detected in HF heifers
between 15 and 19 wk before puberty compared to con-
trols (Figure 1). Circulating concentrations of insulin
and total cholesterol increased throughout the experi-
ment (P < 0.01; Figure 1) in both C and HF heifers.
However, total cholesterol was higher (P < 0.01) in the
HF group than in the C group (141 ± 3 and 105 ± 4 mg/
dL, respectively). Mean serum concentrations of insulin
were higher (P < 0.02) in the C light and HF heavy
heifers than in the HF light and C heavy heifers, 0.73
± 0.03 vs 0.63 ± 0.05, respectively. This dichotomy was
reflected by a significant (P < 0.02) diet × BW group in-
teraction.
Discussion
Age at puberty was not influenced significantly by
diet in this study, although a tendency for puberty to
be reached later in HF heavy heifers was observed.
Moreover, dietary-mediated changes in CLA production
and accretion did not effectively alter adiposity, and
serum concentrations of leptin were not reduced. Our
hypothesis was that diets high in linoleic acid would
lead to a reduction in adiposity and lowered leptin pro-
duction as a result of increased ruminal CLA production
and tissue accumulation of CLA. Had this hypothesis
been confirmed, age at puberty was expected to be de-

Table 3. Least squares means (± SEM) of major fatty acid percentages in longissimus muscle, subcutaneous fat, and
kidney, heart, and pelvic (KHP) fat from heifers receiving a control (n = 10) or high fat (n = 9) dieta
Longissimus muscle Subcutaneous fat KHP fat

Fatty acids Control High fat Control High fat Control High fat

14:0 2.17 ± 0.17 2.00 ± 0.18 3.30 ± 0.10 3.40 ± 0.20 4.10 ± 0.30y
2.20 ± 0.40z
16:0 24.70 ± 0.70y 21.20 ± 0.70z 25.80 ± 0.60y 22.60 ± 0.70z 27.40 ± 1.20y 18.70 ± 1.30z
16:1 2.60 ± 0.20y 1.80 ± 0.20z 5.80 ± 0.53y 2.10 ± 1.60z 2.10 ± 0.20y 0.70 ± 0.60z
18:0 17.20 ± 0.80y 20.00 ± 0.80z 10.90 ± 1.40y 18.50 ± 4.20z 30.40 ± 2.10y 40.60 ± 2.20z
18:1 34.40 ± 2.60y 27.60 ± 1.70z 42.10 ± 1.20 42.80 ± 1.30 27.20 ± 0.70 26.40 ± 0.70
18:2 7.10 ± 1.10y 11.40 ± 1.20z 2.20 ± 0.12y 3.10 ± 0.13z 2.30 ± 0.17y 3.40 ± 0.18z
18:3 ND ND 0.17 ± 0.30 0.15 ± 0.05 0.21 ± 0.04 0.27 ± 0.08
cis-9, trans-11
CLA ND ND 0.31 ± 0.08y 0.73 ± 0.09z 0.40 ± 0.04 0.40 ± 0.04
a
CLA = conjugated linoleic acid; ND = not detected.
Row means within tissue classifications with different superscripts differ (P < 0.05).
y,z

Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876

by University of Massachusetts user
on 04 July 2018
 Puberty in heifers fed fat 265

Figure 1. Mean serum concentrations of GH, IGF-I, leptin, and insulin (ng/mL), and total cholesterol (mg/dL) from
1) the onset of the experiment until slaughter (Panel I), and 2) normalized to the wk of puberty (Panel II) in the
control (C; n = 10) and high-fat (HF; n = 9) groups. Circulating GH and IGF-I decreased (P < 0.01) from 15 wk before
until puberty, and IGF-I was lower (P < 0.01) in the HF group. Serum insulin and total cholesterol increased (P <
0.01) over time, and total cholesterol was higher (P < 0.01) in the HF group. Serum leptin did not differ by diet, but
increased (P < 0.01) with time and as puberty approached.

Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876

by University of Massachusetts user
on 04 July 2018
 266 Garcia et al.

Table 4. Correlation coefficients and associated probabilities (in parentheses) among BW,
circulating concentrations of leptin, GH, IGF-I, insulin, and total cholesterol
from the onset of the study until postpubertal slaughter
BW, kg Leptin, ng/mL GH, ng/mL IGF-I, ng/mL Insulin, ng/mL Cholesterol, mg/dL

BW, kg 1.0 0.51 −0.35 −0.15 0.57 0.63

(0.0001) (0.0001) (0.0004) (0.0001) (0.0001)
Leptin, ng/mL 0.51 1.0 −0.23 −0.11 0.3 0.35
(0.0001) (0.0001)
GH, ng/mL −0.35 −0.23 1.0 0.04 −0.21 −0.23
(0.0001) (0.0001) (0.33) (0.0001) (0.0001)
IGF-I, ng/mL −0.15 −0.11 0.04 1.0 −0.19 −0.19
(0.0001) (0.006) (0.33) (0.0001) (0.0004)
Insulin, ng/mL 0.57 0.3 −0.21 −0.19 1.0 0.41
(0.0001) (0.0001) (0.0001) (0.0001) (0.0001)
Cholesterol, mg/dL 0.63 0.35 −0.23 −0.19 0.41 1.0
(0.0001) (0.0001) (0.0001) (0.0004) (0.0001)

layed. Frisch (1981) proposed that a critical percentage
of body fat is essential to the sexual maturation process
after observing a delay in pubertal development in ath-
letic, lean, young girls and an acceleration of the process
in obese girls. Similar observations have been made in
cattle where lean, lighter-weight heifers reached pu-
berty later than heavier heifers (Wiltbank et al., 1966;
Short and Bellows, 1971).
Mean serum concentrations of leptin increased as
puberty approached. This is consistent with observa-
tions reported by Garcia et al. (2002); however, no differ-
ences in mean concentrations of leptin were detected
between dietary groups. This is likely attributable to
similarities in the percentage of total carcass fat in the
HF and C heifers. Recent studies in monogastric species
have reported that CLA reduces adiposity, which re-
sults in a leaner carcass in rodents (West et al., 1998),
chickens (Szymczyk et al., 2001), and pigs (Dugan et
al., 1997). The fat-reducing effects of CLA are believed
to occur by preventing both the proliferation and lipo-
genic activity of adipocytes (Evans et al., 2000; Loor
and Herbein et al., 1998). Such action becomes optimal
when exposure to high concentrations of CLA occurs
during the early stages of development for an extended
period of time (Parodi, 1999).
In the current study, effects of HF diets on lipid me-
tabolism were obvious as shown by increased concentra-
tions of total cholesterol in serum and linoleic acid in
muscle and fat samples. Furthermore, the increase in
cis-9, trans-11 CLA content in subcutaneous adipose
tissue in HF heifers implies that more linoleic acid was
available for CLA production. Beaulieu et al. (2002)
observed a higher cis-9, trans-11 CLA content in subcu-
taneous adipose tissue compared to other fat depots
in steers; however, CLA content was not affected by
soybean oil supplementation, another rich source of li-
noleic acid. Contrasting effects of high linoleic acid diets
on tissue fatty acid composition in cattle may be due
to breed type and/or sex, as has been reported by Zem-
bayashi et al. (1995). A further indirect verification of
increased CLA production in the HF group of the cur-
rent work were the observed decreases in tissue content
of myristic, palmitic, and palmitoleic acids, which are
considered to be hallmarks of increased accumulation
of CLA in tissue (Loor and Herbein, 1998). In previous
reports, concentrations of CLA increased 109% in milk
fat obtained from Holstein cows receiving extruded oil-
seeds high in linoleic acid (Dhiman et al., 1999). More-
over, steers receiving diets high in linoleic acid had
a greater carcass content of CLA than steers fed low
quantities of linoleic acid (French et al., 2000). Although
CLA accumulation was greater in HF heifers in the
current experiment, the concentration clearly was in-
sufficient to promote marked reductions in total carcass
fat. Reports of the fat-reducing effects of CLA have
arisen mainly from experiments with monogastrics,
which were fed large doses of CLA directly, and in rumi-
nants receiving abomasal infusions of CLA. The latter
resulted in a 20% reduction in milk fat in Holstein cows
(Loor and Herbein, 1998). However, the infusion of an
equal amount of linoleic acid decreased milk fat by only
5%. This indicates that the accumulation of CLA from
biohydrogenation of linoleic acid in the rumen may not
be large enough to create significant effects on car-
cass adiposity.
Future efforts to manipulate CLA production in rumi-
nants through optimization of the approach described
herein may be problematic. Although increasing the
amount of dietary linoleic acid to levels greater than
that fed in the current study could potentially increase
CLA production, consumption of fats or oils in quanti-
ties greater than 5% of DM intake can markedly reduce
rumen fiber and protein digestibilities (Byers and
Schelling, 1988). Moreover, these problems are most
pronounced with diets high in polyunsaturated fatty
acids (Jenkins, 1993), which are necessary to produce
CLA isomers. Rumen digestibility problems can be
avoided to some degree by feeding whole oil seeds, such
as in the current study, where dietary added fat was
increased to 7% of DM. Whole oilseeds may slow the
release of oil into the rumen compared to other forms
of fat supplementation. Previously, we have fed cattle

Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876

by University of Massachusetts user
on 04 July 2018
 Puberty in heifers fed fat
up to 8% ether extract on a DM basis using whole cotton-
seed to manipulate metabolic and endocrine variables
and no obvious perturbations in rumen function were
apparent (Williams, 1989).
Many studies have shown that mature cows fed a
diet high in polyunsaturated fat exhibit an array of
metabolic, hormonal, and ovarian responses that can
enhance reproductive performance (See reviews by Wil-
liams, 1998; Williams and Stanko, 1999). Hence the
basis for using dietary fat supplementation in cattle
has traditionally focused on its positive benefits. Al-
though the goals of the current study were to gain in-
sight into the relative importance of adiposity and lep-
tin in pubertal development through dietary efforts to
reduce their presence, some of the same metabolic and
hormonal effects of high linoleic acid diets reported in
mature cows were expected also in heifers. These in-
clude increased total cholesterol, insulin, and GH in
serum. Except for total serum cholesterol, HF diets did
not affect these variables in the current study, although
paradoxically, serum IGF-1 was lower in HF compared
to control heifers. Therefore, the growing heifer appears
to represent a physiological state in which the typical
hormonal changes that are seen in mature cows are not
readily observed. Serum insulin increased in all groups
over time, which was expected, because circulating con-
centrations of insulin are positively associated with DM
and caloric intake (Bassett et al., 1971). Unlike insulin,
serum concentrations of GH and IGF-I, while increas-
ing early in the feeding period, declined throughout
much of the 10-wk period preceding puberty in the cur-
rent study. Circulating concentrations of IGF-I have
been reported to be important for sexual maturation
in rodents, primates, and heifers (Hiney et al., 1996;
Copeland et al., 1982; Armstrong et al., 1992). Immu-
nizing heifers against growth hormone-releasing hor-
mone resulted in a reduction in serum IGF-I and a
delay in age at puberty, suggesting that IGF-I may
be important to sexual maturation in cattle. However,
large variability exists in serum concentrations of IGF-
I in prepubertal heifers. Previous studies have reported
moderate increases in circulating concentrations of
IGF-I during pubertal development (Garcia et al., 2002;
Armstrong et al., 1992; Yelich et al., 1996). However,
Jones et al. (1991) reported that serum concentrations
of IGF-I in prepubertal heifers vary by breed after ob-
serving an increase in circulating IGF-I in prepubertal
Angus heifers, but a decrease in Charolais and Simmen-
tal heifers as puberty approached. It is possible that
maximal serum concentrations of GH and IGF-1 are
achieved in heifers at different times, depending upon
rates of growth and maturation as influenced by both
genetics and nutritional environment. As noted pre-
viously, overall concentrations of IGF-I were lower in
HF compared to C heifers, a result that was not accom-
panied by a reduction in GH and a relationship not
observed previously in mature cows (Williams, 1998).
Collectively, our data indicate that feeding diets high
in linoleic acid to developing heifers does not result in
Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876
by University of Massachusetts user
on 04 July 2018
267
altered carcass adiposity or a delay in puberty. More-
over, the previously reported metabolic and ovarian
effects that are the hallmark of polyunsaturated fat
supplementation in mature cows probably do not apply
to the developing, prepubertal heifer.
Implications
High-fat diets (5 to 7% added fat) containing large
quantities of linoleic acid do not appear to increase age
at puberty nor reduce total carcass fat and serum leptin
in developing heifers, despite increases in conjugated
linoleic acid tissue accumulation. Therefore, this nutri-
tional model is not likely to contribute to our under-
standing of the roles of adiposity and leptin in sexual
maturation. Viewed from an opposing perspective, the
positive benefits on reproduction that have been ob-
served repeatedly in mature cows fed diets high in poly-
unsaturated fats are not apparent as they relate to
factors that could decrease age at puberty.
References
Allain, C. A., L. S. Poon, C. S. G. Chan, W. Richmond, and P. C. Fu.
1974. Enzymatic determination of total serum cholesterol. Clin.
Chem. 20:470–472.
Amstalden, M., M. R. Garcia, R. L. Stanko, S. E. Nizielski, C. D.
Morrison, D. H. Keisler, and G. L. Williams. 2002a. Central
infusion of recombinant ovine leptin normalizes plasma insulin
and stimulates a novel hypersecretion of luteinizing hormone
after short-term fasting in mature beef cows. Biol. Reprod.
66:1555–1561.
Amstalden, M., M. R. Garcia, S. W. Williams, R. L. Stanko, S. E.
Nizielski, C. D. Morrison, D. H. Keisler, and G. L. Williams.
2000. Leptin gene expression, circulating leptin, and luteinizing
hormone pulsatility are acutely responsive to short-term fasting
in prepubertal heifers: relationships to circulating insulin and
insulin-like growth factor I. Biol. Reprod. 63:127–133.
Amstalden, M., D. A. Zieba, J. L. Gallino, S. Morton, J. F. Edwards,
P. G. Harms, T. H. Welsh Jr., R. L. Stanko, D. H. Keisler, and
G. L. Williams. 2002b. Leptin modulates basal secretion of LH
and enhances gonadotroph responsiveness to GnRH in adenohy-
pophyseal explants from fasted cows. Biol. Reprod. (Suppl.
1)66:451 (Abstr.).
Armstrong, J. D., R. L. Stanko, W. S. Cohick, R. B. Simpson, R. W.
Harvey, B. G. Huff, D. R. Clemmons, M. D. Whitacre, R. M.
Campbell, and E. P. Heimer. 1992. Endocrine events prior to
puberty in heifers: role of somatotropin, insulin-like growth fac-
tor-I and insulin-like growth factor binding proteins. J. Physiol.
Pharm. 43:179–193.
Bassett, J. M., R. H. Watson, and J. P. Hogan. 1971. Dietary regula-
tion of plasma insulin and growth hormone concentration in
sheep. Aust. J. Biol. Sci. 24:321–325.
Beaulieu, A. D., J. K. Drackley, and N. R. Merchen. 2002. Concentra-
tions of conjugated linoleic acid (cis-9, trans-11-octadecadienoic
acid) are not increased in tissue lipids of cattle fed a high-concen-
trate diet supplemented with soybean oil. J. Anim. Sci.
80:847–861.
Byers, F. M., and G. T. Shelling. 1988. Lipids in ruminant nutrition.
Pages 298–310 in The Ruminant Animal: Digestive Physiology
and Nutrition. D. C. Church, ed. Prentice-Hall, Inglewood
Cliffs, NJ.
Copeland, K. C., T. J. Kuehl, and V. D. Castracane. 1982. Pubertal
endocrinology of the baboon: elevated somatomedin-C/insulin-
like growth factor I at puberty. J. Clin. Endocrinol. Metab.
55:1198–1201.
 268 Garcia et al.
Cunningham, M. J., D. K. Clifton, and R. A. Steiner. 1999. Leptin’s
action on the reproductive axis: perspectives and mechanisms.
Biol. Reprod. 60:216–222.
Delavaud, D., F. Bocquier, Y. Chilliard, D. H. Keisler, A. Gertler, and
G. Kann. 2000. Plasma leptin in ruminants: effect of nutritional
status and body fatness of plasma leptin concentrations assessed
by a specific RIA in sheep. J. Endocrinol. 165:519–526.
Dhiman, T. R., E. D. Helmink, D. J. McMahon, R. L. Fife, and M.
W. Pariza. 1999. Conjugated linoleic acid content of milk and
cheese from cows fed extruded oilseeds. J. Dairy Sci. 82:412–419.
Dugan, M. E. R., J. L. Aalhus, A. L. Schaefer, and J. K. G. Kramer.
1997. The effects of conjugated linoleic acid on fat to lean reparti-
tioning and feed conversion in pigs. Can. J. Anim. Sci.
77:723–725.
Evans, M., C. Geigerman, J. Cook, L. Curtis, B. Kuebler, and M.
McIntosh. 2000. Conjugated linoleic acid suppresses triglyceride
accumulation and induces apoptosis in 3T3-L1 preadipocytes.
Lipids 35:899–910.
Fajersson, P., R. L. Stanko, and G. L. Williams. 1999. Distribution
and repeatability of anterior pituitary responses to GnRH and
relationship of response classification to the postpartum anovu-
latory interval of beef cows. J. Anim. Sci. 77:3043–3049.
Folch, J., M. Lees, and G. H. Sloane-Stanley. 1957. A simple method
for the isolation and purification of total lipids from animal
tissues. J. Biol. Chem. 226:497–499.
French, P., C. Stanton, F. Lawless, E. G. O’Riordan, F. J. Monahan,
P. J. Caffrey, and A. P. Moloney. 2000. Fatty acid composition,
including conjugated linoleic acid, of intramuscular fat from
steers offered grazed grass, grass silage, of concentrate-based
diets. J. Anim. Sci. 78:2849–2855.
Frisch, R. E. 1981. Nutrition, fatness, puberty, and fertility. Nutrition
7:15–23.
Garcia, M. R., M. Amstalden, S. W. Williams, R. L. Stanko, S. E.
Nizielski, C. D. Morrison, D. H. Keisler, and G. L. Williams. 2002.
Serum leptin and its adipose gene expression during pubertal
development, the estrous cycle, and different seasons in cattle.
J. Anim. Sci. 80:2158–2167.
Hankins, O. G. 1946. Estimation of the composition of beef carcasses
and cuts. Pages 1–55 in Technical Bulletin No. 926. U.S. Dept.
of Agric., Washington, DC.
Hiney, J. K., V. Srivastava, C. L. Nyberg, S. R. Ojeda, and W. L.
Dees. 1996. Insulin-like growth factor I of peripheral origin acts
centrally to accelerate the initiation of female puberty. Endocri-
nology 137:3717–3728.
Jenkins, T. C. 1993. Lipid metabolism in the rumen. J. Dairy Sci.
76:3851–3863.
Jones, E. J., J. D. Armstrong, and R. W. Harvey. 1991. Changes
in metabolites, metabolic hormones, and luteinizing hormone
before puberty in Angus, Braford, Charolais, and Simmental
heifers. J. Anim. Sci. 69:1607–1615.
Downloaded from https://academic.oup.com/jas/article-abstract/81/1/261/4789876
by University of Massachusetts user
on 04 July 2018
Loor, J. J., and J. H. Herbein. 1998. Exogenous conjugated linoleic
acid isomers reduce bovine milk fat concentration and yield by
inhibiting de novo fatty acid synthesis. J. Nutr. 128:2411–2419.
Medina, E. A., W. E. Horn, N. L. Keim, P. J. Havel, P. Benito, D. S.
Kelley, G. J. Nelson, and K. L. Erickson. 2000. Conjugated lino-
leic acid supplementation in humans: effects on circulating leptin
concentrations and appetite. Lipids 35:783–788.
Nagatani, S., Y. Zeng, D. H. Keisler, D. L. Foster, and C. A. Jaffe.
2000. Leptin regulates pulsatile luteinizing hormone and growth
hormone secretion in the sheep. Endocrinology. 141:3965–3975.
NRC. 1984. Pages 90–110 in Nutrient Requirements of Beef Cattle.
6th ed. Natl. Acad. Press, Washington, DC.
Parodi, P. W. 1999. Conjugated linoleic acid and other anticarcino-
genic agents of bovine milk fat. J. Dairy. Sci. 82:1339–1349.
Ryan, D. P., B. Bao, M. K. Griffith, and G. L. Williams. 1995. Metabolic
and luteal sequalae to heightened dietary fat intake in under-
nourished, anestrous beef cows induced to ovulate. J. Anim. Sci.
73:2086–2093.
Short, R. E., and R. A. Bellows. 1971. Relationships among weight
gains, age at puberty and reproductive performance in heifers.
J. Anim. Sci. 32:127–131.
Slover, H. T., and E. Lanza. 1979. Quantitative analysis of food fatty
acids by capillary gas chromatography. J. Am. Oil Chem. Soc.
56:933–935.
Szymczyk, B., P. M. Pisulewski, W. Szczurek, and P. Hanczakowski.
2001. Effects of conjugated linoleic acid on growth performance,
feed conversion efficiency, and subsequent carcass quality in
broiler chickens. Br. J. Nutr. 85:465–473.
West, D. B., J. P. Delany, P. M. Camet, F. Blohm, A. A. Truett, and
J. Scimeca. 1998. Effects of conjugated linoleic acid on body fat
and energy metabolism in the mouse. Am. J. Physiol.
44:R667–R672.
Williams, G. L. 1989. Modulation of luteal activity in postpartum beef
cows through changes in dietary lipid. J. Anim. Sci. 67:785–793.
Williams, G. L. 1998. Fat, follicles and fecundity: The ruminant para-
digm. Pages 163–179 in Nutrition and Reproduction. W. Hansel
and G. Bray, ed. Louisiana State Univ. Press, Baton Rouge.
Williams, G. L., and R. L. Stanko. 1999. Dietary fats as reproductive
nutraceuticals in cattle. Proc. Am. Soc. Anim. Sci. Available:
http://www.asas.org. Accessed January 18, 2000.
Wiltbank, J. N., K. E. Gregory, L. A. Swiger, J. E. Ingalls, J. A.
Rothlisberger, and R. M. Koch. 1966. Effects of heterosis on age
and weight at puberty in beef heifers. J. Anim. Sci. 25:744–751.
Yelich, J. V., R. P. Wettemann, T. T. Marston, and L. J. Spicer. 1996.
Luteinizing hormone, growth hormone, insulin-like growth fac-
tor-I, insulin and metabolites before puberty in heifers fed to
gain at two rates. Domest. Anim. Endocrinol. 13:325–338.
Zembayashi, M., K. Nishimura, D. K. Lunt, and S. B. Smith. 1995.
Effect of breed type and sex on the fatty acid composition of
subcutaneous and intramuscular lipids of finishing steers and
heifers. J. Anim. Sci. 73:3325–3332.
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/303852996

Strategies for attaining early puberty in cattle and buffalo: A review

Article  in  Agricultural Reviews · June 2016

DOI: 10.18805/ar.v37i2.10741

CITATIONS READS
15 13,309

6 authors, including:

Shailesh Kumar Gupta Pawan Singh Dabas

Indian Institute of Technology Roorkee National Dairy Research Institute
27 PUBLICATIONS   89 CITATIONS    66 PUBLICATIONS   414 CITATIONS   

SEE PROFILE SEE PROFILE

Shabir Ahmad Lone Narendra Kumar

54 PUBLICATIONS   344 CITATIONS   
Shaheed Mangal Pandey Government Girls Post Graduate College Madhavpuram Me…
25 PUBLICATIONS   78 CITATIONS   
SEE PROFILE
SEE PROFILE

Some of the authors of this publication are also working on these related projects:

SEMEN SEXING IN CATTLE View project

animal behaviour and semen technology View project

All content following this page was uploaded by Anshuman Kumar on 14 February 2017.

The user has requested enhancement of the downloaded file.

Agricultural Reviews, 37 (2) 2016 : 160-167 AGRICULTURAL RESEARCH COMMUNICATION CENTRE
Print ISSN:0253-1496 / Online ISSN:0976-0539 www.arccjournals.com

Strategies for attaining early puberty in cattle and buffalo: A review

Shailesh Kumar Gupta*, Pawan Singh, Kuladip Prakash Shinde, Shabir Ahmad Lone1,
Narendra Kumar and Anshuman Kumar2
Division of Livestock Production and Management,
ICAR-National dairy Research Institute, Karnal- 132001, India.
Received: 17-03-2016 Accepted: 28-05-2016 DOI: 10.18805/ar.v37i2.10741
ABSTRACT
Puberty is a period at which sexually organs are functionally developed and animals become able to release the gametes. A
cow maturing at early age will also calve at early age and produces more milk in her life time. Delayed sexual maturity has
a profound effect on the economics of dairy farm. The objective of this review is to study factors affecting age at puberty.
Many factors like species, genetic potentiality or breed, plane of nutrition, growth, body weight, role of different hormones,
health and other managemental conditions are responsible for the growth, puberty and sexual maturity in animals. Age at
puberty can be improve by different practices but the environment improvement and new nutritional practices are more
effective. New modern hormonal technologies, proper management, housing, feeding system of the dairy animals can also
reduce the age of puberty and sexual maturity.
Key words: Biostimulation, Energy, Growth rate, Photoperiod, Protein, Sexual maturity.
Abbreviations: E2 = estradiol; CL=corpus luteum, GRF =Growth hormone releasing factor, LH=luteinizing hormone,
DMI= dry matter intake, GH=growth hormone.
Puberty is the period when the sexual organs are 46 months (Bashir, 2006). In the tropical condition the age
functionally developed. Puberty in heifers is characterized at puberty in Bos indicus range between 16 and 40 months
by first ovulation and plasma progesterone concentrations (Mc Dowell et al., 1976). The Indian buffalo (Bubalus
above 1 ng/ml (Evans et al., 1995). Sexual maturity is the bubalis) attain puberty between 16 to 40 month but the
stage when the animal is able to express its full reproductive average time is over 2.5 years of age (CIRB Annual Report,
potential. Sexual maturity in males is characterized by sperm 1999–2000). Murrah attain puberty as late as an average
ejaculate that contains minimum 50 million spermatozoa with age of 33 months (NDRI Annual Report, 1995–1996), Nilli
minimum of 10% motile sperm (Wolf et al., 1965). The onset Ravi at 32.5 months (Naqvi and Shami, 1999) and Surti at
of puberty is the result of a series of complex events that 45.5 months of age (Sule et. al., 2001). Postnatal growth
occur within the reproductive endocrine system (Foster et plays an important role in the performance of the dairy
al. 1994). A cow maturing at early age will produce more animals.
milk in her whole life time. Delayed puberty in cattle and Genetics and Breed : Genetic selection is not an effective
buffalo is a major problem in the dairy industry. Heifers tool as other environment managemental approaches are
calved at 540 kg were more economical than those at 620 kg necessary for early puberty. Age of puberty is moderately
(Dawson and Carson, 2004). Rauw et al. (1998) reported heritable and in cattle it ranges between 0.16 to 0.57
that modern reproduction and DNA-techniques in animal (Martinez-Velazquez et al., 2003). Nogueira (2004)
breeding programme may result in physiological, suggested that selection of heifers should be based on age at
behavioural, and immunological problems in animals. Many first calving and recommended crossbreeding between Zebu
factors like species, genetic potentiality, plane of nutrition, and Bos taurus cattle for early puberty in zebu cattle. He
growth, body weight, role of different hormones, health and also suggested for consideration of environmental effect for
other management conditions have a direct or indirect effect early puberty in zebu cattle. Zebu cattle are famous for
on growth, puberty and sexual maturity in animals (Figure disease resistance and better feed utilization with low
1). Among all factors, body weight at early age has an management requirement than exotic animals. Naz and
important role on life time performance of animals including Ahmad. (2006) reported a low correlation between maturity
production and reproduction. age and weight at first conception in Nili-Ravi buffalo. He
Age of the animal : Average age of puberty in cow heifers also reported a genetic correlation for age at maturity with
is between 37 and 34 months but Sahiwal attain puberty at weight at maturity, age at first conception were 0.49 and
*Corresponding author’s e-mail: sgshailesh786@gmail.com. 1Division of Animal Reproduction Gynaecology and Obstetrics.
2
Division of Dairy Cattle Breeding, National Dairy Research Institute, Karnal- 132001, Haryana, India.
 Volume 37 Issue 2 (2016)
Fig 1: Endocrine mechanism during onset of puberty and several factors affecting interval to puberty onset (Source: Adapted and
modified from Williams and Amstalden, 2010)
0.88, respectively. Thyroid hormones have a great role in
the metabolism and cell growth in the body. Fernandez et al.
(2014) reported a significant association (P < 0.05) between
single nucleotide polymorphisms (SNPs) markers and
puberty in Angus bulls. So this marker is good indicator for
puberty in animals. In case of males scrotal circumference
is an important criterion for selection because it is highly
heritable and related to reproductive performance (Gressler
et al., 2000). During the under nutrition Neuropeptide Y
(NPY) is responsible for low secretion of luteinizing
hormone (LH). Leptin has an important role in suppression
of Neuropeptide Y (NPY). Vaiciunas et al. (2008) reported
a lower NPY-Y1 and NPY-Y4 expression had a regulating
role for puberty in early-maturing Bos indicus heifers. Heifer
selection should based on good health condition, structurally
large body size and puberty at early age.
Growth and body weight: Maturity of the heifer depends
on the body weight rather than age. Lower growth rate occurs
due to underfeeding or imbalanced feed composition. Birth
weight also affects growth rate and age at puberty. Many
genetic and non-genetic factors are responsible for body
growth in animals. Genetic factors along with nutrition,
hormones, animals’s individuality and many other factors
determine the growth of animals. Feeding high energy or
high concentrate diets not only reduce the age of sexual
maturity but also lowers the time period for attaining the
age of first calving. Buffalo heifers reared on seasonal green
forages and crop residues resulting in poor growth rates and
delayed onset of puberty (Bhatti et al., 2007). The body
weight gain may have a greater influence on onset of puberty
161
(Wiltbank et al., 1966). About 60 to 65% of mature body
weight may be a standard during the starting breeding season
in heifers (Endecott et al., 2013). Da Luz et al. (2012)
reported that Murrah buffalo reached sexual maturity at 2
year of age and at this time sperm production is 13 million
sperm per gram of testis. The monthly weight gain was faster
upto 3 month of age and slower from 3 to 6 month of age in
case of swamp buffalo (Das, 2004) and Murrah buffalo. A
particular body weight has a role in attainment of puberty
(Lemond, 1970) and a low body weight causes delay in onset
of puberty (Maquivar et al., 2006). During the early phase
of life, body’s cells and parenchyma cells of the mammary
gland develop very fast than the late phase of life. However,
over conditioned animals presently facings many health
related problems resulted in poor productive and
reproductive performance.
Nutritional management: Balanced feeding and improved
management can be helpful in better growth and early sexual
maturity (Heinrichs et al., 2005). The first important factor
that affects age of maturity is the plan of nutrition (Poy and
Panday, 1971). Delay in puberty also occurs due to
inadequate supply of feed and essential nutrition during the
early growing period. But some authors reported that a pre-
determined body size at which puberty will occur within each
specific breed (Oyedipe et al., 1982). The onset of puberty
at the early stage (between 4 and 6.5 months of age) occurs
due to high plan of feeding (Gasser et al., 2006). Colostrum
is essential at early age of life to provide the natural immunity
to the newborn calves. At the starting stage colostrum feeding
through the bottle leads to higher intake rate than the pail
162 AGRICULTURAL REVIEWS
feeding (Smijisha and Kamboj, 2012). A good quality calf
starter should contain 18% crude protein and 3.0 Mcal/Kg
metabolizable energy (NRC, 2001). Khan et al. (1992)
worked on the Sahiwal calves and reported that the restricted
suckling calves gained live weight 49% faster with 80%
improvement in efficiency of converting milk into live
weight. Similar observations were reported by the Bwire et
al. (1996) in Zebu heifers, they reported that restricted
suckling tended to gain more body weight (g/day) than the
than those on artificial rearing system. Contrary to this report
Crabtree. (1967) reported that pre-weaning management
system had no significant effect on growth performance.
Nanda et al. (2003) observed that better nutrition reduces
the age of maturity in buffalo heifers. Shatavari (Asparagus
racemosus) can be used as a feed supplement for growth
and puberty in dairy animals. It has anti-stress properties
(Kumar et al., 2008) and causes early puberty and increase
in weight of ovaries, uterus and teats in female (Sharma,
2011). Feeding of Shatavari @150mg/kg BW/day has
significant effect on attaining higher average daily gain, early
attainment of puberty and age at first service in Sahiwal
heifers (Jamara et al., 2014) (Table 1).
Proteins and energy are most critical nutrients
influencing the growth of calves. High level of nutrition is
essential during the growth period in the buffalo calves but
the cattle calves require low level of protein than the buffalo
calves (Basra et al., 2003). Contrary to this report Fluharty
and Loerch. (1995) reported that higher protein concentrate
mixture supplementation did not increase the growth rate.
According to NRC (2001), heifers fed with dietary level of
ME 124% gained higher growth rate than on other diets.
Anjum et al. (2014) worked on the Sahiwal heifers with Stair-
Step Feeding (consists of two rations having 20% below or
20% above of NRC energy levels) and reported that 100 %
of animal came in puberty at 22 months of age than control
(83%). Fiaz et al. (2012) reported that high dietary energy
level (ME 124% of NRC) enhanced the growth parameter
but adequate performance of Sahiwal heifers in terms of age
of puberty was achieved even at low lower dietary energy
level (ME 88% of NRC). The feed conversion efficiency
was higher when the Sahiwal heifers were fed with the extra
dietary energy than the recommendations of NRC (2001).
He also reported that age of sexual maturity, age at
conception and serum progesterone level were not influenced
by the different dietary energy level. The supplementation
of different energy levels in the diet of heifers is an effective
key for the optimum growth rate from 13 to 18 month of
Table 1: Effect of Shatavari (Asparagus racemosus) supplementation on growth, Puberty and age of first service in Sahiwal heifers
(Source: Jamara et al., 2014).
Group DMIKg/d Growth rate (G/Day) GHng/ml
Control 4.70 ± 0.09 223.26 5.41± 0.15
Treatment 5.35 ± 0.18 345.34 6.33 ±0.11
age. The diet containing 16% protein and 3.0Mcal/kg energy
is sufficient for the growth of red Sindhi calves (Javaid et
al., 2014). The diet with proper concentration of nutrients
reduces the age of maturity in buffalo heifers. The animals
fed with green fodder along with of 2.0 Kg concentrate ration
reach maturity earlier (727.77 ± 44.17 days) than the control
group (993.33 ± 68.78 days) (Rafiq et al., 2008).
Animals require specific minerals for the growth
and skeleton development. The supplementation of minerals
(Chaudary et al., 1991) and UMMB (urea molasses mineral
blocks) (Garg et al., 1990) may be associated with early
maturity. Phosphorus is involved in the many metabolic
process and cellular metabolism in the body (Rasby et al.,
1998), VFAs concentrations and bacterial population in the
rumen (Zain et al., 2010). Previous studies revealed that
optimal growth rates can be achieved when diets containing
P level from 0.20% to 0.22% of DM (Tillman et al., 1959),
0.33% to 0.40% of dietary P concentration (Ferguson and
Sklan, 2005) and Ca to P from 1:1 to 7:1 (Wise et al., 1963).
Anjum et al. (1996) reported that the ration containing 0.75%
Ca and 0.31% P on dry matter basis with Ca: P ratio 2.5:1 is
more suitable for better weight gain in Nili-Ravi buffalo.
Niacin plays a critical role in mitochondria respiration and
the metabolism of carbohydrate, lipids and amino acids. Oral
administration of niacin has resulted in increased microbial
protein synthesis and higher weight gain in growing animals
(Flachowsky, 1993). Contrary to this observation, Kumar et
al. (2006) reported that supplementation of niacin at 100
and 200 ppm in the diet of buffalo calves had no significant
effect on their growth and nutrient utilization. Use of higher
levels of vitamin E in the diet improves the growth and
skeleton development in the calves.
Hormones: Key factor for puberty: The fundamental
requirement for the onset of puberty is the secretion of a
gonadotropin releasing hormone (GnRH) from the
hypothalamus which stimulates release of gonadotropin
hormone i.e. luteinizing hormone (LH). GnRH plays an
important role in the regulating secreation of LH, follicular
development, and secretion of steroid hormones (Figure 1).
Madgwick et al. (1995) worked to know the effect of GnRH
on sexual puberty in heifer calves from 4 to 8 weeks of age
and concluded that GnRH treated heifers reached puberty
earlier than control heifers (56.8 ± 1.7 vs. 62.8 ± 2.4 weeks)
with high level of LH hormone (0.58 ±0.06 ng/ml vs. 0.41±
0.02 ng/ml) and greater number of LH pulses (2.0± 0.19 vs.
1.32± 0.12 pulses per 10 h.) than the control. The changes
in the metabolic status cause changes in metabolic hormones
Age of Puberty(Days) Age at First Service (Days)
739.66 ± 19.17 846.10 ± 24.0
713.60 ± 16.10 817.40 ± 20.37
 Volume 37 Issue 2 (2016) 163
Table 2: GRF induced growth and puberty in Murrah female buffalo (Source: Haldar and Prakash, 2006)
Group(n=6) bGFR / 15 days Body weight at Puberty at GH LH
puberty (kg) days concentration Concentration
A 10 µg/100 kg. body weight 380.67±6.42 887.5±17.5 19.4±0.5 ng/ml 0.71±0.02ng/ml
B 0.9 Nacl/100 kg. body weight 371.50±8.16 946±26.3 16.8±0.3ng/ml 0.69±0.02 ng/ml

leading to the onset of puberty. In case of bull calves
increased level of LH causes early age of puberty (Evans et
al., 1995), testicular development (Chandolia et al., 1997)
and increased spermatogenesis cycle (Rawlings and Evans,
1995). Growth hormone (GH) has important role in growth
and development during postnatal life. Growth hormone
releasing factor (GRF) has an important role for activity of
hypothalamus–pituitary–gonadal axis. Haldar and Prakash.
(2006) worked on the Murrah buffalo with administration
of 10 µg/100 kg body bGRF (Bovine gonadotropin releasing
factor) to each animal and reported that GRF has a significant
effect on the body weight, plasma progesterone
concentrations and onset of puberty. Effect of GRF on GH
and LH concentration and age at puberty are presented in
Table 2. Buffalo heifers treated with bovine growth hormone-
releasing factor (bGRF) showed puberty onset at an age of
887.5 ± 17.5 days (Mondal and Prakash, 2004).
Plasma Insulin like growth factor I (IGF-I) has
important role in regulation of cell growth, cell
differentiation, cell function and immune function. Many
authors reported about the role of IGF- I in growth of the
cattle (Ortega et al., 2008; Lancaster et al., 2008). Laxmi et
al. (2014) used fermented yeast culture (Saccharomyces
cerevisiae) which stimulated IGF- I for growth of ruminal
bacteria in low body weight Murrah buffalo calves. This is
due to increasing FCE (feed conversion efficiency) and
digestibility of essential nutrients. Long term administration
of GRF causes faster growth in buffalo calves resulted in
higher body weight due to increase plasma LH level (Mondal
and Prakash, 2004). Progestogens have a role in initiation
of oestrus and ovulation in prepubetral heifer. It is due to
enhanced luteal function and stimulation of endocrine
system. Polat. (2009) reported that PRID (progesterone
releasing intravaginal device) 1.55 g of progesterone and
10 mg of oestradiol benzoate is effective on delayed pubertal
heifer. Gulia et al. (2010) reported that the animals secreted
high level of testosterone during the early growth period for
attaining the early sexual maturity. So maintenance of
testosterone during early phase of life is important. Leptin
hormone produced mainly by adipose tissue has a role on
onset of puberty, energy balance and feed intake. Vaiciunas.
(2008) reported a higher leptin level regulates puberty in
early-maturing Bos indicus heifers. Hormonal
supplementation is helpful to reduce the age of sexual
maturity in the Indigenous cattle and buffalo.
Photoperiod : Photoperiod can alter long-term physiological
processes, particularly reproduction and production. Long-
day photoperiod hasten puberty and accelerates lean growth
in dairy heifers. Perera et al. (1989) reported that light has
no effect on growth (16.2 kg. vs. 20.8 kg.) but higher
progesterone (0.41ng/ml vs. 0.19) and high prolactin level
was observed in case of Surti buffalo. Long day photoperiod
(LDPP) treated calves tended to have higher mean
concentrations of PRL relative to SDPP (short day
photoperiod) animals (11 ng/ml vs 5 ng/ml) (Rius et al.,
2005). LDPP causes decline in the levels of melatonin which
is important for the reproductive performance in the animals
(Walker et al., 1996). Kassim et al. (2008) worked on the
buffalo heifers, divided animals into two groups as G1 for
long photoperiod in which heifers were exposed daily 16
hours of light and 8 hours darkness per day. The second
group (G2) consisted of natural photoperiod of 8 hours light
and 16 hours darkness daily. They reported that animals in
G1 had higher values in live body weight than G2 at puberty
and first ovulation (Table 3).
Climatic effect: Variation of the season has an important
role in the body weight of the animals. A positive relationship
was observed between season and onset of puberty. Winter
season is favorable for early puberty in dairy animals. The
non-significant effect of season was observed in swamp
buffalo at 6 month of age but significant effect was observed
from 7 to 12 month of age (Das, 2004). Zaman (1996) also
found a non significant effect of season on the body weight.
During initial six month of life autumn and winter season
has a positive effect for early weight gain and puberty. Effect
of season is related with managemental and nutritional
practices. Penchev et al. (2014) reported lower calving age
in the heifers born in summer and autumn in Bulgarian
Murrah heifers.
Exposure to male: Biostimulation or male effect is the
stimulus provoked by the presence of males, which induces
estrus and ovulation through genital stimulation, pheromones
Table 3: Effect of photoperiod on dry matter intake (DMI), total
digestible nutrition (TDN), age and weight at puberty and first
ovulation (Source: Kassim et al., 2008)
Items Experimental Groups
G1 G2
DM intake (kg) 13.2±0.3 12.8±0.2
TDN intake (kg) 7.1±0.1 7±0.1
Age of puberty (months) 10.5±0.2b 11.7±0.4a
Weight at puberty (kg) 208.0±11.2 201.1±10.2
Age at first ovulation (months) 12.6±0.1b 13.3±0.2a
Weight at first ovulation (kg) 248.6±11.6 239.8±10.2
164 AGRICULTURAL REVIEWS
or other external cues (Tiwari et al., 2014). Biostimulation
is helpful for early puberty in males and females. Heifers
exposed to bulls attained puberty at an earlier age than heifers
that were not exposed to bulls. Presence of a vasectomised
bull has been reported to hasten the onset of puberty in heifers
(Rekwot et al., 2001). Roberson et al. (1991) reported that
more number of heifers exposed to bulls came in puberty
earlier than the non exposed heifers (61.8 % vs. 45.4%).
Izard et al. (1982) reported that the urine treated heifers came
in puberty earlier than the control group (222 ± 4.9 days vs.
277 ± 5.0 days). Biostimulation may be effective and
economic tool to boost sexual maturity in animals. The
knowledge of effectiveness, conditions and procedure are
important for successful implementation.
CONCLUSION
Age at puberty and sexual maturity are important
economic traits. Many factors are directly or indirectly
related to age at puberty in dairy animals. Huge economic
losses have been related to delayed puberty. Among the all
factors affecting age at puberty, nutritional is most important.
Higher correlations have been observed between age at
puberty and body weight. This can be achieved by proper
nutrition than other factors. For early puberty, heifer must
be fed properly to get a sufficient weight for puberty at
recommended time. So nutritional management should be
given priority for reducing age at puberty. Use of green
fodders along with mineral mixture reduces the age of
puberty and maintains the proper growth. The Ca to P should
be supplemented at the ratio of 1:1 to 2.5. Long-day
photoperiod hastens growth and sexual maturity in the dairy
animals. Diet containing balanced energy and protein
concentration helps in proper growth and puberty. The use
of herbal preparation like Shatavari @ 150mg/kg BW/day
has significant effect on growth and sexual maturity.
Application of new knowledge and modern technologies are
necessary for growth and reproductive management for dairy
animals.

REFERENCES
Anjum, M. I., Mirza, I. H. and Saghar, M. S. (2014). Effects of compensatory growth on puberty age in Sahiwal cattle
heifers fed low followed by high energy based total mixed rations. The J Anim Plant Sci., 24: 20-23.
Anjum, M.I., Mirza, I.H., Begum, I.and Javaid, S. (1996). Effects of varying levels of calcium in rations for buffalo
(bubalus bubalis) calves on growth rate and nutrient digestibility. The J Anim Plant Sci., 24: 24-29.
Bashir, M. K., (2006). Genetic and phenotypic aspects of some performance traits of Nili-Ravi buffaloes in Pakistan. Ph.
D. Thesis. Univ. Agri., Faisalabad, Pakistan.
Basra, M. J., Khan, M. A., Nisa, M., Riaz, M., Tuqueer, N. A. and Saeed, M. N. (2003). Energy and Protein requirements
of 6-9 months old calves.Int J Agric Biol. 5 : 377-379
Bhatti, S. A., Sarwar, M., Khan, M. S. and Hussain, S. M. I., (2007). Reducing the age at first calving through nutritional
manipulations in dairy buffaloes and cows: A Review. Pakistan Vet. J., 27: 42-47
Bwire, J. M. N., and H. Wiktorsson.(1996). Pre weaning nutrition management and dry season nutrition supplementation
on intake, growth and onset of puberty of improved zebu heifers. Livest. Prod. Sci., 46:229-238.
Chandolia, R.K., Rawlings, N.C. and Evans, A.C .(1997). Effect of inhibition of increased gonadotrophin secretion before
20 weeks of age in bull calves on testicular development. J Reprod Fertil 109:65–71.
Chaudhry, M. A., Asghar, A. A. and Ahmad, M. (1991). Productive and reproductive performance of Nili- Ravi buffalo
heifers as influenced by mineral and concentrates mixture. Buffalo J., 1: 41-49.
CIRB (Central Institute for research on Buffalo) (1999-2000). Buffalo performance at CIRB. Annual Report. pp-14.
Crabtree, J.R. (1967). The effect of age and previous nutrition on voluntary feed intake of roughage-concentrate diets by
sheep. Anim. Prod., 9: 275.
Da Luz, P. A.C., Andrighetto, C., Santos, P. R.S., Jorge, A., Constantino, M. V. P., Flavia, P., T.V., Mess, A. and Neto,
A. C. A. (2012). Daily sperm production and evaluation of morphological reproductive parameters of Murrah buffaloes in
an extensive breeding system. Spermatogenesis 2:88-93.
Das, A., Das, D., Goswami, R.N. and Bhuyan, D. (2004). Growth performance of swamp buffaloes of Assam from birth to
12 months of age. Buffalo Bull, 23: 4
Dawson, L. E. R.; Carson, A. F. (2004): Management of the dairy heifer. Cattle Practice.12:181-192.
Endecott, R.L., R.N. Funston, J.T. Mulliniks, and A.J. Roberts. (2013). Implications of beef heifer development systems
and lifetime productivity. J. Anim. Sci, 91:1329-1335.
Evans, A.O., Davis, F.J., Nasser, L.F., Bowman, P., Rawlings, N.C. (1995).Differences in early patterns of gonadotrophin
secretion between Early and Late Maturing bulls, and changes in semen characteristics at puberty. Theriogenology,
43:569–78.
 Volume 37 Issue 2 (2016) 165
Ferguson, J.D. and Sklan, D. (2005). Effects of dietary phosphorus and nitrogen on cattle reproduction, in nitrogen and
phosphorus nutrition of cattle, [ E. Pfeffer and A. Hristov, ed.] CABI Publishing, Wallingford, Oxfordshire, UK.
Fernández, M. E, Goszczynski, D. E., Prando A. J., Peral-García, P., Baldo, A., Giovambattist, G., and Liron, J. P. (2014).
Assessing the association of single nucleotide polymorphisms in thyroglobulin gene with age of puberty in bulls.
J. Anim. Sci. Technol , 56:17
Fiaz, M., Abdullah, M., Ali, A., Pasha, T.N., Jabbar, M. A., Babar, E.M., Bhatti J.A. and Nasir, M. (2012). Evaluation
varying dietary energy levels for optimum growth and early puberty in Sahiwal heifers. Pakistan J. zool.,
44:625-634.
Flachowsky, G. (1993). Niacin in dairy and beef cattle nutrition. Arch. Anim. Nutr. 43:195-213.
Fluharty, f. L. and Loerch, S. C. (1995).Effect of protein concentration and protein source on performance of newly arrived
feedlot steers, J. Anim. Sci., 73: 1585–1594.
Foster, D.L., (1994). Puberty in sheep. The physiology of reproduction (2 ed.) New York: Raven Press. pp: 411
Garg, M.R., Tripathi, A.K. and Kunju, P.J.,I. (1990). Effect of supplementation urea molasses mineral blocks licks to
untreated or ammonia treated paddy straw on economics of weight gain and age of sexual maturity in buffalo
calves. Ind. J. of Ani. Nutr. 7 : 55-58.
Gasser, C. L., Behlke, E. J., Grum, D. E. and Day, M. L. (2006). Effect of timing of feeding a high concentrate diet on
growth and attainment of puberty in early weaned heifers. J. Anim. Sci. 84:3118-3122.
Gressler, S.L., Bergmann, J.A.G., Pereira, C.S., Penna, V.M., Pereira, J.C.C. and Gressler, M.G.M. (2000). Estudo das
associac¸o˜ es gene´ ticas entre perý´metro escrotal e caracterý´sticas reprodutivas de feˆmeas Nelore. Revista
Brasileira de Zootecnia 29 : 427–437.
Gulia, S., Sarkar, M., Kumar, V., H. Mayer, H. D., Prakash, B. S. (2010). Divergent development of testosterone secretion
in male Zebu (Bos indicus) and cross bred cattle (Bos indicus X Bos Taurus) and buffalo (Bubalus Bubalis) during
growth. Trop Ani Health Prod. 42: 1143-1148.
Haldar, A. and B.S. Prakash, (2006). Growth hormone-releasing factor (GRF) induced growth hormone advances puberty
in female buffaloes. Anim. Reprod. Sci, 92 : 254-267
Heinrichs, A. J., Heinrichs, B. S., Harel, O. G. Rogers, W. and Place, N. T., (2005). A prospective study of calf factors
affecting age, body size and body condition score at first calving of Holstein dairy heifers. J. Dairy Sci.,
88: 2828–2835.
Izard, M.K. and Vandenbergh, G.J. (1982). The effects of bull urine on puberty and calving date in crossbredbeef heifers.
J. Anim. Sci.., 55: 1160-1168.
Jamara, M. S., Mehla, R. K., Singh, M., Ali, M. M. and Chouhan, N. (2014). Effect of the fed shatavari (asparagus
Racemosus) on body weight and puberty of Sahiwal heifers. Int. J. Agric. Sc. & Vet. Med, 2 : 64-67.
Javaid, S., Sadiq, N., Anjum, M.I. and Lund, J. (2014). Effects of various weaning diets contained varying protein and
energy levels on growth performance and nutrient digestibility in Red sindhi calves. Inter J Vet Sci, 4: 22-25.
Kassim, N.S.I., Afify, A. A., and Hoda, Z.H. (2008). Effect of Photoperiod Length on Some Reproductive Traits and
Hormonal Profiles in Buffalo Heifers.American-Eurasian J. Agric. & Environ. Sci., 3 : 646-655.
Khan, M. F. and Preston, T. R. (1992). Effect of restricted suckling on performance of Shorthorn and Sahiwal cows and
calves in Pakistan. Livest Res Rural Dev, 4: 2
Kumar, R. and Dass, R.S, (2006). Effect of niacin supplementation on growth, nutrient utilization and blood biochemical
profile in male buffalo calves. Asian-Aust. J. Anim. Sci. 19: 1422 – 1428.
Kumar, S., Mehla, R.K. and Dang, A.K. (2008).Use of Shatavari (Asparagus racemosus) as a galactopoietic and therapeutic
herb : A Review, Agric. Rev., 29 : 132-138.
Lamond, D. R. (1970). The influence of udder nutrition on reproduction in the cow. Animal Breeding Abstract
30: 359-372.
Lancaster, P.A., Carstens, G.E., Ribeiro, F.R., Davis, M.E., Lyons, J.G. and Welsh, T.H. (2008). Effects of divergent selection
for serum insulin-like growth factor-I concentration on performance, feed efficiency, and ultrasound measures of
carcass composition traits in Angus bulls and heifers. J Anim Sci, 86: 62-71.
Laxmi, A., Nathand, G., Prasad, S. (2014). Efficacy of blood plasma IGF1 as a marker and implications of fermented yeast
culture in improvement of growth performance of low body weight Murrah buffalo calves. Asia Pac J Res.
1: 42-52.
166 AGRICULTURAL REVIEWS
Madgwick, S., Evans, A.O. and Beard, A.P. (1995).Treating heifers with GnRH from 4 to 8 weeks of age advanced growth
and the age at puberty. Theriogenology, 63: 2323–2333.
Maquivar, M.G., Galina, C.S., Galindo, J.R. Molina, R. Estrada, S. and Mendoza, M.G. (2006). Reproductive response in
supplementation heifers in the tropics of costa Rice. Anim. Reprod. Sci., 93: 16-23.
Martinez-Velazquez, M., G., Greegory,, K.E., Bennett, G.L., Van Vleck, L.D. (2003). Genetics relationship between scrotal
circumferences and female reproductive traits. J Anim Sci. 81:395-401.
Mc Dowell, R.E., Hollon, B.F., Camoens, J.K. and Vanvleck, L.D. (1976). Reproductive Efficiency of Jerseys, Red Sindhi
and Crossbreds, Journal of Dairy Science., 59: 127-136.
Mondal, M. and Prakash, S. (2004). Effects of long-term GH-releasing factor administration on patterns of GH and LH
secretion in growing female buffaloes (Bubalus bubalis). Reproduction, 127: 45–55.
Nanda, A.S., Brar, P.S. and Pradhakar, S. (2003). Enhancing reproductive performance in dairy buffaloes: major constraints
and achievements. Reprod. Suppl., 61: 27-36.
Naqvi, A.N. and Shami, S.A. (1999). Comparative performance of early and late maturing in Nili Ravi buffalo. Asian-
Australian J. Anim. Sci. 12: 336-340.
Naz, N. A. and Ahmad, M. (2006) Genetic and phenotypic correlations for some sexual maturity traits in Nili Ravi buffalo
heifers. Pakistan Vet. J., 26: 141-143.
NDRI (National Dairy research Institute) (1995-96). Murrah buffalo herd performance at NDRI, Annual report, pp-66.
Nogueira, G.P. (2004).Puberty in South American Bos indicus (Zebu) cattle. Anim. Reprod. Sci. 82–83: 361–372.
NRC, (2001). Nutrient Requirements of Dairy Cattle, 7 th Ed. National Research Council, National Academy Press,
Washington, DC., USA.
Ortega, H. Palomar, H., Acosta, M. M., Salvetti, N. R.., Dallard, B. E. and Lorentz, J.A. (2008). Insulin-like growth factor
I in sera, ovarian follicles and follicular fluid of cows with spontaneous or induced cystic ovarian disease. Res.
Vet. Sci, 84:419-427.
Oyedipe, E.O., Osori, D.I.K., Akarejola, 0. And Saror, D. (1982). Effects of nutrition on onset of puberty and conception
rates of Zebu heifers. Theriogenology, 18: 525-536.
Penchev, P., Ilieva, Y. and Dimov, K. (2014). Effect of season of birth on season of calving and age at first calving in
buffalo heifers. Bulg J of Agric Sci, 20: 447-451.
Perera, K.S., Gwazdauskas, F.C., Akers, R.M., McGilliard, M.L. (1989)..Effect of supplemental light on growth, prolactin,
progesterone and luteinizing hormone in water buffalo (Bubalusbubalis). Int J Biometeorol, 33: 89-94.
Polat, B., Colak, A., Kaya, M, and Ucar, O. (2009). Stimulation of delayed puberty in heifers by using a PRID regime.
Revue Méd. Vét. 160: 149-153
Poy, K. and Panday, R.D. (1971). .Effect of higher levels of protein on production of milk and reproductive performance
in lactating buffaloes. Indian J. Anim. Nutr., 5: 52-57.
Rafiq, M., Chaudhry, M.A. and Jabbar, M.A. (2008). Effect of level of concentrate supplementation on growth rate and age
at maturity in growing buffalo heifers. Pakistan Vet. J., 28: 37-39.
Rasby, R., Brink, D., Rush, I. and Adams, D. (1998). Minerals and vitamins for beef cows, Institute of Agriculture and
Natural Resources, University of Nebraska, Nebraska, USA.
Rauwa, W.M., Kanisb E., Noordhuizen-Stassenc, E.N., Grommersc, F.J. (1998). Undesirable side effects of selection for
high production efficiency in farm animals: a review. Livest Prod Sci 56:15–33
Rawlings, N.C., Evans, A.C.O., (1995). Androgen negative feedback during the early rise in LH secretion in bull calves. J.
Endocrinol. 145: 243–249.
Rekwot, P.I., Ogwu, D., Oyedipe, E.O. and Sekoni, V.O. (2001). The role of pheromones and biostimulation in animal
reproduction. Anim. Reprod. Sci., 65: 157-170.
Roberson, M.S., Wolfe, M.W., Stump, T.T., Werth, L.A., Cupp, Andrea S., Kojima, N., Wolfe, P.L., Kittok, Roger J. and
Kinder, J.E. (1991). Influence of growth rate and exposure to bulls on age at puberty in beef heifers. J. Anim. Sci.,
1:292-298.
Ruis, A.G., Connor, E.E., Cpuco, A.V., Kendall, P.E., Auchtury, T.L. and Dahl, G.E. (2005).Long –Day photoperiod that
enhances puberty does not limit body growth in Holstein heifers. J. Dairy Sci., 88: 4356- 4365.
 Volume 37 Issue 2 (2016) 167
Sharma, R., George, A., Kamble, N.M., Singh, K., Panda, S.K., Chauhan, M.S., Singla S.K.,Manik, R.S. and Palta, P.
(2011). Development of a culture system capable of long-term maintenance of buffalo (bubalusbubalis) embryonic
stem cells. Reprod. Fertil.Develop., 23: 251.
Smijisha, A.S. and Kamboj, M.L. (2012). Calves reared under different management practices. Tamilnadu J. Vet Anim Sci,
8 : 42-44.
Sule, S.R. Tapala, A.I., Jain, I.B. and tailor and S.P. (2001). Productive status of Surti buffalo maintained under sub-humid
condition of Rajasthan. Indian Vet. J., 78: 1049-1051.
Tillman, A.D., Brethour, J.R. and Hansard, S.L. 1959. Comparative procedure for measuring the Phosphorus requirement
of cattle, J. Anim. Sci., 18 : 249-255.
Tiwari, R. P., Ahmed, A., Mishra, G.K. (2014). Role of Pheromones and Biostimulation in Animal Reproduction-An Overview.
J Vet Sci Tech. 3: 15-20.
Vaiciunas, A., Luiz, L., Flávio, C., Meirelles, V., Pires, A. V. and Silva, L. F. P. (2008). Leptin and hypothalamic gene
expression in early- and late-maturing Bos indicus Nellore heifers. Genet. Mole. Biol. 31: 657-664
Walker, W.L., Nebel, R.L. and McGilliard, M.L. (1996). Time of ovulation relative to mounting activity in dairy cattle.
Dairy Sci., 79: 1555-1561.
Williams, G. L., and Amstalden, M. (2010). Understanding postpartum anestrus and puberty in the beef female. In
Proceedings, Applied Reproductive Strategies in Beef Cattle. San Antonio, TX.
Wiltbank, J.N., Gregory, L.A., Swiger, .J.E., Ingalls, J.E., Rothlisberger, J.A., Koch, R.M. (1966). Effects of heterosis on
age and weight at puberty in beef heifers. J Anim Sci, 25:744–84.
Wise, M.B., Ordoveza, A.L. and Barrick, E.R. (1963). Influence of variations in dietary calcium: phosphorus ratio on
performance and blood constituents of calves. J. Nutrition., 79: 79.
Wolf, F.R., Almquist, J.O., Hale, E.B., (1965). Pubertal behaviour and pubertal characteristics of beef bulls on high nutrition
allowance. J. Anim. Sci. 24: 761–765.
Zain, M., Ninggrat, R. and Namarun, T.A. (2010). Effect of phosphorus supplementation of ammoniatedrice straw on
rumen fermentability, synthesisted microbial protein and degradability in vitro, paper presented at Annual
Conference, British Society of Animal Science, Belfast, Northern Ireland, UK.
Zaman, G.U. (1996).Genetic studies on swamp buffaloes. Ph.D. Thesis, Assam Agricultural University, Assam, India.

View publication stats

 2018.00328

RELATIONSHIP BETWEEN THE ESTABLISHMENT OF FIRST ESTRUS

(PUBERTY) AND LEPTIN LEVELS IN BALI CATTLE
L. G. S. S. Heryani, D. N. D. I. Laksmi
Faculty of Veterinery Medicine, Udayana University, Bali-Indonesia, 80234
Corresponding author: surya_heryani@unud.ac.id

INTRODUCTION
One measure of reproductive efficiency is the early achievement of early puberty according to its
genetic potential. This is important to achieve optimum cattle reproduction performance and provide
increased productivity. Information on early puberty is also important as a reference in improving
reproductive efficiency based on the potential and problems in the field through various technological
innovations. Puberty is controlled by certain physiological mechanisms involving the gonads and
adenohypophyte glands, so puberty does not escape the influence of hereditary and environmental
factors that work through these organs (Toelihere 1995), the environment (nutrition, climate and
season) and males or biostimulation ( Rekwort et al., 2000; Getzewick 2005; Abdelgadir et al., 2010).
Adipose weight and tissue mass are thought to play an important role in regulating the onset of
puberty (Maciel et al., 2003). In prepubertal ruminants, short-term feed restriction will reduce the
expression of the adipose leptin gene and leptin secretion. (Amstalden et al., 2002). In this case, the
lack of nutrients will inhibit LH secretion. However, leptin administration will restore LH secretion. This
shows a positive relationship between LH and leptin secretion (Amstalden et al., 2002). Furthermore,
leptin concentration increases as well as leptin gene expression in heifers. The basic thing needed
for the emergence of puberty is GnRH secretion due to the high amplitude and frequency of the
GnRH pulsatile and the estradiol feedback system of the ovary with the hypothalamus. However, Figure 1. Graph of Correlation Between Age and Leptin Hormone Level in Bali Cattle
there are things to note is the complex system of neural pathways, neurohormones and peptides that
modulate the secretion of GnRH itself and mediate the effect of estradiol on GnRH. In line with the Table 1. Average (x ± SD) levels of leptin (ng / ml) and age (months) the appearance of
increasing age and growth of virgin cattle there are factors that induce and interact with various puberty in Bali cattle
metabolic signals, one of which is leptin where leptin is known by its receptors in the central nervous
system. Leptin concentration increases during puberty development. However, leptin concentration
must reach a certain threshold to activate the axis of the ovarian pituitary hypothalamus.This study Ages Leptin level
aims to determine leptin levels when the first estrus emergence (puberty) and find out the first
estrous quality (puberty) in bali cattle. uring puberty development together with increased IGF-I 20.80 ± 2.43 5.62 ± 0.24
concentration and body weight (Garcia et al., 2002).Giving leptin has been studied to produce
puberty in rodentia animals. Leptin injection can give rise to puberty earlier in mice by
increasing the maturation of the reproductive tract (Chehab et al., 1997; Cheung et al., 1998).
However, the hormones and metabolism that link nutrition and puberty, as well as the neuro-
endocrine mechanism by which GnRH neurons are stimulated to increase secretory activity Conclusion
resulting in first puberty ovulation, has not been explained in cattle. Leptin levels when the first estrus emergence (puberty) in bali cattle is an average of
5.62 ng / ml. There is a close relationship between the age of the appearance of puberty
Research Methods with leptin levels in Balinese cattle with a level of correlation (r) = 0.826.
This study is an analytic observational study with CrossSectional Study design. The sample used
was a cattle at puberty. The research sample had a health status that showed no signs of illness. Thank You Note
The collection of blood samples from bali cattle was carried out in several simantri in Mengwi
Thank you to the Ministry of Research and Technology of Higher Education through the
District, Badung Regency. Parameters measured were leptin levels and physical signs of estrus,
Institute for Research and Community Service, Udayana University for the assistance of
namely the presence of transparent colored springs. For measuring hormone levels was used the
the Leading Research Fund of the Study Programe, Udayana University
Direct Elisa method, Double Antibody Sandwich. Estrus observation was carried out 2 times a day,
that is every morning (06.00-09.00 WITA) and in the afternoon (16.00-18.00 WITA) with estrus signs
observed. Data were analyzed with the SPSS for Window version 20 program, including; normality Bibliography
test with Kolmogorov-smirnov, homogeneity test with Leven's Test, and Correlation and Regression
Abdelgadir AM, Izeldin A, Babiker, Eltayeb AE. 2010. Effect of concentrate supplementation
test to determine the relationship and evenness between leptin levels and the appearance of the first
on growth and sexual development of dairy heifers. J Appl Sci Res. 6(3):212- 217.
estrus (puberty).
Amstalden, M., D. A. Zieba, J. F. Edwards, P. G. Harms, T. H. Welsh Jr, R. L. Stanko, and
Results and Discussion G. L. Williams. 2003. Leptin acts at the bovine adenohypophysis to enhance basal and
The average levels of leptin hormone in bali cattle kept in several Simantri in Sobangan village, gonadotropin-releasing hormone-mediated release of luteinizing hormone: differential
Badung regency showed that the emergence of puberty in Balinese cattle ranged from 20.80 effects are dependent upon nutritional history. Biol. Reprod. 69:1539-1544.
months with an average leptin level of 5.62 ng / ml which is presented in Table 1. Statistical
analysis of the relationship between the age of puberty with hormone leptin gives the correlation Chehab F F, Mounzih K, Lu R, Lim M E. 1997. Early Onset of Reproductive Function in
coefficient (r) = 0.826 and the coefficient of determination (r2) = 0.682 with a regression line y = Normal Female Mice Treated with Leptin. Science 27. 88-90.
68.39 + 8:46 x, where y is the age and x is leptin levels (Figure 1). The graph above shows the age
of puberty is closely related to levels of leptin hormone and contributes 68.2% to the level of the
Cheung C C, Thornton J E, Kuijper J L, Weigle D S, Clifton D K. 1997. Leptin is a Metabolic
hormone leptin. Increasing age by 1 point causes an increase in leptin levels of 8.46%. Serum
gate for onset of Puberty in The Female Rat. Endocrinology 138. 855-858.
leptin increases at puberty in rodents and humans (Ahima et al., 1997; Quinton et al., 1999).
Weight gain, seasonal changes, and serum leptin-binding proteins are variables that have been
Getzewich KE. 2005. Hormonal regulation of the onset puberty in purebred and crossbred
shown to contribute to increased circulation of leptin (Maffei et al., 1995; Bocquier et al. 1998;
Holstein and Jersey heifers. Thesis. The Virginia Polytechnic Institute and State University.
Housknecht et al., 1996). In conditions of lack of nutrition, inhibition of LH secretion can be treated
with leptin. This shows a positive relationship between LH and leptin secretion (Amstalden et al., Maciel M.N., Zieba, D.A., Amstalden, M., Keisler, D.H., Neves, J. and Williams G.L. 2004.
2002). Serum leptin concentration increases during puberty in mice, pigs and cattle (Garcia et al., Chronic administration of recombinant ovine leptin in growing beef heifers: Effects on
2002). In prepubertal ruminants, limited feed reduces leptin gene expression in adipose tissue and secretion of LH, metabolic hormones, and timing of puberty. J Anim sci, 82:2930-2936.
leptin secretion, but increases hypothalamic OB-rb expression. Leptin does not function as a trigger
signal but acts primarily as a permissive signal that allows puberty to occur. Therefore, in Rekwort P, Ogwu D, Oyedipe E, Sekoni V. 2000. Effects of bull exposure and body growth
ruminants, leptin 1) acts primarily as a passive hormone that allows puberty to occur when sexual on onset of puberty in Bunaji and Friesian Bunaji heifers. Reprod Nutr Dev. 40:359-367.
maturity is reached; and 2) function as a metabolic signal that can regulate gonadotropin secretion
in response to limited acute or chronic energy (Maciel et al., 2013) Toelihere MR. 1995. Fisiologi Reproduksi pada Ternak. Penerbit Angkasa. Bandung.
 Chronic administration of recombinant ovine leptin in growing beef heifers:
Effects on secretion of LH, metabolic hormones, and timing of puberty1

M. N. Maciel*†‡, D. A. Zieba*‡, M. Amstalden*‡, D. H. Keisler§,

J. P. Neves†, and G. L. Williams*‡2

*Animal Reproduction Laboratory, Texas A&M University Agricultural Research Station, Beeville 78102;
†Federal University of Santa Maria, Santa Maria, Rio Grande do Sul, Brazil; ‡Department of Animal Science,
Center for Animal Biotechnology and Genomics, Texas A&M University, College Station 77843;
and §Department of Animal Science, University of Missouri, Columbia 65211

ABSTRACT: Serum concentrations of leptin increase
linearly from approximately 16 wk before until the
week of pubertal ovulation in beef heifers. To test the
hypothesis that exogenous leptin can hasten the onset
of puberty in heifers, we examined the effects of chronic
administration of recombinant ovine leptin (oleptin) on
timing of puberty, pulsatile and GnRH-mediated re-
lease of LH, and plasma concentrations of GH, IGF-
I, and insulin. Fourteen fall-born, prepubertal heifers
(Brahman × Hereford, 12 to13 mo; 304.7 ± 4.12 kg)
were used. Heifers were stratified by age and BW and
assigned randomly to one of two groups (seven animals
per group): 1) Control; heifers received s.c. injections of
saline twice daily (0700 and 1900) for 40 d; and 2)
Leptin; heifers received s.c. injections of oleptin (19.2
␮g/kg) twice daily at 0700 and 1900 for 40 d. Blood
samples were collected at 10-min intervals for 5 h on
d 0, 5, 10, 20, 30, and 40, and twice daily, just before
each treatment injection, throughout the study. On d
41, heifers received i.v. injections of GnRH at 0 (0.0011
␮g/kg) and 90 min (0.22 ␮g/kg), with additional sam-
pling for 5.5 h to examine releasable pools of LH. Diets
promoted a gain of 0.32 ± 0.09 kg/d, which did not differ
between groups. Plasma concentrations of leptin in-
creased markedly in leptin-treated heifers and were
greater (P < 0.001) than controls throughout (27.8 ±
0.8 vs. 4.9 ± 0.12 ng/mL). None of the heifers reached
puberty during the experiment, but did so within 45 d
of its termination. Mean concentrations of plasma LH,
GH, IGF-I, and insulin were not affected by treatment,
nor was there an overall effect on the frequency of LH
pulses. However, a treatment × day interaction (P =
0.02) revealed that the frequency of LH pulses (pulses/
5 h) was greater (P = 0.03) in controls (3.6 ± 0.36) than
in leptin-treated heifers (1.7 ± 0.28) on d 10. Character-
istics of GnRH-induced release of LH were not affected
by treatment. In summary, chronically administered
leptin failed to induce puberty or alter endocrine char-
acteristics in beef heifers nearing the time of ex-
pected puberty.

Key Words: Heifer, Leptin, Luteinizing Hormone, Metabolic Hormones, Puberty

2004 American Society of Animal Science. All rights reserved. J. Anim. Sci. 2004. 82:2930–2936

Introduction tion results in delayed puberty in rodents (Cheung et

Both BW and adipose tissue mass are considered to
play critical roles in regulating the onset of puberty
(Kennedy and Mitra, 1963; Frisch et al., 1973). More-
over, the retarded growth caused by chronic diet restric-
1 in 1994 (Zhang et al. 1994), not only decreases food
Supported by National Research Inititative Competitive Grant
00-35203-9132 from the USDA Cooperative State Research, Educa-
tion, and Extension Service, the Foundation for Coordination of Im-
provement of High Level Scholars (CAPES), the Ministry of Education
of Brazil, and the Texas Agric. Exp. Stn.
2
Correspondence: 3507 Hwy 59E (fax: 361-358-4930; e-mail:
glwilliams@tamu.edu).
Received March 10, 2004.
Accepted June 8, 2004.
al., 1997), sheep (Foster and Olster, 1985), and cattle
(Day et al., 1986). However, the hormones and metabo-
lites linking nutrition and puberty, as well as the neuro-
endocrine mechanisms by which GnRH neurons are
stimulated to increase their secretory activity, resulting
in the first pubertal ovulation, have not been elucidated.
Leptin, an adipose-derived peptide first characterized
intake and BW in mutant, leptin-deficient (ob/ob) obese
mice, but also restores their fertility (Barash et al.,
1996; Chehab et al., 1996). As a result of these and
other observations, leptin is considered to be a major
link between nutrition, metabolism, and reproduction.
In humans (Kiess et al., 1999), rats (Ahima et al., 1997;
Quinton et al., 1999), and heifers (Garcia et al., 2002),

2930

Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196

by University of Connecticut user
on 30 July 2018
 Chronic leptin treatment in heifers
increasing circulating concentrations of leptin precede
the onset of puberty, and leptin has been shown to
regulate either acutely (Ahima et al., 1997) or permis-
sively (Cheung et al., 2001) the onset of puberty in
rodents. Furthermore, studies in our laboratory have
confirmed the ability of leptin to modulate acutely the
hypothalamic-hypophyseal axis of nutritionally
stressed cattle (Amstalden et al., 2002, 2003; Maciel et
al., 2004). To test the hypothesis that leptin regulates
pubertal onset in heifers, we examined the effects of
chronic treatment with recombinant ovine leptin (olep-
tin; Gertler et al., 1998) on patterns of LH secretion,
adenohypophyseal responsiveness to GnRH, circulat-
ing metabolic hormones, and timing of the onset of
puberty.
Materials and Methods
The Institutional Agricultural Animal Care and Use
Committee of the Texas A&M University System ap-
proved in advance all procedures used in these studies.
Establishment of Dose of Oleptin
In a preliminary experiment, we compared three
doses of oleptin, administered s.c., to establish a dose
appropriate for the current study. The criterion used
to choose the appropriate dose was the amount of olep-
tin that would result in mean plasma concentrations
between 5 and 10 ng/mL, which would then remain
above baseline for approximately 8 to 12 h after a single
injection. Eleven heifers (Brahman × Hereford-F1, 15
to 16 mo of age) were assigned randomly to one of four
groups: 1) Control (n = 3); s.c. injection of saline; 2) Low
dose (n = 3); single s.c. injection of recombinant oleptin
(4.8 ␮g/kg BW); 3) Mid dose (n = 3); single s.c. injection
of oleptin (9.6 ␮g/kg BW); and 4) High dose (n = 2);
single s.c. injection of oleptin (19.2 ␮g/kg BW). Heifers
averaged 318 ± 5.11 kg, with an average BCS of 5 (1
to 9 scale). Blood samples were collected by coccygeal
venipuncture at −15 min, just before each injection, and
at 15 min, 1, 2, 4, 6, 8, 12, 18, and 24 h after the injection.
Samples were placed immediately on ice, centrifuged
at 3,000 × g to obtain plasma within 2 h, and stored at
−20°C until RIA for leptin. The recombinant oleptin
preparation used in both preliminary and formal stud-
ies was as reported previously (Gertler et al., 1998;
Amstalden et al., 2002).
All doses of leptin increased mean concentrations of
plasma leptin within 15 min after injection (Figure 1).
The highest dose of oleptin resulted in the greatest
increase in mean concentrations of leptin, with the
greatest concentrations occurring approximately 1 h
after injection (12.01 ± 2.23 ng/mL). Plasma concentra-
tions of leptin in this group remained elevated (P <
0.05) above controls for 12 h after the injection (5.97 ±
0.98 vs. 2.31 ± 0.03 ng/mL; Figure 1), whereas leptin
values for the other dose groups did not differ from
controls after 6 h. Based on these results, we selected
Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196
by University of Connecticut user
on 30 July 2018
2931
Figure 1. Mean serum concentrations of leptin during
24 h in control heifers (saline; n = 3) and heifers treated
with single injections of Low (4.8 ␮g/kg BW; n = 3), Mid
(9.6 ␮g/kg BW; n = 3), and High (19.2 ␮g/kg BW; n =
3) doses of recombinant ovine leptin (oleptin) adminis-
tered s.c. during a preliminary study. Plasma concentra-
tions of leptin in the High group remained elevated above
controls for 12 h (P < 0.05), whereas other groups were
elevated (P < 0.05) for 6 h. Pooled SEM were 0.28, 0.53,
0.97, and 1.01 for Control (saline), Low, Mid, and High
doses, respectively.
the highest dose (19.2 ␮g/kg BW), administered twice
daily at 12-h intervals, to use in the formal study.
Animals and Procedures
Fourteen fall-born, prepubertal beef heifers (12 to 13
mo of age, 304.7 ± 4.12 kg BW, Hereford × Brahman,
F1) were used for this study. Before the beginning of
the experiment, animals were maintained in pens (4 to
5 heifers per pen) measuring 25 × 9 m. Serum concentra-
tions of progesterone were determined in twice-weekly
blood samples collected by caudal venipuncture to mon-
itor pubertal status. During the experimental period,
all heifers received diets formulated to meet all nutri-
tional requirements and to promote an ADG of approxi-
mately 0.68 kg/d (NRC, 1996). Diets consisted of
Coastal bermudagrass hay, ground corn, cottonseed
meal, limestone, and vitamin A-D-E premix.
Twenty-four hours before the start of the experiment,
each heifer was fitted with a jugular catheter (Silastic
tubing, 1.4 mm i.d, 1.9 mm o.d.; Dow Corning Corp.,
Midland, MI) for intensive and daily blood sampling.
Heifers were assigned randomly into two groups (seven
animals per group): 1) Control; twice daily s.c. injections
of saline (0700 and 1900) for 40 d; and 2) Leptin; twice
daily s.c. injections (0700 and 1900) of oleptin in saline
at a dose rate of 19.2 ␮g/kg BW for 40 d. The volume
 2932
of each injection was approximately 2 mL, with the
volume varying slightly depending on individual BW.
During the experiment, blood samples were collected
twice daily (0700 and 1900) just before each saline or
leptin injection. Also, on d 0, 5, 10, 20, 30, and 40 of
the experiment, heifers were placed in indoor stan-
chions and blood samples (10 mL) were collected at 10-
min intervals for 5 h (0800 to 1300). On d 41, all heifers
received an i.v. injection of GnRH (0.001 ␮g/kg) in-
tended to produce a physiological pulse of LH (Maciel
et al., 2004), with blood samples (10 mL) collected every
10 min for 90 min (0800 to 0930). At this time, a second
GnRH injection (0.22 ␮g/kg), intended to release all
releasable pools of LH, was administered and intensive
bleeding continued for an additonal 4 h (Maciel et al.,
2004). During this period, blood samples (10 mL) were
collected at 15-min intervals during the first hour (0930
to 1030) and at 1-h intervals during the last 3 h (1030
to 1330).
Blood samples were dispensed into tubes containing
a solution of 150 ␮L of heparin (10,000 UI/mL) and 5%
EDTA and immediately placed on ice. During intensive
blood sampling, the volume of blood collected (10 mL)
was replaced with an equal volume of saline or heparan-
ized (300 IU/mL) saline during cathether flushing. Se-
rum from nonintensively collected tail vein blood sam-
ples and plasma from intensively collected samples
were obtained by centrifugation (1,200 × g) and stored
at −20°C until hormone assays were conducted. After
each intensive and daily blood sampling, heifers were
returned to outside pens.
Hormone and Biochemical Assays
To confirm the prepubertal status of heifers, serum
concentrations of progesterone were assayed in twice-
weekly samples collected beginning 70 d before the be-
ginning of the experiment and throughout the study
using the Coat-A-Count assay kit (Diagnostic Product
Corp., Los Angeles, CA) as reported previously from
this laboratory (Fajersson et al., 1999). Heifers were
to be considered pubertal if serum concentrations of
progesterone was greater than 1 ng/mL for two consecu-
tive samples and accompanied by an ultrasonographi-
cally definable corpus luteum. Plasma concentrations
of leptin were determined in samples collected twice
daily from d 0 to 40 using a highly specific oleptin RIA
validated for use in bovine serum or plasma (Delavaud
et al., 2002) and reported previously from this labora-
tory (Amstalden et al., 2000; Garcia et al., 2002).
Plasma concentrations of LH were determined in sam-
ples collected at 10-min intervals for 5 h on d 0, 5, 10,
20, 30, and 40, with all samples collected after GnRH
injections on d 41 assayed for LH as reported previously
(McVey and Williams, 1991).
To assess metabolic status in response to leptin treat-
ment, circulating concentrations of GH, insulin, and
IGF-I were also monitored. Plasma concentrations of
GH were determined in one sample collected every
Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196
by University of Connecticut user
on 30 July 2018
Maciel et al.
morning just before the treatment injection (0700) on d
0, 1, 2, 3, 4, 5, 10, 20, 30, and 40, as validated previously
(Ryan et al., 1994). Circulating concentrations of insu-
lin were determined in samples collected every morning
just before the treatment injection (0700) on d 0, 1, 2,
3, 4, 5, 10, 20, 30, and 40 using an assay reported
previously (Ryan et al., 1995). Plasma concentrations
of IGF-I were determined in samples collected twice
weekly from d 0 to 40 (Ryan et al., 1994). Intra- and
interassay CV for progesterone, LH, insulin, GH, and
IGF-I were 4.0 and 6.0, 7.5 and 9.0, 9.2 and 10.6, 11.0
and 16.2, and 12.0 and 22%, respectively. Leptin was
determined in a single assay with an intraassay CV
of 4.5%.
Statistical Analysis
The frequency and amplitude of LH pulses were de-
termined using both visual inspection and the aid of
a pulse-detection algorithm (Pulsefit 1.2; Kushler and
Brown, 1991). The frequency of LH pulses was analyzed
by the GLM models for repeated measures using PROC
MIXED of SAS (SAS Inst., Inc., Cary, NC). Because of
differences in the frequency of LH pulses among groups
on d 0, analysis of covariance was used to test main
effects on d 5, 10, 20, 30, and 40. Circulating concentra-
tions of LH, GH, IGF-I, insulin, and leptin were ana-
lyzed using SAS PROC MIXED for repeated measures.
Sources of variation were treatment, day, and their
interaction. Day was used as the repeated variable, and
heifer within treatment was used as the subject. When
differences in circulating concentrations of hormones
were detected between groups on d 0, analysis of covari-
ance was performed to compare treatment means on d
5, 10, 20, 30, and 40. The least squares means procedure
(PDIFF option) was used to compare means when sig-
nificant F-value was obtained.
To analyze GnRH-induced release of LH, samples
collected before and after both the low and high doses
of GnRH were grouped into four periods: Period I, 10-
min samples from −90 to 0 min relative to low dose
injection; Period II, 10-min samples from 0 to 40 min
after the low dose of GnRH; Period III, 10-min samples
from 50 to 90 min after the low dose of GnRH; and
Period IV, 15-min samples from 15 to 60 min and 1-h
samples until 3 h after the high dose of GnRH. Because
of differences noted in concentrations of LH among
groups during Period I, analyses of covariance were
used to test main effects during Periods II, III, and IV.
When a significant difference was detected, the least
squares means procedure (PDIFF option) of SAS was
used to compare means.
Results
Plasma Leptin and Onset of Puberty
Recombinant oleptin markedly increased plasma con-
centrations of leptin in the Leptin group, with mean
 Chronic leptin treatment in heifers 2933

Figure 2. Mean plasma concentrations (± SEM) of leptin
on d 0, 5, 10, 20, 30, and 40. Concentrations of leptin were
greater (P < 0.003) in the Leptin group than in the Control
group throughout the experiment.
Figure 3. Mean frequencies of LH pulses (± SEM) in
control (n = 7) and leptin-treated (n = 7) heifers on d 0,
5, 10, 20, 30, and 40. After adjusting for differences in
frequencies of LH pulses on d 0, the mean frequency of
LH pulses was greater in controls on d 10 (P < 0.03).

concentrations greater (P < 0.001) than controls Discussion

throughout the study (27.8 ± 0.8 vs. 4.9 ± 0.12 ng/mL;
Figure 2). Diets promoted a gain of 0.32 ± 0.09 kg/d Recent studies in this laboratory have demonstrated
that did not differ between groups, with final BW at the ability of peripherally administered, recombinant
the end of the study averaging 319.18 kg across both oleptin to prevent fasting-mediated decreases in the
groups. Serum concentrations of progesterone re- frequency of LH pulses in heifers that were within days
mained below 0.2 ng/mL throughout the experiment in or weeks of their first pubertal ovulation (frequency of
both Control and Leptin heifers, indicating that leptin
treatment was unable to accelerate the onset of puberty.
Although none of the heifers reached puberty during
the experimental period, all heifers attained puberty
within 45 d after the end of the experiment and were
bred at the expected time for heifers of this breed type.

Pulsatile Patterns of LH Secretion

and GnRH-Mediated Release of LH

Mean concentrations of LH, frequency of LH pulses,

and amplitude of LH pulses did not differ between
groups during the study (Figure 3). However, a treat-
ment × day interaction (P = 0.02) revealed that the
frequency of LH pulses (pulses/5 h) was greater (P =
0.03) in controls than in leptin-treated heifers on d 10.
Neither mean plasma concentrations of LH after GnRH
nor area under the curve was affected by treatment
with oleptin (Figure 4). Figure 4. The GnRH-mediated release of LH during
Period I: 10-min samples from –90 to 0 min relative to
Metabolic Hormones low dose (0.001 ␮g/kg BW) injection; Period II: 10-min
samples from 0 to 40 min after the low dose of GnRH;
Mean concentrations of GH, IGF-I, and insulin in Period III: 10-min samples from 50 to 90 min after the
plasma were not affected by treatment (Figure 5). How- low dose of GnRH; and Period IV: 15-min samples from
ever, mean concentrations of insulin (P < 0.002) and 15 to 60 min and 1-h samples until 3 h after the high dose
IGF-I (P < 0.003) increased transiently from d 0 to 40 of (0.22 ␮g/kg BW) of GnRH. The GnRH-induced release
the study in both the control and leptin-treated groups did not differ between saline- and leptin-treated heifers.
(Figure 6). Values are mean ± SEM.

Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196

by University of Connecticut user
on 30 July 2018
 2934 Maciel et al.

Figure 5. Mean plasma concentrations of GH during

Period I (d 0), Period II (d 1 to 5), Period III (d 6 to10),
Period IV (d 11 to 20), Period V (d 21 to 30), and Period
VI (d 31 to 40) in saline- and leptin-treated heifers. Mean
concentrations did not differ between groups during any
period. The pooled SEM was 1.04.

LH pulses between 0.6 and one pulse/h; Maciel et al.,

2004). Such observations imply the ability of leptin to
modulate the activity of the GnRH pulse generator in
this animal model and are in agreement with previous
studies in rodents (Ahima et al., 1997), monkeys (Finn
et al., 1998), and male estradiol-implanted sheep (Na-
gatani et al., 2000). However, in the current study, the
peripheral administration of recombinant oleptin for
40 d did not stimulate an increase in LH pulse frequency
in prepubertal heifers that were gaining BW at moder-
ate to high rates, were approaching the expected age
of pubertal onset, and whose frequency of LH pulses
were still relatively low. This confirms a previous report
on well-fed prepubertal lambs (Morrison et al., 2002),
in which LH, GH, and several other metabolic hormones
were not affected by chronic treatment with recombi-
nant oleptin.
The lack of an effect of leptin on LH pulse frequency,
and its failure to accelerate the timing of the onset of
puberty, suggest that leptin treatment was ineffectual
in increasing the frequency of GnRH pulses or in chroni-
cally elevating the baseline for LH via direct effects on
the pituitary (Amstalden et al., 2002, 2003). Currently,
the circumstances and mechanisms by which leptin can
stimulate hypothalamic GnRH and/or adenohypophy-
seal LH secretion remain to be fully delineated, particu-
larly in ruminants. However, several lines of evidence
support the potential for a direct action of leptin at both
loci, including the presence of leptin receptors within
the arcuate nucleus (Dyer at al., 1997) and on gonado-
tropes (Iqbal et al., 2000). Importantly, one of the pri-
mary factors associated with an increase in the number
of leptin receptors in the ventromedial hypothalamus of
ewes is malnutrition (Dyer et al., 1997), and numerous
Figure 6. Mean plasma concentrations of IGF-I (Panel
A) on d 0, 5, 10, 15, 20, 25, 30, 35, and 40 of the experiment.
Plasma concentrations of IGF-I did not differ between
saline- and leptin-treated heifers on any d. The pooled
SEM was 5.4. Mean plasma concentrations of insulin
(Panel B) on d 0, 1, 2, 3, 4, 5, 10, 20, 30, and 40 of the
experiment. Plasma concentrations of insulin did not dif-
fer between saline- and leptin-treated heifers on any day.
The pooled SEM was 0.12.
reports suggest that leptin may only stimulate LH se-
cretion during nutritional stress in sheep (Nagatani et
al., 2000; Henry et al., 2001) and cattle (Amstalden et
al., 2002, 2003). Hence, both fasting and chronic, severe
dietary energy restriction appear to hypersensitize the
hypothalamic-hypophyseal axis to leptin. These find-
ings may explain why exogenous oleptin did not affect
LH secretion patterns in well-fed heifers in the current
study, which would preclude it from serving as a neuro-
endocrine trigger for puberty per se.
In vivo studies with well-fed sheep (Henry et al.,
1999; Morrison et al., 2002) and anterior pituitary ex-
plants from well-fed cows (Zieba et al., 2003b) indicate
that leptin is also incapable of consistently influencing
the secretion of GH in normally nourished ruminants,
although one exception to this view has been published
(Henry et al., 2001). In the current study, exogenous
oleptin did not affect mean concentrations of plasma

Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196

by University of Connecticut user
on 30 July 2018
 Chronic leptin treatment in heifers
GH. However, leptin stimulates GH secretion in fasted
sheep (Nagatani et al., 2000), in anterior pituitary ex-
plants from cows in the fasted state (Zieba et al., 2003b),
and in fasted prepubertal heifers (Maciel et al., 2004).
Moreover, leptin receptor mRNA is increased in the
pituitary and hypothalamus of fasted rats (Zamorano
et al., 1997). Thus, similar to the effects of leptin on
LH secretion, it is plausible to conclude that the somato-
tropic axis of well-fed heifers in the current study was
not sensitized, or was resistant to, the effects of leptin
and could not respond to exogenous oleptin with an
increase in basal GH secretion.
As expected, mean concentrations of IGF-I and insu-
lin increased from d 0 to 40 of the experiment in all
animals. However, neither IGF-I nor insulin was influ-
enced by leptin treatment in the current study. These
results are consistent with results obtained in well-fed
lambs (Morrison et al., 2002). Moreover, recent studies
from this laboratory have demonstrated that the ability
of oleptin to normalize fasting-mediated decreases in
circulating insulin, similar to both LH and GH, depends
on both metabolic status and the dose of oleptin used
(Zieba et al., 2003b).
Although the s.c. dose of oleptin used in the current
study was based on preliminary experiments in which
physiological concentrations of leptin were targeted and
achieved, long-term treatment of heifers in this study
with the selected dose resulted in mean concentrations
of circulating leptin that were between two- and three-
fold greater than our target. Moreover, these values
increased nearly linearly as the experiment progressed
in spite of results from preliminary experiments indi-
cating that an appropriate dose of leptin had been cho-
sen. In fasted, mature cows with significant adipose
reservoirs, biological responses were inversely propor-
tional to dose of leptin and dose was therefore a critical
determinant for achieving sustained increases in LH,
GH, and pancreatic insulin release during short-term
experiments (Zieba et al., 2003a). Importantly, studies
in other species indicate that large doses of leptin may
cause the accumulation of excessive amounts of sup-
pressors of cytokine signaling-3, thus creating a state
of leptin resistance (Emilsson et al., 1999). Obesity syn-
dromes in humans are also thought to be related to a
state of leptin resistance (Caro et al., 1996; Considine
et al., 1996). Although we have previously reported that
mature, estrous-cycling beef cows can exhibit circulat-
ing concentrations of leptin of between 15 and 20 ng/
mL (Garcia et al., 2002), with values similar to those
obtained in treated heifers during the first 10 to 15
d of the current study, it is possible that the greater
concentrations of circulating leptin created by the pro-
longed administration of oleptin resulted in a state of
leptin resistance. In addition, circulating concentra-
tions of leptin in control heifers in the current study
were well within the range of values noted in developing
heifers that reached puberty at the expected time (Gar-
cia et al., 2002). Finally, more recent studies in this
laboratory (our unpublished observations) indicate that
Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196
by University of Connecticut user
on 30 July 2018
2935
relatively small doses (0.2 ␮g/kg BW) of oleptin, shown
previously to stimulate an increase in LH and insulin
secretion in fasted cows (Zieba et al., 2003a), are also
incapable of accelerating pulse generator activity in
heifers at any development stage before puberty. Thus,
collective observations, both published and unpub-
lished, have led us to believe that the major factor con-
tributing to a failure of leptin to modify the function of
the hypothalamic-adenohypophyseal axis in the cur-
rent study is related to metabolic status. Hence, an
integration of results across species, particularly rumi-
nants, support the contention that leptin 1) acts mainly
as a passive hormone that permits puberty to occur
when sexual maturity is reached; and 2) serves as a
metabolic signal that can regulate gonadotropin secre-
tion in response to either acute or chronic dietary en-
ergy restriction.
Literature Cited
Ahima, R. S., J. Dushay, S. N. Flier, D. Prabakaran, and J. S. Flier.
1997. Leptin accelerates the onset of puberty in normal female
mice. J. Clin. Invest. 99:391–395.
Amstalden, M., M. R. Garcia, R. L. Stanko, S. E. Nizielski, C. D.
Morrinson, D. H. Keisler, and G. L. Williams. 2002. Central
infusion of recombinant ovine leptin normalizes plasma insulin
and stimulates a novel hypersecretion of luteinizing hormone
after short-term fasting in mature beef cows. Biol. Reprod.
66:1555–1561.
Amstalden, M., M. R. Garcia, S. W. Williams, R. L. Stanko, S. E.
Nizielski, C. D. Morrinson, D. H. Keisler, and G. L. Williams.
2000. Leptin gene expression, circulating leptin, and luteinizing
hormone pulsatility are acutely responsive to short-term fasting
in prepubertal heifers: Relationships to circulating insulin and
insulin-like growth factor I. Biol. Reprod. 63:127–133.
Amstalden, M., D. A. Zieba, J. F. Edwards, P. G. Harms, T. H. Welsh,
Jr., R. L. Stanko, D. H. Keisler, and G. L. Williams. 2003. Leptin
acts at the bovine adenohypophysis to enhance basal and gonado-
tropin-releasing hormone-mediated release of luteinizing hor-
mone: Differential effects are dependent upon nutritional his-
tory. Biol. Reprod. 69:1539–1544.
Barash, I. A., C. C. Cheung, D. S. Weigle, H. Ren, E. B. Kabigting,
J. L. Kuijper, D. K. Clifton, and R. A. Steiner. 1996. Leptin is
a metabolic signal to the reproductive system. Endocrinology
137:3144–3147.
Caro, J. F., M. K. Sinha, and J. W. Kolaczynski. 1996. Leptin: The
tale of an obesity gene. Diabetes 45:1455–1462.
Chehab, F. F., M. E. Lim, and R. Lu. 1996. Correction of the sterility
defect in homozygous obese female mice by treatment with the
human recombinant leptin. Nat. Genet. 12:318–320.
Cheung, C. C., J. E. Thornton, J. L. Kuijper, D. S. Weigle, D. K.
Clifton, and R. A. Steiner. 1997. Leptin is a metabolic gate for the
onset of puberty in the female rat. Endocrinology 138:855–858.
Cheung, C. C., J. E. Thornton, S. D. Nurani, D. K. Clifton, and R.
A. Steiner. 2001. A reassessment of leptin’s role in triggering
the onset of puberty in the rat and mouse. Neuroendocrinology
74:12–21.
Considine, R. V., M. K. Sinha, M. L. Heiman, A. Kriauciunas, T. W.
Stephens, M. R. Nyce, J. P. Ohannesian, C. C. Marco, L. J.
McKee, and T. L. Bauer. 1996. Serum immunoreactive-leptin
concentrations in normal-weight and obese humans. N. Engl. J.
Med. 334:292–295.
Day, M. L., K. Imakawa, D. D. Zalesky, R. J. Kittok, and J. E. Kinder.
1986. Effects of dietary energy intake during the prepubertal
period on secretion of luteinizing hormone and responsiveness
of the pituitary to luteinizing-hormone releasing hormone in
heifers. J. Anim. Sci. 62:1641–1648.
 2936 Maciel et al.
Delavaud, C., A. Ferlay, Y. Faulconnier, F. Bocquier, G. Kann, and
Y. Chilliard. 2002. Plasma leptin concentration in adult cattle:
effects of breed, adiposity, feeding level, and meal intake. J.
Anim. Sci. 80:1317–1328.
Dyer, C. J., J. M. Simmons, R. L. Matteri, and D. H. Keisler. 1997.
Leptin receptor mRNA is expressed in ewe anterior pituitary and
adipose tissues and is differentially expressed in hypothalamic
regions of well-fed and feed-restricted ewes. Domest. Anim. En-
docrinol. 14:111–128.
Emilsson, V., J. R. S. Arch, R. P. de Groot, C. A. Lister, and M. A.
Cawthorne. 1999. Leptin treatment increases suppressors of
cytokine signaling in central and peripheral tissues. FEBS Lett.
455:170–174.
Fajersson, P., R. L. Stanko, and G. L. Williams. 1999. Distribution
and repeatability of anterior pituitary responses to GnRH and
relationship of response classification to the postpartum anovu-
latory interval of beef cows. J. Anim. Sci. 77:3043–3049.
Finn, P. D., M. J. Cunningham, K. Y. F. Pau, H. G. Spies, D. K.
Clifton, and R. A. Steiner. 1998. The stimulatory effect of leptin
on the neuroendocrine reproductive axis of the monkey. Endocri-
nology 139:4652–4662.
Foster, D. L., and D. H. Olster. 1985. Effect of restricted nutrition
on puberty in the lamb: Patterns of tonic luteinizing hormone
(LH) secretion and competency of the LH surge system. Endocri-
nology 116:375–381.
Frisch, R. E., R. Revelle, and S. Cook. 1973. Components of weight
at menarche and the initiation of the adolescent growth spurt
in girls: Estimated total water, lean body weight and fat. Hum.
Biol. 45:469–483.
Garcia, M. R., M. Amstalden, S. W. Williams, R. L. Stanko, C. D.
Morrinson, D. H. Keisler, S. E. Nizielski, and G. L. Williams.
2002. Serum leptin and its adipose gene expression during pu-
bertal development, the estrous cycle, and different seasons in
cattle. J. Anim. Sci. 80:2158–2167.
Gertler, A., J. M. Simmons, and D. H. Keisler. 1998. Large-scale
preparation of biological-active recombinant ovine obese protein
(leptin). FEBS Lett. 422:137–140.
Henry, B. A., J. W. Goding, W. S. Alexander, A. J. Tilbrook, B. J.
Canny, F. Dunshea, A. Rao, A. Mansell, and I. J. Clarke. 1999.
Central administration of leptin to ovariectomized ewes inhibits
food intake without affecting the secretion of hormones from the
pituitary gland: evidence for a dissociation of effects on appetite
and neuroendocrine function. Endocrinology 140:1175–1182.
Henry, B. A., J. W. Goding, A. J. Tilbrook, F. R. Dunshea, and I. J.
Clarke. 2001. Intracerebroventricular infusion of leptin elevates
the secretion of luteinizing hormone without affecting food in-
take in long-term food-restricted sheep, but increases growth
hormone irrespective of body weight. J. Endocrinol. 168:67–77.
Iqbal, J., S. Pompolo, R. V. Considine, and I. J. Clarke. 2000. Localiza-
tion of leptin receptor-like immunoreactivity in the corticotropes,
somatotropes, and gonadotropes in the ovine anterior pituitary.
Endocrinology 141:1515–1520.
Kennedy, G. C., and J. Mitra. 1963. Body weight and food intake as
initiating factors for puberty in the rat. J. Physiol. 166:408–418.
Downloaded from https://academic.oup.com/jas/article-abstract/82/10/2930/4790196
by University of Connecticut user
on 30 July 2018
Kiess, W., A. Reich, K. Meyer, A. Glasow, J. Deutscher, J. Klammt,
Y. Yang, G. Muller, and J. Kratzsch. 1999. A role for leptin in
sexual maturation and puberty. Horm. Res. 51:55–63.
Kushler, R. H., and M. B. Brown. 1991. A model for the identification
of hormone pulses. Stat. Med. 10:329–340.
Maciel, M. N., D. A. Zieba, M. Amstalden, D. H. Keisler, J. P. Neves,
and G. L. Williams. 2004. Recombinant oleptin prevents fasting-
mediated reductions in pulsatile LH release and stimulates GH
secretion in peripubertal heifers. Biol. Reprod. 70:229–235.
McVey, W. R., Jr., and G. L. Williams. 1991. Mechanical masking of
neurosensory pathways at the calf-teat interface: Endocrine,
reproductive, and lactational features of the suckled anestrous
cow. Theriogenology 35:931–941.
Morrison, C. D., R. Wood, E. L. McFadin, N. C. Whitley, and D. H.
Keisler. 2002. Effect of intravenous infusion of recombinant
ovine leptin on feed intake and serum concentrations of GH,
LH, insulin, IGF-1, cortisol, and thyroxine in growing prepuber-
tal ewe lambs. Domest. Anim. Endocrinol. 22:103–112.
Nagatani, S., Y. Zeng, D. H. Keisler, D. L. Foster, and C. A. Jaffe.
2000. Leptin regulates pulsatile luteinizing hormone and growth
hormone secretion in the sheep. Endocrinology 141:3965–3975.
NRC. 1996. Nutrient Requiriments of Beef Cattle. 7th ed. Natl. Acad.
Press, Washington, DC.
Quinton, N. D., R. F. Smith, P. E. Clayton, M. S. Gills, S. Shalet, S.
K. Justice, S. A. Simon, S. Walters, M. C. Postel-Vinay, A. I. F.
Blakemore, and R. J. M. Ross. 1999. Leptin binding activity
changes with age: The link between leptin and puberty. Endocri-
nology 84:2336–2341.
Ryan, D. P., B. Bao, M. K. Griffith, and G. L. Williams. 1995. Metabolic
and luteal sequelae to heightened dietary fat intake in under-
nourished, anestrous beef cows induced to ovulate. J. Anim. Sci.
73:2086–2093.
Ryan, D. P., R. A. Spoon, M. K. Griffith, and G. L. Williams. 1994.
Ovarian follicular recritment, granulosa cell steroidogenic po-
tential and growth hormone/insulin-like growth factor I relation-
ships in suckled beef cows consuming high lipid diets: Effects
of graded differences in body condition maintained during the
puerperium. Domest. Anim. Endocrinol. 11:161–174.
Zamorano, P. L., V. B. Mahesh, L. M. DeSevilla, L. P. Chorich, G.
K. Bhat, and I. Brann. 1997. Expression and localization of the
leptin receptor in endocrine and neuroendocrine tissues of the
rat. Neuroendocrinology 65:223–228.
Zhang, Y., R. Proenca, and M. Maffei. 1994. Positional cloning of the
mouse obese gene and its human homologue. Nature 372:425–
431.
Zieba, D. A., M. Amstalden, M. N. Maciel, D. H. Keisler, N. Raver,
A. Gertler, and G. L. Williams. 2003a. Divergent effects of leptin
on luteinizing hormone and insulin secretion are dose depen-
dent. Exp. Biol. Med. 228:325–330.
Zieba, D. A., M. Amstalden, S. Morton, J. L. Gallino, J. F. Edwards,
P. G. Harms, and G. L. Williams. 2003b. Effects of leptin on
basal and GHRH-stimulated GH secretion from the bovine ade-
nohypophysis are dependent upon nutritional status. J. Endocri-
nol. 178:83–89.
 Theriogenology xxx (2016) 1–6

Contents lists available at ScienceDirect

Theriogenology
journal homepage: www.theriojournal.com

Review

Factors affecting puberty in replacement beef heifers

G.A. Perry*
South Dakota State University, Department of Animal Science, Brookings, USA

a b s t r a c t

Keywords: Puberty is defined as when ovulation is accompanied by visual signs of estrus and sub-
Beef heifer sequent normal luteal function. Age at puberty is an important trait in relation to repro-
Puberty ductive success, productive life span, and profitability in beef operations. Although puberty
Nutrition
and initiation of normal estrous cycles are complex events that require maturation of the
Estradiol
hypothalamic-pituitary-ovarian axis, it has been well documented that nutrition, age, and
Genetics
genetics are regulators of age at puberty. However, their role is mainly as regulators of the
endocrine maturation that must occur for sustained ovarian cyclicity to be initiated.
Increased growth rate between 4 and 7 months of age is apparently sufficient to induce
early puberty, and this increased growth rate decreased the negative feedback of estradiol
on LH secretion during the prepubertal period. As puberty approaches, a progressive
decrease in the negative feedback of estradiol on GnRH secretion allows increased pulse
frequency of LH, thus stimulating follicular growth and increased estradiol production. In
addition, expression of estrogen receptors in the anterior hypothalamus and ventromedial
nucleus is negatively correlated with LH pulse frequency. Although a significant number of
genes and pathways are involved in neuromaturation for the initiation of normal estrous
cycles, the inhibitory effects of neuropeptide Y on GnRH/LH release appear to decrease, and
the stimulatory effect of melanocyte-stimulating hormone alpha on GnRH appears to in-
crease as puberty approaches. Thus, a thorough understanding of the metabolic and
neuroendocrine changes that occur to initiate normal estrous cycles is needed to facilitate
management of the important reproductive event.
Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction
When heifers are selected as replacements for a beef
operation, puberty and/or age at puberty is often not
considered. However, age at puberty is an important trait
when heifers are inseminated during a restricted breeding
season to calve at 2 years of age [1]. Pregnancy success
during a defined breeding season has been correlated with
the percentage of heifers that reached puberty before or
early in the breeding season [2]. In addition, according to a
review by Patterson et al. [3], heifers need to calve by
24 months of age (conceive by 15 months of age) to achieve
maximum lifetime productivity, and heifers that conceive
* Corresponding author. Tel.: 605 688 5456; fax: 605 688 6170.
E-mail address: George.Perry@sdstate.edu
early in the breeding season and calve in the first 21 days of
their initial calving season had greater longevity in the herd
and weaned more pound of calf compared with heifers that
calved in the second or third 21-day calving periods [4].
However, across several herds in three multistate studies,
the percentage of heifers that had reached puberty before
the start of the breeding season ranged from 19% to 100%
[5–7].
Puberty in a female has been defined as when ovulation
is accompanied by visual signs of estrus and subsequent
normal luteal function and life span (see review by [8]).
Previous research has also demonstrated up to a 21% in-
crease in fertility from a heifer’s pubertal estrus to the third
estrus [9,10]. Thus, to reach maximal fertility at the start of
a heifer’s first breeding season, puberty needs to be reached
by 13 months of age. Using reproductive tract scores as an
indicator of puberty, previous studies have reported

0093-691X/$ – see front matter Ó 2016 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.theriogenology.2016.04.051
2 G.A. Perry / Theriogenology xxx (2016) 1–6
differences in response to estrous synchronization [11,12]
and conception rates [13] between pubertal and prepu-
bertal heifers. This review will focus on how physiological
factors that are known to impact age at puberty regulate
the initiation of normal estrous cycles in beef heifers.
2. Mechanisms controlling puberty
Puberty is a complex series of events that requires the
maturation of the hypothalamic-pituitary-ovarian axis. The
negative feedback of estradiol on LH release has to be
reversed to a stimulatory feedback to induce a LH surge and
ovulation, and although ovulation can occur by inducing a
surge of LH during the prepubertal stage, animals’ return to
anestrous and normal cycling activity is not sustained [14].
Although nutrition, age, and genetics are well-known reg-
ulators of age at puberty, their role in advancement in the
age at puberty is mainly as regulators of the endocrine
maturation that must occur for sustained cycling activity to
be initiated.
2.1. The role of nutrition and body composition in initiation of
normal estrous cycles
Timing of puberty is dependent on both age and weight
but varies among breeds [2,15,16]. Several studies have
reported that heifers reach puberty at a genetically influ-
enced size [17], and a recent study reported that across
several breeds, heifers were 55% to 60% of mature BW when
puberty was attained [18]. Thus, most research has focused
on nutritional changes after weaning and their impact on
age at puberty. Heifers developed to lighter weights were
older when they reached puberty [2,19]. Thus, undernu-
trition can delay age at puberty. Therefore, a typical man-
agement practice has been to develop heifers to a specific
target weight (i.e., usually 65% of mature weight), but, the
specific target weights will vary across breed because
mature weight will differ among breeds [20]. Several
studies have investigated the method to reach the target
weight from weaning to the start of the breeding season
(continuous growth, slow–rapid) and have found no sig-
nificant effects on age at puberty as long as the appropriate
target weight is reached [21].
Leptin is produced by adipose tissue and is regulated by
long-term nutritional history (i.e., body condition) and
current nutritional status (i.e., feed availability) [22], and it
plays a role in regulation of the hypothalamic-pituitary axis
[23,24]. Mean serum concentrations of leptin increased as
puberty approached [25], and changes in diet did not
impact concentrations of leptin when percentage of total
carcass fat was similar between treatments [26]. Therefore,
a minimum amount of body condition (i.e., total body fat) is
necessary for puberty and reproductive success to occur.
Less research has focused on nutritional effects during
the preweaning period, but preweaning gain had a larger
impact on age at puberty than postweaning gain [3,16,27].
A few studies that specifically evaluated the influence of
preweaning gain on reproductive development and pu-
bertal status indicated that weaning heifers at 2 to
4 months of age and feeding a high concentrate resulted in
most heifers attaining puberty at 8 to 10 months of age
[28–31]. Furthermore, this feeding regime hastened the
increase in LH pulse frequency [31] and size of the domi-
nant follicle [30] and decreased the prepubertal negative
feedback of estradiol on LH secretion [29] at an earlier age
than in control animals. Furthermore, this research has
indicated that this increased plane of nutrition does not
have to be sustained, but a short period of only 10 weeks
between 4 and 7 months of age was sufficient to induce
early puberty in 67% of heifers [28].
2.2. The role of genetic selection in initiation of normal
estrous cycles
Age at puberty has been reported to be moderately
heritable and has been reported to be 0.33 [32] to 0.40 [33].
Thus, there are genes that influence the onset of puberty in
beef heifers, and the heritability estimates indicate that
advancements could be made in heifer reproductive per-
formance by understanding and selecting for the specific
genes and/or pathways involved. Selection for a decreased
age at puberty increased pregnancy rates and decreased
calving day in a population of Angus heifers [34]. Conse-
quently, by decreasing the age at puberty, there is a
correlated increase in reproductive performance. Thus,
genes that are influencing the onset of reproductive cycles
could also be influencing fertility. Most would argue that
this is due to an increased percentage of heifers reaching
puberty before the start of the breeding season [2]. How-
ever, there is the possibility that genetic selection for
decreased age at puberty could also be selected for genes
that improve reproductive performance.
A number of transgenic mouse models have implicated
members of the circadian clock genes in proper mamma-
lian reproductive function [35,36]. Older mice lacking the
period 1 or period 2 gene had an increased incidence of
anestrus and reduction in litter size compared with wild-
type controls [37]. Furthermore, Chappell et al. [38] re-
ported that mice underexpressing the Clock gene had
prolonged estrous cycles and decreased litter size, whereas
mice underexpressing the Bmal1 gene had prolonged
estrous cycles and decreased progesterone secretion [39].
Thus, genes reported to affect estrous cycles have also been
reported to impact reproductive performance.
Both the candidate gene approach and the whole-
genome association study approach have been used to
identify genes associating with age at puberty in beef
heifers. These studies have clearly demonstrated that age at
puberty is a polygenic trait, controlled by many genes with
very small effects of each gene [40,41]. Using genome-wide
association study, Snelling et al. [41] reported a negative
genetic correlation between age at puberty and heifer
pregnancy rate (r ¼ 0.33), indicating that if genetic se-
lection was used to decrease age at puberty, it would result
in an increase in heifer pregnancy rates. Thus, continued
work to discover genetic markers and genes controlling
puberty may not only provide a selection method for
decreasing age at puberty but also provide tools to improve
heifer pregnancy success. However, when using genetic or
traditional selection, care must be used because significant
decreases in age at puberty among beef heifers can increase
 G.A. Perry / Theriogenology xxx (2016) 1–6
the risk of very young heifers becoming bred by a co-
pastured bull before weaning.
2.3. The role of hormone regulation in initiation of normal
estrous cycles
The individual functions of the hypothalamus, pituitary,
and ovaries are established well before puberty occurs. As
puberty approaches, a progressive decrease in the negative
feedback of estradiol on luteinizing hormone releasing
hormone (LHRH) secretion allows increased secretion of LH
thus stimulating follicular growth and increased estradiol
production by the growing follicles. This increased secre-
tion of estradiol eventually reaches concentrations suffi-
cient to induce the pubertal LH surge (see review [42,43]).
The period over which this change in negative feedback of
estradiol on LH release diminished is referred to as the
peripubertal period and begins approximately 50 days
before the pubertal ovulation [44,45].
Exposure of heifers to a progestin has been reported to
hasten the onset of puberty [46–49]. The first luteal phase
after the first ovulation in prepubertal heifers is usually of
short duration. Although the oocyte may become fertilized,
embryo mortality occurs due to the onset of luteolysis
before the time of maternal recognition of pregnancy (see
reviews by [50,51]). Treatment with some progestins, before
the first ovulation, was able to eliminate the occurrence of a
short-duration CL [52–54]. Therefore, many estrous syn-
chronization protocols have included treatment with a
progestin [6,55,56] to induce puberty. However, different
progestins are known to differ in their chemical structure,
potency, pharmacokinetics, metabolism [57], and in binding
affinity to the progesterone receptor [58–60]. The ability of a
progestin to change LH pulse frequency and amplitude ap-
pears necessary to hasten the onset of puberty [43], and this
ability appears to be restricted to the peripubertal period of
time. When a norgestomet (synthetic progestin) implant
was used, it was able to induce puberty at 12.5 months of age
but not at 9.5 or 11 months of age [61]. After 9 days of low-
dose exposure to norgestomet, the number of neurons
positive for the estrogen receptor in the preoptic area was
decreased, and expression of estrogen receptors in the
anterior hypothalamus and ventromedial nucleus was
negatively correlated with LH pulse frequency [43].
The first period of elevated concentrations of proges-
terone after formation of luteal tissue in prepubertal heifers
is usually of short duration. Although the oocyte released
during the first ovulation can become fertilized, embryo
mortality usually occurs due to the onset of luteolysis
before the time of maternal recognition of pregnancy (see
reviews by [50,51]). It is believed that premature release of
PGF2a from the uterus is responsible for the short-lived
duration of the first ovulatory CL [50,51,62,63]. When a CL
of short duration and normal duration were compared,
there were no differences in weight, concentrations of
progesterone, LH receptors, adenylate cyclase activity,
number of luteal cells, ratio of large to small cells, or PGF2a
receptors (see reviews by [51] and [64]). It is well known
that release of PGF2a from the uterus is responsible for
normal luteal regression [65], and to investigate the specific
role of the uterus is the short life span of first ovulatory CL,
3
hysterectomy before ovulation eliminated the occurrence
of short-duration CL in postpartum cattle [66] and in pre-
pubertal ewes [67].
In addition to the ability to hasten the onset of puberty,
treatment with some progestins before the first ovulation,
was also able to eliminate the occurrence of a short-
duration CL [52–54]. For example, 100% of anestrous beef
cows exposed to progesterone (i.e., in an intravaginal de-
vice) for 5 days before a GnRH-induced ovulation had a
normal luteal phase after ovulation, but only 46% of anes-
trous beef cows fed melengestrol acetate (MGA) for 5 days
before a GnRH-induced ovulation had a normal luteal
phase [53]. When anestrous cows were treated with pro-
gesterone (i.e., in a controlled internal drug–releasing de-
vice) or MGA and allowed to spontaneously ovulate, more
cows treated with progesterone ovulated within 4 days
after controlled internal drug–releasing device removal,
and more progesterone-treated cows had a normal-length
luteal phase compared with cows treated with MGA [68].
Thus, the normal dose of MGA (0.5 mg,cow1,day1) may
be adequate to hasten puberty but insufficient to prevent
the earlier secretion of PGF2a from the uterus.
2.4. Development of the brain in initiation of normal estrous
cycles
Several studies have reported increased circulating
concentrations of LH in heifers around 3 to 4 months of age
that then decrease until just before puberty [69,70], and as
previously mentioned, as puberty approaches, a progres-
sive decrease in the negative feedback of estradiol on LHRH
secretion by the hypothalamus occurs allowing estradiol to
reach concentrations sufficient to induce the pubertal LH
surge [43]. In addition, expression of estrogen receptors in
the anterior hypothalamus and ventromedial nucleus was
negatively correlated with LH pulse frequency, and 9 days
of exposure to norgestomet decreased the number of
neurons positive for the estrogen receptor in the preoptic
area [43]. Thus, changes in neuroregulation must occur
before the initiation of puberty.
There are a significant number of genes and pathways
involved in neuromaturation for the initiation of normal
estrous cycles [71]. The model described previously, which
increased growth rate to induce puberty at an early age, has
been used in several studies to investigate these genes and
pathways. This model tended to increase circulating con-
centrations of leptin [72], but increased leptin alone is not
sufficient to induce puberty or normal estrous cycles
[73,74]. Neuropeptide Y (NPY) expression was decreased in
the arcuate nucleus, and NPY innervation of GnRH neurons
was decreased in the medial basal hypothalamus, whereas
expression of proopiomelanocortin expression was
increased in the arcuate nucleus [71]. However, KISS1 does
not appear to be a major differentially regulated gene in
early puberty [40,72,75], although KISS1 expression was
decreased in nutrient-restricted rats, and administering
kisspeptin restored LH release [76]. It is more likely that
kisspeptin plays a role in the feedback of estradiol on GnRH
and/or LH release, as kisspeptin neurons have estradiol
receptors [71], and GnRH neurons contain the receptor for
kisspeptin [77]. Thus, the inhibitory effects of NPY on GnRH
4 G.A. Perry / Theriogenology xxx (2016) 1–6
and/or LH release appear to decrease [78,79], and the
stimulatory effect of melanocyte-stimulating hormone
alpha (a proopiomelanocortin-derived peptide) on GnRH
[80] appears to increase as puberty approaches [71].
3. Advancing our understanding of puberty and
fertility
Basic research on the control of puberty and fertility has
greatly improved reproduction and pregnancy success.
However, current research in the control of puberty and
fertility will continue to contribute to improving repro-
duction and pregnancy success. Furthermore, advance-
ments in genomic technologies will likely provide a
powerful tool for selecting heifers at birth or weaning that
will have a high probability of being reproductively suc-
cessful, if managed correctly. Some reproductive traits are
highly heritable (i.e., age at puberty, heritability ¼ 0.41;
weight at puberty, heritability ¼ 0.40 [81]); however, the
genetic impact on reproduction and pregnancy success has
been difficult to determine because pregnancy success is
impacted by management and environment [33]. There-
fore, reproductive traits are often considered moderately
(e.g., conceived on first service, heritability ¼ 0.22; con-
ceptions per estrous cycle exposed, heritability ¼ 0.27) or
lowly (e.g., pregnant at the end of breeding season,
heritability ¼ 0.09; calf alive at 2 weeks of age,
heritability ¼ 0.03; calf born alive, heritability ¼ 0.00 [82])
heritable. The difficulties in this area of research are
exemplified through the evidence that most currently
available commercial genetic platforms evaluate very few if
any reproductive traits. However, advances in genotyping
and DNA sequencing techniques are allowing more data to
be generated on genomic and even transcriptomic se-
quences [83]. However, the largest limitation in this area is
the need for high-quality and accurate phenotypes to
match up with the genetic profiles that can be produced.
Thus, this advancing technology needs to be combined
with increased basic research to develop phenotypes and to
understand the factors that control puberty and fertility.
Using this combination approach will likely provide
powerful tools for selecting heifers at birth that will have a
high probability of being reproductively successful if
managed correctly [41]. Thus, there is tremendous poten-
tial to advance our understanding of puberty, fertility, and
their interactions with the environment (i.e., nutrition).
However, caution needs to be taken as advancement of
puberty to younger ages can result in negative outcomes
through precocious puberty and/or selection for other un-
wanted traits.
4. Summary
Age at puberty is an important trait in relation to
reproductive success, productive life span, and profitability
in beef operations. Nutrition, age, and genetics are regula-
tors of age at puberty, but puberty and initiation of normal
estrous cycles also require maturation of the hypothalamic-
pituitary-ovarian axis. Leptin plays a role in regulation of
the hypothalamic-pituitary axis, and mean serum concen-
trations of leptin increased as puberty approached,
indicating that a minimum amount of body condition
(i.e., total body fat) is necessary for puberty and repro-
ductive success to occur. Increased leptin alone is not suf-
ficient to induce puberty or normal estrous cycles. As
puberty approached, a progressive decrease in the negative
feedback of estradiol on LHRH secretion allows increased
secretion of LH, thus stimulating follicular growth and
increased estradiol production. This change in feedback
may be regulated through expression of estrogen receptors
in the anterior hypothalamus and ventromedial nucleus,
which was negatively correlated with LH pulse frequency.
Although a significant number of genes and pathways are
involved in neuromaturation for the initiation of normal
estrous cycles, the inhibitory effects of NPY on GnRH and/or
LH release appear to decrease, and the stimulatory effect of
melanocyte-stimulating hormone alpha on GnRH appears
to increase as puberty approaches. Kisspeptin has been
implicated in the onset of puberty, and administering
kisspeptin restored LH release in nutrient-restricted rats.
However, it is more likely that kisspeptin plays a role in the
feedback of estradiol on GnRH and/or LH release, as kiss-
peptin neurons have estradiol receptors, and GnRH neu-
rons contain receptors for kisspeptin. Thus, a thorough
understanding of the changes that occur to initiate normal
estrous cycles is needed to facilitate management of the
important reproductive event.
References
[1] Ferrell CL. Effects of postweaning rate of gain on onset of puberty
and productive performance of heifers of different breeds. J Anim Sci
1982;55:1272–83.
[2] Short RE, Bellows RA. Relationships among weight gains, age at
puberty and reproductive performance in heifers. J Anim Sci 1971;
32:127–31.
[3] Patterson DJ, Perry RC, Kiracofe GH, Bellows RA, Staigmiller RB,
Corah LR. Management considerations in heifer development and
puberty. J Anim Sci 1992;70:4018–35.
[4] Cushman RA, Kill LK, Funston RN, Mousel EM, Perry GA. Heifer
calving date positively influences calf weaning weights through six
parturitions. J Anim Sci 2013;91:4486–91.
[5] Lucy MC, Billings HJ, Butler WR, Ehnis LR, Fields MJ, Kesler DJ, et al.
Efficacy of an intravaginal progesterone insert and an injection of
PGF2a for synchronizing estrus and shortening the interval to
pregnancy in postpartum beef cows, peripubertal beef heifers, and
dairy heifers. J Anim Sci 2001;79:982–95.
[6] Lamb GC, Larson JE, Geary TW, Stevenson JS, Johnson SK, Day ML,
et al. Synchronization of estrus and artificial insemination in
replacement beef heifers using gonadotropin-releasing hormone,
prostaglandin F2alpha, and progesterone. J Anim Sci 2006;84:
3000–9.
[7] Bridges GA, Lake SL, Kruse SG, Bird SL, Funnell BJ, Arias R, et al.
Comparison of three CIDR-based fixed-time AI protocols in beef
heifers. J Anim Sci 2014;92:3127–33.
[8] Moran C, Quirke JF, Roche JF. Puberty in heifers: a review. Anim
Reprod Sci 1989;18:167–82.
[9] Byerley DJ, Berardinelli JG, Short RE. Pregnancy rates of breed
heifers bred either on puberal or third estrus. J Anim Sci 1987;65:
645–50.
[10] Perry RC, Corah LR, Cochran RC, Brethour JR, Olson KC, Higgins JJ.
Effects of hay quality, breed, and ovarian development on onset of
puberty and reproductive performance of beef heifers. J Prod Agric
1991;4:13–8.
[11] Leitman NR, Busch DC, Bader JF, Mallory DA, Wilson DJ, Lucy MC,
et al. Comparison of protocols to synchronize estrus and ovulation
in estrous-cycling and prepubertal beef heifers. J Anim Sci 2008;86:
1808–18.
[12] Wood-Follis SL, Kojima FN, Lucy MC, Smith MF, Patterson DJ. Estrus
synchronization in beef heifers with progestin-based protocols. I.
Differences in response based on pubertal status at the initiation of
treatment. Theriogenology 2004;62:1518–28.
 G.A. Perry / Theriogenology xxx (2016) 1–6
[13] Holm DE, Thompson PN, Irons PC. The value of reproductive tract
scoring as a predictor of fertility and production outcomes in beef
heifers. J Anim Sci 2009;87:1934–40.
[14] McLeod BJ, Peters AR, Haresign W, Lamming GE. Plasma LH and FSH
responses and ovarian activity in prepubertal heifers treated with
repeated injections of low doses of GnRH for 72 h. J Reprod Fertil
1985;74:589–96.
[15] Varner LW, Bellows RA, Christensen DS. A management system for
wintering replacement heifers. J Anim Sci 1977;44:165–71.
[16] Wiltbank JN, Gregory KE, Swiger LA, Ingalls JE, Rothlisberger JA,
Koch RM. Effects of heterosis on age and weight at puberty in beef
heifers. J Anim Sci 1966;25:744–51.
[17] Taylor CS, Fitzhugh Jr HA. Genetic relationships between mature
weight and time taken to mature within a breed. J Anim Sci 1971;
33:726–31.
[18] Freetly HC, Kuehn LA, Cundiff LV. Growth curves of crossbred cows
sired by Hereford, Angus, Belgian Blue, Brahman, Boran, and Tuli
bulls, and the fraction of mature body weight and height at puberty.
J Anim Sci 2011;89:2373–9.
[19] Wiltbank JN, Roberts S, Nix J, Rowden L. Reproductive performance
and profitability of heifers fed to weigh 272 or 318 kg at the start of
the first breeding season. J Anim Sci 1985;60:25–34.
[20] Freetly HC, Cundiff LV. Reproductive performance, calf growth, and
milk production of first-calf heifers sired by seven breeds and raised
on different levels of nutrition. J Anim Sci 1998;76:1513–22.
[21] Grings EE, Geary TW, Short RE, MacNeil MD. Beef heifer develop-
ment within three calving systems. J Anim Sci 2007;85:2048–58.
[22] Chilliard Y, Delavaud C, Bonnet M. Leptin expression in ruminants:
nutritional and physiological regulations in relation with energy
metabolism. Domest Anim Endocrinol 2005;29:3–22.
[23] Williams GL, Amstalden M, Garcia MR, Stanko RL, Nizielski SE,
Morrison CD, et al. Leptin and its role in the central regulation of
reproduction in cattle. Domest Anim Endocrinol 2002;23:339–49.
[24] Zieba DA, Amstalden M, Williams GL. Regulatory roles of leptin in
reproduction and metabolism: a comparative review. Domest Anim
Endocrinol 2005;29:166–85.
[25] Garcia MR, Amstalden M, Williams SW, Stanko RL, Morrison CD,
Keisler DH, et al. Serum leptin and its adipose gene expression
during pubertal development, the estrous cycle, and different sea-
sons in cattle. J Anim Sci 2002;80:2158–67.
[26] Garcia MR, Amstalden M, Morrison CD, Keisler DH, Williams GL. Age
at puberty, total fat and conjugated linoleic acid content of carcass,
and circulating metabolic hormones in beef heifers fed a diet high in
linoleic acid beginning at four months of age. J Anim Sci 2003;81:
261–8.
[27] Buskirk DD, Faulkner DB, Ireland FA. Increased postweaning gain of
beef heifers enhances fertility and milk production. J Anim Sci 1995;
73:937–46.
[28] Gasser CL, Behlke EJ, Grum DE, Day ML. Effect of timing of feeding a
high-concentrate diet on growth and attainment of puberty in
early-weaned heifers. J Anim Sci 2006;84:3118–22.
[29] Gasser CL, Bridges GA, Mussard ML, Grum DE, Kinder JE, Day ML.
Induction of precocious puberty in heifers III: hastened reduction of
estradiol negative feedback on secretion of luteinizing hormone. J
Anim Sci 2006;84:2050–6.
[30] Gasser CL, Burke CR, Mussard ML, Behlke EJ, Grum DE, Kinder JE,
et al. Induction of precocious puberty in heifers II: advanced ovarian
follicular development. J Anim Sci 2006;84:2042–9.
[31] Gasser CL, Grum DE, Mussard ML, Fluharty FL, Kinder JE, Day ML.
Induction of precocious puberty in heifers I: enhanced secretion of
luteinizing hormone. J Anim Sci 2006;84:2035–41.
[32] Mialon MM, Renand G, Krauss D, Menissier F. Genetic variability of
the length of postpartum anoestrus in Charolais cows and its rela-
tionship with age at puberty. Genet Sel Evol 2000;32:403–14.
[33] Martin LC, Brinks JS, Bourdon RM, Cundiff LV. Genetic effects on beef
heifer puberty and subsequent reproduction. J Anim Sci 1992;70:
4006–17.
[34] Morris CA, Wilson JA, Bennett GL, Cullen NG, Hickey SM, Hunter JC.
Genetic parameters for growth, puberty, and beef cow reproductive
traits in a puberty selection line. New Zeal J Ag Res 2000;43:83–91.
[35] Kennaway DJ. The role of circadian rhythmicity in reproduction.
Hum Reprod Update 2005;11:91–101.
[36] Boden MJ, Kennaway DJ. Circadian rhythms and reproduction.
Reproduction 2006;132:379–92.
[37] Pilorz V, Steinlechner S. Low reproductive success in Per1 and Per2
mutant mouse females due to accelerated ageing? Reproduction
2008;135:559–68.
[38] Chappell PE, White RS, Mellon PL. Circadian gene expression regu-
lates pulsatile gonadotropin-releasing hormone (GnRH) secretory
5
patterns in the hypothalamic GnRH-secreting GT1-7 cell line. J
Neurosci 2003;23:11202–13.
[39] Ratajczak CK, Boehle KL, Muglia LJ. Impaired steroidogenesis and
implantation failure in Bmal1-/- mice. Endocrinology 2009;150:
1879–85.
[40] Fortes MR, Reverter A, Zhang Y, Collis E, Nagaraj SH, Jonsson NN,
et al. Association weight matrix for the genetic dissection of puberty
in beef cattle. Proc Natl Acad Sci U S A 2010;107:13642–7.
[41] Snelling WM, Cushman RA, Fortes MR, Reverter A, Bennett GL,
Keele JW, et al. Physiology and Endocrinology Symposium: how
single nucleotide polymorphism chips will advance our knowledge
of factors controlling puberty and aid in selecting replacement beef
females. J Anim Sci 2012;90:1152–65.
[42] Atkins JA, Pohler KG, Smith MF. Physiology and endocrinology of
puberty in heifers. In: Patterson DJ, Smith MF, editors. Veterinary
clinics of North America: food animal practice. Management con-
siderations in beef heifer development and puberty. Philadelphia,
Pennsylvania: Elsevier; 2013. p. 479–92.
[43] Day ML, Anderson LH. Current concepts on the control of puberty in
cattle. J Anim Sci 1998;76:1–15.
[44] Day ML, Imakawa K, Garcia-Winder M, Zalesky DD, Schanbacher BD,
Kittok RJ, et al. Endocrine mechanisms of puberty in heifers:
estradiol negative feedback regulation of luteinizing hormone
secretion. Biol Reprod 1984;31:332–41.
[45] Day ML, Imakawa K, Wolfe PL, Kittok RJ, Kinder JE. Endocrine
mechanisms of puberty in heifers. Role of hypothalamo-pituitary
estradiol receptors in the negative feedback of estradiol on lutei-
nizing hormone secretion. Biol Reprod 1987;37:1054–65.
[46] Short RE, Bellows RA, Carr JB, Staigmiller RB, Randel RD. Induced or
synchronized puberty in heifers. J Anim Sci 1976;43:1254–8.
[47] Sheffield LG, Ellicott AR. Effect of low levels of exogenous proges-
terone on puberty in beef heifers. Theriogenology 1982;18:177–83.
[48] Burfening PJ. Induction of puberty and subsequent reproductive
performance. Theriogenology 1979;12:215–21.
[49] Gonzalez-Padilla E, Ruiz R, LeFever D, Denham A, Wiltbank JN. Pu-
berty in beef heifers. III. Induction of fertile estrus. J Anim Sci 1975;
40:1110–8.
[50] Garverick HA, Smith MF. Mechanisms associated with subnormal
luteal function. J Anim Sci 1986;62:92–105.
[51] Garverick HA, Zollers WG, Smith MF. Mechanisms associated with
corpus luteum lifespan in animals having normal or subnormal
luteal function. Anim Reprod Sci 1992;28:111–24.
[52] Ramirez-Godinez JA, Kiracofe GH, McKee RM, Schalles RR, Kittok RJ.
Reducing the incidence of short estrous cycles in beef cows with
norgestomet. Theriogenology 1981;15:613–23.
[53] Smith VG, Chenault JR, McAllister JF, Lauderdale JW. Response of
postpartum beef cows to exogenous progestogens and gonado-
tropin releasing hormone. J Anim Sci 1987;64:540–51.
[54] Zollers Jr WG, Garverick HA, Smith MF. Oxytocin-induced release of
prostaglandin F2a in postpartum beef cows: comparison of short
versus normal luteal phases. Biol Reprod 1989;41:262–7.
[55] Odde KG. A review of synchronization of estrus in postpartum
cattle. J Anim Sci 1990;68:817–30.
[56] Patterson DJ, Kiracofe GH, Stevenson JS, Corah LR. Control of the
bovine estrous cycle with melengestrol acetate (MGA): a review. J
Anim Sci 1989;67:1895–906.
[57] Stanczyk FZ. All progestins are not created equal. Steroids 2003;68:
879–90.
[58] Bauer ER, Daxenberger A, Petri T, Sauerwein H, Meyer HH. Char-
acterisation of the affinity of different anabolics and synthetic
hormones to the human androgen receptor, human sex hormone
binding globulin and to the bovine progestin receptor. APMIS 2000;
108:838–46.
[59] Moffatt RJ, Zollers Jr WG, Welshons WV, Kieborz KR, Garverick HA,
Smith MF. Basis of norgestomet action as a progestogen in cattle.
Domest Anim Endocrinol 1993;10:21–30.
[60] Perry GA, Welshons WV, Bott RC, Smith MF. Basis of melengestrol
acetate action as a progestin. Domest Anim Endocrinol 2005;28:
147–61.
[61] Hall JB, Staigmiller RB, Short RE, Bellows RA, MacNeil MD,
Bellows SE. Effect of age and pattern of gain on induction of puberty
with a progestin in beef heifers. J Anim Sci 1997;75:1606–11.
[62] Hunter MG. Characteristics and causes of the inadequate corpus
luteum. J Reprod Fertil Suppl 1991;43:91–9.
[63] Lishman AW, Inskeep EK. Deficiencies in luteal function during re-
initiation of breeding activity in beef cows and in ewes. South Afr
J Anim Sci 1991;21:59–76.
[64] Garverick HA, Moser MT, Keisler DH, Hamilton SA, Roberts RM,
Smith MF. Luteal function after intrauterine infusion of recombinant
6 G.A. Perry / Theriogenology xxx (2016) 1–6
bovine interferon-alpha I1 into postpartum beef cows expected to
have short or normal luteal phases. J Reprod Fertil 1992;94:319–25.
[65] McCracken JA, Custer EE, Lamsa JC. Luteolysis: a neuroendocrine-
mediated event. Physiol Rev 1999;79:263–323.
[66] Copelin JP, Smith MF, Garverick HA, Youngquist RS. Effect of the
uterus on subnormal luteal function in anestrous beef cows. J Anim
Sci 1987;64:1506–11.
[67] Keisler DH, Inskeep EK, Dailey RA. First luteal tissue in ewe lambs:
influence on subsequent ovarian activity and response to hyster-
ectomy. J Anim Sci 1983;57:150–6.
[68] Perry GA, Smith MF, Geary TW. Ability of intravaginal progesterone
inserts and melengestrol acetate to induce estrous cycles in post-
partum beef cows. J Anim Sci 2004;82:695–704.
[69] Evans AC, Currie WD, Rawlings NC. Effects of naloxone on circu-
lating gonadotrophin concentrations in prepubertal heifers. J
Reprod Fertil 1992;96:847–55.
[70] Evans AC, Adams GP, Rawlings NC. Follicular and hormonal devel-
opment in prepubertal heifers from 2 to 36 weeks of age. J Reprod
Fertil 1994;102:463–70.
[71] Amstalden M, Willams GL. Kisspeptin neuronal networks in pu-
bertal development of domestic female ruminants. In: Juengel JL,
Miyamoto A, Price CA, Reynolds LP, Smith MF, Webb R, editors.
Reproduction in domestic ruminants VIII. Leicestershire, England:
Context Products Ltd; 2014. p. 127–40.
[72] Allen CC, Alves BR, Li X, Tedeschi LO, Zhou H, Paschal JC, et al. Gene
expression in the arcuate nucleus of heifers is affected by controlled
intake of high- and low-concentrate diets. J Anim Sci 2012;90:
2222–32.
[73] Maciel MN, Zieba DA, Amstalden M, Keisler DH, Neves JP,
Williams GL. Chronic administration of recombinant ovine leptin in
growing beef heifers: effects on secretion of LH, metabolic hor-
mones, and timing of puberty. J Anim Sci 2004;82:2930–6.
[74] Zieba DA, Amstalden M, Morton S, Maciel MN, Keisler DH,
Williams GL. Regulatory roles of leptin at the hypothalamic-
hypophyseal axis before and after sexual maturation in cattle. Biol
Reprod 2004;71:804–12.
[75] Fortes MR, Snelling WM, Reverter A, Nagaraj SH, Lehnert SA,
Hawken RJ, et al. Gene network analyses of first service conception
in Brangus heifers: use of genome and trait associations,
hypothalamic-transcriptome information, and transcription factors.
J Anim Sci 2012;90:2894–906.
[76] Castellano JM, Navarro VM, Fernandez-Fernandez R, Nogueiras R,
Tovar S, Roa J, et al. Changes in hypothalamic KiSS-1 system and
restoration of pubertal activation of the reproductive axis by kiss-
peptin in undernutrition. Endocrinology 2005;146:3917–25.
[77] Smith JT, Li Q, Yap KS, Shahab M, Roseweir AK, Millar RP, et al.
Kisspeptin is essential for the full preovulatory LH surge and stim-
ulates GnRH release from the isolated ovine median eminence.
Endocrinology 2011;152:1001–12.
[78] McShane TM, May T, Miner JL, Keisler DH. Central actions of
neuropeptide-Y may provide a neuromodulatory link between
nutrition and reproduction. Biol Reprod 1992;46:1151–7.
[79] Gazal OS, Leshin LS, Stanko RL, Thomas MG, Keisler DH, Anderson LL,
et al. Gonadotropin-releasing hormone secretion into third-ventricle
cerebrospinal fluid of cattle: correspondence with the tonic and
surge release of luteinizing hormone and its tonic inhibition by
suckling and neuropeptide Y. Biol Reprod 1998;59:676–83.
[80] Backholer K, Smith J, Clarke IJ. Melanocortins may stimulate
reproduction by activating orexin neurons in the dorsomedial hy-
pothalamus and kisspeptin neurons in the preoptic area of the ewe.
Endocrinology 2009;150:5488–97.
[81] Laster DB, Smith GM, Cundiff LV, Gregory KE. Characterization of
biological types of cattle (Cycle II). II. Postweaning growth and pu-
berty of heifers. J Anim Sci 1979;48:500–8.
[82] Dearborn DD, Koch RM, Cundiff LV, Gregory KE, Dickerson GE. An
analysis of reproductive traits in beef cattle. J Anim Sci 1973;36:
1032–40.
[83] Taylor JF, Chapple RH, Decker JE, Gregg SJ, Kim JW, McKay SD, et al.
Genomic tools for characterizing monogenic and polygenic traits in
ruminants - using the bovine as an example. In: Reproduction in
domestic ruminants VII. Anchorage, Alaska: Nottingham University
Press; 2010.
 Animal, page 1 of 8 © The Animal Consortium 2017
doi:10.1017/S1751731117001070
animal

Impacts of stocking density on development and puberty

attainment of replacement beef heifers
K. M. Schubach1, R. F. Cooke1†, A. P. Brandão1,2, K. D. Lippolis1, L. G. T. Silva1,2,
R. S. Marques1 and D. W. Bohnert1
1
Oregon State University – Eastern Oregon Agricultural Research Center, Burns, OR 97720, USA; 2UNESP – Faculdade de Medicina Veterinária e Zootecnia,
Botucatu 18168-000, Brazil

(Received 6 October 2016; Accepted 19 April 2017)

In all, 60 Angus × Hereford heifers were ranked by age and BW (210 ± 2 days and 220 ± 2 kg) on day 0, and assigned to: (a) one of
three drylot pens (10 × 14 m pens; 10 heifers/pen) resulting in a stocking density of 14 m2/heifer (HIDENS; n = 3), or ( b) one of three
pastures (25 ha pastures; 10 heifers/pasture), resulting in a stocking density of 25 000 m2/heifer (LOWDENS; n = 3). Pastures were
harvested for hay before the beginning of this experiment, and negligible forage was available for grazing to LOWDENS heifers
during the experiment (days 0 to 182). All heifers received the same limited-fed diet, which averaged (dry matter basis) 4.0 kg/heifer
daily of hay and 3.0 kg/heifer daily of a corn-based concentrate. Heifer shrunk BW was recorded after 16 h of feed and water
withdrawal on days −3 and 183 for BW gain calculation. On day 0, heifers were fitted with a pedometer behind their right shoulder.
Each week, pedometer results were recorded and blood samples were collected for puberty evaluation via plasma progesterone.
Plasma samples collected on days 0, 28, 56, 84, 112, 140, 161 and 182 were also analyzed for cortisol concentrations. On days 0,
49, 98, 147 and 182, hair samples were collected from the tail switch for analysis of hair cortisol concentrations. On days 28, 102
and 175, blood samples were collected for whole blood RNA isolation and analysis of heat shock protein (HSP) 70 and HSP72 mRNA
expression. Heifers from LOWDENS had more ( P < 0.01) steps/week compared with HIDENS. No treatment effects were detected
( P = 0.82) for heifer BW gain. Plasma cortisol concentrations were greater ( P ⩽ 0.05) in LOWDENS compared with HIDENS heifers on
days 84, 140, 161 and 182 (treatment × day interaction; P < 0.01). Hair cortisol concentrations were greater ( P < 0.01) in HIDENS
compared with LOWDENS heifers beginning on day 98 (treatment × day interaction; P < 0.01). Heifers from LOWDENS had greater
( P = 0.04) mean mRNA expression of HSP72, and tended ( P = 0.09) to have greater mean mRNA expression of HSP70 compared
with HIDENS. Heifers from HIDENS experienced delayed puberty attainment and had less ( P < 0.01) proportion of pubertal heifers on
day 182 compared with LOWDENS (treatment × day interaction; P < 0.01). In summary, HIDENS altered heifer stress-related and
physiological responses, and delayed puberty attainment compared with LOWDENS.

Keywords: beef heifers, growth, puberty, stocking density, stress

Implications development programs to optimize reproductive and overall

Rearing replacement beef heifers in drylots with high
stocking density altered stress-related and physiological
responses, and delayed puberty attainment compared with
rearing heifers in pastures with low stocking density. More-
over, these outcomes were independent of heifer nutritional
status and growth rate, but were associated with reduced
physical activity and increased chronic stress most likely
caused by the higher stocking density and/or greater degree
of confinement. Therefore, housing management and
resultant stocking density should be considered in heifer
†
E-mail: reinaldo.cooke@oregonstate.edu
efficiency of cow-calf operations.
Introduction
Public scrutiny on beef production systems is growing
rapidly, and cattle welfare is one of the main targets for
attention (Grandin, 2014). Cattle producers are currently
challenged with improving production efficiency while
fostering animal well-being (Thornton, 2010). Hence,
management regimens that increase beef cattle productivity
and promote animal welfare are warranted to enhance
profitability in beef cattle systems, address the current and
projected increases in beef demand, and satisfy industry and
public requirements for proper animal care.

1
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
 Schubach, Cooke, Brandão, Lippolis, Silva, Marques and Bohnert

Stocking density is one example of management that
impact welfare and productive efficiency in cattle operations
(Fraser et al., 2013). In typical US spring-calving cow-calf
herds, replacement heifers are weaned in the fall and
exposed to their first breeding season the following spring.
Hence, these heifers are commonly reared in drylot systems
to facilitate feeding and management during the fall and
winter (Olson et al., 1992). However, rearing cattle in areas
with elevated stocking density is known to stimulate stress
reactions (Grandin, 2014), whereas acute and chronic stress
directly impairs reproductive function in beef cattle (Dobson
and Smith, 2000). Accordingly, Petersen et al. (2014) repor-
ted that heifers developed in drylots (11 m2/heifer) gained
more BW but had increased heart rate and rested less
compared with contemporary heifers reared on native range
(7400 m2/heifer). Mulliniks et al. (2013) also indicated that
heifers reared in drylots had greater average daily gain
(ADG), but reduced pregnancy rates compared with cohorts
reared on range pastures. Based on this information, it was
hypothesized that elevated stocking density impairs welfare
and reproductive development in beef heifers. To test this
hypothesis, this experiment compared growth, physical
activity, stress-related and physiological responses, and
puberty attainment in heifers reared on high (drylots) or low
(pastures) stocking densities from weaning until the start of
their first breeding season.
All pastures utilized herein were harvested for hay before
the beginning of this experiment, and negligible forage was
available for grazing to LOWDENS heifers throughout the
experimental period due to wintery conditions. Heifers were
weaned 7 days before the beginning of the experiment, and
maintained as a single group within a 6-ha pasture with
ad libitum access to alfalfa-grass hay until day 0. During the
experimental period (days 0 to 182), all heifers received the
same limited-fed diet described in Table 1, in addition to
ad libitum access to water and a commercial mineral
and vitamin mix (Cattleman’s Choice; Performix Nutrition
Systems, Nampa, ID, USA) containing 14% Ca, 10% P, 16%
NaCl, 1.5% Mg, 6000 ppm Zn, 3200 ppm Cu, 65 ppm I,
900 ppm Mn, 140 ppm Se, 136 IU/g of vitamin A, 13 IU/g of
vitamin D3 and 0.05 IU/g of vitamin E. Diets were offered
daily at 0800 h in feed bunks with similar linear space across
treatments (0.7 m/heifer). Hay was offered separated from
concentrate, and the entire diet was completely consumed
within 24 h after being offered.
Sampling
Hay and concentrate samples were collected at the beginning
of the experiment, and analyzed for nutrient content by a
commercial laboratory (Dairy One Forage Laboratory, Ithaca,
NY, USA). Samples were analyzed in triplicates by wet
chemistry procedures as reported by Reis et al. (2015).

Table 1 Composition and nutrient profile of diets offered during the

Material and methods
experiment
This experiment was conducted at the Oregon State
Days 0 Days 70 Days 140
University – Eastern Agricultural Research Center (Burns, OR, Items to 69 to 139 to 182
USA) from September 2015 until March 2016 (days 0 to 182).
All animals were cared for in accordance with acceptable Ingredients (kg/day)
practices and experimental protocols reviewed and approved Alfalfa-grass hay 4.1 4.1 4.0
by the Oregon State University Institutional Animal Care and Whole corn 2.5 3.0 3.5
Use Committee (no. 4757). Soybean meal 0.0 0.0 0.2
Nutrient profile (dry matter basis)1
Dry matter (%) 91.8 86.0 91.7
Animals and treatments
Total digestible nutrients (%)2 70.0 71.3 72.5
On day 0 of the experiment, 60 Angus × Hereford heifers NDF (%) 40.1 38.0 35.4
were ranked by age and BW (initial age = 210 ± 2 days; ADF (%) 26.0 24.3 22.4
initial BW = 220 ± 2 kg) and allocated to: (a) one of three Net energy for maintenance (Mcal/kg)3 1.57 1.62 1.66
drylot pens (10 × 14 m pens; 10 heifers/pen), resulting in a Net energy for gain (Mcal/kg)3 0.96 1.00 1.04
stocking density of 14 m2/heifer (HIDENS; n = 3), or (b) one of CP (%) 10.9 10.9 11.9
three meadow foxtail (Alopecurus pratensis L.) pastures Nutrient intake2
(25 ha pastures; 10 heifers/pasture), resulting in a stocking Dry matter (kg/day) 6.60 7.10 7.80
density of 25 000 m2/heifer (LOWDENS; n = 3). Pasture and Total digestible nutrients (kg/day) 4.62 5.06 5.66
drylot pens were located ~800 and 80 m, respectively, NDF (kg/day) 2.65 2.70 2.76
from the handling facility where cattle were processed ADF (kg/day) 1.72 1.73 1.75
Net energy for maintenance (Mcal/day)2 10.4 11.5 13.0
during the present experiment. Treatments were designed
Net energy for gain (Mcal/day)2 6.34 7.10 8.11
to represent stocking densities of drylot- or pasture-based CP (kg/day) 0.72 0.77 0.93
heifer development programs utilized at the Oregon
State University – Eastern Agricultural Research Center,
1
Values obtained from a commercial laboratory wet chemistry analysis (Dairy
One Forage Laboratory, Ithaca, NY, USA).
and representative of commercial cow-calf operations 2
Calculated with the following equations (NRC, 2000): net energy for main-
(Cooke et al., 2012; Reis et al., 2015). In addition, HIDENS tenance = 1.37 metabolizable energy − 0.138 (metabolizable energy)2 + 0.0105
heifers were exposed to the stocking density recommended (metabolizable energy)3 − 1.12; net energy for gain = 1.42 metabolizable
energy − 0.174 (metabolizable energy)2 + 0.0122 (metabolizable energy)3–
for growing cattle reared in drylot systems (Albin and 0.165, given that metabolizable energy = digestible energy × 0.82, and 1 kg of
Thompson, 1990; Hurnik, 1991). total digestible nutrients = 4.4 Mcal of digestible energy.

2
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070

Net energy for maintenance (NEm) and net energy for gain
(NEg) were calculated using the equations proposed by
the NRC (2000). Nutritional profile of the diets is described
in Table 1.
Heifer shrunk BW was recorded after 16 h of feed and
water withdrawal on days −3 and 183 for ADG calculation.
Heifer temperament was assessed via chute score, exit
velocity and overall temperament score as described by
Cooke (2014) on days 0 and 182. On day 0, heifers were also
fitted with a pedometer (HJ-321; Omron Healthcare, Inc.,
Bannockburn, IL, USA) placed inside a polyester patch
(HeatWatch II; CowChips, LLC, Manalapan, NJ, USA) fixed
behind their right shoulder to assess physical activity
(Haley et al., 2005; Knight et al., 2015). Pedometers had the
capability to store daily data for 7 consecutive days, and
remained in heifers throughout the experimental period.
Each week during the experiment (days 0 to 182), heifer
full BW and pedometer results were recorded, and blood
samples were collected via jugular venipuncture into com-
mercial blood collection tubes (Vacutainer, 10 ml; Becton
Dickinson, Franklin Lakes, NJ, USA) with 158 US Pharmaco-
peial Convention units of freeze-dried sodium heparin for
plasma collection. If pedometer malfunctioned or it was lost,
a new pedometer was inserted during the weekly handling
and data from the previous week was considered missing.
Pedometer data from the day of sampling was discarded
to prevent confounding effects between treatments and
additional activity due to cattle gathering and handling.
All plasma samples were analyzed for progesterone con-
centrations to estimate onset of puberty. Heifers were con-
sidered pubertal once plasma progesterone concentrations
were ⩾1.0 ng/ml, followed by a cyclic pattern of plasma
progesterone < and ⩾1.0 ng/ml suggestive of normal estrous
cycles (Reis et al., 2015). Puberty attainment was declared at
the first sampling that resulted in plasma progesterone
⩾1.0 ng/ml. Heifer age and BW at puberty was calculated
based on weekly full BW measurements and heifer age at the
week of puberty attainment. Heifer full BW on day 182 was
also used to estimate the percentage of mature BW at the end
of the experiment, based on the mature BW of the cowherd
utilized herein (545 kg; Marques et al. 2016). Plasma samples
collected on days 0, 28, 56, 84, 112, 140, 161 and 182 were
also analyzed for concentrations of cortisol.
On days 0, 49, 98, 147 and 182, hair samples were
collected from the tail switch (Burnett et al., 2014) for ana-
lysis of hair cortisol concentrations. Within each sampling,
hair was collected from an area that has not been previously
sampled. Hair was collected using scissors as close to the
skin as possible, and the hair material closest to the skin
(2.5 cm of length, 300 mg of weight) was stored at −80°C
until processed for cortisol extraction. On days 28, 102 and
175, blood samples were also collected via jugular veni-
puncture into PAXgene tubes (BD Diagnostics, Sparks, MD,
USA) for subsequent whole blood RNA isolation and analysis
of heat shock protein (HSP) 70, HSP72, ribosomal protein 9
and β2-microglobulin mRNA expression in whole blood cells
via real-time quantitative reverse transcription (RT)-PCR.
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
Stocking density and heifer development
Laboratory analyses
For plasma collection, blood samples were placed immedi-
ately on ice after sampling, subsequently centrifuged
(2500 × g for 30 min; 4°C), and plasma stored at −80°C on
the same day of collection. Plasma concentrations of pro-
gesterone and cortisol were analyzed using chemilumines-
cent enzyme immunoassays (Immulite 1000; Siemens
Medical Solutions Diagnostics, Los Angeles, CA, USA). The
intra- and interassay CV were, respectively, 5.1% and 5.8%
for progesterone and 4.8% and 7.0% for cortisol.
Cortisol was extracted from hair samples based on the pro-
cedures described by Moya et al. (2013). In brief, hair samples
were cleaned with warm water (37°C) for 30 min, and dried at
room temperature for 24 h. Hair samples were then washed
twice with isopropanol, dried at room temperature for 120 h,
and ground in a 10-ml stainless steel milling cup with a 12-mm
stainless steel ball (Mixer Mill MM400 ball mill;
Retsch, Hannover, Germany) for 5 min at a frequency of 30
repetitions/s. A quantity of 20 mg of ground hair and 1 ml of
methanol were combined into a 7-ml glass scintillation vial,
sonicated for 30 min, and incubated for 18 h at 50°C and 100 r.
p.m. for steroid extraction. Upon incubation, 0.8 ml of metha-
nol was transferred to a 2-ml microcentrifuge tube and
evaporated at 45°C. Samples were reconstituted in 100 μl of
the phosphate-buffered saline supplied with a salivary cortisol
ELISA kit (High Sensitivity 1-E3002; Salimetrics Expanded
Range, State College, PA, USA), and stored at −80°C. Samples
were analyzed for cortisol concentrations using the aforemen-
tioned ELISA kit, whereas intra- and inter-assay CV were,
respectively, 5.8% and 7.3%.
Upon collection, PAXgene tubes were stored at room tem-
perature overnight and then at −80°C until RNA isolation.
Total RNA was extracted from whole blood samples using
the PAXgene Blood RNA Kit (Qiagen, Valencia, CA, USA).
Quantity and quality of isolated RNA were assessed via
UV absorbance (NanoDrop Lite; Thermo Fisher Scientific,
Wilmington, DE, USA) at 260 nm and 260/280 nm ratio,
respectively. Extracted whole blood RNA (120 ng) was reverse
transcribed using the High-Capacity cDNA Reverse Transcrip-
tion Kit with random hexamers (Applied Biosystems, Foster
City, CA, USA). Real-time RT-PCR was completed using the
Fast SYBR Green Master Mix (Applied Biosystems) and
gene-specific primers (20 pM each; Table 2) with the StepOne
Real-time PCR system (Applied Biosystems), according to
procedures described by Rodrigues et al. (2015). At the end
of each RT-PCR, amplified products were subjected to a
dissociation gradient (95°C for 15 s, 60°C for 30 s and 95°C
for 15 s) to verify the amplification of a single product by
denaturation at the anticipated temperature. A sample of
each amplified product was purified with the QIAquick PCR
purification kit (Qiagen) and sequenced at the Oregon State
University – Center for Genome Research and Biocomputing
to verify the specificity of amplification. All amplified products
represented only the genes of interest. Responses were
quantified based on the threshold cycle (CT), the number of
PCR cycles required for target amplification to reach a
predetermined threshold. The CT responses from HSP70
3
 Schubach, Cooke, Brandão, Lippolis, Silva, Marques and Bohnert
Table 2 Primer sequences, accession number and reference for all gene transcripts analyzed by real-time reverse
transcriptase-PCR
Target genes Primer sequence 5' to 3'
Heat shock protein 70
Forward CGGCTTAGTCCGTGAGAACA
Reverse CCGCTCGGTATCGGTGAA
Heat shock protein 72
Forward AACATGAAGAGCGCCGTGGAGG
Reverse GTTACACACCTGCTCCAGCTCC
Ribosomal protein 9
Forward ACATCCCGTCCTTCATCGT
Reverse GCCCTTCTTGGCGTTCTT
β2-microglobulin
Forward GGGCTGCTGTCGCTGTCT
Reverse TCTTCTGGTGGGTGTCTTGAGT
and HSP72 were normalized to the geometrical mean of
CT values from ribosomal protein 9 and β2-microglobulin
(Vandesompele et al., 2002). The CV for the geometrical mean
of ribosomal protein 9 and β2-microglobulin CT values across
all samples was 2.5%. Results are expressed as relative fold
change (2 ΔΔCT ), as described by Rodrigues et al. (2015).
Statistical analysis
All data were analyzed using pen or pasture (three replica-
tions per treatment) as experimental unit, with the MIXED or
GLIMMIX procedure of SAS (SAS Institute Inc., Cary, NC,
USA) for quantitative and binary data, respectively, and
Satterthwaite approximation to determine the denominator
df for the tests of fixed effects. One heifer from the LOWDENS
treatment was already pubertal at the beginning of the
experiment; hence, results from this heifer were removed
from the experiment. All data were analyzed using replica-
tion (treatment) and heifer (replication) as random effects.
The model statement used for ADG, initial and final BW,
initial and final temperament variables, as well as heifer BW
and age at puberty contained the effects of treatment. The
model statement for puberty attainment, physical activity
and physiological variables contained the effects of treat-
ment, day and the treatment × day interaction. The specified
term used in the repeated statement was day, the subject
was heifer (replication), and the covariance structure utilized
was autoregressive, which provided the best fit for these
analyses according to the Akaike information criterion.
Results are reported as least square means. Significance was
set at P ⩽ 0.05 and tendencies were determined if P > 0.05
and ⩽0.10. Results are reported according to effect of
treatment if no interactions were significant, or according to
the highest order interaction detected.
Results
Growth and physical activity
A treatment effect was detected (P < 0.01) for phy-
sical activity, given that LOWDENS had more steps/week
4
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
Accession no. Reference
BTU09861 Liu et al. (2014)
U02892 Lacetera et al. (2006)
NM001101152 Liu et al. (2014)
NM_173893 Rodrigues et al. (2015)
compared with HIDENS heifers throughout the experiment
(Table 3). No treatment differences (P = 0.82) were detected
for heifer BW and ADG during the experimental period
(Table 3). In addition, heifer full BW and percentage of
mature BW at the end of the experiment (day 182) were
similar (P = 0.57) between HIDENS and LOWDENS heifers
(364 and 368 kg of full BW, SEM = 5; 66.8% and 67.6% of
mature BW, SEM = 1.0; respectively).
Physiological parameters
A treatment × day interaction was detected (P < 0.01) for
plasma cortisol concentration (Figure 1), which was greater
(P ⩽ 0.05) in LOWDENS compared with HIDENS heifers
on days 84, 140, 161 and 182 of the experiment. A treat-
ment × day interaction was also detected (P < 0.01) for hair
cortisol concentrations, which were greater (P < 0.01) for
HIDENS compared with LOWDENS heifers on days 98, 147
and 182 (Figure 2). Heifers from the LOWDENS group had
greater (P = 0.04) mean mRNA expression of HSP72, and
tended (P = 0.09) to have greater mean mRNA expression of
HSP70 compared with HIDENS heifers during the experiment
(Table 3; treatment × day interaction, P = 0.26).
Temperament parameters
No treatment differences were detected for temperament
traits (P = 0.37), given that LOWDENS and HIDENS heifers had
similar chute score, exit velocity and overall temperament
score at the beginning and end of the experiment (Table 3)
Puberty attainment
A treatment × day interaction was detected (P < 0.01) for
puberty attainment, as HIDENS heifers experienced delayed
puberty attainment compared with LOWDENS heifers
(Figure 3). At the end of the experimental period, a greater
(P < 0.01; Figure 3) proportion of LOWDENS were pubertal
compared with HIDENS heifers (65.4% v. 31.9% pubertal
heifers/total heifers; SEM = 5.5). Within heifers that reached
puberty during the experiment, HIDENS were heavier
(P < 0.01) and older (P = 0.04) at puberty attainment
 Stocking density and heifer development

compared with LOWDENS heifers (324% v. 372 kg of BW, LOWDENS had greater area available for movement com-
SEM = 10; 331 v. 364 days of age, SEM = 12; respectively). pared with HIDENS heifers. Others have also reported greater
physical activity in heifers reared on pasture compared with
Discussion drylot cohorts (Petersen et al., 2014; Perry et al., 2015).
Hence, HIDENS heifers were not only exposed to greater
Growth and physical activity
stocking density, but also had less opportunity to exercise
Treatment differences detected for steps/week were expec-
compared with LOWDENS heifers.
ted based on the current experimental design, given that
Although elevated physical activity may increase main-
Table 3 Activity, growth parameters, temperament variables and tenance requirements and reduce growth rates in cattle
whole blood mRNA expression of heat shock proteins (HSP) in heifers (NRC, 2000), LOWDENS and HIDENS heifers had similar BW
reared in low stocking density (25 000 m2/heifer; LOWDENS, n = 3) or and ADG during the experimental period (Table 3). According
high stocking density (14 m2/heifer; HIDENS, n = 3)1 to the NRC (2000) model, stocking density and space
allowance assigned to LOWDENS, their NEm requirements
Items LOWDENS HIDENS SEM P
could be up to 15% greater compared with NEm require-
Activity ments of HIDENS heifers. Petersen et al. (2014) and Perry
Steps/week2 19 709 3148 628 <0.01 et al. (2015) also reported greater ADG in heifers reared in
Growth parameters drylot compared with pastures, although nutritional man-
Initial BW on day −3 (kg) 211 212 3 0.82 agement differed among heifer groups. In this experiment,
Final BW on day 183 (kg) 356 358 5 0.84 pasture availability and grazing activity of LOWDENS heifers
ADG (kg/day)3 0.777 0.783 0.018 0.82 were deemed negligible due to previous hay harvest and
Temperament variables4 snow cover resultant from wintery conditions. Hence, it is
Chute score unlikely that LOWDENS heifers consumed pasture in
Initial (day 0) 1.93 1.80 0.12 0.45 amounts that fulfilled potential increases in their NEm
Final (day 182) 1.85 1.89 0.11 0.76
requirements, although pasture availability and intake were
Exit velocity (m/s)
Initial (day 0) 2.50 2.25 0.19 0.37
not evaluated herein to fully support this rationale. Given
Final (day 182) 1.62 1.67 0.15 0.80 that HIDENS and LOWDENS heifers were offered and com-
Temperament score pletely consumed the same limit-fed diet, BW and ADG
Initial (day 0) 2.45 2.35 0.16 0.60 results suggest that the stocking densities evaluated herein
Final (day 182) 2.44 2.39 0.17 0.83 did not impact growth rates in beef heifers receiving the
HSP mRNA expression5 same dietary regimen.
HSP70 (fold effect) 3.72 2.39 0.46 0.09
HSP72 (fold effect) 3.48 2.77 0.18 0.04 Physiological parameters
1
From days 0 to 182, HIDENS heifers were reared in one of three drylot pens Treatment differences detected for plasma cortisol con-
(10 × 14 m pens; 10 heifers/pen) and LOWDENS heifers were reared in one of centrations do not corroborate with the hypothesis that cattle
three meadow foxtail (Alopecurus pratensis L.) pastures (25 ha pastures; reared in elevated stocking density experience increased
10 heifers/pasture).
2
Based on pedometers (HJ-321; Omron Healthcare, Inc., Bannockburn, IL, USA) adrenocortical stress response (Huzzey et al., 2012; Grandin,
assessed every 7 days during the experimental period. 2014). Circulating cortisol concentrations have been widely
3
Calculated using initial (day −3) and final (day 183) shrunk BW, which was used as a biomarker of stress in cattle (Carroll and Forsberg,
recorded after 16 h of feed and water withdrawal.
4
According to the techniques described by Cooke (2014), and evaluated on 2007). However, plasma cortisol concentrations are also
days 0 and 182 of the experiment. promptly increased in response to physical activity (Hill et al.,
5
Samples collected on days 28, 102 and 175 of the experiment, processed and 2008). Hence, treatment differences for plasma cortisol can be
evaluated for mRNA expression according to Rodrigues et al. (2015). The
treatment × day interaction was not significant (P = 0.24); hence, results are attributed, at least partially, to the additional activity of
reported according to main treatment effects. gathering and bringing the LOWDENS heifers from pasture to

50 HIDENS LOWDENS
Panel A **
45
Plasma cortisol, ng/mL

40
* * *
35
30
25
20
15
10
5
0
0 28 56 84 112 140 161 182
Figure 1 Plasma cortisol concentrations from heifers reared in low stocking density (25 000 m /heifer; LOWDENS; n = 3) or high stocking density (14 m2/
2

heifer; HIDENS; n = 3) from days 0 to 182 of the experiment. A treatment × day interaction was detected (P < 0.01). Within days: *P ⩽ 0.05, **P ⩽ 0.01.

5
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
 Schubach, Cooke, Brandão, Lippolis, Silva, Marques and Bohnert

the handling facility, whereas HIDENS heifers were grouped in cortisol concentration to cross the skin line and become
drylot pens adjacent to the handling facility. available for collection (Burnett et al., 2014). Treatment
Accordingly, treatment differences detected for hair cortisol effects on hair cortisol concentrations may also help explain-
concentration support this latter rationale and the main ing the similar ADG among HIDENS and LOWDENS heifers. It
hypothesis of this research. Cortisol concentration in hair from can be speculated that the greater chronic stress experienced
the tail switch has been recently validated as biomarker of by HIDENS heifers during the experiment increased their basal
chronic stress in cattle (Burnett et al., 2014; Moya et al., metabolism and maintenance requirements to the same level
2015). Cortisol is gradually accumulated in the emerging tail that physical activity increased these parameters in LOWDENS
hair and its concentration represents long-term adrenocortical heifers (NRC, 2000; Petersen et al., 2014).
activity rather than concurrent circulating cortisol concentra- Expression of HSP in whole blood cells can also be used
tions (Moya et al., 2013; Burnett et al., 2014; Cooke et al., as diagnostic marker of stress, given that HSP are rapidly
2017). Hence, measuring cortisol in hair from the tail switch synthesized when cells are exposed to a variety of stressors
eliminates the confounding effects that gathering and hand- (Welch, 1992). Therefore, treatment effects of whole blood
ling cattle exert on plasma cortisol concentrations (Moya mRNA expression of HSP70 and HSP72 also do not corrobo-
et al., 2013, Moya et al., 2015). Treatment differences rate with the hypothesis of this research and treatment
detected for hair cortisol concentration (Figure 2) suggest that effects detected for hair cortisol concentrations. Nevertheless,
chronic stress and adrenocortical activity were indeed greater exercise has been shown to stimulate mRNA expression
in HIDENS compared with LOWDENS heifers. Such outcomes and circulating concentrations of these HSP in rodents and
were only noted beginning on day 98 of the experiment, humans (Naito et al., 2001; Febbraio et al., 2002; Milne and
which might be associated with the time required for elevated Noble, 2002). Exercise activates the heat shock response via
stocking density to be perceived as a stressor by HIDENS several mechanisms including increased muscle temperature,
heifers, as well as the time required for hair with elevated exercise-related production of reactive oxygen species and
muscle ATP depletion (Noble et al., 2008). Thus, treatment
10
effects detected for whole blood mRNA expression of HSP70
Hair cortisol, pg/mg of hair

9 HIDENS LOWDENS ** and HSP72 should be attributed to the greater physical

8
7 **
activity of LOWDENS v. HIDENS heifers, either on a daily
6 basis according to differences in stocking rate and steps/
5 **
4
week (Table 3), or during gathering for weekly samplings
3 corroborating with plasma cortisol outcomes (Figure 1).
2
1
0 Temperament parameters
0 49 98 147 182
Rearing cattle in intensive systems, such as drylot with ele-
Day of the experiment
vated stocking density, results in increased human-animal
Figure 2 Cortisol concentrations in tail switch hair from heifers reared interaction, which has been shown to impact cattle tem-
in low stocking density (25 000 m2/heifer; LOWDENS; n = 3) or high
stocking density (14 m2/heifer; HIDENS; n = 3) from days 0 to 182 of the
perament and subsequent productivity (Cooke, 2014).
experiment. A treatment × day interaction was detected (P < 0.01). However, treatments evaluated herein did not impact heifer
Within days: **P ⩽ 0.01. temperament variables as reported in Table 3; perhaps the

80
**
70 **
**
60 **
Pubertal heifers, %

**
50

40 ** **
**
30 ** ** ** ** **
* * * * *
20

10

0
0 14 28 42 56 70 84 98 112 126 140 154 168 182
Day of the experiment

Figure 3 Puberty attainment in heifers reared in low stocking density (25 000 m2/heifer; LOWDENS, n = 3, represented by gray line) or high stocking
density (14 m2/heifer; HIDENS, n = 3, represented by black line) from days 0 to 182 of the experiment. Puberty was evaluated according to plasma
progesterone concentrations in samples collected weekly during the experiment. Heifers were considered pubertal once plasma progesterone
concentrations were ⩾1.0 ng/ml, followed by a cyclic pattern of plasma progesterone < and ⩾1.0 ng/ml suggestive of normal estrous cycles (Reis et al.,
2015). Puberty attainment was declared at the first sampling that resulted in plasma progesterone ⩾1.0 ng/ml. A treatment × day interaction was detected
(P < 0.01). Within days: *P ⩽ 0.05, **P ⩽ 0.01.

6
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070

level of interaction between HIDENS heifers and research
personnel was not sufficient to impact heifer temperament.
Cattle temperament has been directly associated with
neuroendocrine reactions and subsequent circulating cortisol
concentrations (Cooke, 2014). Hence, treatment differences
detected for plasma and hair cortisol concentrations should
not be attributed to heifer temperament, which in turn
did not impact any of the heifer performance parameters
evaluated herein.
Puberty attainment
Age at puberty in cattle is highly determined by BW and growth
rate (Schillo et al., 1992); however, HIDENS heifers experienced
delayed puberty attainment compared with LOWDENS heifers
(Figure 3) despite their similar ADG (Table 2). It is also impor-
tant to note that heifers from both treatments achieved the
recommended BW for puberty attainment during the experi-
mental period (60% to 65% of mature BW; Patterson et al.,
1992). These results indicate that rearing heifers in high
stocking density delayed their onset of puberty despite ade-
quate age and BW development, and reasons for this outcome
likely include treatment differences among physical activity and
chronic stress parameters. Regarding physical activity, exercise
stimuli alter circulating concentrations of endogenous opioids
that modulate gonadotropin secretion and consequent onset of
puberty, cyclicity and fertility in cattle (Mahmoud et al., 1989).
Accordingly, Lamb et al. (1979) reported that prepartum
exercise regimens enhanced subsequent reproductive
efficiency in dairy heifers without impacting BW change.
Regarding stress and puberty attainment, chronic stress and
the resultant increase in adrenocortical activity impairs gona-
dotrophin synthesis and release and reduces the sensitivity of
the brain to estrogen (Dobson and Smith, 2000). Hence, the
reduced physical activity and increased adrenocortical activity
of HIDENS heifers, as evidenced by treatment differences on
steps/week and hair cortisol concentrations, likely contributed
to their delayed puberty attainment compared with LOWDENS
cohorts.
Overall conclusions
In conclusion, rearing replacement beef heifers in drylots
with high stocking density impacted stress-related and phy-
siological responses, and delayed puberty attainment com-
pared with rearing heifers on pastures with low stocking
density. Moreover, these outcomes were independent of
heifer nutritional status and growth rate, but were associated
with reduced physical activity and increased chronic stress
most likely caused by the higher stocking density and/or
greater degree of confinement. Therefore, housing manage-
ment and resultant stocking density should be considered in
heifer development programs to optimize reproductive and
overall efficiency of cow-calf operations.
Acknowledgments
Financial support for this research was provided by the Agri-
cultural Research Foundation. Dr Reinaldo Cooke is also affiliated
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
Stocking density and heifer development
as permanent professor to the Programa de Pós-Graduação em
Zootecnia/Faculdade de Medicina Veterinária e Zootecnia,
UNESP – Universidade Estadual Paulista, Botucatu, SP 18618-
970, Brazil.
References
Albin RC and Thompson GB 1990. Cattle feeding: a guide to management.
Trafton Printing, Inc., Amarillo, TX, USA.
Burnett TA, Madureira AML, Silper BF, Nadalin A, Tahmasbi AM, Veira DM and
Cerri RLA 2014. Short communication: factors affecting hair cortisol
concentration in lactating dairy cows. Journal of Dairy Science 97, 7685–7690.
Carroll JA and Forsberg NE 2007. Influence of stress and nutrition
on cattle immunity. Veterinary Clinics of North America: Food Animal Practice 23,
105–149.
Cooke RF 2014. Temperament and acclimation to human handling influence
growth, health, and reproductive responses in Bos taurus and B. indicus cattle.
Journal of Animal Science 92, 5325–5333.
Cooke RF, Bohnert DW, Cappellozza BI, Mueller CJ and DelCurto T 2012. Effects
of temperament and acclimation to handling on reproductive performance of
Bos taurus beef females. Journal of Animal Science 90, 3547–3555.
Cooke RF, Schubach KM, Marques RS, Peres RG, Silva LGT, Carvalho R, Cipriano
RS, Bohnert DW, Pires AV and Vasconcelos JLM 2017. Effects of temperament on
physiological, productive, and reproductive responses in Bos indicus beef cows.
Journal of Animal Science 95, 1–8.
Dobson H and Smith RF 2000. What is stress and how does it affect reproduc-
tion? Animal Reproduction Science 60-61, 743–752.
Febbraio MA, Ott P, Nielsen HB, Steensberg A, Keller C, Krustrup P, Secher NH
and Pedersen BK 2002. Exercise induces hepatosplanchnic release of heat shock
protein 72 in humans. Journal of Physiology 544, 957–962.
Fraser D, Duncan IJ, Edwards SA, Grandin T, Gregory NG, Guyonnet V,
Hemsworth PH, Huertas SM, Huzzey JM, Mellor DJ, Mench JA, Spinka M and
Whay HR 2013. General principles for the welfare of animals in production
systems: the underlying science and its application. The Veterinary Journal 198,
19–27.
Grandin T 2014. Livestock handling and transport: theories and applications,
4th edition. CABI Publishing, Wallingford, UK.
Haley DB, Bailey DW and Stookey JM 2005. The effects of weaning beef calves in
two stages on their behavior and growth rate. Journal of Animal Science 83,
2205–2214.
Hill EE, Zack E, Battaglini C, Viru M, Viru A and Hackney AC 2008. Exercise and
circulating cortisol levels; the intensity threshold effect. Journal of Endocrino-
logical Investigation 31, 587–591.
Hurnik H 1991. Recommended code of practice for the care and handling of farm
animals – beef cattle. Agriculture Canada Publication 1870/E, Ottawa, ON,
Canada.
Huzzey JM, Nydam DV, Grant RJ and Overton TR 2012. The effects of over-
stocking Holstein dairy cattle during the dry period on cortisol secretion and
energy metabolism. Journal of Dairy Science 95, 4421–4433.
Knight CW, Bailey DW, Faulkner D and Schafer DW 2015. Intake and grazing
activity of mature range cows on Arizona rangelands. Proceedings, Western
Section, American Society of Animal Science 66, 222–224.
Lacetera N, Bernabucci U, Scalia D, Barisico L, Morera P and Nardone A 2006.
Heat stress elicits different responses in peripheral blood mononuclear cells from
Brown Swiss and Holstein cows. Journal of Dairy Science 89, 4606–4612.
Lamb RC, Barker BO, Anderson MJ and Walters JL 1979. Effects of forced exercise
on two-year-old Holstein heifers. Journal of Dairy Science 62, 1791–1797.
Liu J, Ye G, Zhou Y, Liu Y, Zhao L, Liu Y, Chen X, Huang D, Liao SF and Huang K
2014. Feeding glycerol-enriched yeast culture improves performance, energy
status, and heat shock protein gene expression of lactating Holstein cows under
heat stress. Journal of Animal Science 92, 2494–2502.
Mahmoud AI, Thompson FN, Peck DD, Mizinga KM, Leshin LS, Rund LA,
Stuedemann JA and Kiser TE 1989. Difference in luteinizing hormone response
to an opioid antagonist in beef heifers and cows. Biology of Reproduction 41,
431–437.
Marques RS, Cooke RF, Rodrigues MC, Cappellozza BI, Larson CK, Moriel P and
Bohnert DW 2016. Effects of organic or inorganic Co, Cu, Mn, and Zn
7
 Schubach, Cooke, Brandão, Lippolis, Silva, Marques and Bohnert
supplementation to late-gestating beef cows on productive and physiological
responses of the offspring. Journal of Animal Science 94, 1215–1226.
Milne KJ and Noble EG 2002. Exercise-induced elevation of HSP70 is intensity
dependent. Journal of Applied Physiology 93, 561–568.
Moya D, He ML, Jin L, Wang Y, Penner GB, Schwartzkopf-Genswein KS and
McAllister TA 2015. Effect of grain type and processing index on growth
performance, carcass quality, feeding behavior, and stress response of
feedlot steers. Journal of Animal Science 93, 3091–3100.
Moya D, Schwatzkopf-Genswein KS and Veira DM 2013. Standarization of a
non-invasive methodology to measure cortisol in hair of beef cattle. Livestock
Science 158, 138–144.
Mulliniks JT, Hawkins DW, Kane KK, Cox SH, Torrell LA, Scholljegerdes EJ and
Petersen MK 2013. Metabolizable protein supply while grazing dormant winter
forage during heifer development alters pregnancy and subsequent in-herd
retention rate. Journal of Animal Science 91, 1409–1416.
Naito H, Powers SK, Demirel JA and Aoki J 2001. Exercise training increases heat
shock protein in skeletal muscles of old rats. Medicine and Science in Sports and
Exercise 33, 729–734.
Noble EG, Milne KJ and Melling CWJ 2008. Heat shock proteins and exercise:
a primer. Applied Physiology, Nutrition, and Metabolism 33, 1050–1065.
National Research Council (NRC) 2000. Nutrient requirements of beef cattle, 7th
revised edition. National Academic Press, Washington, DC, USA.
Olson KC, Jaeger JR and Brethour JR 1992. Growth and reproductive perfor-
mance of heifers overwintered in range or drylot environments. Journal of
Production Agriculture 5, 72–76.
Patterson DJ, Perry RC, Kiracofe GH, Bellows RA, Staigmiller RB and Corah LR
1992. Management considerations in heifer development and puberty. Journal
of Animal Science 70, 4018–4035.
8
Downloaded from https:/www.cambridge.org/core. Cornell University Library, on 24 May 2017 at 00:52:42, subject to the Cambridge Core terms of use, available at
https:/www.cambridge.org/core/terms. https://doi.org/10.1017/S1751731117001070
Perry GA, Larimore EL, Perry BL and Walker JA 2015. Grazing behavior of drylot
developed beef heifers and the influence of post-AI supplementation on AI
pregnancy success. Professional Animal Scientist 31, 264–269.
Petersen MK, Muscha JM, Roberts AJ and Waterman RC 2014. Can
method of weaning and subsequent development impact heifer fitness.
Proceedings, Western Section, American Society of Animal Science 65,
116–119.
Reis MM, Cooke RF, Cappellozza BI, Marques RS, Guarnieri Filho TA, Rodrigues
MC, Bradley JS, Mueller CJ, Keisler DH, Johnson SE and Bohnert DW 2015.
Creep-feeding to stimulate metabolic imprinting in nursing beef heifers:
Impacts on heifer growth, reproductive, and physiological parameters. Animal 9,
1500–1508.
Rodrigues MC, Cooke RF, Marques RS, Arispe SA, Keisler DH and Bohnert DW
2015. Effects of oral meloxicam administration to beef cattle receiving
lipopolysaccharide administration or vaccination against respiratory pathogens.
Journal of Animal Science 93, 5018–5027.
Schillo KK, Hall JB and Hileman SM 1992. Effects of nutrition and season
on the onset of puberty in the beef heifer. Journal of Animal Science 70,
3994–4005.
Thornton PK 2010. Livestock production: recent trends, future prospects.
Philosophical Transactions of the Royal Society B: Biological Sciences 365,
2853–2867.
Vandesompele J, de Preter K, Pattyn F, Poppe B, Van Roy N, de Paepe A
and Speleman F 2002. Accurate normalization of real-time quantitative RT-PCR
data by geometric averaging of multiple internal control genes. Genome
Biology 3, research0034-1.
Welch WJ 1992. Mammalian stress response: cell physiology, structure/function
of stress proteins, and implications for medicine and disease. Physiological
Reviews 72, 1063–1081.
 CHALID TALIB: Sapi Bali di Daerah Sumber Bibit dan Peluang Pengembangannya

SAPI BALI DI DAERAH SUMBER BIBIT DAN PELUANG

PENGEMBANGANNYA

CHALID TALIB
Balai Penelitian Ternak, P.O. Box 221, Bogor 16002

ABSTRAK

Sapi Bali sebagai sapi asli Indonesia telah tersebar di seluruh wilayah Indonesia dan disukai oleh peternak rakyat yang
umumnya berskala usaha kecil. Sapi ini mudah beradaptasi dengan baik pada berbagai lingkungan yang ada dengan
menampilkan performan produksi yang cukup bervariasi dan performan reproduksi yang tetap tinggi. Daerah sumber bibit utama
sapi Bali adalah Bali, Sulawesi Selatan, Nusa Tenggara Timur (NTT) dan Nusa Tenggara Barat (NTB). Performan produksi sapi
Bali pada daerah ini menunjukkan bahwa secara keseluruhan produktivitas sapi Bali di Bali adalah yang terbaik dan berdasarkan
populasi maka Sulawesi Selatan memiliki populasi sapi Bali terbanyak. Bila diamati dari tingkat kesuburan maka sapi Bali pada
semua daerah sumber bibit ini tetap menunjukkan prolifikasi yang tinggi tetapi pada saat panen anak maka diketahui bahwa
kematian anak tertinggi adalah di NTT dan terendah di Bali. Adanya penurunan bobot dewasa sapi dara di luar Pulau Bali
disamping menunjukkan daya adaptasi yang luar biasa dari bangsa ini terhadap cekaman iklim dan kurang pakan, juga sekaligus
menggambarkan bahwa tanpa perbaikan genetik yang tertata baik dan dibawah pengaruh lingkungan yang kurang mendukung,
sapi Bali cenderung memperkecil ukuran tubuhnya. Oleh karenanya pemasukan darah baru unggul sudah selayaknya menjadi
prioritas dalam pengembangan sapi Bali yang berjalan seiring dengan program perbaikan pakan dan manajemen, diharapkan
ketiganya dapat berjalan bersama.
Kata kunci: Sapi Bali, bibit, produktivitas dan pengembangan

ABSTRACT

BALI CATTLE IN THE BREEDING STOCK AREAS AND THEIR FUTURE DEVELOPMENT

Bali cattle is one of Indonesian native breed of cattle distributed in almost all Indonesian provinces under small holder
rearing system. The breed is easily adapted within many variations of tropical environment in Indonesia. Although there are a big
differences of the production performance between places but the reproduction performances reported are always good. The Bali
cattle resources in the country are Bali, South Sulawesi, East and West Nusa Tenggara (NTT and NTB). Based on the production
performance, Bali cattle in Bali are the best Bali cattle in Indonesian and in population, South Sulawesi is province having the
highest population of the cattle. All of Bali cattle in the resource areas have a high prolific with a good calving rate but NTT
shows the highest number of calf mortality and Bali is the lowest. Except in Bali, Bali heifers perform a decline adult body
weight that caused by no genetik improvement program and less of supported environment. All of the phenomenons are as as a
guidance for a higghly adaptation ability of the breed. In addition, introducing a new blood with highly genetic potential together
with the improvement in feeding and management should be conducted.
Key words: Bali cattle, breeding stock, production and development

PENDAHULUAN berhasilnya pengembangan sapi Bali di Jawa

Sapi Bali adalah sapi asli Indonesia sebagai hasil
domestikasi dari banteng liar yang telah berjalan lama.
Kapan dimulainya proses penjinakan banteng belum
diketahui dengan jelas, demikian pula dengan mengapa
lebih terkenal di Indonesia sebagai sapi Bali dan
bukannya sapi banteng mengingat dalam keadaan liar
dikenal sebagai banteng. Pendapat yang bisa dirujuk
adalah dijinakkan di Jawa dan Bali (HERWEIJER, 1947;
MEIJER, 1962; PANE, 1990 dan 1991) dan dalam
perkembangannya ternyata kondisi di Bali lebih sesuai
bagi bangsa sapi ini karena adanya budaya orang Bali
yang memuliakan ternak sapi. Sementara itu tidak
kemungkinan disebabkan karena cukup tingginya
populasi ternak domba yang kemungkinan besar telah
menjadi carrier dari penyakit MCF yang mudah sekali
menulari sapi Bali dengan akibat yang cukup fatal bagi
bangsa sapi ini. Hal yang berbeda terdapat di beberapa
wilayah di Indonesia seperti Sulawesi, Nusa Tenggara,
Maluku, Sumatera dan Kalimantan.
Dalam keadaan liar, habitat asli banteng di
Indonesia, adalah di Jawa Timur (Blauran) dan di Jawa
Barat (Ujung Kulon). Dari galur yang lebih kecil,
banteng juga ditemukan di perbatasan hutan
Kalimantan Timur, Laos, Vietnam dan di Semenanjung
Coubourgh di Australia Utara (SCHERF, 1995).

100
 WARTAZOA Vol. 12 No. 3 Th. 2002

Walaupun demikian yang pasti sesuai dengan namanya,
dapat dikatakan bahwa sapi Bali di Indonesia hampir
semuanya bermula dari sapi Bali yang ada di Bali dan
hasil pembuktian lanjutan menunjukkan bahwa sapi
Bali di Bali adalah yang paling murni (NAMIKAWA dan
WIDODO, 1978; NAMIKAWA et al., 1980) jika
digunakan darah banteng sebagai kontrolnya.
Secara umum bila dilihat dari peta penyebaran
sapi Bali di luar Indonesia, ternyata sapi Bali juga
terdapat di negara Asia Tenggara lainnya, Australia
Utara dan sedikit di peternakan khusus di Texas dan
Australia (Brisbane dan NSW) dan juga dalam jumlah
terbatas tersebar di 112 buah tempat penangkaran dan
kebun binatang di seluruh dunia. Pada tempat-tempat
yang disebut belakangan, sapi Bali lebih dikenal
sebagai “banteng cattle” (DEVENDRA et al., 1973;
KIRBY, 1979; SCHERF, 1995; TALIB et al., 1998).
ASAL-USUL
Ada bermacam-macam bangsa sapi di dunia dari
ukuran yang besar lebih dari satu ton dan ada juga sapi
kate yang ukuran dewasanya kurang dari 100 kg
(LASLEY, 1981). Walaupun demikian semua sapi
termasuk dalam genus Bos, dengan klasifikasi menurut
zoology sebagaimana terlihat dalam Gambar 1.

Class Mammalia

Order Artiodactyla
(even-toed, hoofed
animals)

Family Bovidae
(hollow horned)

Taurine Group Bibovine group Bisontine group Bubaline group

Bos taurus Bos gaurus Bos grunniers Bos caffer
Ordinary cattle The guar The yak The African buffalo

Bos indicus Bos frontalis Bos bonasus Bos buballus

Humped cattle The gayal The European bison The Indian bufallo

Bos sundaicus Bos bison

The banteng The American bison

Gambar 1. Klasifikasi menurut zoology untuk genus Bos

101
 CHALID TALIB: Sapi Bali di Daerah Sumber Bibit dan Peluang Pengembangannya
Gambar1 menunjukkan bahwa yang menjadi
anggota dari Famili Bovidae antara lain Bos taurus
(Sapi Eropa dan sapi di Afrika), Bos indicus (Sapi di
anak benua India dan sebagian besar sapi di Afrika)
dan Bubaline sp. (kerbau). Di beberapa negara juga
telah diternakkan sapi-sapi yang tidak termasuk dalam
ketiga anggota di atas yaitu Bos bison di Amerika
Serikat, Bos grunniens di negara-negara sekitar
pegunungan Himalaya dan Bos sundaicus (Bibos
banteng, Bos javanicus) di Indonesia dan beberapa
negara Asia Tenggara dan Australia Utara yang juga
dikenal sebagai sapi Banteng atau sapi Bali.
Keluarga bovidae ini memiliki jumlah pasangan
kromosom yang bervariasi dari 30–60 tetapi jumlah
dasar pasangan kromosom dari keluarga ruminansia ini
sebenarnya hanya bervariasi dari 58–62 pasang. Bos
taurus, Bos indicus dan Bos sundaicus memiliki jumlah
pasangan kromosom yang sama yaitu 60 pasang
(PAYNE dan ROLLINSON, 1973). Oleh karena itu secara
teoritis mereka seharusnya dapat dikawinkan satu
dengan lainnya dengan keturunan yang fertil. Dalam
meneliti mengenai sel-sel karyotype didapatkan bahwa
kromosom Y pada ternak jantan dari Bos sundaicus
hampir identik dengan yang dimiliki oleh Bos taurus
tetapi berbeda cukup jauh dengan Bos indicus (KIRBY,
1979). Pengamatan lanjutan yang dilakukan diperoleh
hasil yang menunjukkan bahwa Bos taurus dan Bos
indicus sekitar tiga juta tahun yang lalu memiliki tetua
yang sama yang dikenal sebagai Bos primigenius–
Aurochs, kemudian kedua kelompok baru mulai
dibentuk sekitar satu juta tahun yang lalu terutama
melalui penjinakan (LASLEY, 1981; KIKKAWA et al.,
1995), yang pada akhirnya dikenal tetua dari Bos
indicus sebagai Bos namadicus yang menurunkan
sekitar 600.000 juta sapi Zebu di Asia dan Afrika
(FAO, 1995). Selanjutnya KIKKAWA dengan teman-
temannya melalui penelusuran RFPLs dari mitochondria
dan DNA pada genom mitochondria mendapatkan
bahwa Bos sundaicus (Sapi Bali) ternyata memiliki
nenek moyang yang berbeda dengan Bos taurus dan
Bos indicus. Hasil yang ditunjukkan oleh KIKKAWA
dan kelompoknya ini lebih dapat diterima karena
kenyataannya semua persilangan sapi Bali dengan Bos
taurus maupun Bos indicus menghasilkan keturunan
jantan yang infertile (KIRBY, 1979).
Hasil ini menarik karena sekaligus membuka
suatu cakrawala baru pengembangan sapi Bali di
Indonesia. Berdasarkan Gambar 1 dan bentuk phenotype
antara sapi Bali dan Bos gaurus yang terkenal dengan
nama sapi Mithan di pegunungan Tibet dan sekitarnya,
seharusnya sapi Bali dapat dikembangkan melalui
perkawinan dengan sapi Mithan ini. Diharapkan
keturunannya akan besar-besar dan bersaing dengan
sapi Zebu dan sapi Taurine dengan pertumbuhan yang
102
cepat dan fertil (subur) pada kondisi tropis-basah
maupun kering di Indonesia.
PRODUKTIVITAS
Sapi Bali telah menunjukkan pewarnaan yang
seragam dengan sedikit kelainan-kelainan yang sering
timbul, tetapi karena kelainan warna ini tidak disukai
oleh peternak maka dengan cepat menghilang dari
populasi. Akhir-akhir ini dilaporkan bahwa pada
beberapa lokasi di NTB dan Bali ada kecenderungan
peternak mempertahankan kelainan-kelainan yang ada
seperti sapi Bali albino di Desa Taro yang digunakan
untuk ritual keagamaan dan turisme dan sapi Bali
bintik putih pada caudal yang banyak terdapat di NTB
(TALIB et al., 2002). Kerabatnya yang terdapat di
negara-negara Asia Tenggara menunjukkan warna yang
bervariasi. Bila sapi Bali jantan di Indonesia pada usia
dewasa, warna merah tubuhnya berubah menjadi hitam
karena adanya pengaruh sex-linkage gene dengan
pigmentasi warna bulu (SANDHI et al., 1990), maka lain
halnya dengan kerabatnya di Kambodja dan Laos yang
tetap berwarna merah sampai dewasa dengan ciri-ciri
warna lainnya yang serupa dengan sapi Bali, tetapi
dengan ukuran tubuh dewasa yang sedikit lebih kecil
(SCHERF, 1995). Tetapi laporan mengenai produktivitas-
nya masih sangat terbatas.
Di Indonesia dikenal beberapa daerah sumber
bibit sapi Bali yaitu Bali, Sulawesi Selatan, NTT, NTB
dan akhir-akhir ini adalah Lampung. Walaupun demikian
yang akan dibahas dalam makalah ini hanyalah pada
tiga daerah yang disebut pertama. Sapi Bali di Indonesia
dapat dikatakan bersumber dari sapi Bali yang ada di
Bali, yang penyebarannya baru dimulai pada awal abad
1900an. Walaupun demikian dalam waktu hampir
seratus tahun pengembangannya di luar Bali, sapi-sapi
ini telah menunjukkan variasi yang cukup besar dalam
produktivitasnya.
Penyebaran sapi Bali di berbagai wilayah di
Indonesia
Sapi Bali di Pulau Timor, pertama kali dimasukkan
oleh pemerintah Belanda pada tahun 1912 dari Bali.
Pada tahun 1916 terbukti bahwa sapi Bali sangat baik
adaptasinya di Pulau Timor (DE WILDE, 1916) sehingga
diputuskan pada tahun 1919 untuk lebih berkonsentrasi
pada pengembangan sapi Bali dari sapi lainnya yang
ada di Timor Barat, NTT ini. Pada tahun 1952 jumlah
populasi sapi ini telah mencapai 108.000 ekor. Pada
tahun 1989 diketahui bahwa jumlah sapi Bali di Pulau
Timor menjadi 550.000 ekor dengan jumlah pemilikan
sebesar 4,6 ± 2 ekor per kepala keluarga (MALESSY et
al., 1990; PATRICK, 1994).
 WARTAZOA Vol. 12 No. 3 Th. 2002
Tabel 1. Dinamika populasi ternak sapi di Indonesia dari tahun 1941−1995 (000 ekor)
Ternak 1841 1945
Sapi potong 0,67 3,84
Sapi perah 0,00 0,00
Sapi Bali 0,02 1,14
Sumber: AALF (1934), DITJENNAK (1996; 1997; 2001) data di olah kembali
Pada tahun 1927 sapi Bali dimasukkan ke
Sulawesi Selatan (Rampi) sebanyak 5 ekor dan pada
tahun 1940 jumlahnya telah mencapai 80 ekor. Pada
tahun 1947 sapi Bali disebarkan ke propinsi ini secara
besar-besaran. Sapi-sapi inilah bersama dengan
pendahulunya menjadi cikal bakal sapi Bali di Sulawesi
Selatan yang telah berkembang menjadi propinsi
dengan jumlah sapi Bali terbanyak di Indonesia. Hanya
sayangnya, pada tahun 1964 di Bali terjadi musibah
penyakit jembrana secara besar-besaran yang
menyebabkan sapi Bali tidak boleh dikeluarkan lagi
dari pulau Bali sebagai ternak bibit. Mulai periode inilah
sumber bibit sapi Bali bagi daerah lain di Indonesia
digantikan oleh NTT, Sulawesi Selatan dan NTB.
Pada tahun 1957 dilaporkan bahwa populasi sapi
Bali di Indonesia mencapai 503.000 ekor dan pada tahun
1989 telah mencapai sekitar 3 juta ekor atau sekitar
15% dari total populasi sapi (Tabel 1). Pada tahun 2001
diperkirakan jumlah sapi Bali berada pada kisaran 3,5
juta ekor dari total 12 juta ekor ternak sapi yang ada di
Indonesia atau hampir 30% dari total populasi sapi di
Indonesia.
Melihat jumlah ini ternyata bahwa potensi
pengembangan sapi Bali di Indonesia menunjukkan
grafik pengembangan yang sangat baik dan ada
kecenderungan pada akhirnya dapat menjadi sumber
utama daging sapi di Indonesia bilamana tidak ada
intervensi kebijakan lainnya.
Performan produksi
Sapi Bali termasuk sapi kecil (Tabel 2), dengan
ukuran bobot yang hampir sama dengan beberapa
bangsa sapi kecil lainnya di Afrika dan India. Data ini
juga menunjukkan bahwa variasi bobot badan pada
berbagai tingkat umur pada sapi Bali cukup besar,
sehingga peluang pengembangan melalui seleksi masih
akan efektif. Hasil penelitian TALIB et al. (1998)
menunjukkan bahwa korelasi genetik sapi Bali antara
bobot umur 120 hari dengan bobot sapih dan bobot
setahun maupun dengan bobot lahir dan pertambahan
bobot harian relatif cukup baik. Oleh karena itu sifat ini
dapat dipertimbangkan untuk dijadikan kriteria seleksi,
mengingat produksi susu sapi Bali yang baik hanya
1969 1984 1995 2001
6,45 9,24 11,55 11,64
0,00 0,20 0,34 0,35
1,60 2,20 3,27 3,5
dalam 4 bulan pertama (LIWA, 1990; TALIB et al.,
1999). Korelasi genetik bobot umur 120 hari dengan
sifat-sifat ekonomis lainnya juga ditemukan pada
bangsa sapi lainnya (TALIB, 1988; KRIESSE et al., 1991;
BENNET dan GREGORY, 1996). Cara lain untuk
meningkatkan produktivitas sapi adalah dengan
memanfaatkan Banteng yang memiliki bobot dewasa
yang besar (bilamana susah mencari pejantan sapi Bali
dengan bobot sekitar 600−800 kg di luar pulau Bali)
ataupun sapi Mithan yang memang masih satu tetua
dengan sapi Bali (SCHERF, 1995; TALIB et al., 1997).
Sapi Bali umur sekitar 2 tahun dengan bobot 400 kg
atau umur 4 tahun dengan bobot badan sekitar 600–800
kg dapat ditemukan di Bali. Karena adanya kasus
penyakit-penyakit khas sapi Bali mengakibatkan
potensi yang baik ini belum dapat digunakan dengan
semestinya di luar Pulau Bali.
Tabel 2 juga secara tersirat menunjukkan adanya
perbedaan performan antara dua sistem pemeliharaan
yang mendominasi peternakan sapi Bali di Indonesia
yaitu sistem grazing (Sulawesi Selatan dan NTT) vs
intensif (sebagian di NTT dan Bali). Pada umumnya di
Sulawesi Selatan pemeliharaan sapi Bali dengan
grazing, sehingga performan produksi lebih rendah.
Hal yang sama juga ditunjukkan oleh batas bawah dari
performan sapi Bali di NTT. Tetapi pada pemeliharaan
intensif terlihat bahwa sapi Bali baik di Bali ataupun di
NTT menunjukkan performan yang sama baiknya.
Pada pemeliharaan intensif maupun ekstensif sapi Bali
menunjukkan kemampuan adaptasi yang baik terhadap
lingkungan khusus tersebut. Hal ini dapat dilihat dari
laporan SIREGAR et al. (2000) bahwa walaupun sapi
Bali di Ujung Pandang berukuran kecil tetapi
mempunyai body condition score yang baik, artinya
sapi-sapi tersebut tidak kurus. Kemampuan adaptasi ini
merupakan salah satu keunggulan sapi Bali tetapi juga
sekaligus merupakan kelemahannya karena bilamana
lingkungan hidupnya kurang baik (pakan jelek)
adaptasi sapi Bali adalah dengan menurunkan ukuran
tubuh. Sehingga, dengan sendirinya akan menghasilkan
jumlah edible meat sedikit dan kecil-kecil. Dengan
demikian pasarannya juga hanya dapat menjangkau
kalangan bawah sampai hampir menengah.
103
 CHALID TALIB: Sapi Bali di Daerah Sumber Bibit dan Peluang Pengembangannya
Tabel 2. Performan produksi sapi Bali pada tiga wilayah sumber bibit di Indonesia
Status Sulawesi Selatan
Bobot lahir (kg) 12−13
Bobot 120 hari (kg) 40
Bobot 205 hari (kg) 70−75
Bobot 365 hari (kg) 105−112
Bobot melahirkan I, umur 30 bulan (kg) 180
Bobot dewasa, umur 5 th (kg) 280
Persentase karkas % 45−47
*) 1. PANE, 1990; 2. TALIB et al., 2002; 3. WIRDAHAYATI dan BAMUALIM,1990; 4. TALIB et al., 1999; 5. ASTAWA, 1990; 6.
DITJENNAK dan UNIBRAW, 1983; 7. SIREGAR et al., 1985; 8. SUPRAPTINI, 1980; 9. TALIB et al., 1998; 10. TALIB, 1984a; 11.
BAKRY et. al., 1994; 12. SUDRANA, 1988; 13. TALIB, 1984b; 14. DJAGRA dan BUDIARTA, 1990; 15. TALIB et al., 2002.
Pengembangan sapi Bali melalui persilangan
dengan sapi Taurin dan sapi Zebu walaupun sudah
banyak dilakukan, tetapi tidak dapat diharapkan
sempurna karena adanya kendala kesuburan pada
keturunan yang jantan walaupun sudah mencapai pada
3/4 darah Bali pada crossbred tersebut (PULUNGAN dan
MA’SUM, 1978; KIRBY, 1979). Hasil persilangan
terutama dengan sapi Taurin menunjukkan hasil yang
cukup baik sebagai ternak komersial. Persilangan untuk
menghasilkan sapi-sapi final stock ini telah dikembang-
kan di beberapa wilayah di Indonesia dalam jumlah
yang cukup banyak seperti di Timor–Barat (dengan
sapi Taurin dan Zebu); NTB (dengan Taurin); dan di
Sulawesi Selatan dan beberapa propinsi di Sumatera
(dengan sapi Taurin dan Zebu). Hasil persilangan
dengan sapi Zebu kurang baik jika dibandingkan
dengan sapi Taurine terutama Simmenthal, Limousin
dan Angus. Hanya perlu kehati-hatian dalam persilangan
ini karena adanya kecenderungan peternak untuk
mempertahankan keturunannya yang betina, karena
dikhawatirkan pada masa mendatang dapat berakibat
terhadap hilangnya plasma nutfah sapi Bali.
Performan Reproduksi
Sapi Bali, walaupun ukurannya kecil tetapi
disukai di Indonesia, salah satu penyebabnya adalah
kemampuan adaptasi reproduksinya yang luar biasa
dibawah cekaman lingkungan yang keras (Tabel 3).
Dari Tabel 3 terlihat bahwa secara umum prestasi
reproduksi pada sapi-sapi Bali di Sulawesi Selatan dan
NTT untuk sifat-sifat birahi dan lama bunting relatif
sama dengan yang di Bali. Pada pemeliharaan intensif
(Bali) maupun ekstensif (Sulawesi Selatan dan NTT)
ternyata sapi Bali tetap memperlihatkan kemampuan
reproduksi yang cukup superior. Hal yang serupa juga
ditunjukkan oleh bangsa sapi-sapi kecil di daerah
savana tropis–Afrika (MUKASA MURGEWA, 1989).
Bahwa ukuran tubuh yang kecil pada sapi kemungkinan
104
NTT Bali Pustaka*)
10,5−15 16−18 1,2,3,4,5,15
43−49 70 4,6,9,10
67−89 82 - 94 1,6,7,8,9,10,11
105−130 137 1,6,7,11,12
190 236 1,6,7
295−478 329 1,7,10
47−49 56–57 7,10,13,14
besar merupakan strategi dari spesies ini untuk
mempertahankan eksistensi mereka melalui proses
adaptasi terhadap lingkungan yang kurang mendukung
bagi sapi-sapi dengan tubuh yang besar. Hal ini mudah
terlihat dari tubuh banteng liar dewasa yang dapat
mencapai bobot hidup sekitar 800 kg, yang jarang
ditemukan pada sapi Bali. Hal kedua adalah terlihat
dari mulai banyak ditemukan sapi-sapi Bali induk
dengan bobot badan yang hanya berkisar antara 120–
150 kg dalam kehidupan padang penggembalaan di
Sulawesi Selatan (SIREGAR et al., 2000). Pada
penelitian di padang penggembalaan juga terlihat
bahwa ternyata sapi Bali dapat menyesuaikan siklus
kelahiran dengan fluktuasi produktivitas padang
rumput dengan sangat baik (WIRDAHAYATI dan
BAMUALIM, 1990; TALIB dan SIREGAR, 1991;
HIDAYATI et al., 2000) dan juga bobot lahir yang kecil
yang dengan sendirinya akan memperkecil bobot
dewasa (Tabel 2).
Kelemahan lainnya yang dapat dilihat pada sapi
Bali ini adalah pada pemeliharaan ekstensif di NTT,
bahwa kematian pra-sapih yang dialami cukup besar
yaitu mencapai 15–50%, tetapi tidak terjadi pada
pemeliharaan ekstensif di Sulawesi Selatan maupun
pemeliharaan yang intensif di Bali. Dari penelitian
lanjutan diketahui bahwa penyebab kematian ini
terutama disebabkan karena beberapa hal yaitu: bobot
lahir yang kecil (< 10 kg); produksi air susu induk yang
rendah, anak terlahir lemah (gejala dehidrasi); dan anak
yang baru dilahirkan disembunyikan/tidak diketahui
oleh pemiliknya. Penyebab lainnya yaitu bagi pedet-
pedet yang dilahirkan diluar musim kelahiran (pada
saat produksi padang rumput sudah tidak mendukung),
karena pada saat ini induk-induk sapi akan kehilangan
sebagian besar bobot badan yang dengan sendirinya
juga menurunkan mothering ability dalam membesarkan
pedet termasuk produksi susu (WIRDAHAYATI dan
BAMUALIM, 1990; TALIB et al., 1999).
 WARTAZOA Vol. 12 No. 3 Th. 2002

Tabel 3. Performan reproduksi sapi Bali pada tiga wilayah sumber bibit di Indonesia

Sumber variasi Sulawesi Selatan NTT Bali Pustaka*)

Pertama birahi (bulan) 18–24 18–24 19–21 1,4,6,15
Siklus berahi (hari) 20–21 19–23 20–21 4,5,7
Lama birahi (jam) 18–36 18–36 27–48 1,2,4,6
Conseption rate (%) 70–90 80–90 86–88 1,4,5,8
Lama bunting (hari) 281–286 280–290 285–302 4,6,9,14
Calving rate (%) 82 83 69–83 4,5,6,15
Beranak pertama (bulan) 30–40 30–38 31 4,5,6
Oestrus postpartum (hari) < 90 60–90 60–180 2,4,10,14
Selang beranak (bulan) 11–16 15–18 13–17 1,4,5,6,12,13,14,
Produksi susu, pada 4 bulan pertama (kg) 1,8 1,2–1,8 − 3,11
Kematian prasapih (%) 7 15–50 8 (5) 3,4,5
Kematian dewasa 3 1 3 (4) 1,4,5,8

*) 1. TALIB dan SIREGAR, 1984; 2. POHAN, 2000; 3. WIRDAHAYATI dan BAMUALIM, 1990; 4. PANE, 1990; 5. TALIB, 1984a; 6.
TALIB, 1984b; 7. TALIB et al., 2000; 8. SIREGAR et al., 1985; 9. TALIB, 1989; 10. TALIB et al., 2000; 11. LIWA, 1990; 12.
SUMBUNG et al., 1976; 13. DARMADJA, 1980; 14. ARDIKA, 1995; 15. ASTAWA, 1990.

Rendahnya kematian dini pedet sapi Bali di
Sulawesi Selatan salah satunya karena kelahiran
banyak terjadi ketika panen padi sawah/tegal baru saja
selesai sehingga wilayah penggembalaan sapi justru
dilakukan di areal tanam padi tersebut. Keuntungannya
adalah kelahiran mudah diketahui (tidak ada tempat
persembunyian) pemiliknya, sehingga peternak akan
dengan cepat mengetahui kelahiran yang terjadi dan
akan menambat induk-induk yang baru melahirkan.
Sehingga masalah produksi air susu induk yang rendah
dapat teratasi dengan penyediaan pakan hijauan
tambahan oleh peternak.
PELUANG PENGEMBANGAN
Perbaikan yang perlu dilakukan adalah pada sifat-
sifat yang kurang baik menjadi baik yakni dengan
mempertahankan ataupun meningkatkan sifat-sifat baik
yang sudah dimiliki. Peluang perbaikan yang dapat
dilakukan antara lain:
1. Bobot badan sapi Bali dapat ditingkatkan melalui
seleksi sebagaimana yang telah dilakukan di Proyek
Pengembangan dan Perbibitan Sapi Bali (P3Bali) di
Bali dan Sulawesi Selatan. Induk-induk yang ikut
dalam program pemuliaan ini haruslah induk-induk
yang memiliki sifat reproduksi yang terbaik.
2. Seleksi yang dilakukan seharusnya juga memasuk-
kan sifat produksi susu, sehingga induk-induk yang
ikut dalam perbaikan genetik ini hanyalah induk-
induk dengan produksi susu yang baik. Mengingat
adanya hubungan negatif antara produksi susu tinggi
dengan datangnya oestrus postpartum, dan juga
memiliki record birahi kembali sekitar 60–90 hari.
3. Perbaikan genetik dapat juga dilakukan melalui
perkawinan dengan banteng ataupun dengan sapi
Mithan (Bos gaurus) yang sangat mirip dengan sapi
Bali walaupun tidak memiliki warna putih pada
pantat.
4. Perbaikan manajemen pemeliharaan ekstensif yaitu
dengan memberi perhatian lebih pada induk-induk
bunting tua dan yang baru melahirkan untuk
menyelamatkan terutama pedet pra-sapih tersebut.
Kemudian program pemberian pakan tambahan
pada sistem pemeliharaan ekstensif di padang
penggembalaan terutama pada saat produksi padang
rumput minimum.
5. Program pemuliaan hendaknya diarahkan untuk
menghasilkan dua macam galur, yaitu galur untuk
pemeliharaan intensif dan galur untuk pemeliharaan
dipadang penggembalaan.
6. Karena trend produksi susu sapi Bali yang hanya
cukup baik dalam 4 bulan pertama maka seleksi
pada pedet umur 120 hari sangat dianjurkan
mengingat adanya korelasi genetik positive antara
bobot ini dengan bobot badan dan pertambahan
bobot badan lainnya pada sapi Bali.
7. Persilangan dengan Bos taurus dan Bos indicus
hendaknya hanya diarahkan untuk memproduksi
sapi-sapi final stock ataupun induk-induk perantara
penghasil final stock saja. Keturunan betina dari
persilangan ini yang tidak diperuntukan sebagai
induk-induk perantara sebaiknya dijadikan final
stock saja agar keaslian plasma nutfah sapi Bali
dapat tetap dipertahankan.

105
 CHALID TALIB: Sapi Bali di Daerah Sumber Bibit dan Peluang Pengembangannya
KESIMPULAN
Sapi Bali adalah tipe sapi kecil dengan
kemampuan reproduksi yang baik dan daya adaptasi
yang sangat baik pada pemeliharaan intensif maupun
ekstensif-padang penggembalaan. Sapi Bali mempunyai
persentasi karkas yang tinggi walaupun jumlah edible
meat yang dihasilkan per ekor relatif sedikit.
Bobot lahir yang terlalu rendah sering menyebab-
kan kematian pra-sapih yang tinggi karena didukung
oleh kapasitas produksi air susu induk yang rendah dan
cekaman lingkungan yang tidak menunjang. Perbaikan
secara genetik dapat ditempuh untuk meningkatkan
bobot lahir dan bobot selanjutnya dengan tetap berusaha
mempertahankan keunggulan sifat-sifat reproduksi dan
terjadinya peningkatan jumlah produksi susu.
DAFTAR PUSTAKA
AALFS, H.G. 1934. De Rundeveeteelt op het Eiland Bali.
Proefschrift, H.J. Smith, Utrecht.
ARDIKA, I.N. 1995. Parameter fenotipik dan genetic sifat
produksi dan reproduksi sapi Bali pada Proyek
Pembibitan dan Pengembangan sapi Bali (P3Bali) di
Bali. Thesis Fakultas Pasca Sarjana, Institut Pertanian
Bogor, Bogor.
BAKRY, W.R., B.M. CHRISTIE, A. MUTHALIB, and K.F.
DOWSETT. 1994. Productivity of beef cattle in Nusa
Tenggara. In CHAPS Book A, Collection of papers
from the final seminar of the cattle health and
repoductivity survey (CHAPS) held at the disease
investigation centre, Denpasar, Bali, 15–17 Mei,
p:170
BENNET, G.L. and K.E. GREGORY. 1996. Genetic (co)
variances among birth weight, preweaning gain, 200-
day weight and postweaning gain in composites and
parental breeds of beef cattle. Journal of Animal
Science 74: 2598.
DARMADJA, D. 1980. Setengah abad peternakan sapi
tradisional dalam ekosistem pertanian di Bali. PhD,
Thesis. Universitas Padjadjaran, Bandung.
DEVENDRA, C., T. Lee Kok Choo and M. Phatmasingham.
1973. The productivity of Bali cattle in Malaysia.
Malaysian Agricultural Journal 49: 183.
DITJENAK. 1997. Statistical Book on Livestock (Buku
Statistik Peternakan) 1996. Direktorat Jenderal
Peternakan. Jakarta.
DITJENNAK. 1996. Statistical Book on Livestock (Buku
Statistik Peternakan) 1995. Direktorat Jenderal
Peternakan. Jakarta.
DJAGRA, I.B. dan I.G.K. BUDIARTA. 1990. Hubungan antara
berat badan kosong dengan berat karkas sapi Bali.
Seminar Nasional Sapi Bali, Denpasar, 22-23 Sep.
Fapet-Udayana.
106
HERWEIJER, C.H. 1947. De ontwikkeling der Runderteelt in
Zuid Celebes en de megelijkheit tot het stichten van
Ranch Bedrijven. Hemera Zoa 56: 222.
HIDAYATI, N., C. TALIB, dan A. POHAN. 2000. Produktivitas
padang rumput alam di padang penggembalaan
Kupang Timur, Nusa Tenggara Timur. Seminar
Nasional Biologi XVI, Perhimpunan Biologi
Indonesia, Bandung, 25–27 Juli. Inpress.
KIKKAWA, Y., T. AMANO, and H. SUZUKI. 1995. Analysis of
genetic diversity of domestic cattle in East and
Southeast Asia in term of variations in Restriction
sites and sequences of mitochondria DNA.
Biochemical Genetics, Vol. 33: 51.
KIRBY, G.M.W. 1979. Bali cattle in Australia. World Review
of Animal Production. 31. p: 24.
KRIESSE, L.A., J.K. BERTRAND, and L.L. BENYSHEK. 1991.
Genetic and environmental growth trait parameter
estimates for Brahman and Brahman-derivative cattle.
Journal of Animal Science 69: 2362.
LASLEY, J.F. 1981. Origin and importance of cattle in the
World. In Beef Cattle Production. J.F. Lasley. Print.
Englewood Cliffs, New Jersey. p: 1-24.
LIWA, A.M. 1990. Produktivitas sapi Balidi Sulawesi Selatan.
PhD, Thesis. Fakultas Pasca Sarjana, IPB.
MALESSY, Ch., E.T. SOKA, dan J.H. SCHOTTLER. 1990. Sapi
Bali di Nusa Tenggara Timur. Proc. Seminar
Nasional Sapi Bali 20–22 September. hlm: A42.
MEIJER, W.Ch.P. 1962. Das Balirind A Ziemsen Verslag,
Wittenberg Lutherstandt.
NAMIKAWA, T. and W. WIDODO. 1978. Electrophoretic
variation of hemoglobulin and serum albumin in
Indonesian cattle including Bali cattle. Japan Journal
of Zootechnical Science 49: 11.
NAMIKAWA, T., Y MATSUDA, K. KONDO, B. PANGESTU, and
H. MARTOJO. 1980. Blood groups and blood protein
polymorphisms of different type s of cattle in
Indonesia. In the origin and phylogeny of Indonesia
Native Livestock 33-35. In The Research Group of
Overseas Scientific Survey.
PANE, I. 1990. Upaya meningkatkan mutu genetik sapi Bali di
P3Bali. Proc. Seminar Nasional Sapi Bali 20–22
September. hlm: A42.
PANE, I. 1991. Produktivitas dan breeding sapi Bali. Proc.
Seminar Nasional Sapi Bali 2–3 September. hlm: 50.
PATRICK, I. 1994. Management factors constraining cattle
productivity at CHAPS sites in Nusa Tenggara. In
CHAPS Book A, Collection of papers from the final
seminar of the cattle health and repoductivity survey
(CHAPS) held at the disease investigation centre,
Denpasar, Bali, 15–17 Mei, p: 152.
PAYNE, D.J.A. and D.H.L. ROLLINSON. 1973. Bali Cattle.
World Anim. Review. 7: 13.
 WARTAZOA Vol. 12 No. 3 Th. 2002

POHAN, A. 2000. Perbaikan penampilan reproduksi sapi Bali TALIB, C. and A.R. SIREGAR. 1991. Productivity of Bali cattle
anoestrus postpartum melalui pemberian progesteron in Timor's Savanna. (Produktivitas sapi Bali di
dan estrogen. Thesis. Fakultas Pasca Sarjana, IPB. Savana, Timor, NTT). In Proc. Improving the
Productivity of Animal Husbandry and Fisheries.
PULUNGAN, H. and K. MA’SUM. 1978. Performance of Bali National Seminar, Diponegoro University. Indonesia.
cattle and their crossbreed with Hereford and p: 112.
Shorthorn. Proc. Seminar Ruminansia. Directorat of
Animal Services and Bogor Agriculture University TALIB, C. and A.R. SIREGAR. 1991a. The role of beef cattle
and P4. Bogor. breeding in Indonesia (Peranan Pemuliaan Ternak
Potong in Indonesia). Pusat Penelitian dan
SANDHI, G.N., G.G. MAYUN, M. PASTIKA, dan D. DARMADJA. Pengembangan Peternakan, Bogor. Indonesia.
1990. Pengaruh testosteron terhadap perubahan warna
Wartazoa, 2(1−2): 15−21.
bulu pada sapi Bali jantan kebiri. Seminar Nasional
Sapi Bali, Denpasar 20−22 September. Fapet Udayana. TALIB, C. dan A.R. SIREGAR. 1984. Ternak sapi Bali di
Timor, Nusa Tenggara Timur. Wartazoa 1(3): 1−8.
SCHERF, B.D. 1995. World Watch List–for domestic animal
diversity. 2nd ed. FAO–UNEP. TALIB, C., A. BAMUALIM, dan A. POHAN. 1999. Problematika
pengembangan sapi Bali dalam pemeliharaan di
SIREGAR, A.R., C. TALIB, P. SITORUS, K. DIWYANTO, and U.
padang penggembalaan. Pros. Seminar Nasional
KUSNADI. 1985. Performance sapi Bali di NTT.
Peternakan dan Veteriner, Puslitbangnak, 1−2 Des.
Kerjasama Balai Penelitian Ternak dan Ditjennak.
1998: 248.
SIREGAR, A.R., CHALIJAH, M. SARIUBANG, dan C. TALIB.
TALIB, C., A. BAMUALIM, dan G. HINCH. 1998. Factors
2000. Penyebab kematian dini pada pedet sapi Bali
influencing preweaning and weaning weights of Bali
pada pemeliharaan ekstensif. Tidak dipublikasikan.
(Bos sundaicus) calves. Proc. 6th World Conggres on
SUDRANA, I.P. 1988. Performan produksi sapi Bali di wilayah Genetics Applied to Livestock Production Vol. 23: 141.
Proyek Pembibitan dan Pengembangan Sapi Bali
TALIB, C., CHALIJAH, dan A.R. SIREGAR. 2000. Pola sekresi
Daerah Tingkat 1 Bali. Thesis. Fakultas Pasca
hormon progesterone pada induk sapi Bali dalam
Sarjana, IPB.
periode postpartum di Gowa. Laporan ARMP 2000.
SUMBUNG, F.P., J.T. BATOSAMA, B.R. RONDA and S. Puslitbangnak.
GARANTJANG. 1976. Performans reproduksi sapi Bali.
TALIB, C., CHALIJAH, dan A.R. SIREGAR. 2002. Progesterone
Proc. Seminar Ruminansia. Ditjenak dan P4−T, Bogor.
pattern of Bali cattle at Gowa, South Sulawesi.
TALIB, C. 1984b. Kekhasan sapi Bali di Sulawesi Selatan. Inpress.
Buletin Teknik dan Pengembangan Peternakan IV:
TALIB. C. 1984a. Kekhasan sapi Bali di Indonesia, Sapi Bali
16: 10.
di Timor. Buletin Teknik dan Pengembangan
TALIB, C. 1988. Produktivitas induk sapi Peranakan Ongole Peternakan III: 15: 13.
dan keturunannya. Thesis. Fakultas Pasca Sarjana,
WIRDAHAYATI, R.B. dan A. BAMUALIM. 1995. Parameter
Institut Pertanian Bogor.
fenotipik dan genetik sifat produksi dan reproduksi
TALIB, C. 1989. Pengaruh bangsa pejantan, sex dan musim sapi Bali pada Proyek Pembibitan dan Pengembangan
terhadap bobot lahir dan lama kebuntingan pedet sapi sapi Bali (P3Bali) di Bali. Thesis Fakultas Pasca
persilangan Bos taurus dan Bos indicus dengan Bali. Sarjana, Institut Pertanian Bogor, Bogor.
Proc. Seminar Nasional, Puslitbangnak.
TALIB, C. 2002. Pemberian supplemen daun turi meningkat-
kan produksi susu tetapi tidak mempengaruhi
aktivitas suckling pada sapi Bali. Jurnal Ilmiah
Pertanian "GAKUR YOKU" Tahun 2003. Tidak
dipublikasikan.

107
 Utomo et al. Pubertas Sapi Katingan betina dikaitkan dengan konsentrasi mineral Cu dan lingkungan

Pubertas Sapi Katingan Betina Dikaitkan dengan Konsentrasi Mineral Cu

dan Lingkungan
Utomo BN1, Noor RR2, Sumantri C2, Supriatna I3, Gurnardi ED 2

1
Balai Besar Penelitian Veteriner, Jl. RE. Martadinata 30 Bogor 16114
E-mail: bng_utomo2004@yahoo.com
2
Departemen Ilmu Produksi dan Teknologi Fakultas Peternakan IPB, Jl. Rasamala, Darmaga, Bogor
3
Departemen Klinik, Reproduksi dan Patologi Fakultas Kedokteran Hewan IPB, Jl. Rasamala, Darmaga, Bogor

(Diterima 1 Maret 2013 ; disetujui 20 Mei 2013)

ABSTRACT

Utomo BN, Noor RR, Sumantri C, Supriatna I, Gurnardi ED. 2013. Puberty of Katingan cow in realation to Cu mineral and the
environtment. JITV 18(2): 123-130
The onset of puberty is an important role in order to optimize performance of Katingan cattle reproduction. The onset of
puberty can be estimated from to blood progesterone concentration. In this study the onset of puberty was estimetid through
analysis of progesterone hormone in various age of individual cattle. Thirty blood samples were obtained from 30 Katingan
heifers of 13 months and 15 days to 23 months and 18 days old from Tumbang Lahang (10 samples) and Buntut Bali (20
sampels) to be analyzed for progesterone concentrations using RIA method. The same samples were also analyzed to find out
information about Copper (Cu) concentration. The results showed that progesterone concentration varied narrowly from 0.008 to
0.184 ng/ml. The result indicated that the Katingan cattle in 23 months old was still in prepuberty category. Environment factor
such as land pH was acid (pH<6), grass quality and climate in term of temperature and humidity relatively high, may an
important role to delay the oset of their puberty. One of the environment problem was proved by the most of the same samples
than had under adequate value of level of Copper.
Key Words: Katingan Cattle, Progesterone, Puberty, Cu mineral, Environment

ABSTRAK

Utomo BN, Noor RR, Sumantri C, Supriatna I, Gurnardi ED. 2013. Pubertas Sapi Katingan betina dikaitkan dengan konsentrasi
mineral Cu dan lingkungan. JITV 18(2): 123-130
Umur awal pubertas sangat penting dalam rangka mengoptimumkan performan reproduksi Sapi Katingan. Estimasi umur
awal pubertas dilakukan melalui pemeriksaan konsentrasi hormon progesteron pada individu-individu Sapi Katingan dengan
berbagai variasi umur. Sebanyak 30 ekor Sapi Katingan betina umur 13 bulan 15 hari - 23 bulan 18 hari diperoleh dari Buntut
Bali (20 ekor) dan dari Tumbang Lahang (10 ekor). Konsentrasi hormon progesterone diukur dari serum darah dengan
menggunakan metode Radio Immuno Assay (RIA). Pada contoh serum yang sama juga dilakukan pemeriksaan terhadap kadar
mikro mineral Copper (Cu). Hasil pemeriksaan menunjukkan bahwa kisaran konsentrasi hormon progesterone yang berhasil
diukur adalah 0,008 – 0,184 ng/ml. Hal ini mengindikasikan bahwa sapi-sapi Katingan tersebut masih dalam kategori
prepubertas. Hasil pemeriksaan kadar Cu dalam serum sapi Katingan hampir semuanya di bawah kadar kecukupan. Hal ini
diduga menjadi penyebab keterlambatan pubertas pada sapi Katingan betina. Faktor lingkungan yang diduga kuat ikut
mempengaruhi diantaranya adalah kualitas lahan (pH rendah), kualitas rumput yang diberikan, dan iklim yang ekstrim.
Kata Kunci: Sapi Katingan, Progestron, Pubertas, Mineral Cu, Lingkungan

PENDAHULUAN Awal pubertas mempunyai banyak definisi

Salah satu tolak ukur efisiensi reproduksi adalah
dicapainya umur awal pubertas yang lebih awal sesuai
dengan potensi genetiknya. Hal ini penting untuk
mencapai performan reproduksi sapi yang optimum dan
memberikan peningkatan produktivitasnya. Informasi
umur awal pubertas juga penting sebagai acuan dalam
meningkatkan efisiensi reproduksi berdasarkan potensi
dan permasalahan yang ada di lapangan melalui
berbagai inovasi teknologi.
(Getzewick 2005), antara lain umur ketika hewan mulai
melepaskan sel gamet (betina: pertama ovulasi)
(Rawlings et al. 2003), umur pertama kali estrus, serta
umur pada saat betina mampu untuk bunting dimana
organ-organ reproduksinya mulai berfungsi (Getzewick
2005). Suatu hewan telah dipertimbangkan mencapai
pubertas jika dia memperlihatkan estrus, mempunyai
korpus luteum yang dapat dipalpasi antara hari ke tujuh
dan hari ke 15 setelah estrus dan mempunyai

123
 JITV Vol. 18 No 2 Th. 2013: 123-130
konsentrasi progesteron lebih dari 1 ng/ml dalam
periode tetap (Rekwort et al. 2000).
Pubertas dikontrol oleh mekanisme-mekanisme
fisiologis tertentu yang melibatkan gonad dan kelenjar
adenohipofisa, sehingga pubertas tidak luput dari
pengaruh faktor herediter dan lingkungan yang bekerja
melalui organ-organ tersebut (Toelihere 1985),
lingkungan (nutrisi, iklim dan musim) serta pejantan
atau biostimulation (Rekwort et al. 2000; Getzewick
2005; Abdelgadir et al. 2010).
Umumnya pertumbuhan dan perkembangan menjadi
prasyarat penting untuk inisiasi menuju pubertas
(Rekwort et al. 2000). Menurut Getzewich (2005) pada
umumnya pubertas dicapai ketika mereka telah
mencapai 40% dari bobot badan dewasa dan aspek
pakan mempunyai pengaruh yang besar. Beberapa
penelitian menunjukkan bahwa ternak yang diberi
asupan pakan dengan kecukupan energi dan protein
menyebabkan ternak cepat tumbuh dan umur pubertas
lebih awal bisa dicapai (Son et al. 2001; Romano et al.
2005). Sapi dari spesies Bos indicus permasalahan yang
dihadapi adalah pencapaian awal umur pubertas lebih
lambat dibandingkan dengan sapi dari Bos Taurus
(Sargentini et al. 2007). Menurut Noguiera (2004),
seleksi genetik, crossbreeding dan perbaikan pakan
dapat digunakan untuk mempercepat umur pertama
beranak sapi Bos indicus.
Pemeliharaan pada Sapi Katingan yang biasanya
dilakukan secara ekstensif, menyulitkan pengamatan
umur pubertas dan profil reproduksi lainnya, sehingga.
tidak diketahui secara pasti kapan sebenarnya sapi
tersebut siap untuk dikawinkan. Penggembalaan
campuran antara sapi-sapi jantan dan sekelompok sapi
betina di padang rumput akan menurunkan produktivitas
dan reproduktivitasnya. Faktor lingkungan seperti pH
lahan yang rendah mempengaruhi ketersediaan mineral
Cu (Gartenberg et al. 1990; Darmono 2009) yang
sangat berpengaruh terhadap pencapaian pubertas
akibat gangguan aktivitas ovariumnya (Ahmed et al.
2009) demikian juga dengan pengaruh dari temperatur
dan kelembaban yang ekstrim atau iklim yang ektrim
(Gwazdauskas 1985).
Melihat hal tersebut penentuan umur awal pubertas
pada Sapi Katingan dan faktor-faktor yang
mempengaruhi perlu diteliti sebagai informasi dasar
penting yang menunjang produktivitas ternak Sapi
Katingan.
MATERI DAN METODE
Contoh darah
Penelitian lapang dilakukan selama 6 bulan dengan
lokasi pengambilan contoh darah di Kecamatan
Katingan Tengah dengan konsentrasi lokasi di Desa
Tumbang Lahang sebanyak 10 contoh dan di
124
Kecamatan Pulau Malan dengan konsentrasi lokasi di
Desa Buntut Bali sebanyak 20 contoh. Lokasi tersebut
dipilih berdasarkan informasi petugas dan peternak
tentang sapi-sapi yang teridentifikasi hari, bulan dan
tahun kelahirannya berdasarkan catatan peternak.
Pengambilan contoh darah Sapi Katingan betina
tidak dapat dilakukan secara rutin dengan interval
waktu tertentu, melainkan hanya pada individu-individu
sapi dengan umur yang berbeda, yaitu antara umur 13
bulan 15 hari – 23 bulan 18 hari (Tabel 1). Hal ini
disebabkan karena kondisi lapang yang sulit,
manajemen ekstensif tradisional dan jauh dari
pemukiman serta kejadian banjir saat musim penghujan,
akibatnya lokasi sapi sulit dijangkau. Dengan demikian
contoh darah hanya dikoleksi 1 (satu) kali pada 30 ekor
Sapi Katingan. Darah diambil melalui vena jugularis,
kemudian ditampung dalam tabung vakuntainer 7 ml
tanpa antikoagulan. Tabung berisi darah kemudian
dimiringkan untuk memperlebar bidang permukaan
selama + 20 menit sampai serum terpisah dari bekuan
darahnya. Serum yang keluar dipindahkan ke dalam
tabung eppendrof dan disimpan dalam icebox selama
berada di lapang. Sesampainya di laboratorium contoh
disimpan pada suhu -20oC sampai siap untuk dilakukan
analisis.
Analisis konsentrasi hormon progesteron
Pemeriksaan hormon progesteron dilakukan dengan
metode RIA. Kotak (KIT) berisi perlengkapan uji imun
Radioisotop untuk progesteron adalah buatan Cisbio
Bioassays dari Perancis. Pengukuran radioaktivitas
dilakukan dengan alat gamma counter sehingga
didapatkan nilai CPM (count per minute). Prosedur
pengujian dilakukan sesuai dengan petunjuk yang
tersedia pada KIT progesteron Cisbio Bioassays. Semua
uji untuk kurva baku (standar) dibuat dua kali atau tiga
kali, bersama-sama dengan contoh serum yang tidak
diketahui konsentrasi progesteronnya.
Pembuatan kurva baku untuk progesteron dibuat
dari tabung-tabung A = 0,15 ng/ml, B = 0,40 ng/ml,
C = 1,30 ng/ml, D = 3,50 ng/ml, E = 16,60 ng/ml,
F = 63ng/ml dan O = 0 ng/ml. Kurva dibuat dengan
sumbu X berupa konsentrasi progesteron baku dan
sumbu Y adalah nilai CPM. Perhitungan nilai
progesteron dapat ditentukan langsung melalui grafik
baku yang tersedia berdasarkan nilai CPM contoh atau
dapat ditentukan dengan persamaan regresi linear.
Analisis kadar Cu dan lingkungan
Pada contoh serum yang sama untuk analisis
hormon progesteron juga dilakukan pemeriksaan
terhadap konsentrasi mineral Cu. Analisis mineral Cu
dilakukan di laboratorium Balitnak.
 Utomo et al. Pubertas Sapi Katingan betina dikaitkan dengan konsentrasi mineral Cu dan lingkungan

Tabel 1. Distribusi contoh darah Sapi Katingan untuk analisis laboratorium.

No. Umur sapi Jumlah No. Umur sapi Jumlah (ekor)

(ekor)
Bulan Hari Bulan Hari
1. 13 15 1 17 22 1
2. 14 15 1 23 1
18 1 26 1
3. 15 2 1 27 1
17 1 6. 19 5 1
21 1 15 1
4. 16 15 1 19 1
21 1 7. 20 16 1
29 1 26 1
29 1 8. 21 3 1
5. 17 0 1 16 1
6 1 9. 22 0 1
15 1 5 1
17 3 10. 23 18 1

Aspek lingkungan yang diamati adalah suhu dan
kelembaban yang diukur dari pagi dan sore hari
selamapelaksanaan kegiatan penelitian. Sementara
kondisi pH lahan mengacu pada hasil penelitian yang
dilakukan sebelumnya oleh peneliti BPTP Kalteng.
Manajemen pemeliharaan sapi diamati untuk
memperkaya informasi.
Analisis data
Data dianalisis secara deskriptif meliputi
konsentrasi hormon progesteron, mineral Cu dan aspek
lingkungan. Khusus untuk menentukan pencapaian
umur awal pubertas sapi digunakan kriteria ketika
konsentrasi serum progesteron lebih besar dari 1,0
ng/ml (Cooke dan Arthington, 2009; Getzewick, 2005;
Sargentini et al. 2007).
HASIL DAN PEMBAHASAN
Konsentrasi Hormon Progesteron
Konsentrasi hormon progesteron Sapi Katingan
pada umur 13 bulan 15 hari sampai 23 bulan 18 hari
semuanya masih di bawah 1 ng/ml. Kisaran hasil
pemeriksaan konsentrasi hormon progesteron adalah
0,01 – 0,18 ng/ml (Gambar 1), mengindikasikan bahwa
sapi-sapi tersebut masih dalam kategori belum puber
(Rekwort et al. 2000; Swain and Harjit, 2001).
Konsentrasi hormon antara umur 13.5 sampai 23.5
bulan masih rendah dan sangat fluktuatif akibat
perbedaan umur, bobot badan dan status fisiologis dari
masing-masing individu sapi. Hasil penelitian Romano
et al. (2005) pada sapi yang umurnya relatif seragam
juga menunjukkan gambaran konsentrasi progesteron
yang fluktuatif walau bobot badannya berbeda.
Konsentrasi hormon pada periode ini sesuai dengan
yang dilaporkan Nakada et al. (2000) pada sapi FH dari
lahir sampai prepuber (0,05 + 0.01 sampai 0.18 + 0.05
ng/ml), namun lebih rendah dari laporan Balakrishnan
et al. (1986) pada sapi cross Zebu dan Holstein
(0.23+0,06 ng/ml). Konsentrasi progesteron akan
meningkat signifikan sesaat sebelum pubertas
(Berardinelli et al. 1979)
Berbagai penelitian menunjukkan bahwa
konsentrasi progesteron ketika mencapai umur awal
pubertas melebihi dari 2 ng/ml. Romano et al. (2005)
melaporkan bahwa pada awal pubertas sapi lokal
Nelore dari Brazil pada berbagai umur, konsentrasi
progesteronnya rata-rata 2,78 ng/ml, sedangkan
Rekwort et al. (2005) melaporkan pada sapi lokal
Guinea Bunaji konsentrasi hormon progestronnya 3,00-
3,40 ng/ml.
Berdasarkan hasil pemeriksaan terhadap konsentrasi
hormon progesteron tersebut, diestimasikan bahwa
umur awal pubertas pada Sapi Katingan di atas 23
bulan. Noguiera (2004) mengestimasi umur awal
pubertas dengan melihat umur pertama kali beranak.
Berdasarkan informasi dari 30 responden peternak yang
ada di tiga lokasi penelitian (Pendahara, Buntut Bali
dan Tumbang Lahang), umur rata-rata pertama kali
beranak Sapi Katingan adalah 3,0-3.5 tahun. Sehingga
sangat dimungkinkan bahwa Sapi Katingan mulai puber

125
 JITV Vol. 18 No 2 Th. 2013: 123-130
>1,00
Konsentrasi progesteron (ng/ml)
Umur individu sapi (Bulan, Hari)
Gambar 1. Konsentrasi hormon progesteron pada individu-individu Sapi Katingan berbagai umur.
setelah berumur di atas 23 bulan sebagaimana terjadi
pada sapi-sapi lokal lainnya di daerah tropis (Faruque
and Bhuiyan 2002; Premasundera 2002; Singh et al.
2002; Talib et al. 2003; Miazi et al. 2007; Bishop dan
Pfeiffer 2008 Sutradhar et al. 2010). Lamanya
pencapaian umur pubertas menurut Bishop and Pfeiffer
(2008) menunjukkan bahwa performan reproduksi sapi
tersebut jelek.
Sapi-sapi yang hidup di daerah beriklim tropis
seperti di Afrika rata-rata pencapaian umur awal
pubertas yang didasarkan pada level naiknya
progesteronnya relatif lama, berkisar 25-33 bulan
(Eduvie et al. 1993; Kanuya et al. 1993; Osei et al.
1993). Sebaliknya sapi-sapi yang hidup di daerah
subtropis umur awal pubertas lebih cepat yaitu pada
umur kurang dari 25 bulan (Sargentini et al. 2007;
Saenz et al. 2008).
Faktor lingkungan yang diduga mempengaruhi
pencapaian pubertas
Kondisi lingkungan pemeliharaan (habitat) sapi
Katingan yang diduga mempunyai pengaruh terhadap
pencapaian umur awal pubertas, diantaranya adalah: (1)
Kondisi lahan dengan pH rendah (asam), pada lokasi
Buntut Bali dilaporkan mempunyai pH 4.30
(Firmansyah belum dipublikasi), (2) Kualitas pakan
yang rendah (hanya rumput), dan (3) Suhu dan
kelembaban yang relatif tinggi. Kadarsih (2003)
menyebutkan bahwa penampilan produksi dan
reproduksi dipengaruhi oleh faktor lingkungan dan
faktor genetik dengan perbandingan 60:40. Aspek
lingkungan yang banyak dilaporkan adalah masalah
pakan (Abdelgadir et al. 2010; Noguiera, 2004; Son et
al. 2000; Shehu et al. 2008). Terzano et al. (2007)
melaporkan bahwa pada sistem manajemen
pemeliharaan (intensif dan ekstensif) secara nyata
126
mempengaruhi pencapaian bobot badan saat pubertas
yang sudah barang tentu akan mempengaruhi
pencapaian umur awal pubertas.
Pertumbuhan Sapi Katingan tidak maksimal karena
pakannya hanya yang ada di padang gembalaan yang
kualiltas dan kuantitasnya rendah. Dari berbagai hasil
penelitian menunjukkan bahwa pakan mempunyai
pengaruh yang nyata terhadap pencapaian umur
pubertas (Al-Shami 2007; Son et al. 2001; Romano et
al. 2005; Noguiera 2004; Agustina et al. 2001). Pakan
tidak hanya berhubungan dengan syarat pencapaian
bobot badan saat pubertas tetapi juga mempengaruhi
produksi dan pelepasan hormon (Swain dan Harjit
2001). Menurut Darmono (2009) sapi yang hampir
100% pakannya berasal dari tanaman pakan ternak atau
rumput alam akan mengalami defisiensi mineral yang
dapat menurunkan reproduktivitas.
Kondisi lahan tempat pemeliharaan Sapi Katingan
adalah asam (pH rendah) dan pada kondisi ini menurut
Gartenberg et al. (1990) terjadi kekurangan unsur
mineral mikro Copper (Cu). Menurut Darmono (2009)
hal ini akan berakibat hijauan yang tumbuh di atas
tanah tersebut juga akan miskin mineral Cu. Copper
berperan dalam proses metabolisme estrogen dan
diperlukan pula untuk kesuburan ternak betina. Copper
juga mempunyai peranan yang nyata dalam
pemeliharaan fertilitas yang secara optimum dengan
melibatkan aktivitas FSH, LH dan estrogen (Desai et al.
1982). Defisiensi Cu menyebabkan gangguan aktivitas
ovarium (Ahmed et al. 2009). Defisiensi Cu pada sapi
akan mengakibatkan berkurangnya sintesa estrogen.
Dilaporkan juga bahwa konsentrasi LH di jaringan
pituitary akan lebih rendah ketika terjadi defisiensi Cu
(Xin et al. 1993). Kondisi ini diperparah oleh jarangnya
pemberian pakan tambahan dan mineral. Mineral yang
kadang-kadang diberikan adalah garam dapur. Darmono
(2007) melaporkan bahwa di beberapa daerah
 Utomo et al. Pubertas Sapi Katingan betina dikaitkan dengan konsentrasi mineral Cu dan lingkungan
transmigrasi di Kalimantan sapi-sapi mengalami
defisiensi mineral dan dari hasil penelitian lain
menunjukkan bahwa defisiensi Cu adalah yang paling
sering ditemukan di Indonesia (Stoltz et al. 1985).
Walaupun kondisi lahan lokasi pemeliharaan Sapi
Katingan berdasarkan referensi tersebut ada
kemungkinan defisiensi Cu, namun demikian perlu
dipastikan lebih lanjut melalui pemeriksaan
laboratorium terhadap lingkungan (lahan dan rumput)
dan sapinya sendiri.
Data kandungan mineral Cu dari sapi-sapi yang
sama disajikan pada Gambar 2. Sebagaimana
konsentrasi hormon progesteron, konsentrasi Cu pada
masing-masing individu juga fluktuatif. Status fisiologis
yang berbeda dari masing-masing individu sapi dengan
umur yang bervariasi diduga menjadi salah satu
penyebabnya. Menurut Kincaid (1999) konsentrasi Cu
dipengaruhi oleh infeksi, stress dan eritrosit hemolisis.
Juga bisa dipengaruhi oleh Zn, Fe, Mo dan S yang
dikonsumsinya (McDowell 1992).
Konsentrasi Cu serum berkisar antara 0.18 sampai
0.76 µg/ml. Menurut Kincaid (2000), konsentrasi Cu
dalam plasma untuk batas marginal adalah 0,50-0,70
ug/ml, batas cukup 0.70-0.90 µg/ml sedangkan
dikatakan kandungan Cu tinggi ketika konsentrasinya
0,90-1,10 µg/ml. Standar kecukupan mineral yang
dianjurkan bervariasi, Leanne et al. (2010) memberikan
batasan terendah 0.60 µg/ml, sedangkan Gadberry et al.
(2003) memberikan batas kecukupan dari 0,80-1,40
ppm (µg/ml).
Hasil pemeriksaan contoh serum Sapi Katingan
menunjukkan sebagian besar di bawah standar
kecukupan mineral Cu. Hanya satu dari keseluruh
contoh yang diperiksa (3.30%) mempunyai konsentrasi
yang di atas cukup yaitu 0.76 µg/ml menurut standar
yang disampaikan Kincaid (2000). Dapat dinyatakan
bahwa sapi-sapi Katingan tersebut mengalami defisiensi
mineral Cu yang diduga ikut berperan dalam menunda
terjadinya awal pubertas.
Konsentrasi Cu (µg/ml)
Umur individu sapi (bulan, hari)
Gambar 2. Konsentrasi Cu pada Sapi Katingan yang diperiksa hormon progesteronnya.
Hubungan/korelasi antara kadar progesteron dengan
kadar Cu dipelajari melalui analisis korelasi linear
sederhana (Pearson correlation) dan didapatkan tingkat
hubungan yang rendah dengan arah negatif (P-Value =
0.06) (Gambar 3) dan dengan tingkat keeratan R = -
0.35. Hal ini wajar karena unsur Cu lebih berperanan
pada metabolisme estrogen.
Defisiensi mineral Cu ini diduga menjadi pemicu
beberapa kasus kesulitan melahirkan dan retensi
plasenta yang menurut Garternberg et al. (1990).
Dengan demikian faktor mineral utamanya Cu menjadi
bahan pertimbangan penting dalam rangka membantu
mempercepat pencapaian umur awal pubertas pada Sapi
Katingan. Menurut Gardner et al. (2003) suplementasi
Cu efektif untuk meningkatkan konsentrasi Cu sapi.
Faktor-faktor iklim (suhu, curah hujan dan
kelembaban) yang tidak sesuai bagi ternak sapi dapat
mempengaruhi reproduktivitas. Menurut Ahmed
(2007), zona termonetral suhu nyaman untuk sapi lokal
adalah 21-27oC, kelembaban udara tidak boleh melebihi
60oC dan indek kelembaban suhu (temperature
humidity index) 72. Menurut Gwazdauskas (1985) iklim
yang ekstrim dapat mempengaruhi reproduksi karena
dapat mengubah fungsi endokrin dan dapat menunda
pencapaian umur pubertas. Ketinggian tempat di tiga
lokasi penelitian (Pendahara, Buntut Bali dan Tumbang
Lahang) berada pada kisaran 0-700 meter di atas
permukaan laut. Hal ini menjadikan kawasan ini
memiliki rejim panas (isohyperthermic) dan lembab
(udic). Berdasarkan hasil beberapa kali pengukuran
terhadap temperatur dan kelembaban di Pendahara pada
bulan April 2010 didapatkan rata-rata temperatur dan
kelembaban pada pagi hari 28oC dan >100% sedangkan
pada sore hari 34oC dan 93%. Informasi tersebut
mengisyaratkan bahwa iklim di lingkungan
pemeliharaan sapi Katingan relatif ekstrim.
Manajemen pemeliharaan sapi Katingan
dilakukan secara ekstensif, dimana sapi jantan dan
betina dilepas bersama-sama di dalam ranch atau di
127
 JITV Vol. 18 No 2 Th. 2013: 123-130

0.20

Konsentrasi Progesteron
0.15

Kadar Progesteron
0.10

0.05

0.00

0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8

Kadar Cu
Konsentrasi Cu

Gambar 3. Korelasi antara konsentrasi hormon progestron dan mineral Cu Sapi Katingan.

hutan. Adanya sapi jantan dalam kelompok sapi Agustina D, Mansjoer SS, Purwanto BP. 2001. Performa
tersebut yang oleh Rekwort et al. (2000) dikenal dengan reproduksi sapi perah pada tiga zona klimatik di Bogor.
istilah bull biostimulation berdasarkan hasil J II Pert Indon. 10(2):50-57.
penelitiannya mampu mengurangi pencapaian umur Ahmed WM. 2007. Overview on some factors negatively
awal pubertas. Namun demikian ternyata pencapaian affecting ovarian activity in large farm animals. Global
umur awal pubertas pada sapi Katingan relatif lama. Vet. 1(1):53-66.
Faktor lingkungan diduga lebih menonjol pengaruhnya Ahmed WM, Khadrawy HH, HanafI EM, El Hameed ARA,
terhadap awal pubertas, khususnya aspek lahan yang Sabra HA. 2009. Effect of copper deficiency on ovarian
asam yang berpengaruh pada rumput yang dihasilkan activity in Egyptian Buffalo-cows. World J Zool. 4:01-
(miskin nutrisi dan mineral) dan aspek iklim. 08.
Al-Shami SA. 2007. Effect of feeding hay supplemented with
KESIMPULAN concentrates on feedlot and reproductive performance of
prepubertal Hassawi heifers. J Anim Vet Adv. 6:26-28.
Berdasarkan hasil penelitian diperoleh kesimpulan
bahwa umur pubertas sapi Katingan betina Balakrishnan M, Chinnaiya GP, Nair PG, Rao AJ. 1986.
Studies on serum progesterone levels in Zebu x Holstein
diestimasikan lebih dari 23 bulan berdasarkan heifers during pre- and peripubertal periods. Anim
konsentrasi progesteron dan informasi jarak beranak. Reprod Sci. 11:11-15. Abstract.
Faktor lingkungan terutama pakan akibat defisiensi
mineral Cu diduga kuat mempengaruhi pencapaian awal Berardinelli JG, Dailey RA, Butcher RL, Inskeep EK. 1979.
umur pubertas Sapi Katingan. Source of progesterone prior to puberty in beef heifers. J
Anim Sci. 49:1276-1280.
Berdasarkan hasil tersebut disarankan untuk
dilakukan penelitian lanjutan terhadap kepastian umur Bishop H, Pfeiffer D. 2008. Factors effecting reproductive
awal pubertas pola pemeliharaan ekstensif. Penelitian performance in Rwandan cattle. Trop Anim Health
lebih lanjut juga perlu dilakukan terhadap lingkungan Prod. 40:181-184.
yang diduga mempengaruhi terhadap pencapaian umur Cooke RF, Arthington JD. 2009. Plasma progesterone
awal pubertas pada Sapi Katingan, misalnya concentrations as puberty criteria for Brahman-
manajemen pemeliharaan pakan, perbaikan padang crossbred heifers. Livest Sci. 123:101-105.
rumput, pencapaian bobot ideal dewasa kelamin, dll. Darmono. 2007. Penyakit defisiensi mineral pada ternak
ruminansia dan upaya pencegahannya. J Litbang Pert.
DAFTAR PUSTAKA 26:104-108.
Darmono. 2009. Menyiasati peran suplemen logam dan
Abdelgadir AM, Izeldin A, Babiker, Eltayeb AE. 2010. Effect mineral terhadap kesehatan ternak menuju swasembada
of concentrate supplementation on growth and sexual daging. Orasi pengukuhan profesor riset. Badan
development of dairy heifers. J Appl Sci Res. 6(3):212- Penelitian dan Pengembangan Pertanian. Jakarta.
217.

128
 Utomo et al. Pubertas Sapi Katingan betina dikaitkan dengan konsentrasi mineral Cu dan lingkungan
Desai MC, Thakkar TP, Darshoane A, Janakiramon J. 1982. A
note on serum copper and iron in Surti buffalo in
relation to reproduction and gonadotropins. Indian J
Anim Sci. 52:443-444.
Eduvie LO, Bawa EK, Dawuda PM, Oyedipe EO, Olorunju
SAS, Bale JO, Sekon VO. 1993. Factors affecting the
reproductive performance of Bunaji cattle under
different pastoral management systems in the Guine
savanna zone of Nigeria. In: Improving the productivity
of indigenous African livestock. Vienna: IAEA. Page
31-38.
Faruque MO, Bhuiyan AKFH. 2002. Cattle and buffalo
breeding in Bangladesh. In: Allen J and Ancharlie NA,
editors. Development strategies for genetic evaluation
for beef production in developing countries.
Proceedings of an International Khon Kaen Province
(Thailand): July 23-28 2001. Canberra, Australian
Centre for International Agricultural Research. p. 23-27.
Gadberry MS, Troxel TR, Davis GV. 2003. Blood trace
mineral concentrations of cows and heifers from farms
enrolled in the Arkansas beef improvement program.
Arkansas Animal Science Department Report 2003.
Online: http://arkansasagnews.uark.edu/509-12.pdf.
Tanggal 20 April 2011
Gartenberg PK, MC Dowell LR, Rodriguez D, Wikiinson N,
Conrad JH, Martin FG. 1990. Evaluation of trace
mineral status of ruminant in northeast Mexico.
Livestock Res For rural Development 3(2):1-6.
Gardner WC, Broersma K, Popp JD, Mir Z, Mir PS, Buckley
WT. 2003. Copper and health status of cattle grazing
high-molybdenum forage from a reclaimed mine tailing
site. Can J Anim Sci. 83:479-485.
Getzewich KE. 2005. Hormonal regulation of the onset
puberty in purebred and crossbred Holstein and Jersey
heifers. Thesis. The Virginia Polytechnic Institute and
State University.
Gwazdauskas Fc. 1985. Effects of climate on reproduction in
cattle. J Dairy Sci. 68:1568-1578. Abstract.
Kadarsih S. 2003. Peranan ukuran tubuh terhadap bobot badan
Sapi Bali di Propinsi Bengkulu. Jurnal Penelitian UNIB
9(1):45-48.
Kanuya NL, Nkya R, Kessy BM. 1993. Reproductive
performnace of Tanzania MPWAPWA Cattle at puberty
and post-partum. In: In Improving The Productivity of
Indigenous African Livestock. IAEA. Vienna. Page 49-
57.
Kincaid RL. 1999. Assessment of trace mineral status of
ruminants: A review. Proceedings of the American
Society of Animal Science, 1-10.
Kincaid RL. 2000. Assessment of trace mineral status of
ruminants: A review. J Anim Sci. 77: 1-10.
Leanne MVDW, Hendrick S, Waldner CL. 2010. Serum
micronutrient concentrations in beef cows before and
after the summer grazing season. Can J Anim Sci. 90:
563-574.
Mcdowell LR. 1992. Minerals in Animal and Human
Nutrition. Academic Press, New York.
Miazi OM, Hossain E, Hassan MM. 2007. Productive and
reproductive performance of crossbred and indigenous
dairy cows under rural conditions in Comilla,
Bangladesh. Univ J Zool Rajashahi Univ. 26:67-70.
Nakada K, Moriyoshi M, Nakao T, Watanabe G, Taya K.
2000. Changes in concentrations of plasma
immunoreactive follicle-stimulating hormone,
luteinizing hormone, estradiol 17-ß, testosterone,
progesterone, and inhibin in heifers from birth to
puberty. Domest Anim Endocrinol. 18:57-69.
Nogueira GP. 2004. Puberty in South American Bos indicus
(Zebu) cattle. Anim Reprod Sci. 82–83: 361–372.
Osei SA, Karikari PK, Tuah AK, Gyawu P, Opoku RS,
Asiamah M, Heathcote DC. 1993. Studies on the
reproductive performance of indigenous beef cattle
breeds raised on- farm in Ghana. In: Improving The
Productivity of Indigenous African Livestock. Vienna:
IAEA. Page 103-112.
Premasundera AS. 2002. Cattle and Buffalo Production and
Breeding in Sri Lanka. In: Allen J and Ancharlie NA,
editors. Development Strategies for Genetic Evaluation
for Beef Production in Developing Countries
Proceedings of an International Workshop held in Khon
Kaen Province, Thailand, July 23–28 2001. Australian
Centre for International Agricultural Research.
Canberra. P. 81-87.
Rawlings NC, Evans ACO, Honaramooz A, Bartlewski PM.
2003. Antral follicle growth and endocrine changes in
prepubertal cattle, sheep and goats. Anim Reprod Sci.
78:259-270.
Rekwort P, Ogwu D, Oyedipe E, Sekoni V. 2000. Effects of
bull exposure and body growth on onset of puberty in
Bunaji and Friesian Bunaji heifers. Reprod Nutr Dev.
40:359-367.
Romano MA., Barnabe WH, Silva AEDF, Freitas, Romano.
2005. The effect of nutritional level on advancing age at
puberty in Nelore heifers. Ambiencia Guarapuava PR.
1:157-167.
Saenz SI., Walsh JD, Gardner CM, Mulliniks JT, Schilling
BS, Hallford DM. 2008. Age at puberty in beef heifers:
Criollo Cattle versus British crossbred cattle.
Proceedings, Western Section, American Society of
Anim Sci. 59:237-240.
Sargentini C, Bozzi R, Rivera PD, Giorgetti A, Martini A,
Lupi P, Cazzola PL, Beltempo S, Carelli T. 2007. Onset
of puberty in Maremmana heifers. Ital J Anim Sci.
6:385-394.
Shehu DM, Oni OO, Olorunju SAS, Adeyinka IA. 2008.
Genetic and phenotypic parameters for body weight of
sokoto Gudali (Bokoloji) Cattle. Int Jor P App Scs.
2(2):64-67.
129
 JITV Vol. 18 No 2 Th. 2013: 123-130
Singh G, Gaur GK, Nivsarkar AE, Patil GR, Mitkari KR.
2002. Deoni cattle breed of India. A study on population
dynamics and morphometric characteristics. Agri.
32:35-43.
Son CH, Kang HG, Kim SH. 2001. Application of
progesterone measurement for age and body weight at
puberty, and postpartum anestrus in Korean Native
Cattle. J Vet Med Sci. 63(12):1287-1291.
Stoltz DR, Darmono, Ismawan, Gunawan, Marshall RB.
1985. Bovine copper deficiency in Indonesia. Proc. 3 rd
Animal Sc.Congr. Seoul: Asian-Australian Assoc
Animal Prod Soc. 1:531-533.
Sutradhar ABC, Hasanuzzaman M, Miazi OF, Aktaruzzaman
M, Faruk MO. 2010. Study on the productive and
reproductive performances of Red Chittagong Cow ar
rural areas in Chittagong. Univ J Zool Rajashahi Univ.
28:27-31.
Swain RK, Harjit K. 2001. Plasma progesterone levels during
prepubertal period and estrous cycle in crossbred heifers
fed on two dietary protein levels. J nuclear agric biol.
31(2):99-103. Abstract.
130
Talib C, Entwistle K, Siregar A, Turner SB, Lindsay D. 2003.
Survey of Population and Production Dynamics of Bali
Cattle and Existing Breeding Programs in Indonesia.
In: Entwistle K and Lindsay DR, editors. Strategies to
Improve Bali Cattle in eastern Indonesia. ACIAR
Proceedings no 110. Proceedings of a Workshop 4–7
Februrary 2002, Bali, Indonesia. Australian Centre for
International Agricultural Research. Canberra. Page 3-9.
Terzano GM, Neglia G, Maschio M, Barile VL, Razzano M,
Martiniello P, Cannone I, Borghese A. 2007. Effect of
intensive or extensive systems on buffalo heifers
performances: onset of puberty and ovarian size. Ital. J.
Anim. Sci. 6(2):1273-1276.
Toelihere MR. 1985. Fisiologi Reproduksi pada Ternak.
Penerbit Angkasa. Bandung.
Xin Z, Silvia WJ, Waterman DF, Hemken RW, Tucker WB.
1993. Effect of copper status on In vivo oxidative
modification of erythrocyte luteinizing hormone
secretion in dairy steers. J. Dairy membrane proteins in
copper deficiency. Free Radical Sci. 76:437-444

PUBERTY IN CROSSBRED AND STRAIGHTBRED
HEIFERS ON TWO LEVELS OF FEED 1
J. N. WILTBANK, 2 C. W. KASSON 3 AND J. E. INSALLS 4, 5
U.S. De.partment of Agriculture, Fort Robin'son Beef Research Station, Nebraska
and University of Nebraska, Limoln
p Ulevel
B E R T Y in beef heifers is influenced by
of nutrition, breed, sire, growth rate
and heterosis (Warnick et al., 1956; Chris-
tian, 1957; Wiltbank, Rowden and Ingalls,
1959; Reynolds, DeRouen and High, Jr.,
1963; Wiltbank et al., 1966). I t is not known
if the effect of level of nutrition is comparable
in all breeds and crosses of beef heifers. This
experiment was designed to determine if level
of nutrition had a differential effect on age
and weight at puberty in straightbred and
crossbred beef heifers.
M a t e r i a l and M e t h o d s
The heifers were produced by mating four
Angus and four Hereford sires to yearling
Angus or Hereford females. Each bull was
mated to approximately equal numbers of fe-
males of his own breed and of the other breed
(Wiltbank et al., 1967). The dams of these
heifers were on two different feeding regimes
before and three feeding regimes after the
birth of the calves. The heifers were weaned
from July through October at 127 to 175 days
of age and assigned within breed groups (An-
gus, Hereford or crossbred) to either a low or
high nutritional level. The eight sires were
represented almost equally among the heifers
in each group. Prior nutritional level of dams
could not be considered because of the limited
number of heifers available. Weight of the
heifers at 120 days was used in assigning
heifers to make weight at 120 days as equal
as possible in high and low nutritional groups
in each breed. The design of the experiment
and the number of heifers in each group are
shown in table 1.
Heifers on the high nutritional level received
a full feed of concentrate plus 1.3 to 1.8 kg.
of crested or intermediate wheat grass hay
per head per day. The concentrate was 40%
x Published with the approval of the director as Paper No.
2375 Journal series, Nebraska Agriculture Experiment Station.
S Present address: Department of Animal Science, Colorado
State University, Fort Collins.
s Present address: The Upjohn Co., Kalamazoo, Michigan.
Deceased.
5 Authors wish to acknowledge the assistance of J. W. Thorn-
ton in the analysis of the data.
602
Downloaded from https://academic.oup.com/jas/article-abstract/29/4/602/4697280 by Jean and Alexander Heard Library Vanderbilt University user on 28 December 2019
BEEF
beet pulp 6 and 60% ground shelled corn. The
concentrate was kept in a self-feeder, and
heifers had access to the feeder for approxi-
mately 14 hr. daily.
Heifers on the low nutritional level received
a full feed of either crested or intermediate
wheat grass hay and 0.2 kg. of 40% protein
supplement daily. Heifers received these diets
from weaning until the first ovulatory estrus,
which was defined as puberty.
Estrus was detected with the aid of a steril-
ized bull (Wiltbank, 1961). The bull was
painted twice daily on the brisket with grease
containing pigment. The bull was with heifers
on the low level of nutrition during the night
and with heifers on the high level of nutrition
during the day. Each group of heifers was ob-
served for estrus for approximately 30 mill.
night and morning. A grease mark on the
rump or tail head or standing to be ridden was
taken as an indication of estrus. Rectal exam-
inations of the ovaries were made biweekly to
determine if ovulations had occurred without
estrus and if ovulation occurred following es-
trus. The incidence of ovulations without es-
trus was negligible. The heifers were weighed
biweekly.
Results and Discussion
The heifers assigned to the low level of nu-
trition were heavier at the start of the experi-
ment in all breed groups (table 2). The weight
gains of heifers on the two levels of feed were
markedly different (table 2). The average
daily gain from 6 to 12 months was 0.78 kg.
for heifers on the high level of feed and 0.33
kg. for heifers on the low level of feed ( P ~
.01). The average weight at 12 months of age
was 298.5 kg. for heifers on the high level of
feed and 218.6 kg. for heifers on the low level
of feed ( P < . 0 1 ) .
There was a difference in rate of gain be-
tween breed groups ( P < . 0 1 ) . Hereford heifers
gained slower on both levels of feed than the
6 LPC, manufactured by Great Western Sugar Co. and con-
taining dried beet pulp plus condensed beet solubles neutralized
with ammonia.

TABLE 1. D E S I G N O F E X P E R I M E N T
NUMBERS OF HEIFERS
B r e e d i n g of h e i f e r s
L e v e l of
nutrition H H ** AA
High * 8 12
Low 8 12
* Level of nutrition during experimental period.
9 *~ H : H e r e f o r d ; A~Angus. First letter refers to breed of
sire, second to breed of dam.
other three groups, while the two crossbred
groups made the most rapid gains. The inter-
action between breed group and level of nutri-
tion was not significant ( P > . 0 5 ) , indicating
that level of feed did not have a different effect
on rate of gain in the different breed groups
(table 3).
Straightbred heifers on the high level of feed
reached puberty an average of 191 days earlier
than straightbred heifers on a low level of feed
(table 4). The difference between the cross-
bred heifers on the two levels of feed was only
43 days. Thus, evidence for a differential effect
Downloaded from https://academic.oup.com/jas/article-abstract/29/4/602/4697280 by Jean and Alexander Heard Library Vanderbilt University user on 28 December 2019
P U B E R T Y IN BEEF 603
AND of level of nutrition and breed of heifers on
age at puberty was found (table 5). This dif-
ferential effect is also seen in the difference
between straightbred and crossbred heifers in
AH HA age at puberty on the high level of feed (0
9 8 days) and the low level of feed (148 days)
10 7 (table 4).
Crossbred heifers on the high level of feed
were heavier than straightbred heifers at pu-
berty, while crossbred heifers on the low level
of feed were lighter than straightbred heifers
at puberty. This led to a significant interac-
tion for weight at puberty between nutritional
level and crossbred v s . straightbred heifers
( P < . 0 1 ) (table 5).
Crossbred heifers on the high level of feed
gained more weight from the start of the ex-
periment to puberty than straightbred heifers
(193 v s . 169). The opposite was true on the
low level of feed. Crossbred heifers gained 105
kg. while straightbred heifers gained 128 kg.
(table 4). This led to a highly significant nu-
trition X breed interaction (table 5).

TABLE 2. W E I G H T OF HEIFERS AT START OF THE EXPERIMENT AND WEIGHT GAINS

DURING THE EXPERIMENTAL PERIOD

Straight- Cross- Differ-

HH AA AH HA bred bred ence
Wt. on experiment (kg,)
H i g h nutrition 129.9 136.8 128,7 146.0 133.9 136.8 2.9
Low nutrition 135.2 143.1 147.4 150.3 140.0 148.6 8.6
Difference 5.3 6.3 18.7 4.3 6.1 11.8 ...
Wt. at 12 too. of age (kg.)
High nutrition 270.9 302.2 306.3 311.2 289.0 308.6 19.6
Low nutrition 191.1 219.9 235.8 223.7 208.4 230.8 22.4
Difference 79.8 82.3 70.5 87.5 80.6 77.8 ...
Gain from 6 mo. of age to
12 mo. of age (kg.)
High nutrition 123.2 138.3 153.7 142.8 131.9 148.5 16.6
Low nutrition 47.9 59.3 71.0 57.0 54.8 65.2 10.4
Difference 75.3 79.0 82.7 85.8 77.1 83.3 ...
Av. daily gain from 6 too. of age to
12 too. of age (kg.)
High nutrition .68 .77 .85 .79 .73 .82 .09
Low nutrition .27 .33 .39 .32 .30 .36 : 06
Difference .41 .44 .46 .47 .43 .46 ...

TABLE 3. M E A N SQUARES FOR WEIGHT AND WEIGHT GAIN

Wt. on Av. daily

experi- Wt. at Gain gain
S o u r c e of v a r i a t i o n d.f. ment 12 t o o . 6-12 mo. 6-12 mo.

N u t r i t i o n a l level ( N ) 1 1363" 115541** 117393** 3.62**

Breed Group (B) 3 626 5465** 1849"* .056**
C r o s s b r e d v s . S t r a i g h t b r e d ( C . v s . S) 1 592 8847** 3831"* .12"*
Angus vs. Hereford (A vs. H) 1 534 7536** 1253"* .03*
Angus-Hereford vs. Hereford-Angus 1 752 12 462 .02
N x B 3 236 304 306 .01
NxCvs. S 1 171 0 0 0
NxAvs. H 1 0 0 0 0
N x AH vs. HA 1 368 0 0 0
Residual 66 337 529.4 196 .00,6
* P<.05.
** P<.01.
 Downloaded from https://academic.oup.com/jas/article-abstract/29/4/602/4697280 by Jean and Alexander Heard Library Vanderbilt University user on 28 December 2019
604 WILTBANK, KASSON AND INGALLS
TABLE 4. AGE AND W E I G H T AT P U B E R T Y AS I N F L U E N C E D BY LEVEL OF FEED

Straight- Cross- Differ-

HH AA AH HA bred bred ence
Age at puberty (days)
High nutrition 387 374 384 378 381 381 0
L o w nutrition 660 483 416 402 572 424 148
Difference 273 109 62 24 191 43 ...
Wt. at puberty (kg.)
High nutrition 294 305 331 329 299 330 31
L o w nutrition 279 257 270 238 268 254 14
Difference 15 48 61 91 31 76 ...
Wt. gain start of experiment
to puberty (kg.)
High nutrition 164 173 202 183 169 193 24
L o w nutrition 143 114 123 88 128 105 23
Difference 21 59 79 95 41 88 .,.

Correlations and regressions between age at
puberty and preweaning rate of gain, post-
weaning rate of gain and gain from birth to
12 months were calculated. The regressions for
age at puberty on gain on the high level of
feed were not significant and fluctuated around
zero (table 6). Regressions for crossbred heif-
ers on the low level of feed were all negative
and nonsignificant ( P ~ . 0 5 ) . Regressions for
straightbred heifers on the low level of feed
were all negative and significant ( P < . 0 5 ) , in-
dicating that faster growing straightbred heif-
ers reached puberty earlier. Age at puberty
was adjusted for differences in gain in the
straightbred heifers on the low level of feed.
The adjusted average age at puberty was 4 to
9 days younger than when ages were unad-
justed. Differences between crossbred heifers
and straightbred heifers on the low level were
still large and significant ( P < . 0 5 ) .
The magnitude of the correlation indicates
that only in the straightbred heifers on the low
level of feed could a significant amount of the
variation in age at puberty be accounted for
by differences in growth rate.
TABLE 5. MEAN SQUARES FOR AGE AND W E I G H T AT P U B E R T Y
The relationship between level of feed and
age at puberty reported here is similar to the
results reported for dairy cattle (Eckles, 1915;
Crichton and Aitken, 1954; Hansson, 1956;
Reid, 1959) and beef cattle (Joubert, 1954;
Wiltbank et al., 1966). The cause of the differ-
ence in the magnitude of response in straight-
bred and crossbred heifers on the two levels
of nutrition is not fully known. Some of the
difference appears to be the result of a differ-
ence in growth rate between straightbred and
crossbred heifers.
Three observations indicate that some fac-
tor in addition to weight of heifers is impor-
tant in determining time of puberty. These
are:
(I) Heifers on the high level of feed were
significantly heavier at puberty than
heifers on the low level of feed, indicat-
ing that some factor other than weight
was involved in determining age at pu-
berty in heifers on the high level of
feed.
(2) Crossbred heifers on the high level of

Wt. gain
Age at Wt. at start of experi-
Source of variation d.f. puberty puberty ment to puberty
Nutritional level (N) 1 246737** 51385** 78618**
Breed Group (B) 3 54763** 0 28630**
Crossbred vs. Straightbred (C vs. S) 1 70627** 2019 2075
Hereford vs. Angus (H vs. A) I 87440** 0 57536**
Angus-Hereford vs. Hereford-Angus
(AH v s . HA) 1 6222 1288 26280**
N xB 3 47148** 5259** 81002**
N x C vs. S 1 74773** 6516"* 122718**
N x H vs. A 1 33974** 0 0
N x AH vs. HA 1 0 0 169087**
Residual 66 4802 1171 1048
** P~.O1.

PUBERTY IN BEEF
TABLE 6. REGRESSIONS (DAYS PER 0.1 KG. ADG) AND CORRELATIONS OF AGE
AT PUBERTY ON PREWEANING, POSTWEANING AND LIFETIME GAIN
ADG birth to weaning
Linear
Item Correlation regression
Low nutritional level
Crossbred , --. 07 --. 9
Straightbred --. 69** --21.9*
High nutrition level
Crossbred --. 31 --1.3
Straightbred 0.30 1.2
* P<.05.
** P<.OI.
feed were heavier at p u b e r t y than the
straightbred heifers, yet age at p u b e r t y
was the same, again indicating that a
factor other than size was operative.
(3) Although crossbred heifers on the low
level of feed were heavier at the start
of the experiment and gained faster
than the straightbred heifers on the low
level of feed (0.36 kg. v s . 0.30 kg. per
day), not all the difference in age at
p u b e r t y can be explained b y the differ-
ence in growth rate. Some of the effect
is the result of crossbred heifers reach-
ing p u b e r t y at lighter weights.
These data tend to support those of Wilt-
b a n k et al. (1966), who concluded that there
was a heterotic effect independent of growth
rate on age at puberty. However, the difference
in growth rate between crossbred and straight-
bred heifers on the low level of feed appears
to account for a large portion of the difference
in age at p u b e r t y between crossbreds and
straightbreds.
Summary
Age and weight at p u b e r t y in heifers were
determined for Hereford, Angus and the
crosses between the two breeds. The heifers
were allotted to two nutritional levels from
weaning to puberty. The average daily gain
from 6 to 12 months of age was 0.82 kg. and
0.73 kg. for crossbred and straightbred heifers
on the high level of feed and 0.30 kg. and 0.36
kg. for crossbred and straightbred heifers on
the low level of feed. The average age at pu-
berty was 381 days for both crossbred and
straightbred heifers on the high level of feed,
while on the low level of feed the average age
at p u b e r t y was 424 days for the crossbred
heifers and 572 days for the straightbred
heifers. The average weight at p u b e r t y was
Downloaded from https://academic.oup.com/jas/article-abstract/29/4/602/4697280 by Jean and Alexander Heard Library Vanderbilt University user on 28 December 2019
605
A D G weaning to 12 mo. ADG birth to 12 too.
Linear Linear
Correlation regression Correlation regression
--. 21 --3.5 ~ . 35 --8.1
--.45" --16.8* --. 74** --31.6*
0.05 0.3 --. 22 --1.5
0.09 0.4 0.23 1.3
330 kg. for crossbred heifers and 299 kg. for
straightbred heifers on the high level of feed
and 254 kg. and 268 kg. for crossbred and
straightbred heifers on the low level of feed.
Thus, a n interaction for age and weight at
p u b e r t y was found between level of nutrition
and breed of the heifer.
Literature Cited
Christian, R. E. 1957. Age at puberty and related
phenomena in the beef heifer. Proc. Western Sec.
Am. Soc. An. Prod. 8:XXXXII.
Crichton, J. A. and J. N. Aitken. 1954. The eco-
nomical rearing of dairy heifers. Proc. Nutr. Soc.
13:10.
Eckles, C. H. 1915. The ration and age at calving
as factors influencing the growth and dairy
qualities of cows. Missouri Agr. Exp. Sta. Bul.
135.
Hansson, A. 1956. Influence of rearing intensity on
body development and milk production. Proc.
British Soc. An. Prod. 1956:51.
Joubert, D. M. 1954. The influence of high and low
nutritional plans on the oestrous cycle and con-
ception rate of heifers. J. Agr. Sci. 45:164.
Reid, J. T. 1959. Effect of energy intake upon
reproduction in farm animals. Suppl. J. Dairy Sci.
43.
Reynolds, W. L., T. M. DeRouen and J. W. High,
Jr. 1963. The age and weight at puberty of Angus,
Brahman and Zebu cross heifers. J. Animal Sci.
22:243. (Abstr.).
Warnick, A. C., W. C. Burns, M. Kroger and M. W.
Hazen. 1956. Puberty in English, Brahman and
crossbred breeds of beef heifers. Prec. Assn. Soc
Workers, p. 95.
Wiltbank, J. N., W. W. Rowden and J. E. Ingalls.
1959. The age and weight at puberty in Hereford
heifers. J. Animal Sci. 18:1562. (Abstr.).
Wiltbank, J. N. 1961. A technique for sterilization of
bulls. The Southwestern Vet. 14:194.
Wiltbank, J. N., K. E. Gregory, L. A. Swiger, J.
E. Ingalls, J. A. Rothlisberger and R. M. Koch.
1966. Effects of heterosis on age and weight at
puberty in beef heifers. J. Animal Sci. 25:744.
Wiltbank, J. N., K. E. Gregory, J. A. Rothlisberger,
J. E. Ingalls and C. W. Kasson. 1967. Fertility
in beef cow bred to produce straightbred or
crossbred calves. J. Animal Sci. 26:1005.
 Pengaruh Nutrisi dalam Pengelolaan Reproduksi Ternak (Studi Literatur)
1

Abstract

Nutrients are needed by livestock to maintain the viability of the animal itself. Completeness of nutrients

pregnancy, child birth weight, weaning weight and keep the child after the parent state when lactation. While
the male animals, completeness nutrients in animal feed can maintain the quality of sperm produced. The food
is reasonably necessary for the normal functioning endoktrin. Levels of food affect the synthesis and release
of hormones from endoktrin. Growth and development of the reproductive organs of cattle is inhibited by
lack of food regardless of whether because of low levels of energy, protein, minerals or vitamins. Therefore
it is necessary to maintain forage nutritional completeness in this case will help the management of livestock
reproduction. Reproduction disrupted livestock and poultry farms will harm the survival of the animal itself. This
paper is a contribution of ideas and a review of several studies on the role of nutrition in animal reproduction.
Keywords: nutrition, reproduction, ruminants

Pendahuluan merupakan pertanyaan untuk memahami mekanisme

Makanan merupakan faktor yang penting dalam
suatu usaha peternakan. Tanpa makanan yang baik dan
dalam jumlah yang memadai maka meskipun ternak
tersebut merupakan bibit unggul akan kurang dapat
memperlihatkan keunggulannya. Proses pencernaan
makanan pada ruminansia seperti sapi, kerbau dan
kambing merupakan proses yang komplek. Sebagian
besar aksi konsumsi bahan pakan sebagai suplai
produksi komponen energi dan protein yang dapat
dicerna dan diserap. Rumen didiami oleh banyak
tipe mikro organisme. Sebagian besar pencernaan
karbohidrat komplek, termasuk selulosa, karbohidrat
dasar, memproduksi volatile fatty acids (VFA) seperti
asetat, propionat dan butirat. Propionat merupakan
dua substrat energi utama digunakan oleh ruminansia
dan dirubah menjadi glokosa pada hati. Jumlah
relatif tiap-tiap volatile fatty acids yang diproduksi
merupakan bahan pakan tergantung dengan tipe
pakan. Roughage mendorong produksi asetat dan
pakan dasar sereal mendorong produksi propionat.
Jadi tipe pakan dapat merubah ketersedian nutrisi
untuk tujuan produksi.
Pakan dan nutrisi bahan makanan tertentu selama
kehidupan embrionik dan kehidupan fetus awal
terhadap performansi reproduksi. Kemudian juga
molekuler dan seluler yang terlibat saat pergantian
pada suplai nutrisi menyebabkan perubahan terhadap
performansi reproduksi. Hewan memerlukan
protein sebagai sumber asam amino esensial dan
(pada ruminansia) sebagai sumber nitrogen untuk
cernanya. Bahan pakan protein dikategorikan sebagai
bahan yang dapat terdegradasi dalam rumen dan
tidak dapat terdegradasi dalam rumen pada basis
kemampuan mikroba untuk menghidrolisa protein
dalam rumen.
Kebutuhan protein hewan tergantung pada status
physiologi dan tingkat produksi. Asam amino esensial
harus disuplai dalam pakan monogastrik, namun pada
ternak ruminansia mikroba rumen dapat dijadikan
sumber utama asam amino. Ruminansia juga mampu
mengurangi kehilangan protein dengan mendaur
ulang urea, suatu produk metabolisme protein yang
secara normal dieksresikan. Jadi sebagian besar
urea dapat didaur ulang ke rumen saat pakan rendah
nitrogen. Surplus asam amino akan di deaminasi dan
nitrogen diekskresikan melalui hati dan ginjal, dan
dikeluarkan dalam urin. Kelebihan ammonia adalah
di konjugasi ke urea dan kemudian diekresikan. Jadi
level urea tinggi adalah konsisten dengan kelebihan
protein intake, mungkin dengan kekurangan energi

20
 Yendraliza: Pengaruh Nutrisi dalam Pengelolaan Repproduksi Ternak (Studi Literatur)
bersamaan, dan sepertinya berhubungan dengan level
amonia tinggi dalam sirkulasi (Boland, et al., 2001).
Nutrisi bahan pakan meningkatkan programming
dan ekspresi metabolik pathway yang memungkinkan
hewan mencapai potensi genetiknya untuk reproduksi.
Hal tersebut indikasi dari metabolit blood-borne
sebagai perantara, sebagai contoh, aktivasi nutrisi dari
generator pulse Gonadothrophin Releasing Hormone
(GnRH). percobaan yang sangat sulit. Di lain pihak,
pentingnya observasi baru sangat diperlukan dengan
melihat perbedaan tingkat pemberian.
Kebutuhan Nutrisi untuk Bereproduksi
Pemberian enersi yang tidak cukup kemungkinan
merupakan penyebab terbesar gangguan reproduksi
pada ternak. Hal ini dibuktikan pada penelitian sapi
di Nigeria Utara bahwa penambahan konsentrat kaya
akan protein dan karbohidrat serta campuran mineral
memperlihatkan masak kelamin dan kebuntingan
lebih cepat dibandingkan sapi yang tidak mendapatkan
tambahn enersi. Pada sapi yang sedang bunting dapat
mengalami abortus jika kekurangan energi.
Penambahan protein menyebabkan penambahan
pertumbuhan pada sapi dara namun ada beberapa
penelitian yang memperlihatkan bahwa sapi yang
hidup dengan kadar protein rendah dan enersi rendah
masih memperlihatkan ciri-ciri berahi, bunting
dan melahirkan, seperti pada kerbau (Borghese
mengakibatkan ternak mengalami penundaan
pubertas dan tanda-tanda berahi yang tidak normal.
Kadar calcium yang rendah dalam makanan dapat
menyebabkan ternak lambat pubertas. Begitu juga
akan menyebabkan lahirnya bayi premature pada sapi
perah dan lambatnya dewasa kelamin pada sapi dara.
Pengaruh nutrisi pada saat fetus
Kekurangan nutrisi pada domba selama
kehidupan fetus dan neonatal menurunkan litter
size (reviewed by robinson, 1990). Komponen
penting reproduksi adalah kelangsungan hidup saat
lahir. Hal tersebut adalah bukti pada domba yang
meskipun tidak berpengaruh terhadap bobot lahir
domba, adalah berhubungan dengan penurunan
vigour domba saat lahir dan depresi pada kekebalan
pasif terhadap penyakit (Fisher and MacPherson,
dapat memperbaiki vigour saat lahir.
Bishonga et al. (1994) menemukan bahwa ketika
konsentrasi amonia plasma ditingkatkan (100 - 150
µmol l -1) menyebabkan tingginya insiden kematian
embrio, Selain itu juga dapat menimbulkan oversize
fetus. Fenomena oversize fetus belum dibatasi
meskipun pada kultur embrio secara in vitro tapi
mungkin penyebab oversize fetus tersebut diduga
muncul dari pengaruh nutrisi in vivo. Pemberian
makanan dengan level rendah pada sapi dara, akan
menganggu pertumbuhan sapi dara dan mengalami
kesulitan dalam melahirkan (Salisbury dan
Vabdemark, 1985).
Pengaruh nutrisi terhadap pubertas
Pada sapi potong, penurunan tingkatan makanan
umumnya memperlambat timbulnya pubertas
sedangkan tingkatan makanan yang tinggi dapat
mempercepat pubertas dan peningkatan berat badan
(Toelihere, 1979). Wiltbank et al., 1966 menyatakan
bahwa pertambahan berat badan yang lebih cepat
antara waktu lahir dan waktu disapih dan antara
waktu disapih dan umur 396 hari akan mempercepat
timbulnya pubertas pada sapi-sapi dara. Selanjutnya
Foster et al. (1988) menunjukkan bahwa infusi
parenteral campuran asam amino-dextrose efektif
memberikan frekuensi pulse Lutheneising Hormone
(LH) tinggi dengan syarat program pemberian pakan
dilakukan kontiniu pada domba selama kebuntingan.
Phillippo et al. (1987) berpendapat bahwa
induksi molybdenum mengganggu sekresi LH,
menunda pubertas pada sapi. Penelitian pada efek
nutrisi terhadap pencapaian pubertas adalah bahwa
kekurangan sebagian besar nutrisi dapat menunda
pubertas. Selain itu perubahan level induksi pakan
pada laju pertumbuhan juga dapat menunda pubertas.
Kelambatan timbulnya pubertas karena kekurangan
makanan mungkin disebabkan oleh rendanya
kadar gonadotropin yang dihasilkan oleh kelenjer
adenohypohysa, kurangnya respon ovaria atau
mungkin karena kegagalan ovaria untuk menghasilkan
sejumlah estrogen yang cukup (Toelihere, 1979).
sapi perah dara menunjukkan bahwa kombinasi
tersebut dapat memperlambat dewasa kelamin dan
menekan munculnya tanda-tanda berahi (Salisbury
dan Vandemark, 1985).
21
Kutubkhanah, Vol. 16 No. 1 Januari – Juni 2013
Pada ovarium, feed intake yang rendah
akan menunda pubertas yang disertai penurunan
perkembangan folikel ovarium sehingga pada sapi
betina feed intake yang rendah dapat membuat
folikel dominan lebih kecil (Bergfeld et al. 1994).
Ini terjadi meskipun cukup Gonadothrophin, seperti
diduga oleh respon glandula pituitary terhadap dosis
pada kontrol pelepasan GnRH juga merupakan subjek
spekulasi. Penelitian Hall et al. (1992) menunjukkan
pengaruh stimulasi infusi tyrosine abomasal terhadap
frekuensi pulse LH pada pertumbuhan terbatas anak
domba betina secara tak langsung bahwa mungkin
asam amino ini berfungsi sebagai signal nutrisi
mempengaruhi pusat syaraf mengontrol pelepasan
GnRH. Metabolit blood-borne yang lain adalah
insulin dan insulin-like growth factors (IGFs) namun
berlawanan peran.
Pengaruh nutrisi terhadap Laju Ovulasi
Perubahan laju ovulasi secara umum terjadi saat
durasi waktu dimana kelangsungan hidup folikel
gonadotrophin-dependent meningkat atau ketika
peningkatan pada laju folikel berlangsung tanpa ada
pergantian pada durasi (Scaramuzzi et al. 1993). Pada
kasus respon ovulasi terhadap nutrisi, kedua elemen
mekanisme dapat beroperasi. Melalui pengaruh
ini terhadap feedback hormon mengontrol sekresi
gonadotrophin. Perubahan level dan durasi memulai
folikel gonadotrophin-dependent terhadap FSH.
Pengaruh nutrisi terhadap sirkulasi FSH
konsentrasi tetap samar, hal ini juga telah dinyatakan
bahwa nutrisi 4(glukosa, asam-asam amino) dan
nutrisi yang berhubungan dengan metabolit (insulin,
growth hormon, IGFs dan IGFs binding protein) yang
secara tak langsung berpengaruh pada respon ovulasi
terhadap nutrisi, mungkin berlangsung pada level
ovarium menurunkan jumlah kebutuhan FSH untuk
mendukung folikel-folikel gonadotrophin-dependent
(Downing and Scaramuzzi, 1991). Mekanisme
bermain peran penting sebagai perantara, kemudian
disebut “nutritional effects” yang meningkatkan
sekresi feses pada domba, dengan pakan baik
mengarah untuk mengurangi sirkulasi konsentrasi
plasma (Adam et al., 1994) dan berhubung penurunan
pada oestradiol feed back yang diharapkan akan
meningkatkan laju ovulasi (Payne et al., 1991).
22
Downing et al., (1995a) menyatakan bahwa
aksi ovarium langsung dapat meningkatkan
keberadaan glucosa. Berhubung keberlangsungan
insulin meningkat pada plasma juga telah diteliti
ketika laju ovulasi meningkat baik infusi glucosa
(Downing et al., 1995b) maupun rantai cabang
asam amino, leusin, isoleusin adan valin (Downing
et al., 1995c) selama 5 hari pada akhir tahap luteal
dari siklus esterus. Menggunakan model ovarium
auto-transplanted, Downing (1994) menunjukan
bahwa ketika infusi glukosa atau insulin sendiri,
tidak mempunyai pengaruh terhadap sekresi steroid
ovarium, infusi kombinasinya menurunkan sekresi
baik androstenedione maupun oestradiol pada
respon terhadap GnRH menstimulasi pulse LH, juga
pernyataan keterlibatan perubahan feedback steroid
pada respon ovulasi.
Pengaruh nutrisi terhadap interval
kelahiran
Turunnya konsentrasi estradiol saat kelahiran
menghilangkan feedback negatif pada aksis
hipothalamic-pituitary, kemudian menstimulasi
sintesa mRNA untuk gonadotrophin. Hal ini
diikuti oleh peningkatan LH/FSH pada pituitary
Peristiwa ini dapat terjadi selama periode kurang
nutrisi pada ovulasi, dihalangi oleh tidak cukup
sekresi GnRH. Pada sapi pedaging menyusui setelah
kelahiran, Stagg et al. (1995) mendapatkan bahwa
rata-rata dari melahirkan ke ovulasi pertama adalah
25 hari. Selanjutnya Stagg et al. (1995) menyatakan
bahwa waktu perkembangan folikel dominan dan
dipengaruhi oleh nutrisi. Panjangnya periode
anoestrus diduga disebabkan oleh kekurangan nutrisi.
Kekurangan nutrisi kemungkinan dapat mengulang
perkembangan folikel sehingga terjadi atresia
folikel-folikel dominan. Sejumlah data menunjukkan
interaksi antara kondisi tubuh saat melahirkan dengan
level pemberian pakan dalam kurun waktu tertentu
dapat berpengaruh terhadap interval oesterus pertama
setelah melahirkan. Pada sapi perah yang memiliki
duapertiga minggu pertama setelah melahirkan sangat
berkorelasi dengan interval pada oestrus pertama.
Protein intake rendah dapat mengurangi tingkah
laku estrus atau disebut silent heat dan dapat
mengurangi ketepatan konsepsi pada sapi pedaging.
 Yendraliza: Pengaruh Nutrisi dalam Pengelolaan Repproduksi Ternak (Studi Literatur)
Pakan DUP (digestible undegradable protein) atau
pakan yang rendah energi dapat berpengaruh terhadap
produksi susu. Hal ini juga dapat menyebabkan ternak
et al., (1994) menyatakan bahwa peningkatan yang
DUP tinggi berlawanan dengan DUP rendah pada
sapi menyusui dengan kondisi tubuh rendah saat
kawin. DUP ini sangat berpengaruh terhadap siklus
estrus dan estrus pertama setelah melahirkan. Efek
terhadap sekresi LH belum dapat dideteksi, kondisi
kurang nutrisi pertumbuhan folikel lambat pada sapi
perah setelah melahirkan. Perubahan pada folikel
dinamis ini diiringi oleh penurunan konsentrasi IGF-
1 pada plasma dan penurunan rasio estrogen terhadap
progesteron pada senyawa folikel dominan (Lucy et
al., 1992). Modulasi nutrisi perkembangan folikel
melibatkan baik intra maupun ekstra growth factor
ovarium dipengaruhi oleh IGF-1 dan IGF binding
protein (Echternkamp et al., 1994). transforming
Pengaruh nutrisi terhadap
keberlangsungan hidup embrio
Vanroose et al., (2000) menyatakan bahwa
kematian embrio kemungkinan dapat disebabkan oleh
faktor non infeksi seperti nutrisi. Level pemberian
pakan ekstrim akan mengganggu keberlangsungan
hidup embrio, begitu juga dengan suplai nutrisi bahan
makan khusus, seperti pemberian vitamin-vitamin,
trace elemens dapat berpengaruh pada metabolisme.
Retinoid-retinoid merupakan metabolit utama
vitamin A yang berperanan pada proliferasi sel,
differensiasi, ekspresi growth factors, transkripsi gen
dan steroidogenesis. Retinoid ini mempunyai peranan
penting dalam menjaga kelangsungan hidup embrio.
Asam folat dibutuhkan untuk mempertahankan
embrio karena penting untuk sintesis asam nucleus.
Selain itu keberadaan vitamin C dapat meningkatkan
fungsi luteal. Selain itu vitamin C juga berperanan
dalam proses stereogenesis yang dianggap bermanfaat
pada pemeliharaan awal kebuntingan pada sapi.
menurunkan kematian embrio selama implantasi.
Hal ini juga meningkatkan laju fertilisasi, membantu
kontraksi uterus sehingga memudahkan transportasi
sperma didalam saluran reproduksi betina. Hal ini
juga dibutuhkan pada saat ternak mendapat program
superovulasi. Beberapa penelitian telah dilakukan
pada pengaruh merugikan dari pakan protein tinggi
terhadap fertilitas sapi perah. Elrod dan Butler (1993)
menemukan bahwa intake tinggi rumen degradable
protein (RDP), menunjukkan pada produksi ammonia
rumen berlebih, yang bergabung dengan penurunan
pada pH lingkungan uterus, dan Elrod (1992)
melaporkan bahwa ammonia dan urea secara berbeda
mempengaruhi transportasi ion endometrium.
Pakan RDP tinggi yang menghasilkan produksi
ammonia berlebih pada rumen. Hal ini akan
ditentukan kebutuhan asam amino (Lobley et al.,
1995). Hal ini secara tak langsung dapat dikatakan
bahwa persediaan suplemen asam amino dalam
bentuk protein pakan status rendah degradasi
rumen mungkin menghilangkan efek merugikan
dari RDP berlebihan terhadap lingkungan uterus
dan survival embrio. Pengaruh stimulasi rencana
pemberian pakan tinggi protein tinggi terhadap laju
metabolik progesteron (Parr et al., 1993, ewe; Prime
and Symond, 1993) dan diiringi dengan penurunan
konsentrasi progesteron pada saat (hari ke 11 dan 12
setelah domba kawin) ketika embrio sangat sentitif
sirkulasi perifer) (Parr, 1992). Peran progesterone ini
sulit untuk dilihat perannya pada fungsi endometrium
dengan keberlangsungan hidup embrio.
Penekanan induksi pakan pada sirkulasi
progesteron selama maturasi oocyt pada superovulasi
domba-domba betina baik dengan perlengkapan
single CIDR (0.3 g progesteron) dapat memberi kesan
penghambatan perkembangan yang mengarah pada
penurunan keberlangsungan hidup embrio (McEvoy
et al., 1995). Kemungkinan hal ini disebabkan oleh
abnormal rasio oestradiol dengan progesteron yang
dapat mengganggu maturasi oosit (McEvoy et al.,
1995). Ekspresi maternal mRNAs dibutuhkan untuk
mengatur perkembangan secara maternal hingga
tahap pertengahan blastosis kemungkinan dipengaruhi
oleh level progesterone. Pengurangan pemberian
pakan akan mempengaruhi pemberian progesterone
terhadap jumlah sel embrio dan sintesis protein pada
penelitian McEvoy et al., (1995). Perkembangan
embrio dapat dihambat dan diturunkan dengan
cara melakukan stimulasi pada gen awal dengan
progesteron-dependent, begitu juga dengan ekspresi
Kutubkhanah, Vol. 16 No. 1 Januari – Juni 2013
endometrium abnormal dapat direspon dengan pada
fungsi reseptor progesteron (Heap et al., 1992).
Pengaruh Nutrisi terhadap metabolisme
fetus
Malnutrisi fetus akan mempengaruhi
perkembangan setelah kelahiran (Barker and Clark,
1997). Kekurangan nutrisi menurunkan aliran darah
uterus dan disertai penurunan pada insulin fetus
dan rangkaian IGF-1 dengan meningkatnya growth
hormone, adrenocorticotrophin dan corticosteron
yang akan mempengaruhi pertumbuhan dan
perkembangan fetus. Konsentrasi urea fetus
glukogenesis meningkat oleh fetus dari asam amino
(Bell, 1993). Ini membuktikan bahwa suplemen
UDP pada pemeliharaan berat lahir anak domba
pada domba betina yang menerima energi dibawah
optimal selama akhir kebuntingan akan mengalami
malnutrisi. Pada anak-anak domba baru lahir, status
insulin rendah, corticosteron tinggi dan selenium atau
iodium rendah menghambat thermogenesis dari brown
adipose tissue, BAT (Robinson, 1990; Symond, 1995;
Robinson and Symond, 1995). Peran penting selenium
pada respon termogenik BAT telah ditunjukkan oleh
penemuan bahwa enzim iodothyroine 5-deiodinase
pada jaringan extra-thyroidal termasuk BAT, adalah
selenium–dependent (Arthur, 1991). Jadi anak-anak
domba dari domba-domba betina makan pakan
yang mengandung baik level tidak cukup selenium
(Donald et al., 1994) atau konsentrasi tinggi secara
alami antagonis selenium terjadi seperti cyanogenetic
glycosides (Gutzwller, 1993) akan mempunyai
penurunan kemampuan saat lahir.
Pengaruh nutrisi terhadap reproduksi
jantan
Hubungan antara nutrisi, laju pertumbuhan
dan umur pubertas pada jantan mirip dengan pada
betina. Sepintas, jantan yang dibesarkan dengan
pakan bernutrisi rendah berlawanan dengan nutrisi
tinggi akan mencapai pubertas pada usia lebih tua
dan bobot badan lebih ringan. Ternak yang memiliki
musim pemkembangbiakan seperti domba, kambing
dan rusa, kekurangan nutrisi dapat menunda pubertas
selama setahun penuh. Pada domba dewasa, yang
diberi pakan seadanya akan memiliki pematangan
spermatozoa pada distal cauda epidydimis selama
6-7 minggu karena jumlah spermatozoa pada sperical
spermatids di germinal epithelium tidak mengalami
perkembangan.
Kesimpulan
Makanan merupakan faktor yang penting dalam
suatu usaha peternakan. Tanpa makanan yang baik
dan dalam jumlah yang memadai maka meskipun
ternak tersebut merupakan bibit unggul akan kurang
dapat memperlihatkan keunggulannya. Kelengkapan
zat gizi dalam makanan ternak ruminansia akan dapat
mempercepat pubertas pada sapi, estrus pertama
setelah melahirkan, menjaga kebuntingan, berat anak
lahir, berat anak setelah sapih serta menjaga kondisi
induk saat laktasi. Sedangkan pada ternak jantan,
kelengkapan zat gizi dalam makanan ternak dapat
menjaga kualitas sperma yang dihasilkan. Makanan
yang cukup perlu untuk fungsi endoktrin yang normal.
Catatan: (Endnotes)
1 Dr. Yendraliza, S.Pt., MP. adalah Wakil Dekan I Fakultas
Pertanian dan Peternakan UIN Suska Riau.
Daftar Referensi
Adams, N.R. Abordi, J.A., Briegel, J.R. and Sanders,
M.R. (1994). Effect of diet on the clearance of
674.
Arthur, J.R. (1991). The role of selenium in
thyroid hormone metabolism. Can. J. Physiol.
Pharmacol., 69: 1648-1652.
Barker, D.J. and Clark P.M. (1997). Fetal
undernutrition and disease in later life. Rev.
Reprod., 2: 105-112.
Bell, A.W. (1993). Pregnancy and foetal metabolism.
In: J.M. Forbes and J. France (Editor).
Quantitative Aspects of Ruminant Digestion and
Metabolism. CAB International, Wallingford, pp.
405-431.
Bergfeld, E.G.M., Kojima, F.N., Cupp, A.s.
Wehrman, M.E., Peters, K.E., Garcia-Winder.
M. and Kinder, J.E. (1994). Ovarian follicular
by level of dietary energy intake. Biol. Reprod.,
51: 1051-1057.
Bishonga, C., Robinson, J.J., McEvoy, T.G., Aitken,
R.P., P.A. and Robertson, I. (1994). The effects
 Yendraliza: Pengaruh Nutrisi dalam Pengelolaan Repproduksi Ternak (Studi Literatur)
of excess rumen degradable protein in ewes on
ovulation rate, fertilization and embryo survival
in vivo and during in vitro culture. 50th Winter
Meeting of the British Society of Animal
Production, Paper No 81. British Society of
Animal Production, Edinburgh.
Boland, M.P., Lonergan, P. and Callaghan, D.O.
(2001). Effect of nutrtion on endocrine
parameters, ovarian physiology, and oocyte and
embryo development. Theriogenology, 55: 1323-
1340.
Donald, G.E., Langlands, J.P., Bowles, J.E. and Smith,
6. Thermoregulatory ability of perinatal lambs
born to ewes supplemented with selenium and
iodine. Aust. J. Exp. Agric., 34: 19-24.
Downing, J.A. and Scaramuzzi, R.J., 1991. Nutrient
effect on ovulation rate, ovarian function and
the secretion of gonadotrophin and metabolic
hormones in sheep. J. Reprod. Fertil., Suppl., 43:
209-227.
Downing, J.A. (1994). Interactions of nutrition and
ovulation rate in ewes. Ph.D. Thesis, Macquarie
University, Australia.
Downing, J.A., Joss, J., Connel, P. and Scaramuzzi, R.J.
(1995a). Ovulation rate and the concentrations of
gonadotrophin and metabolic hormones in ewes
fed lupin grain. J. Reprod. Fertil., 103: 137-145.
Downing, J.A., Joss, J. and Scaramuzzi, R.J. (1995b).
Ovulation rate and the concentrations of
gonadotrophins and metabolic hormones in ewes
infused with glucose during the luteal phase of
the oestrous cycle. J. Endocrinol., 146: 403-410.
Downing, J.A., Joss, J. and Scaramuzzi, R.J. (1995c).
A mixture of branched chain amino acids leucine,
isoleucine and valine increases ovulation rate in
ewes when infuse during the late luteal phase of
the oestrous cycle an effect that may be mediated
by insulin. J. Endocrinol., 145; 315-323.
Echternkamp, S.E., Howard, H.J., Roberts, A.J.,
Grizzle, J. and Wise, T. (1994). Relationships
among concentrations of steroids, insulin-
like growth factor binding proteins in ovarian
971-981.
Elrod, C.C. (1992). High dietary protein and high
fertility: can we both? Proc. Cornell Nutr. Conf.
for Feed Manufacturers, Cornell University,
Ithaca, NY, pp. 32-39.
Elrod, C.C. and Butler, W.R. (1993). Reduction of
fertility an alteration of uterine pH in heifers fed
excess ruminally degradable protein. J. Anim.
Sci., 71: 694-701.
Fisher, C.E.J. and MacPherson, A. (1991). Effect
reproductive performance and lamb viability.
Res. Vet. Sci., 50: 319-327.
Foster, D.L., Ebling, F.J.P., Vennerson, L.A.,
Bucholtz, D.C. Wood, R.I., Micka, A.F., Suttie,
J.M. and Veenvliet, B.A. (1988). Modulation of
gonadotrophin secretion durin development by
nutrition and growth. Proc. 11th International
insemnation, 5: 101-108. University College,
Dublin.
Gutzwiller, A. (1993). The effect of a diet containing
cyanogenetic on the selenium status and the
thyroid function of sheep. Anim. Prod., 57: 415-
419.
Hall, J.B., Schillo, K.K., Hileman, S.M. and Boling,
J.A. (1992). Does tyrosine act as a nutritional
signal mediating the effects of increased feed
intake on luteinizing hoemone patterns in growth-
restricted lmb. Biol. Reprod., 46: 573-579.
Heap, R.B., Taussig, M.J., Wang, M.W. and Whyte.
A. (1992). Antibodies, implantation and embryo
survival. Reprod., Fertil. Dev., 4: 467-480.
Ladefeld, T.D., Ebling, F.J.P., Suttie, J.M., Vannerson,
L.A., Padmanabhan, V., Beitins, I.Z. and Foster,
D.L. (1989). Metabolic interfaces between growth
and reproduction. II. Characterization of changes
in messenger ribonucleic acid concentrations of
gonadotrophin subunits, growth hormone and
prolactin in nutritionally growth-limited lambs
and the differential effects of increased nutrition.
Endocrinology, 125: 351-356.
Lobley, G.E., Connell, A., Lomax, M.A., Brown, D.S.,
Milne, E., Calder, A.G. and Farningham, D.A.H.
ovine liver, possible consequences for amino acid
metabolism. Br. J. Nutr., 73: 667-685.
Lucy, M.C., Beck., J., Staples, C.R., Head, H.H., de la
Sota, R.L. and Thatcher, W.W. (1992). Follicular
dynamics, plasma metabolites, hormones and
25
Kutubkhanah, Vol. 16 No. 1 Januari – Juni 2013
insulin-like growth factor 1 (IGF-1) in lactating
cows with positive or negative energy balance
during the preovulatory period. Reprod., Nutr.
Dev., 32: 331-341.
McEvoy, T.G., Robinson, J.J., Aitken, R.P., Findlay,
P.A., Palmer, R.M. and Robertson, I.S. (1995).
Dietary-induce suppression of pre-ovulatury
progesterone concentrations in superovulated
ewes impairs the subsequencet in vivo and in
vitro development of their ova. Anim. Reprod.
Sci., 39: 89-107.
Part, R.A. (1992). Nutrition-progesterone interactions
during early pregnancy in sheep. Reprod. Fertil.
Dev., 4: 297-300.
Part, R.A., Davis, IF., Miles, M.A. and Squires, T.J.
(1993). Feed intake affects metabolic clearance
rate of progesterone in sheep. Res. Vet. Sci., 55:
306-310.
Phillippo, M., Humphries, W.R., Atkinson, T.,
Henderson, G.D. and Garthwaite, P.H. (1987).
The effect of dietary molybdenum and iron on
copper status, puberty, fertility and oestrous
cycles in cattle. J. Agric. Sci., 109: 321-336.
the metabolic clearence rate of progesterone in
ovariectomized gilts. J. Agric. Sci., Cambridge,
121: 389-397.
Robinson. J.J. (1990). Nutrition in the reproduction of
farm animals. Nutr. Res. Rev., 3: 25-276.
Robinson. J.J. and Symond, M.E. (1995). Whole
body fuel selection: ‘reproduction’. Proc. Nutr.
Soc., 54: 283-299.
Scaramuzzi, R.J., Adams, N.R., Baird, D.T.,
Campbell, B.K., Downing, J.A., Findlay, J.K.,
Henderson, K.M., Martin, G.B., McNatty, K.P.,
McNeilly, A.S. and Tsonis, C.G. (1993). A model
for follicle selection and the determination of
ovulation rate in the ewe. Reprod. Fertil. Dev.,
5:459-478.
Sinclair, K.D., Broadbent, P.J. and Hutchinson, J.S.M.
(1994). The effect of pre- and post-partum energy
and the protein supply on the blood metabolites
and reproductive performance of single- and
twin-suckling beef cows. Anim. Prod., 59: 391-
400.
Stagg, K., Diskin, M.G., Sreenan, J.M. and Roche,
J.F. (1995). Follicular development in long-term
anoestrous suckler beef cows fed two levels of
energy post-partum. Anim. Reprod. Sci., 38: 49-
61.
Vanroose, G., deKruif, A., Soom, A.V. (2000).
Embryonic mortality and emryo-pathogen
interactions. Anim. Reprod. Sci., 60: 131-143.