sPENGGUNAAN TERAPI DNA SEBAGAI ALTERNATIF

PENGOBATAN DALAM DUNIA KESEHATAN

Disusun Guna

Memenuhi Tugas Mata Kuliah Biologi Sel

Nama : Tania Nasywa Azzahra

NIM : 4820101230158

Kelas : 1D

Prodi : S1 Farmasi

Dosen PJMK : Putri Kartika Sari, M.Si.

PROGRAM STUDI SARJANA FARMASI

FAKULTAS FARMASI

UNIVERSITAS BORNEO LESTARI

2024
 Kata Pengantar

Puji syukur saya panjatkan kehadirat Tuhan Yang Maha Esa karena berkat rahmat

dan kasih sayang-Nya lah saya dapat menyelesaikan Makalah “Terapi DNA Untuk

Pengobatan” dengan tepat waktu. Terima kasih kepada bapak dosen pengampu

matakuliah Anatomi fisiologi manusia yang telah memberikan bimbingannya.

Makalah ini saya buat dengan tujuan yaitu sebagai pemenuhan tugas matakuliah

Anatomi fisiologi manusia, tak hanya itu saja harapan saya semoga Makalah ini

bermanfaat bagi saya secara pribadi maupun pihak-pihak di luar sana.

Dengan segala kesadaran, saya juga menyadari bahwa makalah ini masih jauh dari

kata sempurna, maka dari itu saya mengajak untuk memberikan kritik dan saran

untuk kesempurnaan Makalah ini.

Banjarbaru, 15 Januari 2024

Penyusun

i
 DAFTAR ISI

KATA PENGANTAR .................................................................................. i

DAFTAR ISI ................................................................................................. ii

BAB I PENDAHULUAN ............................................................................ 1

A. Latar Belakang .................................................................................... 1

B. Rumusan Masalah .............................................................................. 5

C. Tujuan ................................................................................................. 5

BAB II ISI .................................................................................................... 6

A. Pengertian DNA ........................................................................................ 6

B. Fungsi DNA............................................................................................... 7

C Terapi DNA terhadap Pengobatan. ............................................................ 8

BAB III PENUTUP………………………………………………. ................... 16

Kesimpulan .................................................................................................... 16

DAFTAR PUSTAKA.................................................................................... iii

LAMPIRAN……………………………………………………………………

ii
 BAB 1
PENDAHULUAN
A. Latar Belakang

Deoxyribonucleic acid (DNA) merupakan asam nukleat yang menyusun

informasi genetik pada makhluk hidup.DNA juga berperan dalam pengendali

sifat dan ciri morfologi seperti pigmen kulit, warna serta bentuk rambut,

strktur jari serta watak khusus seseorang. Tujuan utama isolasi DNA ialah untuk

memisahkan DNA dari bahan lainnya semacam protein, lemak, dan

karbohidrat. Kualitas DNA yang baik yang diperoleh dari hasil ekstraksi

merupakan syarat dasar yang harus dipenuhi dalam studi molekuler. Isolasi

DNA mempunyai 3 prinsip yaitu: lysis sel, ekstraksi sel, serta presipitasi

Terapi DNA dan gen manusia didefinisikan sebagai pengenalan materi

genetik baru ke dalam sel suatu individu dengan tujuan menghasilkan terapi

manfaat. Sejumlah penyakit manusia diketahui berasal dari genetik (chorea dan

cystic Huntington fibrosis adalah beberapa di antaranya) dan hampir semua

penyakit, kecuali trauma, mempunyai komponen keturunan. Dengan demikian,

peluang untuk mengobati gangguan tersebut adalah dengan mengganti gen yang

rusak dengan gen normal yang sehat gen (terapi gen) menawarkan terapi baru

pendekatan untuk pasien yang menderita penyakit tersebut.

Sekarang, terapi gen secara rutin dimunculkan untuk mencakup berbagai hal

penggunaan asam deoksiribonukleat (DNA) sebagai obat untuk meringankan

gejala suatu penyakit, meskipun gen terapeutik tidak sepenuhnya 'korektif'

(dalam rasa memulihkan fungsi yang diketahui bermutasi dalam sel yang

terkena). Dalam pengertian yang paling luas, gen terapi mewakili peluang untuk

pengobatan kelainan genetik pada orang dewasa dan anak-anak secara genetik

1
modifikasi sel tubuh manusia. Semua gen uji coba terapi saat ini disetujui untuk

digunakan pada manusia pasien menargetkan sel somatik yang hanya akan

hidup sebagai selama pasien.

Hal ini memastikan bahwa genetik pengobatan hanya akan mempengaruhi

satu generasi dan kemauan tidak mengubah susunan genetik keturunan mana

pun pasien, karena tidak ada penyebaran terapi gen ke gamet. Ini dikenal

sebagai somatik terapi gen, dan tujuannya adalah untuk meringankan penyakit

individu yang dirawat saja. Lebih dari 300 klinis uji coba yang melibatkan

transfer gen pada pasien telah dilakukan disetujui dan obat asam nukleat

pertama, antisense oligonukleotida, fomivirsen (dipasarkan sebagai Vitravene)

telah disetujui oleh Makanan Amerika Serikat dan Drug Administration

(USFDA) untuk pengobatan retinitis sitomegalovirus pada imunokompromais

pasien

Sebaliknya, penargetan juga dimungkinkan langsung gamet (sperma dan sel

telur) untuk memodifikasi profil genetik, bukan profil genetik saat ini, tetapi

profil genetik generasi berikutnya dari 'pasien' yang belum lahir. Gen transfer

pada tahap awal perkembangan embrio juga mungkin memiliki efek serupa

dengan mencapai gen ditransfer ke sel somatik dan garis germinal. Ini dikenal

sebagai terapi gen garis kuman.

Terlepas dari ketidakmampuan untuk memprediksi efek jangka panjang dari

perubahan garis kuman melalui penularan materi genetik eksogen pada tingkat

ilmiah, ada banyak masalah etika, sosial, dan komersial mengelilingi teknik

tersebut. Implikasi sosial dari teknologi tersebut mencakup kemungkinan

bahwa pasien mungkin menderita depresi sebagai akibat dari keberadaannya

2
'diubah secara genetik' atau mungkin tidak diterima oleh masyarakat seperti

sebelum pengobatan.

Implikasi komersial dari teknologi tersebut apakah itu perusahaan asuransi

dan sejenisnya institusi juga ingin mengakses apa yang tersedia informasi

sebelum mereka memberikan asuransi jiwa kebijakan. Jadi, jelas sekali bahwa

seseorang terbukti memilikinya kecenderungan terhadap penyakit genetik bisa

sangat parah dihukum karena mutasi pada DNA mereka meskipun mereka

mungkin tidak akan pernah terserang penyakit ini. Itu kemunduran terbesar

dalam terapi gen terjadi pada tahun 1999 ketika Jesse Gelsinger, seorang siswa

sekolah menengah berusia 18 tahun lulusan Arizona, meninggal karena

gen percobaan terapi. Gelsinger mengalami demam dan pembekuan darah di

seluruh tubuhnya dalam beberapa jam setelahnya pengobatan untuk

memperbaiki transkarbamilase ornithine parsial (OTC), penyakit metabolik

langka yang bisa menyebabkan penumpukan amonia yang berbahaya di dalam

tubuh dan meninggal empat hari kemudian. Meskipun ada upaya untuk

melakukannya menjaga kepercayaan masyarakat terhadap terapi gen,

itu Washington Post mendokumentasikan enam kematian yang tidak

dilaporkan pada tanggal 3 November 1999 yang telah terjadi dalam

persidangan dilakukan di Cornell Medical Center, Manhattan dan di

Universitas Tufts, Boston.

Asam nukleat adalah salah satu sumber terpenting tidak hanya untuk

pemahaman fundamental dasar kehidupan manusia tetapi juga untuk

perkembangan sekelompok terapi baru. Salah satu yang signifikan keunggulan

obat berbasis DNA dibandingkan saat ini obat-obatan dengan berat molekul

3
rendah yang tersedia adalah pengenalan selektif mereka terhadap target

molekuler dan jalur, yang memberikan kekhususan yang luar biasa tindakan.

Terapi berbasis DNA meliputi plasmid, oligonukleotida untuk antisense dan

antigen aplikasi, DNA aptamers, dan DNAzymes. Di dalam terapi gen,

teknologi transfer gen adalah DNA sistem pengiriman untuk terapi berbasis

asam nukleat.

Meski sebagian besar obat berbasis DNA dan RNA sedang dalam tahap

awal uji klinis, kelas-kelas ini senyawa telah muncul dalam beberapa tahun

terakhir untuk menghasilkan kandidat yang sangat menjanjikan untuk terapi

obat untuk berbagai penyakit, termasuk kanker, AIDS, gangguan neurologis

seperti penyakit Parkinson dan penyakit Alzheimer, dan gangguan

kardiovaskular.

Penjelasan genom manusia juga memberikan dorongan utama dalam

mengidentifikasi gen manusia yang terlibat pada penyakit, yang pada akhirnya

dapat menyebabkan pengembangan obat berbasis DNA dan RNA untuk gen

penggantian atau target potensial untuk ablasi gen. Proyek Genom Manusia

akan membantu menentukan penanda genetik yang bertanggung jawab atas

respon pasien terhadap terapi obat, interaksi obat, dan potensi efek samping.

Perkembangan genomik manusia, transkriptomik, dan proteomik akan

memberikan dorongan tambahan untuk kemajuan DNA terapi berbasis dengan

menyediakan target baru untuk desain, skrining, dan seleksi obat.

Dalam ulasan ini, kami merangkum terapi berbasis DNA, transfer

gen teknologi, status terapi gen terkini dan terkini perkembangan dalam

penelitian terapi gen.

4
B. Rumusan Masalah

1. Apa pengertian DNA?

2. Apa fungsi DNA?

3. Bagaimanakah terapi DNA terhadap pengobatan?

C. Tujuan

1. Untuk mengetahui pengertian terapi DNA

2. Untuk mengetahui Fungsi Terapi DNA

3. Untuk mengetahui bagaimana terapi DNA terhadap pengobatan

5
 BAB II

ISI

A. Pengertian DNA

DNA merupakan molekul yang memuat seluruh instruksi genetik yang

dibutuhkan oleh semua organisme dalam seluruh siklus hidupnya. Informasi

genetik yang terdapat dalam DNA diturunkan oleh orang tua atau induk ke

generasi berikutnya melalui reproduksi.

Deoxyribonucleic acid (DNA) merupakan asam nukleat yang menyusun

informasi genetik pada makhluk hidup.DNA juga berperan dalam pengendali

sifat dan ciri morfologi seperti pigmen kulit, warna serta bentuk rambut,

strktur jari serta watak khusus seseorang. Tujuan utama isolasi DNA ialah untuk

memisahkan DNA dari bahan lainnya semacam protein, lemak, dan

karbohidrat. Kualitas DNA yang baik yang diperoleh dari hasil ekstraksi

merupakan syarat dasar yang harus dipenuhi dalam studi molekuler. Isolasi

DNA mempunyai 3 prinsip yaitu: lysis sel, ekstraksi sel, serta presipitasi

Struktur DNA adalah berupa dua rantai polinukleotida yang berbentuk

seperti tangga berpilin. Dikutip dari DNA Barcode Fauna Indonesia tulisan M

Syamsul Arifin Zein dan Dewi Malia Prawiradilaga, setiap anak tangga ini

terdiri atas pasangan basa adenine (A), guanine (G), cytosine (C), dan thymine

(T). Adenin selalu berpasangan dengan thymine. Cytosine selalu berpasangan

dengan guanin.

DNA tersimpan di dalam inti sel, sehingga disebut genom DNA inti.

Contohnya, genom DNA inti manusia tersusun sekitar tiga miliar pasang basa

dengan panjang kira-kira 3 meter. Apabila dibandingkan dengan ukuran sel,

6
 maka panjang DNA bisa mencapai 300 ribu kali diameter sel yang

mengandungnya. Meski demikian, DNA tetap berada dalam inti sel karena

mengalami pengepakan sedemikian rupa.

Gen dan DNA adalah dua terminologi yang digunakan terutama dalam

bidang genetika. Secara umum, gen adalah bagian pendek dari DNA dan DNA-

Asam deoksiribonukleat adalah molekul yang membawa instruksi genetik atau

materi keturunan.

DNA adalah biomolekul yang terbuat dari dua untaian panjang dan

bengkok, yang mengandung informasi genetik yang saling

melengkapi. Untaian DNA ini memegang cetak biru semua organisme hidup.

DNA ditemukan pada tahun 1869 oleh ahli biologi Swiss Johannes Friedrich

Miescher. Struktur lengkap molekul DNA menyerupai tangga yang dipelintir

di kedua ujungnya dan terdiri dari nukleotida – gula, gugus fosfat, dan basa

nitrogen. DNA adalah materi genetik yang terlibat dalam membawa informasi

herediter, proses replikasi, mutasi, dan juga pemerataan DNA selama

pembelahan sel

B. Fungsi DNA

Sebagai materi genetik, DNA memiliki fungsi sebagai berikut:

1. DNA harus mampu menyimpan informasi genetik dan bisa

meneruskan informasi tersebut secara tepat keturunan makhluk

hidup dari generasi ke generasi. Fungsi ini adalah fungsi genotipik

yang dilakukan melalui replikasi.

2. DNA bertugas mengatur perkembangan fenotipe organisme.

Maksudnya, materi genetik harus mengarahkan pertumbuhan dan

7
 diferensiasi organisme mulai dari zigot sampai individu dewasa.

Fungsi ini adalah fungsi fenotipik yang dilakukan melalui ekspresi

gen.

3. DNA sewaktu-waktu harus bisa mengalami perubahan sehingga

organisme yang bersangkutan dapat beradaptasi dengan kondisi

lingkungan yang berubah. Tanpa adanya perubahan seperti itu, maka

evolusi tidak akan pernah berlangsung. Fungsi ini adalah fungsi

evolusioner yang dilakukan melalui mutasi.

C. Terapi DNA terhadap Pengobatan

1. Plasmid:

Plasmid memiliki berat molekul tinggi, beruntai ganda Konstruksi

DNA mengandung transgen, yang mengkode protein tertentu. Pada tingkat

molekuler, plasmid Molekul DNA dapat dianggap pro-obat itu setelah

internalisasi seluler menggunakan DNA alat transkripsi dan translasi dalam

sel menjadi melakukan biosintesis entitas terapeutik, protein. Mekanisme

kerja DNA plasmid membutuhkan sehingga molekul plasmid mendapatkan

akses ke dalam nukleus setelah memasuki sitoplasma. Akses nuklir atau

kekurangannya pada akhirnya mengendalikan efisiensi ekspresi gen. Selain

pengobatan penyakit, Plasmid dapat digunakan sebagai vaksin DNA untuk

genetik imunisasi.

Pada tahap awal pengembangan, terapi gen berbasis plasmid dicoba

untuk memperbaikinya kelainan bawaan yang disebabkan oleh satu gen

cacat. Gen manusia pertama yang disetujui pemerintah federal protokol

terapi dimulai pada tahun 1990 untuk pengobatan defisiensi adenosin

8
 deaminase. Sejak itu, lebih dari 500 protokol terapi gen telah disetujui atau

dilaksanakan. Pada tahun 2002, para ilmuwan melaporkan keberhasilan

penyembuhan berbasis terapi gen untuk defisiensi imun gabungan yang

parah (SCID).

Pada tahun 2003, peraturan obat Tiongkok lembaga menyetujui

produk terapi gen pertama untuk karsinoma skuamosa kepala dan leher

yang diperdagangkan nama Gendikin. Saat ini penyakitnya

kompleks etiologi seperti kanker dan neurodegeneratif gangguan seperti

penyakit Alzheimer dan Parkinson penyakit menjadi sasaran. Selain itu,

DNA vaksin untuk malaria, AIDS, dan banyak penyakit lainnya sedang

dalam pengembangan. Vaksin DNA juga telah dilakukan digunakan untuk

mencegah respon alergi

2. Oligonukleotida:

Oligonukleotida adalah segmen beruntai tunggal pendek DNA yang

pada internalisasi seluler dapat selektif menghambat ekspresi protein

tunggal. Untuk aplikasi antisense, oligonukleotida berinteraksi dan

membentuk dupleks dengan mRNA atau premRNA dan menghambat

translasi atau pemrosesannya, akibatnya menghambat biosintesis protein.

Untuk aplikasi antigen, oligonukleotida harus masuk inti sel;

membentuk tripleks dengan untaian ganda DNA genom, dan menghambat

translasi juga sebagai proses transkripsi protein. Di tingkat molekuler,

banyak mekanisme telah dilakukan diusulkan untuk menjelaskan dasar

oligonukleotida tindakan Untuk tujuan terapeutik, oligonukleotida dapat

digunakan untuk memblokir ekspresi secara selektif protein yang terlibat

9
 dalam penyakit. Dengan penghambatan antisense yang sukses terhadap

protein pada hewan model, obat antisense pertama, fomivirsen sodium

(Vitravene, Isis Farmasi, Carlsbad, CA) disetujui untuk pengobatan

sitomegalovirus retinitis pada pasien AIDS pada tahun 1998 [29].

Antisense oligonukleotida seperti MG98 dan ISIS 5132, dirancang untuk

menghambat biosintesis DNA metiltransferase dan c-raf kinase, masing-

masing, sedang dalam uji klinis pada manusia untuk kanker.

Sintetis oligonukleotida DNA antisense dan oligonukleotida analog,

yang menghambat replikasi beberapa agen infeksi seperti virus hepatitis

C, manusia sitomegalovirus , virus imunodefisiensi manusia dan virus

papiloma, juga telah dirancang.

3. Aptamer:

DNA-Aptamers adalah asam nukleat beruntai ganda segmen yang dapat

langsung berinteraksi dengan protein. Aptamers mengganggu fungsi

molekuler protein yang terlibat penyakit atau mereka yang berpartisipasi

di dalamnya proses transkripsi atau translasi. Aptamer adalah lebih

disukai daripada antibodi dalam penghambatan protein sesuai dengan kota

spesifiknya, non-imunogenisitas, dan stabilitasnya formulasi farmasi.

Aptamer DNA yang telah menunjukkan janji dalam intervensi biosintesis

protein patogen adalah integrase HIV-1 enzim.

4. DNAzim:

DNAzim adalah analog dari ribozim dengan lebih besar stabilitas biologis.

Kimia tulang punggung RNA digantikan oleh motif DNA yang memberikan

peningkatan stabilitas biologis. DNAzyme diarahkan melawan reseptor

faktor pertumbuhan endotel vaskular 2 adalah dipastikan mampu menekan

10
 tumor dengan menghalangi angiogenesis pada suntikan intratumoral di tikus.

Terapi gen adalah suatu teknik terapi yang digunakan untuk memperbaiki

gen-gen mutan (abnormal/cacat) yang bertanggung jawab terhadap terjadinya

suatu penyakit. Pada awalnya, terapi gen diciptakan untuk mengobati penyakit

keturunan (genetik) yang terjadi karena mutasi pada satu gen, seperti penyakit

fibrosis sistik. Penggunaan terapi gen pada penyakit tersebut dilakukan dengan

memasukkan gen normal yang spesifik ke dalam sel yang memiliki gen mutan.

Terapi gen kemudian berkembang untuk mengobati penyakit yang terjadi

karena mutasi di banyak gen, seperti kanker. Selain memasukkan gen normal

ke dalam sel mutan, mekanisme terapi gen lain yang dapat digunakan adalah

melakukan rekombinasi homolog untuk melenyapkan gen abnormal dengan gen

normal, mencegah ekspresi gen abnormal melalui teknik peredaman gen, dan

melakukan mutasi balik selektif sehingga gen abnormal dapat berfungsi normal

kembali.

terapi gen adalah memasukkan DNA ke dalam sel sebagai obat, untuk

memperbaiki efek gen yang bermutasi dalam tubuh, bekerja langsung dan

dengan presisi untuk memperbaiki mutasi dan selanjutnya mengobati

penyakit. Juga dikenal sebagai transfer gen manusia, terapi gen sangat berbeda

dengan perawatan lainnya yang tersedia karena tujuannya menyembuhkan cacat

genetik, sekaligus mengubah sumber penyakit, melakukan lebih daripada

sekadar mengobatinya.

Harapan lain yang sangat luar biasa menjanjikan dalam bidang studi ini

berupa perbedaan antara dua klasifikasi terapi gen – Terapi gen somatik dan

Terapi gen germline. Jika pada Terapi gen somatik, DNA diintegrasikan ke

11
dalam sel seperti sumsum tulang tetapi tidak ke dalam sel reproduktif, Terapi

gen germline memasukkan DNA ke dalam sel reproduktif, karena itu memiliki

kemampuan untuk memodifikasi genom, mengubah yang dapat diturunkan ke

anak dari pasien di masa mendatang. Dengan demikian, Terapi gen germline

berpotensi dapat membantu menghilangkan secara permanen penyakit

keturunan tertentu. Walaupun ini kedengaran sangat menjanjikan, penting

untuk dicatat bahwa teknologi ini masih dalam tahap eksperimental dan karena

pengetahuan yang belum memadai terkait risiko dan alasan etika, Terapi gen

germline masih merupakan topik yang sangat sensitif dan di sebagian besar

negara saat ini dilarang penggunaannya pada manusia.

Nanoteknologi dan terapi gen menghasilkan pengobatan menjadi kanker

torpedo (Maret 2009); Sekolah Apotek di London sedang menguji pengobatan

pada tikus, yang mengirimkan gen yang dibungkus nanopartikel ke sel kanker

untuk menargetkan dan menghancurkan yang sulit dijangkau sel kanker [170].

Hasil terapi gen pertama di dunia untuk kebutaan bawaan menunjukkan

perbaikan penglihatan (April 2008); Peneliti Inggris dari UCL Institute

Oftalmologi dan Rumah Sakit Mata Moorefield

Pusat Penelitian Biomedis NIHR telah mengumumkan hasil uji klinis

pertama di dunia yang menguji a pengobatan terapi gen revolusioner untuk

jenis kebutaan yang diturunkan. Hasilnya, dipublikasikan di New England

Journal of Medicine, menunjukkan bahwa pengobatan eksperimental aman dan

dapat membaik penglihatan. Temuan ini merupakan tonggak penting bagi terapi

gen teknologi dan dapat memberikan dampak yang signifikan pengobatan masa

depan untuk penyakit mata

12
 Walaupun bidang terapi gen mengalami kemajuan besar, semua riset masih

menghadapi tiga tantangan utama pada tingkat terapeutik. Presesi untuk terapi gen,

sehingga gen baru mencapai sel yang tepat; menghindari reaksi supresif dari sistem

kekebalan, karena dirancang untuk melawan sel asing yang masuk ke dalam tubuh;

dan memastikan bahwa gen baru tidak mengganggu fungsi atau efisiensi gen lain

saat ini.

Tetapi mungkin tantangan terbesar dalam bidang terapi gen adalah biaya

finansial. Terapi gen datang dengan label harga yang sangat mahal karena banyak

penyakit keturunan yang dapat diatasi dengan terapi gen terbilang langka dan

memerlukan pendekatan individu kasus demi kasus. Tantangan ini sering terjadi

pada sebagian besar perawatan medis yang masih berada pada tahap awal dan

seiring waktu terapi gen akan lebih mudah untuk diakses dan cara pendekatan dan

perawatan kami terhadap berbagai kondisi medis akan diatur ulang.

Beberapa Contoh Terapi gen antara lain:

Terapi gen adalah modifikasi, manipulasi, atau penghapusan gen untuk

mengobati, mencegah, atau menyembuhkan suatu penyakit. Sering digunakan

pada penyakit atau kelainan yang dianggap tidak dapat disembuhkan dengan

pengobatan konvensional, terapi gen dapat mengubah hidup pasien.

Meskipun terapi gen dapat diterapkan pada berbagai macam penyakit,

terapi gen sangat berguna dalam meneliti pengobatan kanker, karena banyak

jenis kanker pada manusia berkembang melalui perubahan genetik. Faktanya,

lebih dari 65% uji klinis terapi gen global berkaitan dengan kanker2 , dan

beberapa di antaranya telah mendapat persetujuan FDA dalam beberapa tahun

terakhir. Misalnya, Kymriah (tisagenlecleucel), terapi gen pertama yang

disetujui FDA untuk penggunaan medis, adalah terapi genetik sel T reseptor

13
antigen chimeric (CAR) untuk mengobati leukemia limfoblastik akut (ALL),

salah satu penyakit anak dan muda yang paling umum. kanker dewasa. 13 Data

uji klinis menunjukkan bahwa 56% dari seluruh pasien mencapai remisi

berkelanjutan setelah pengobatan dengan Kymriah.

Kanker payudara adalah bidang lain yang memperoleh manfaat besar dari

terapi gen yang ditargetkan. Dari jenis kanker payudara yang diturunkan,

penyebab paling umum adalah mutasi pada

gen BRCA1 dan BRCA2 . 14 Terapi gen dapat membantu mencegah kanker

payudara yang diturunkan dengan mengganti versi gen yang bermutasi dengan

versi fungsional. Untuk bentuk kanker payudara yang tidak diturunkan, terapi

gen dapat digunakan untuk menargetkan gen oncolytic yang mendorong

perkembangan kanker. Menurut ClinicalTrials.gov, banyak uji coba terapi gen

yang secara aktif merekrut pasien, dan beberapa di antaranya menunjukkan

hasil yang menjanjikan.

Bidang utama lain yang dapat dimanfaatkan oleh terapi gen adalah

penelitian penyakit langka. Meskipun ribuan penyakit langka telah

diidentifikasi, hanya sebagian kecil yang menyetujui pengobatannya. Karena

lebih dari 80% penyakit langka disebabkan oleh mutasi pada satu gen, terapi

gen menawarkan potensi untuk memperbaiki penyakit yang mendasarinya

dibandingkan meminimalkan gejala dengan pengobatan

tradisional. 15 Misalnya, terapi gen yang sedang dikembangkan untuk fibrosis

kistik (CF) bertujuan untuk mengirimkan salinan fungsional gen pengatur

14
konduktansi transmembran fibrosis kistik (CFTR) ke dalam paru-paru,

menggantikan versi protein yang bermutasi, dan mengurangi gejala CF secara

permanen pada pasien. paru-paru.

15
 BAB III

PENUTUP

Kesimpulan

1. DNA merupakan molekul yang memuat seluruh instruksi genetik yang

dibutuhkan oleh semua organisme dalam seluruh siklus hidupnya. Informasi

genetik yang terdapat dalam DNA diturunkan oleh orang tua atau induk ke

generasi berikutnya melalui reproduksi.

2. Fungsi DNA Sebagai materi genetik, DNA memiliki fungsi sebagai berikut:

a. DNA harus mampu menyimpan informasi genetik dan bisa meneruskan

informasi tersebut secara tepat keturunan makhluk hidup dari generasi

ke generasi. Fungsi ini adalah fungsi genotipik yang dilakukan melalui

replikasi.

b. DNA bertugas mengatur perkembangan fenotipe organisme.

Maksudnya, materi genetik harus mengarahkan pertumbuhan dan

diferensiasi organisme mulai dari zigot sampai individu dewasa. Fungsi

ini adalah fungsi fenotipik yang dilakukan melalui ekspresi gen.

c. DNA sewaktu-waktu harus bisa mengalami perubahan sehingga

organisme yang bersangkutan dapat beradaptasi dengan kondisi

lingkungan yang berubah. Tanpa adanya perubahan seperti itu, maka

evolusi tidak akan pernah berlangsung. Fungsi ini adalah fungsi

evolusioner yang dilakukan melalui mutasi.

16
3. terapi gen adalah memasukkan DNA ke dalam sel sebagai obat, untuk

memperbaiki efek gen yang bermutasi dalam tubuh, bekerja langsung dan

dengan presisi untuk memperbaiki mutasi dan selanjutnya mengobati

penyakit. Juga dikenal sebagai transfer gen manusia, terapi gen sangat

berbeda dengan perawatan lainnya yang tersedia karena tujuannya

menyembuhkan cacat genetik, sekaligus mengubah sumber penyakit,

melakukan lebih daripada sekadar mengobatinya. Harapan lain yang sangat

luar biasa menjanjikan dalam bidang studi ini berupa perbedaan antara dua

klasifikasi terapi gen – Terapi gen somatik dan Terapi gen germline. Jika

pada Terapi gen somatik, DNA diintegrasikan ke dalam sel seperti sumsum

tulang tetapi tidak ke dalam sel reproduktif, Terapi gen germline

memasukkan DNA ke dalam sel reproduktif, karena itu memiliki

kemampuan untuk memodifikasi genom, mengubah yang dapat diturunkan

ke anak dari pasien di masa mendatang. Dengan demikian, Terapi gen

germline berpotensi dapat membantu menghilangkan secara permanen

penyakit keturunan tertentu

17
 DAFTAR PUSTAKA

Alam, A., Farooq, U., Singh, R., Dubey, V., Kumar, S., Kumari, R., Naik, K. K., &
Tripathi, BD, Dhar, K. (2018). Chemotherapy Treatment and Strategy
Schemes: A Review. Open Access Journal of Toxicology,
2(5). https://doi.org/10.19080/oajt.2018.02.555600
Chinnery, Patrick F, Elliott, Hannah R, Hudson, Gavin, Samuels, David C, Relton,
Caroline L. (2012). Epigenetics, epidemiology and mitochondrial DNA
diseases. International Journal of Epidemiology. Pages 177–187,
https://doi.org/10.1093/ije/dyr232
Depkes, R. I. 2010 Rencana Pembangunan Kesehatan Menuju Indonesia
Sehat.
Jakarta.
Dwi Jayanti, Liah. Mushlih, Miftahul. (2021). Comparison of the Quality of DNA
Template Isolation Results of the Resin Method with and Without
Centrifugation. Indonesian Journal of Innovation Studies.
https://ijins.umsida.ac.id/index.php/ijins/article/view/551/481?download=p
df DOI: 10.21070/ijins.v15i.551
Fatchiyah, Arumningtyas, E.L., Widyarti,S., Rahayu, S. 2011. Biologi
Molekuler, Prinsip Dasar Analisis. Jakarta: Penerbit Erlangga.
Ferlay, J., Soerjomataram, I., Ervik, M., Dikshit, R., & Eser, S. 2013.
Cancer Incidence and Mortality worldwide: IARC Cancer Base.
Lyon: Internationa Research on Cancer.
Hengkengbala, Irvan R. Gerung, Grevo S. Wullur, Stenly, (2018). DNA extraction
and amplification of the rbcL (ribulose-1,5- bisphosphate
carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp.
from Bahoi Waters, North Minahasa Regency. Journal of Aquatic Science
& Management https://media.neliti.com/media/publications/346656-dna-
extraction-and-amplification-of-the-7911a24f.pdf
Saraswati, P. Soni, R.R, Bhandari, Nagori, B. (2009). DNA as Therapeutics; an
Update. Indian Journal of Pharmaceutical Sciences
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2866338/pdf/IJPhS-71-
488.pdf
Sowmyya, T. (2016). Touch DNA: An Investigative Tool In Forensic
science. International Journal of Current Research

iii
LAMPIRAN COVER REVIEW JURNAL

COVER REVIEW JURNAL 1

\
COVER REVIEW JURNAL 2
OVER REVIEW JURNAL 3
OVER REVIEW JURNAL 4
OVER REVIEW JURNAL 5
 Open Access Journal of Toxicology

How to cite this article: Afroze Alam, U Farooq, Ruchi Singh, VP Dubey, Shailendra Kumar, et al. Chemotherapy Treatment and Strategy Schemes: A
005 Review. Open Acc J of Toxicol. 2018;2(5): 555600. DOI: 10.19080/OAJT.2018.02.555600.
 Review Article

DNA as Therapeutics; an Update

P. SARASWAT*, R. R. SONI1, A. BHANDARI2 AND B. P. NAGORI3
Mahatma Gandhi Medical College and Hospital, RIICO Institutional Area, Sitapura, Jaipur-302 022, India, 1Jaipur
Fertility and Microsurgery Research Center, Bani Park, Jaipur-302 016, India, 2Department of Pharmacy, Jodhpur
National University, Narnadi, Jhanwar Road, Jodhpur-342 001, India, 3Department of Pharmaceutical Chemistry,
L. M. College of Science and Technology, Shastri Nagar, Jodhpur-342 003, India

Saraswat, et al.: DNA as Therapeutics

Human gene therapy is the introduction of new genetic material into the cells of an individual with the intention
of producing a therapeutic benefit for the patient. Deoxyribonucleic acid and ribonucleic acid are used in gene
therapy. Over time and with proper oversight, human gene therapy might become an effective weapon in modern
medicine’s arsenal to help fight diseases such as cancer, acquired immunodeficiency syndrome, diabetes, high
blood pressure, coronary heart disease, peripheral vascular disease, neurodegenerative diseases, cystic fibrosis,
hemophilia and other genetic disorders. Gene therapy trials in humans are of two types, somatic and germ line
gene therapy. There are many ethical, social, and commercial issues raised by the prospects of treating patients
whose consent is impossible to obtain. This review summarizes deoxyribonucleic acid-based therapeutics and
gene transfer technologies for the diseases that are known to be genetic in origin. Deoxyribonucleic acid-based
therapeutics includes plasmids, oligonucleotides for antisense and antigene applications, deoxyribonucleic acid
aptamers and deoxyribonucleic acidzymes. This review also includes current status of gene therapy and recent
developments in gene therapy research.

Key words: Gene therapy, nucleic acid therapeutics, antisense, gene transfer technology, gene therapy trials,
DNA delivery systems, viral vectors, nonviral vectors, liposomes

Human gene therapy is defined as the introduction of
new genetic material into the cells of an individual
with the intention of producing a therapeutic
benefit[1-3]. A number of human diseases are known to
be genetic in origin (Huntington’s chorea and cystic
fibrosis to name a few) and virtually all diseases,
except for trauma, have a hereditary component[4].
Thus, the opportunity to treat such disorders by
replacing the defective gene(s) with a normal healthy
gene (gene therapy) offers a novel therapeutic
approach for patients who suffer from such diseases.
Now, gene therapy routinely is evoked to encompass
the use of deoxyribonucleic acid (DNA) as a drug
to alleviate the symptoms of a disease, even if the
therapeutic genes are not strictly ‘corrective’ (in the
sense of restoring a function known to be mutated
in the affected cells). In its broadest terms, gene
therapy represents an opportunity for the treatment
of genetic disorders in adults and children by genetic
modification of human body cells[5]. All of the gene
therapy trials currently approved for use in human
*Address for correspondence
E-mail: saraswatmgmch@rediffmail.com
488 Indian Journal of Pharmaceutical Sciences
patients target somatic cells that will live only as
long as the patient. This ensures that the genetic
treatment will affect only one generation and will
not alter the genetic makeup of any offspring of the
patient, since there is no spread of the therapeutic
gene(s) to the gametes. This is known as the somatic
gene therapy, and its purpose is to alleviate disease in
the treated individual alone. More than 300 clinical
trials involving gene transfer in patients have been
approved and the first nucleic acid drug, an antisense
oligonucleotide, fomivirsen (marketed as Vitravene)
has been approved by the United States Food and
Drug Administration (USFDA) for the treatment of
cytomegalovirus retinitis in immunocompromised
patients [6]. In contrast, it is also possible to target
directly the gametes (sperm and ova) in order to
modify the genetic profile, not of the current, but of
the subsequent generation of unborn ‘patients’. Gene
transfer at an early stage of embryonic development
also might have similar effects by achieving gene
transfer to both somatic and germ line cells. This is
known as the germ line gene therapy.
Apart from the inability to predict the long-term
September - October 2009
 www.ijpsonline.com
effects of altering the germ line by delivery of
exogenous genetic material at the scientific level,
there are many ethical, social, and commercial issues
surround the technique. The social implications of
such technology include the possibility that patients
might suffer from depression as a result of being
‘genetically altered’ or might not be accepted by
society in the way that they were before treatment.
The commercial implications of such technology
are that the insurance companies and other such
institutions also would want to access the available
information prior to them granting life insurance
policies. So, it is obvious that a person shown to have
a predisposition to a genetic disease could be severely
penalized because of a mutation in their DNA, even
though they might never develop the disease. The
biggest setback for gene therapy occurred in 1999
when Jesse Gelsinger, an 18 year-old high-school
graduate from Arizona, died as a result of a gene
therapy experiment. Gelsinger developed a fever
and blood clots throughout his body within hours of
treatment to correct partial ornithine transcarbamylase
(OTC) deficiency, a rare metabolic disease that can
cause a dangerous build-up of ammonia in the body
and died four days later[7]. Despite this attempt to
preserve public confidence in gene therapy, the
Washington post documented six unreported deaths
on 3 rd November 1999 that had occurred in trials
conducted at the Cornell Medical Center, Manhattan
and at the Tufts University, Boston[8].
Nucleic acids are one of the most important sources
not only for the understanding of the fundamental
basis of human life but also for the development of
a novel group of therapeutics. One of the significant
advantages of DNA-based drugs over currently
available low molecular weight pharmaceuticals is
their selective recognition of molecular targets and
pathways, which imparts tremendous specificity
of action. DNA-based therapeutics includes
plasmids, oligonucleotides for antisense and antigene
applications[9], DNA aptamers, and DNAzymes. In
gene therapy, the gene transfer technologies are DNA
delivery systems for nucleic acid based therapeutics.
Although most of the DNA and RNA based drugs
are in early stages of clinical trials, these classes of
compounds have emerged in recent years to yield
extremely promising candidates for drug therapy
for wide range of diseases, including cancer, AIDS,
neurological disorders such as Parkinson’s disease and
September - October 2009 Indian Journal of Pharmaceutical Sciences
Alzheimer’s disease, and cardiovascular disorders[10,11].
Elucidation of the human genome has also provided a
major impetus in identifying human genes implicated
in diseases, which may eventually lead to the
development of DNA and RNA based drugs for gene
replacement or potential targets for gene ablation[12].
The Human Genome project will help determine
genetic markers responsible for patient response
to drug therapy, drug interactions, and potential
side effects[13]. Developments in human genomics,
transcriptomics, and proteomics will provide an
additional impetus for the advancement of DNA
based therapeutics by supplying novel targets for
drug design, screening, and selection. In this review,
we summarize DNA-based therapeutics, gene transfer
technologies, current status of gene therapy and recent
developments in gene therapy research.
DNA- BASED THERAPEUTICS
Plasmids:
Plasmids are high molecular weight, double stranded
DNA constructs containing transgenes, which encode
specific proteins. On the molecular level, plasmid
DNA molecules can be considered pro-drugs that
upon cellular internalization employ the DNA
transcription and translation apparatus in the cell to
biosynthesize the therapeutic entity, the protein[14].
The mechanism of action of plasmid DNA requires
that the plasmid molecules gain access into the
nucleus after entering the cytoplasm. Nuclear access
or lack thereof eventually controls the efficiency of
gene expression. In addition to disease treatment,
plasmids can be used as DNA vaccines for genetic
immunization[15]. In the early stages of development,
plasmid-based gene therapy was attempted to correct
inheritable disorders resulting from a single gene
defect. The first federally approved human gene
therapy protocol was initiated in 1990 for the
treatment of adenosine deaminase deficiency [16] .
Since then, more than 500 gene therapy protocols
have been approved or implemented [17]. In 2002,
scientists reported the successful gene-therapy-
based cure for severe combined immunodeficiency
(SCID) [18]. In 2003, the Chinese drug regulatory
agency approved the first gene therapy product for
head and neck squamous carcinoma under the trade
name Gendicine[19]. Currently, diseases with complex
etiologies such as cancer[20-21] and neurodegenerative
disorders such as Alzheimer’s disease and Parkinson’s
disease [22] are being targeted. In addition, DNA
489
 www.ijpsonline.com
vaccines for malaria, AIDS, and many other diseases
are in development[23]. DNA vaccines have also been
used to prevent allergic response[24].
Oligonucleotides:
Oligonucleotides are short single-stranded segments
of DNA that upon cellular internalization can
selectively inhibit the expression of a single protein.
For antisense applications, oligonucleotides interact
and form a duplex with the mRNA or the pre-
mRNA and inhibit their translation or processing,
consequently inhibiting protein biosynthesis. For
antigene applications, oligonucleotides must enter the
cell nucleus; form a triplex with the double- stranded
genomic DNA, and inhibits the translation as well
as the transcription process of the protein. On the
molecular level, numerous mechanisms have been
proposed to explain the basis of oligonucleotide
action[25-27]. For therapeutic purposes, oligonucleotides
can be used to selectively block the expression of
proteins that are implicated in diseases [28] . With
successful antisense inhibition of proteins in animal
models, the first antisense drug, fomivirsen sodium
(Vitravene, Isis Pharmaceuticals, Carlsbad, CA)
was approved for the treatment of cytomegalovirus
retinitis in AIDS patients in 1998 [29] . Antisense
oligonucleotides such as MG98 and ISIS 5132,
designed to inhibit the biosynthesis of DNA
methyltransferase and c-raf kinase, respectively,
are in human clinical trials for cancer[30]. Synthetic
antisense DNA oligonucleotides and oligonucleotide
analogs[31], which inhibit the replication of several
infectious agents such as hepatitis C virus[32], human
cytomegalovirus[33], human immunodeficiency virus
and papilloma virus[34-43], have also been designed.
Aptamers:
DNA-Aptamers are double-stranded nucleic acid
segments that can directly interact with proteins[10].
Aptamers interfere with the molecular functions of
disease-implicated proteins or those that participate in
the transcription or translation processes. Aptamers are
preferred over antibodies in protein inhibition owing
to their specificity, non-immunogenicity, and stability
of pharmaceutical formulation [44]. DNA-aptamers
that have demonstrated promise in intervention of
pathogenic protein biosynthesis are HIV-1 integrase
enzyme[45].
DNAzymes:
DNAzymes are analogs of ribozymes with greater
490 Indian Journal of Pharmaceutical Sciences
biological stability[28]. The RNA backbone chemistry
is replaced by the DNA motifs that confer improved
biological stability. DNAzyme directed against the
vascular endothelial growth factor receptor 2 was
confirmed to be capable of tumor suppression by
blocking angiogenesis upon intratumoral injections in
mice[46].
GENE TRANSFER TECHNOLOGIES
Gene transfer technologies or DNA delivery methods
can be classified into 3 general types; electrical
techniques, mechanical transfection, and vector
assisted delivery systems.
Mechanical and electrical techniques:
Mechanical and electrical strategies of introducing
naked DNA into cells include microinjection, particle
bombardment, the use of pressure, and electroporation.
Microinjection is highly efficient since one cell at
a time is targeted for DNA transfer; however, this
precision is achieved at the expense of time. Ballistic
transfer of gold micro-particles can be achieved
using particle bombardment equipment such as the
gene gun. Electroporation uses high-voltage electrical
current to facilitate DNA transfer. This technique
results in high cell mortality and therefore is not
suitable for clinical use[47-50].
Vector-assisted delivery systems:
Vector-assisted DNA/gene delivery systems can
be classified into 2 types based on their origin;
biological viral DNA delivery systems and chemical
nonviral delivery systems. In viral delivery systems,
nonpathogenic attenuated viruses can be used as
delivery systems for genes/DNA molecules; especially
plasmids [51-53]. These viral DNA-delivery vectors
include both RNA and DNA viruses. The viruses
used as gene therapy vectors can be classified
into 4 types; retroviruses [54], adenoviruses, adeno-
associated viruses [55] and Herpes simplex viruses.
Gene expression using viral vectors has been achieved
with high transfection efficiencies in tissues such
as kidney[56], heart muscle[57], eye[55], and ovary[58].
Viruses are currently used in more than 70% of
human clinical gene therapy trials world-wide[59]. Gene
therapy using viral systems has made considerable
progress for the treatment of a wide range of
diseases, such as muscular dystrophy [57], AIDS [60],
and cancer [61] . The only approved gene therapy
treatment (Gendicine) delivers the transgene using a
September - October 2009
 www.ijpsonline.com
recombinant adenoviral vector[20]. DNA delivery using
viral vectors has been extensively reviewed[52,53,62].
The first-generation retroviral vectors were largely
derived from oncoretroviruses, such as the Maloney
murine leukemia virus (MMuLv), and were unable to
transfer genes into non-dividing cells[63,64]. This limited
the potential for their application as a delivery system
in gene therapy. The utilization of the lentivirus
family of retroviruses has overcome this shortcoming.
Lentiviruses, which include Human immunodeficiency
virus type1 (HIV-1), bovine immunodeficiency virus
(BIV), feline immunodeficiency virus (FIV) and
simian immunodeficiency virus (SIV), are able to
transfer genes to non-dividing cells[64,65].
Retroviral vectors used in gene therapy are replication
deficient, such that they are unable to replicate in
the host cell and can infect only one cell[66,67]. This
characteristic, although essential for the safety of viral
vectors in gene therapy, imposes restrictions on the
amounts of virus that can safely be administered[68,69].
Retroviral-mediated delivery of therapeutic DNA
has been widely used in clinical gene therapy
protocols, including the treatment of cancers, such
as melanoma [70] and ovarian cancer [71], adenosine
deaminase deficiency-severe combined immune
deficiency (ADA-SCID)[72,73] and Goucher’s disease[74].
Retroviral vectors are capable of transfecting high
populations (45-95%) of primary human endothelial
and smooth muscle cells, a class of cells that are
generally extremely difficult to transfer[75].
Adenoviruses have been used to deliver therapeutic
DNA to patients suffering from metastatic breast,
ovarian and melanoma cancers [76-78] . Indeed, the
severe immune response of the host contributes to
the limited survival of the adenoviral DNA in the
targeted cells and results in a transient expression
of the therapeutic gene since the adenoviral DNA
is lost over time[79-83]. First- generation adenoviral
vectors were able to accommodate the introduction of
therapeutic genes over 7 Kb long (but rarely larger)
into targeted cells [84]. However, the generation of
gutless adenoviral vectors, which lack all viral genes,
has facilitated adenoviral delivery of up to 30 Kb
of a therapeutic DNA sequence[85-88] with decreased
toxicity[89]. Adenoviral-mediated gene transfer in COS-
7 cells was significantly higher than that achieved by
liposomal delivery systems[90].
The use of adeno-associated viral (AAV) vectors
September - October 2009 Indian Journal of Pharmaceutical Sciences
provides an alternative to adenoviral vectors for
gene therapy and a means for long-term gene
expression with a reduced risk of adverse reactions
upon administration of the vector[91,92]. AAV viruses
are linear, single stranded DNA parvoviruses that
are not associated with any disease in humans[93]. In
humans, the site of AAV viral DNA integration is
on chromosome 19[94,95]. In the engineering of AAV
vectors, most of the AAV genome can be replaced
with the therapeutic gene [96], which significantly
reduces potential adverse responses of the host to
viral infection. However, the size of the therapeutic
gene is limited to approximately 5 Kb [97,98]. First
generation adeno-associated viruses had a very
small capacity of ~4.7 Kb for encapsulation of the
plasmid DNA cargo. Recent reports demonstrate
efficient production of second-generation AAV with
higher encapsulating capabilities [99] . It has been
demonstrated that adenoviruses in formulations may
lose their potency after storage in commonly used
pharmaceutical vials[100].
Herpes simplex virus (HSV) vector is a large and
relatively complex enveloped, double-stranded DNA
virus that has the capacity to encode large therapeutic
genes and, like AAV, can remain latent in infected
cells providing the potential for long term expression
of the therapeutic gene[101]. Although, able to infect
many cell types, HSV vectors currently are limited in
their use by vector toxicity[102].
Non-viral delivery systems have the greatest
advantage over viral delivery systems is the lack
of immune response and ease of formulation and
assembly. Commonly used non-viral vectors for
delivery of DNA-based therapeutics can be classified
into 3 major types; Naked DNA delivery systems,
polymeric delivery systems, and liposomal delivery
systems[30,103-105].
Naked DNA can be administered via two possible
routes, either by ex vivo delivery or by in vivo
delivery. The ex vivo method of naked DNA delivery
has been used successfully for the introduction of
DNA into endothelial and smooth muscle cells[106,107],
its reliance on the culture of harvested cells renders
it unsuitable for many cell types. In vivo delivery of
naked DNA was first described in 1990[108]. Efficiency
of the delivery of naked DNA can be improved when
administered in a pressure-mediated fashion[107,109].
Particle bombardment technology enables the localized
491
 www.ijpsonline.com
delivery of DNA readily into skin or muscle [110].
Another technique for delivery of naked DNA directly
into target cells is electroporation. The successful
delivery of DNA by electroporation in vivo has been
reported in tissues such as skin and muscle[111-114].
In polymeric delivery systems, cationic polymers
are used in gene delivery because they can easily
complex with the anionic DNA molecules[115]. The
mechanism of action of these polycomplexes is
based on the generation of a positively charged
complex owing to electrostatic interaction of
these cationic polymers with anionic DNA [48] .
Commonly used polymers include polyethylenimine
(PEI)[116], poly-L-lysine (PLL)[117], chitosans[118], and
dendrimers [30]. Agents such as folates, transferin,
antibodies, or sugars such as galactose and
mannose can be incorporated for tissue targeting[30].
Synthetic polymers such as protective interactive
non-condensing polymers (PINC), poly-L-lysine,
cationic polymers and dendrimers offer an alternative
to cationic lipids as a vehicle for DNA delivery
into target cells [119-123] . Encapsulation of a DNA
molecule or even a therapeutic viral vector within
a biodegradable polymer has been demonstrated
to permit the controlled release of the DNA in a
targeted cell over a period of weeks or months[124,125].
The inclusion of proteins and peptides in the DNA
complex that are recognized by receptors on targeted
cells has led to an improvement in the efficiency of
DNA uptake in several instances[126]. Some polymers
have inherent potent pharmacological properties (such
as hypercholesterolemia-induced by chitosans) that
make them extremely unfavorable for human use[127].
Liposomes are one of the most versatile tools for the
delivery of DNA therapeutics[28,103,104,128]. Liposome
and drug/lipid complexes have been used for the
delivery of the anticancer drugs doxorubicin and
daunorubicin[129]. Liposomes can be used as DNA drug
delivery systems either by entrapping the DNA-based
therapeutics inside the aqueous core or complexing
them to the phospholipids lamellae. Liposome can
also be used for specialized gene delivery options
that include long circulation half-life, sustained and
targeted delivery[103].
Numerous studies have demonstrated the use of
cationic liposomal formulations for the delivery of
different plasmid constructs in a wide range of cells,
both in vivo and in vitro [130]. The use of cationic
492 Indian Journal of Pharmaceutical Sciences
lipids to transfer DNA into cells was first described
as an in vitro method of DNA delivery[131]. Cationic
liposomes have also been used in clinical trials to
deliver therapeutic DNA[132-136]. Cationic liposomal
formulations consist of mixtures of cationic and
zwitterionic lipids[128,137,138]. Proprietary formulations
of cationic lipids such as lipofectamine (Invitrogen,
Carlsbad, CA), effectene (Qiagen, Valencia, CA), and
tranfectam (Promega, Medison, WI) are commercially
available [139], but most of the kits are useful only
for in vitro experimentation. There are reports of
improved efficiency of DNA delivery by cationic
lipid via the coupling of specific receptor ligands
or peptides to DNA/liposome complexes [126,140-143].
Cytotoxicity of cationic lipids has been established in
numerous in vitro[144,145] and in vivo[146-148] studies. Low
transfection efficiencies have been attributed to the
heterogeneity and instability of cationic lipoplexes[149].
Another drawback in the use of cationic lipids is their
rapid inactivation in the presence of serum [138,150].
Some in vivo studies have revealed that the gene
transduction responses obtained by cationic lipoisomes
were transient and short-lived[151,152].
As an alternative to cationic lipids, the potential of
anionic lipids for DNA delivery has been investigated.
The safety of anionic lipids has been demonstrated
when administered to epithelial lung tissue. In recent
years, a few studies, using anionic liposomal DNA
delivery vectors have been reported. There have
been attempts to incorporate anionic liposomes
into polymeric delivery systems. However, these
vectors have limited applications, mainly because
of (1) inefficient entrapment of DNA molecules
within anionic liposomes and (2) lack of toxicity
data. Lack of further progress of these systems
may be attributed, in part, to the poor association
between DNA molecules and anionic lipids, caused
by electrostatic repulsion between these negatively
charged species[145,146,153-160].
Along with numerous cationic and anionic lipid
derivatives, functionalized liposomal formulations
serving specific therapeutic objectives have shown
promise in gene therapy [103,161,162] . Specialized
liposomal delivery platforms include pH-sensitive
liposomes, immunoliposomes, and stealth liposomes.
pH-Sensitive Liposomes can be generated by the
inclusion of 1,2-dioleoyl-3-phosphoethanolamine
(DOPE) into liposomes composed of acidic lipids
such as cholesterylhemisuccinate or oleic acid.
September - October 2009
 www.ijpsonline.com
At the neutral cellular pH 7, these lipids have the
typical bilayer structure; however, upon endosomal
compartmentalization they undergo protonation and
collapse into a nonbilayer structure, thereby leading
to the disruption and destabilization of the endosomal
bilayer, which in turn helps in the rapid release of
DNA into the cytoplasm[161]. Efficient gene delivery
of the beta-galactosidase and luciferase reporter
plasmids has been obtained using pH-sensitive
liposomes in a variety of mammalian cell lines[163].
A chemical derivative of DOPE, Citraconyl-DOPE,
has been used to deliver DNA-based therapeutics
to cancer cells, thereby combining the targeting and
the rapid endosome-releasing aspects of specialized
liposomal delivery systems[164]. A phosphatidylcholine/
glycyrrhizin combination was also successful in pH-
sensitive gene delivery in mice[165]. Immunoliposomes
are sophisticated gene delivery systems that can
be used for cell targeting by the incorporation of
functionalized antibodies attached to lipid bilayers[162].
Immunoliposomes containing an antibody fragment
against the human transferring receptor were
successfully used in targeted delivery of tumor-
suppressing genes into tumors in vivo [166]. Tissue-
specific gene delivery using immunoliposomes has
been achieved in the brain[167], embryonic tissue[168],
and breast cancer tissue [169]. Stealth liposomes are
sterically stabilized liposomal formulations that
include polyethylene glycol (PEG)-conjugated
lipids[103].
CURRENT STATUS OF GENE THERAPY
RESEARCH
Current gene therapy is experimental and has not
proven very successful in clinical trials. Little
progress has been made since the first gene therapy
clinical trial began in 1990. In 1999, gene therapy
suffered a major setback with the death of 18-year-old
Jesse Gelsinger. Another major blow came in January
2003, when the FDA placed a temporary halt on all
gene therapy trials using retroviral vectors in blood
stem cells. FDA took this action after it learned
that a second child treated in a French gene therapy
trial had developed a leukemia-like condition. Both
this child and another who had developed a similar
condition in August 2002 had been successfully
treated by gene therapy for X-linked severe combined
immunodeficiency disease (X-SCID), also known as
"bubble baby syndrome".
September - October 2009 Indian Journal of Pharmaceutical Sciences
FDA's Biological Response Modifiers Advisory
Committee (BRMAC) met at the end of February
2003 to discuss possible measures that could allow
a number of retroviral gene therapy trials for
treatment of life-threatening diseases to proceed with
appropriate safeguards. In April of 2003 the FDA
eased the ban on gene therapy trials using retroviral
vectors in blood stem cells.
RECENT DEVELOPMENTS IN GENE
THERAPY
Nanotechnology and gene therapy yields treatment
to torpedo cancer (March, 2009); The School of
Pharmacy in London is testing a treatment in mice,
which delivers genes wrapped in nanoparticles to
cancer cells to target and destroy hard-to-reach
cancer cells[170]. Results of world's first gene therapy
for inherited blindness show sight improvement
(April, 2008); UK researchers from the UCL Institute
of Ophthalmology and Moorefield’s Eye Hospital
NIHR Biomedical Research Centre have announced
results from the world’s first clinical trial to test a
revolutionary gene therapy treatment for a type of
inherited blindness. The results, published in the
New England Journal of Medicine, show that the
experimental treatment is safe and can improve
sight. The findings are a landmark for gene therapy
technology and could have a significant impact on
future treatments for eye disease[171,172].
Previous information on this trial (May 1, 2007); A
team of British doctors from Moorfields Eye Hospital
and University College in London conduct first
human gene therapy trials to treat Leber's congenital
amaurosis, a type of inherited childhood blindness
caused by a single abnormal gene. The procedure
has already been successful at restoring vision for
dogs. This is the first trial to use gene therapy in an
operation to treat blindness in humans[173].
A combination of two tumor suppressing genes
delivered in lipid-based nanoparticles drastically
reduces the number and size of human lung cancer
tumors in mice during trials conducted in The
University of Texas M. D. Anderson Cancer Center
and the University of Texas Southwestern Medical
Center [174] . Researchers at the National Cancer
Institute (NCI), part of the National Institutes of
Health, successfully reengineer immune cells, called
lymphocytes, to target and attack cancer cells in
493
 www.ijpsonline.com
patients with advanced metastatic melanoma. This is
the first time that gene therapy is used to successfully
treat cancer in humans[175].
Gene therapy is effectively used to treat two adult
patients for a disease affecting nonlymphocytic white
blood cells called myeloid cells. Myeloid disorders
are common and include a variety of bone marrow
failure syndromes, such as acute myeloid leukemia.
The study is the first to show that gene therapy can
cure diseases of the myeloid system (http://www.
cincinnatichildrens.org/March 31, 2006). A research
team at the University of California, Los Angeles is
able to transport genes into the brain using liposomes
coated with polyethylene glycol. The transfer of genes
into the brain is a significant achievement because
viral vectors are too big to get across the blood-
brain barrier. This method has potential for treating
Parkinson's disease[176].
RNA interference or gene silencing may be a new
way to treat Huntington's. Short pieces of double-
stranded RNA (short, interfering RNAs or siRNAs)
are used by cells to degrade RNA of a particular
sequence. If a siRNA is designed to match the RNA
copied from a faulty gene, then the abnormal protein
product of that gene will not be produced[177]. New
gene therapy approach repairs errors in messenger
RNA derived from defective genes. Technique has
potential to treat the blood disorder thalassaemia,
cystic fibrosis, and some cancers[178]. Gene therapy for
treating children with X-SCID (bubble boy) disease
is stopped in France when the treatment resulted in
leukemia in one of the patients[179]. Researchers at
Case Western Reserve University and Copernicus
Therapeutics are able to create tiny liposomes 25
nanometers across that can carry therapeutic DNA
through pores in the nuclear membrane[180]. Sickle cell
is successfully treated in mice[181].
REFERENCES
1. Anderson WF. Human gene therapy. Science 1992;256:808-13.
2. Baltimore DP. Intracellular immunization. Nature 1988;335:395-7.
3. Mizutani TN, Kato M, Hirota K, Sugiyama A, Murakami J,
Shimotohno K. Inhibition of hepatitis C virus replication by antisense
oligonucleotids in culture cells. Biochem Biophys Res Commun
1995;212:906-11.
4. SoRelle R. Who owns your DNA? Who will own it? Circulation
2000;101:e67-8.
5. Report of the United Kingdom Health Minister’s Gene Therapy
Advisory Committee. Guidance on making proposals to conduct gene
therapy research on human subjects. Hum Gene Ther 1995;6:335-46.
6. Rosenberg SA, Blaese RM, Branner MK, Deisseroth AB, Ledley FD,
494 Indian Journal of Pharmaceutical Sciences
Lotze MT, et al. Human gene marker/therapy protocols. Hum Gene
Ther 2000;11:919-79.
7. Lehrman S. Virus treatment questioned after gene therapy death. Nature
1999;401:517-8.
8. Anon S. The increasing opacity of gene therapy. Nature 1999;402:107.
9. Crooke ST. An overview of progress in antisense therapeutics. Antisense
Nucleic Acid Drug Dev 1998;8:115-22.
10. Stull RA, Szoka FC Jr. Antigene, ribozyme and aptamer nucleic acid
drugs: Progress and prospects. Pharm Res 1995;12:463-5.
11. Patil SD, Burgess DJ. DNA-based pharmaceuticals: therapeutics for the
21st century. AAPS Newsmagazine 2003;6:27.
12. Baker BF. The role of antisense oligonucleotides in the wave
of genomic information. Nucleosides Nucleotides Nucleic Acids
2001;20:397-9.
13. Van Ommen GJ, Bakker E, Den Dunnen JT. The human genome
project and the future of diagnostics, treatment, and prevention. Lancet
1999;354:5-10.
14. Uherek C, Wels W. DNA-carrier proteins for targeted gene delivery.
Adv Drug Deliv Rev 2000;44:153-66.
15. Johnston SA, Talaat AM, McGuire MG. Genetic Immunization What’s
in a name? Arch Med Res 2002;33:325-9.
16. Anderson WF. Human gene therapy. Nature (London) 1998;392:25-30.
17. Vorburger SA, Hunt KK. Adenoviral gene therapy. Oncologist
2002;7:46-59.
18. Otsu M, Candotti F. Gene therapy in infants with severe combined
immunodeficiency. BioDugs 2002;16:229-39.
19. Zhaohui P. China OKs Gene Therapy Drug. Genetic Engineering News
2003;6. [http://www. p53therapy.com/news/(November 19, 2003)].
20. Galanis E, Russell S. Cancer gene therapy clinical trials: Lessons for
the future. Br J Cancer 2001;85:1432-6.
21. Mulherkar R. Gene therapy for cancer. Curr Sci 2001;81:555-60.
22. Baekelandt V, De Strooper B, Nuttin B, Debysre Z. Gene therapeutic
strategies for neurodegenerative diseases. Curr Opin Mol 2000;2:540-54.
23. Bunnel BA, Morgan RA. Gene therapy for HIV infection. Dugs Today
1996;32:209-24.
24. Horner AA, van Uden JH, Jubeldia JM, Broide D, Raz E. DNA-based
immunothrapeutics for the treatment of allergic disease. Immunol Rev
2001;179:102-18.
25. Crooke ST. Molecular mechanisms of antisense drugs. Biochem
Biophys Acta 1999;1489:31-43.
26. Crooke ST. Molecular mechanisms of antisense drugs: Human RNaseH.
Antisense Nucleic Acid Drug Dev 1999;9:377-9.
27. Speedie M. Antisense therapeutic agents. In: Williams DA, Lemke TL,
editors. Foye’s Principles of Medicinal Chemistry. 5th ed. Philadelphia:
Lippincott, Williams & Wilkins; 2005. p. 1053-4.
28. Akhtar S, Hughes MD, Khan A. The delivery of antisense therapeutics.
Adv Drug Deliv Rev 2000;44:3-21.
29. Crooke ST. Vitravene another piece in the mosaic. Antisense Nucleic
acid Drug Dev 1998;8:vii-v3.
30. Mardan T, Kopecek J, Kissel T. Prospects for cationic polymers in
gene and oligonucleotide therapy against cancer. Adv Drug Deliv Rev
2002;54:715-58.
31. Agarawal S, Tang JY. GEM-91-an antisense oligonucleotide
phosphorothioate as a therapeutic agent for AIDS. Antisense Res Dev
1992;2:261-6.
32. Alt M, Ring R, Hofschneider PH, Paumgartner G, Caselmann WH.
Specific inhibition of hepatitis C viral gene expression by antisense
phosphorothioate oligodeoxynucleotides. Hepatology 1995;22:707-17.
33. Azad RF, Driver VB, Tanaka K, Cooke RM, Anderson KP. Antiviral
activity of a phosphorothioate oligonucleotide complementary to
RNA of the human cytomegalovirus major immediate-early region.
Antimicrob Agents Chemother 1993;37:1945-54.
34. Bordier B, Helena C, Barr PJ, Litvak S, Sarih-Cottin L. In vitro effects
of antisense oligonucleotides on human immunodeficiency virus type 1
reverse transcription. Nucleic Acids Res 1992;20:1999-2006.
35. Cowsert LM, Fox MC, Zon G, Mirabelli MK. In vitro evaluation
of phosphorothioate oligonucleotides targeted to the E2 mRNA of
September - October 2009
 www.ijpsonline.com
papillomavirus: potential treatment for the genital warts. Antimicrob
Agents Chemother 1993;37:171-7.
36. Gerviax A, Li X, Kraus G, Wong-Staal F. Multigene antivirus vectors
inhibit divers human immunodeficiency virus type 1 clades. J Virol
1997;71:3048-53.
37. Hanecak R, Brown-Driver V, Fox MC, Azad RF, Furusako S, Nozaki
C, et al. Antisense oligonucleotide inhibition of hepatitis C virus gene
expression in transformed hepatocytes. J Virol 1996;70:5203-12.
38. Kinchington D, Galpin S, Jeroszewski J, Ghosh K, Subashinghe
C, Cohen JS. A comparision of gag, pol, and rev antisense
oligodeoxynucleotides as inhibitors of HIV-1. Antiviral Res 1992;17:53-
62.
39. Lisziewicz J, Sun D, Klotman M, Agarwal S, Zamencik P, Gallo RC.
Specific inhibition of human immunodeficiency virus type 1 replication
by antisense oligonuclotides: An in vitro model for treatment. Proc Natl
Acad Sci USA 1992;89:11209-13.
40. Lisziewicz J, Sun D, Metelev V, Zamencik P, Gallo RC, Agarwal S.
Long term treatment of human immunodeficiency virus infected cells
with antisense oligonucleotide phosphorothioates. Proc Natl Acad Sci
USA 1993;90:3860-4.
41. Mirabelli CK, Bennet CF, Anderson K, Crooke ST. In vitro and in vivo
pharmacologic activities of antisense oligonucleotides. AntiCancer Drug
Design 1991;6:647-61.
42. Morvan F, Porumb H, Degols G, Lefebvre I, Pampon A, Sproat BS,
et al. Comparative evaluation of seven oligonucleotide analogues as
potential antisense agents. J Med Chem 1993;36:280-7.
43. Tonkinson JL, Stein CA. Antisense nucleic acids-prospects for antiviral
intervention. Antiviral Chem Chemother 1993;4:193-9.
44. Jayasena SD. Aptamers: An emerging class of molecules that rival
antibodies in diagnostics. Clin Chem 1999;45:1628-50.
45. de Saultrait VR, Lozach PY, Altmeyer R, Tarrago-Litvak L, Litvak S,
Andreola ML. DNA aptamers derived from HIV-1 RNaseH inhibitors
are strong anti-integrase agents. J Mol Biol 2002;324:195-203.
46. Zhang L, Gasper WA, Stass SA, Ioffe OB, Davis MA, Mixson AJ.
Angiogenic inhibition mediated by a DNAzyme that target vascular
endothelial growth factor receptor 2. Cancer Res 2002;62:5463-9.
47. McAlister DV, Allen MG, Prausnitz MR. Microfabricated microneedles
for gene and drug delivery. Annu Rev Biomed Eng 2000;2:289-313.
48. Luo D, Saltzman WM. Synthetic DNA delivery systems. Nat Biotechnol
2000;18:33-7.
49. Regnier V, Tahiri A, Andre N, Lemaitre M, Le Doan T, Preat V.
Electroporation-mediated delivery of 3’-protected phosphodiester
oligodeoxynucleotides to the skin. J Control Release 2000;67:337-46.
50. Huang L, Viroonchatapan E. Introduction. In: Huang L, Huang M-C,
Wagner E, editors. Nonviral vectors for gene therapy. San Diego, CA:
Academic Press; 1999. p. 3-22.
51. Kamiya H, Tsuchiya H, Yamazaki J, Harashima H. Intracellular
trafficking and transgene expression of viral and non-viral gene vectors.
Adv Drug Deliv Rev 2001;52:153-64.
52. Mah C, Byrne BJ, Flotte TR. Virus-based gene delivery systems. Clin
Pharmacokinet 2002;41:901-11.
53. Lotze MT, Kost TA. Viruses as gene delivery vectors: Application to
gene function, target validation, and assay development. Cancer Gene
Ther 2002;9:692-9.
54. McTaggart S, Al-Rubeai M. Retroviral vectors for human gene delivery.
Biotechnol Adv 2002;20:1-31.
55. Martin KR, Klein RL, Quigley HA. Gene delivery to the eye using
adeno-associated viral vectors. Methods 2002;28:267-75.
56. Lien Y-HH, Lie L-W. Gene therapy for renal disorders: What are the
benefits for the elderly? Drugs Aging 2002;19:553-60.
57. Chamberlain JS. Gene therapy of muscular dystrophy. Hum Mol Genet
2002;11:2355-62.
58. Wolf JK, Jenkins AD. Gene therapy for ovarian cancer. Int J Oncol
2002;21:461-8.
59. Walther W, Stein U. Viral vectors for gene transfer: A review of their
use in the treatment of human diseases. Drugs 2000;60:249-71.
60. Lever AML. Gene therapy in the fight against AIDS. Expert Opin Ther
September - October 2009 Indian Journal of Pharmaceutical Sciences
Patents 1996;6:161-7.
61. Zhao W, Kobayashi M, Hosokawa M, Seth P. Adenoviral vectors for
cancer gene therapy. Curr Genomics 2002;3:163-80.
62. Hale SJ, Green NK. Viral approaches to cancer gene therapy. Expert
Opin Ther Patents 2002;12:369-78.
63. Roe T, Reynolds TC, Yu G, Brown PO. Integration of murine leukemia
virus DNA depends on mitosis. EMBO J 1993;12:2099-108.
64. Lewis PF, Emerman M. Passage through mitosis is required for
oncoretroviruses but not for the human immunodeficiency virus. J Virol
1994;68:510-6.
65. Naldini L, Blomer U, Gally P. In vivo gene delivery and stable
transduction of nondividing cells by a lentiviral vector. Science
1996;272:263-7.
66. Mann R, Mulligan RC, Baltimore D. Construction of a retrovirus
packaging mutant and its use to produce helper-free defective
retrovirus. Cell 1983;33:153-9.
67. Cone RD, Mulligan RC. High-efficiency gene transfer into mammalian
cells: Generation of helper-free recombinant retrovirus with broad
mammalian host range. Proc Natl Acad Sci USA 1984;81:6349-53.
68. Kim SH, Yu SS, Park JS, Robbins PD, An CS, Kim S. Construction of
retroviral vectors with improved safety, gene expression, and versatility.
J Virol 1998;72:994-1004.
69. Sheridan PL, Bodner M, Lynn A. Generation of retroviral packaging
and producer cell lines for large-scale vector production and clinical
application: Improved safety and high titer. Mol Ther 2000;2:262-75.
70. Fujji S, Huang S, Fong TC. Induction of melanoma-associated antigen
systemic immunity upon intratumoral delivery of interferon-gamma
retroviral vector in melanoma patients. Cancer Gene Ther 2000;7:1220-
30.
71. Tait DL, Obermiller PS, Hatmaker AR. Ovarian cancer BRCA1 gene
therapy: Phase I and II trial differences in immune response and vector
stability. Clin Cancer Res 1999;5:1708-14.
72. Bordignon C, Notarangilo LD, Nobili N. Gene therapy in peripheral
blood lymphocytes and bone marrow for ADA-immunodeficient
patients. Science 1995;270:470-5.
73. Onodera M, Ariga T, Kawamura N. Successful peripheral
T-lymphocyte-directed gene transfer for a patient with severe combined
immunodeficiency caused by adenosine deaminase deficiency. Blood
1998;91:30-6.
74. Dunbar CE, Kohn DB, Shiffman R. Retroviral transfer of the
glucoceribrosidase gene into CD34+ cells from patients with Goucher
disease: In vivo detection of transduced cells without myeloblation.
Hum Gen Ther 1998;9:2629-40.
75. Garton KJ, Ferri N, Raines EW. Efficient expression of exogenous
genes in primary vascular cells using IRES-based retroviral vectors.
Biotechniques 2002;32:830-43.
76. Stewart AK, Lassam NJ, Quirt IC. Adenovector-mediated gene delivery
of interleukin-2 in metastatic breast cancer and melanoma: Results of a
phase 1 clinical trial. Gene Ther 1999;6:350-63.
77. Alvarez RD, Barns MN, Gomez-Navarro J. A cancer gene therapy
approach utilizing an anti-erbB-2 single-chain antibody-encoding
adenovirus (AD21): A phase I trial. Clin Cancer Res 2000;6:3081-7.
78. Alvarez RD, Gomez-Navarro J, Wang M. Adenoviral-mediated suicide
gene therapy for ovarian cancer. Mol Ther 2000;2:524-30.
79. Byrnes AP, Rusby JE, Wood MJ. Adenovirus gene transfer causes
inflammation in the brain. Neuroscience 1995;66:1015-24.
80. Yang Y, Jooss KU, Su Q. Immune responses to viral antigens versus
transgene product in the elimination of recombinant adenovirus-infected
hepatocytes in vivo. Gene Ther 1996;3:137-44.
81. Yang Y, Su Q, Wilson JM. Role of viral antigens in destructive cellular
immune responses to adenovirus vector-transduced cells in mouse lungs.
J Virol 1996;70:7209-12.
82. van Ginkel FW, McGhee JR, Liu C. Adenoviral gene delivery elicits
distinct pulmonary-associated T helper cell responses to the vector and
to its transgene. J Immunol 1997;159:685-93.
83. Michou AI, Santoro L, Christ M. Adenovirus-mediated gene transfer:
Influence of transgene, mouse strain and type of immune response on
495
 www.ijpsonline.com
persistence of transgene expression. Gene Ther 1997;4:473-82.
84. Bett AJ, Prevec L, Graham FL. Packaging capacity, and stability of
human adenovirus type 5 vectors. J Virol 1993;67:5911-21.
85. Clemens PR, Kochanek S, Sunada Y. In vivo muscle gene transfer
of full-length dystrophin with an adenoviral vector that lacks all viral
genes. Gene Ther 1996;3:965-72.
86. Kochanek S, Clemens PR, Mitani K. A new adenoviral vector:
replacement of viral coding sequences with 28 kb of DNA
independently expressing both full-length dystrophin and beta-
galactosidase. Proc Natl Acad Sci USA 1996;93:5731-6.
87. Parks RJ, Grahm FL. A helper-dependent system for adenovirus vector
production helps define a lower limit for efficient DNA packaging. J
Virol 1997;71:3293-8.
88. Morsy MA, Gu M, Motzel S. An adenoviral vector deleted for all viral
coding sequences results in enhanced safety and extended expression of
a leptin transgene. Proc Natl Acad Sci USA 1998;95:7866-71.
89. Schiedner G, Morral N, Parks RJ. Genomic DNA transfer with a high-
capacity adenovirus vector results in improved in vivo gene expression
and decreased toxicity. Nat Genet 1998;18:180-3.
90. Heider H, Verca HB, Rusconi S, Asmis R. Comparision of lipid-
mediated, and adenoviral gene transfer in human monocyte-derived
macrophages and COS-7 cells. Biotechniques 2000;28:260-70.
91. Fisher KJ, Jooss K, Alston J. Recombinant adeno-associated virus for
muscle directed gene therapy. Nat Med 1997;3:306-12.
92. Jooss K, Yang Y, Fisher KJ. Transduction of dendritic cells by DNA
viral vectors directs the immune response to transgene products in
muscle fibers. J Virol 1998;72:4212-23.
93. Rose JA, Berns KI, Hoggan MD. Evidence for a single stranded
adenovirus-associated virus genome: Formation of a DNA density
hybrid on release of viral DNA. Proc Natl Acad Sci USA 1969;64:
863-9.
94. Kotin RM, Siniscalco M, Samulski RJ. Site-specific integration by
adeno-associated virus. Proc Natl Acad Sci USA 1990;87:2211-5.
95. Samulski RJ, Zhu X, Xiao X. Targeted integration of adeno-associated
virus (AAV) into human chromosome 19. EMBO J 1991;10:3941-50.
96. Samulski RJ, Chang LS, Shenk T. Helper-stocks of recombinant adeno-
associated viruses: Normal integration does not require viral gene
expression. J Virol 1989;63:3822-8.
97. Dong JY, Fang PD, Frizzel RA. Quantitative analysis of the packaging
capacity of recombinant adeno-associated virus. Hum Gene Ther
1996;7:2101-12.
98. Hermonat PL, Quirk JG, Bishop BM. The packaging capacity of adeno-
associated virus (AAV) and the potential for wild-type-plus AAV gene
therapy vectors. FEBS Lett 1997;407:78-84.
99. Owens RA. Second generation adeno-associated virus type 2-based
gene therapy systems with the potential for preferential integration into
AAVS 1. Curr Gene Ther 2002;2:145-59.
100. Nyberg-Hoffman C, Aguilar-Cardova E. Instability of adenoviral vectors
during transport and its implication for clinical studies. Nat Med
1999;5:955-7.
101. Carpenter DE, Stevens JG. Long term expression of a foreign gene
from a unique position in the latent herpes simplex virus genome. Hum
Gene Ther 1996;7:1447-54.
102. Lowenstein PR, Morrison EE, Bain D. Use of recombinant vectors
derived from herpes simplex virus 1 mutant tsK for short-tem
expression of transgenes encoding cytoplasmic and membrane anchored
proteins in post mitotic-polarized cortical neurons and glial cells in
vitro. Neuroscience 1994;60:1059-77.
103. Fattal E, Dellattre J, Dubernet C, Couvrur P. Liposomes for the delivery
of nucleotides and oligonucleotides. S.T.P. Pharma Sciences 1999;9:
383-90.
104. Fattal E, Dubernet C, Couvrur P. Liposome-based formulations for the
delivery of oligonucleotids. S.T.P. Pharma Sciences 2001;11:31-44.
105. Pedroso de Lima MC, Simoes S, Pires P, Faneca H, Duzguns N.
Cationic lipid-DNA complexes in gene delivery: From biophysics to
biological applications. Adv Drug Deliv Rev 2001;47:277-94.
106. Nakamura M, Devila-Zavala P, Tokuda H. Uptake and gene expression
496 Indian Journal of Pharmaceutical Sciences
of naked plasmid DNA in cultured brain microvessel endothelial cells.
Biochem Biophys Res Commun 1998;245:235-39.
107. Mann MJ, Gibbons GH, Hutchinson H. Pressure-mediated
oligonucleotide transfection of rat and human cardiovascular tissues.
Proc Natl Acad Sci USA 1999;96:6411-6.
108. Wolff JA, Malone RW, Williams P. Direct gene transfer into mouse
muscle in vivo. Science 1990;247:1465-8.
109. Liu F, Song Y, Liu D. Hydrodynamics-based transfection in animals by
systemic administration of plasmid DNA. Gene Ther 1999;6:1258-66.
110. Fynan EF, Webster RG, Fuller DH. DNA vaccines: protective
immunizations by parenteral, mucosal, and gene-gun inoculations. Proc
Natl Acad Sci USA 1993;90:11478-82.
111. Wong TK, Neumann E. Electric field mediated gene transfer. Biochem
Biophys Res Commun 1982;107:584-7.
112. Neumann E, Schaefer-Ridder M, Wang Y. Gene transfer into lyoma by
electroporation in high electric fields. EMBO J 1982;1:841-5.
113. Rols MP, Delteil C, Golzio M. In vivo electrically mediated protein and
gene transfer in murine melanoma. Nat Biotechnol 1998;16:168-71.
114. Rizzuto G, Cappelletti M, Maione D. Efficient and regulated
erythropoietin production by naked DNA injection and muscle
electroporation. Proc Natl Acad Sci USA 1999;96:6417-22.
115. Hwang SJ, Davis ME. Cationic polymers for gene delivery: Designs for
overcoming barriers to systemic administration. Curr Opin Mol Ther
2001;3:183-91.
116. Lemkine GF, Demeneix BA. Polyethylenimins for in vivo gene delivery.
Curr Opin Mol Ther 2001;3:178-82
117. Lollo CP, Banaszczyk MG, Mullen PM. Poly-L-lysine based gene
delivery systems: synthesis, purification, and application. Methods Mol
Med 2002;69:1-13.
118. Borchard G. Chitosans for gene delivery. Adv Drug Deliv Rev
2001;52:145-50.
119. Boussif O, Lezoualc’h F, Zanta MA. A versatile vector for gene
and oligonucleotide transfer into cells in culture and in vivo:
Polyethylenimin. Proc Natl Acad Sci USA 1995;92:7297-301.
120. Wadhwa MS, Knoell DL, Young AP. Targeted gene delivery with a low
molecular weight glycopeptide carrier. Bioconjug Chem 1995;6:283-91.
121. Kukowska-Latello JF, Bielinska AU, Johnson J. Efficient transfer of
genetic material into mammalian cells using Starbust polyamidoamine
dendrimers. Proc Natl Acad Sci USA 1996;93:4897-902.
122. Tang MX, Szoka FC. The influence of polymer structure on the
interactions of cationic polymers with DNA and morphology of the
resulting complexes. Gene Ther 1997;4:823-32.
123. Mumper RJ, Wang J, Klakamp SL. Protective interactive noncondensing
(PINC) polymers for enhanced plasmid distribution and expression in
rat skeletal muscle. J Control Release 1998;52:191-203.
124. Naughton BA, Dai Y, Sibanda B. Long-term expression of a retrovirally
introduced beta-galactosidas gene in rodent cells implanted in
vivo using biodegradable polymer meshes. Somat Cell Mol Genet
1992;18:451-62.
125. Singh M, Briones M, Ott G. Cationic microparticles: A potent delivery
system for DNA vaccines. Proc Natl Acad Sci USA 2000;97:811-16.
126. Jenkins RG, Herrick SE, Meng QH. An integrin-targeted non-viral
vector for pulmonary gene therapy. Gene Ther 2000;7:393-400.
127. LeHoux JG, Grondin F. Some effects of chitosan on liver function in
the rat. Endocrinology 1993;132:1078-84.
128. Godbey WT, Mikos AG. Recent progress in gene delivery using non-
viral transfer complexes. J Control Release 2001;72:115-25.
129. Tejada-Berges T, Granai CO, Gordinier M, Gajewski W. Caelyx/Doxil
for the treatment of metastatic ovarian and breast cancer. Expert Rev
Anticancer Ther 2002;2:143-50.
130. Marshal J, Yew NS, Eastman SJ, Jiang C, Sheule RK, Cheng SH.
Cationic lipid-mediated gene delivery to the airways. In: Wagner E,
editors. Nonviral vectors for gene therapy. San Diego, CA: Academic
Press; 1999. p. 39-68.
131. Felgner PL, Gadek TR, Holm M. Lipofection: A highly efficient,
lipid-mediated DNA-transfection procedure. Proc Natl Acad Sci USA
1987;84:7413-7.
September - October 2009
 www.ijpsonline.com
132. Caplen NJ, Alton EW, Middleton PG. Liposome-mediated CFTR gene
transfer to the nasal epithelium of patients with cystic fibrosis. Nat Med
1995;1:39-46.
133. Hyde SC, Southern KW, Gileadi U. Repeate administration of DNA/
liposome to the nasal epithelium of patients with cystic fibrosis. Gene
Ther 2000;7:1156-65.
134. Noone PG, Hohnker KW, Zhou Z. Safety and biological efficacy of a
lipid-CFTR complex for gene transfer in the nasal epithelium of adult
patients with cystic fibrosis. Mol Ther 2000;1:105-14.
135. Nabel GJ, Nabel EG, Yang ZY. Direct gene transfer with DNA-
liposome complexes in melanoma: Expression, biological activity, and
lack of toxicity in humans. Proc Natl Acad Sci USA 1993;90:11307-11.
136. Nabel GJ, Gordon D, Bishop DK. Immune response in human
melanoma after transfer of an allogenic class I major histocompatibility
complex gene with DNA-liposome complexes. Proc Natl Acad Sci USA
1996;93:15388-93.
137. Felgner JH, Kumar R, Sridhar CN. Enhanced gene delivery and
mechanism studies with a novel series of cationic lipid formulations. J
Biol Chem 1994;269:2550-61.
138. Hofland HEJ, Shephard L, Sullivan SM. Formation of stable cationic
lipid/DNA complexes for gene transfer. Proc Natl Acad Sci USA
1996;93:7305-9.
139. Kang S-H, Zirbes EL, Kole R. Delivery of antisense oligonucleotides
and plasmid DNA with various carrier agents. Antisense Nucleic Acid
Drug Dev 1999;9:497-505.
140. Ellison KE, Bisphoric NH, Webster KA. Fusigenic liposome-mediated
DNA transfer into cardiac myocytes. J Mol Cell Cardiol 1996;28:1385-
99.
141. Simoes S, Slepushkin V, Gaspar R. Gene delivery by negatively
charged ternary complexes of DNA, cationic liposomes and transferin
or fusigenic peptides. Gene Ther 1998;5:955-64.
142. Shinmura K, Morishita R, Aoki M. Catheter-delivered in vivo gene
transfer into rat myocardium using the fusigenic liposomal mediated
method. Jpn Heart J 2000;41:633-47.
143. Compton SH, Mecklenbeck S, Mejia JE. Stable integration of large
(>100kb) PAC constructs in HaCa T keratinocytes using an integrin-
targeting peptide delivery system. Gene Ther 2000;7:1600-7.
144. Lappalainen K, Jaaskelainen I, Syrjanen K, Urtti A, Syrjanen S.
Comparison of cell proliferation and toxicity assays using two cationic
liposomes. Pharm Res 1994;11:1127-31.
145. Patil SD, Rhodes DG, Burgess DJ. Anionic liposomal delivery system
for DNA transfection. The AAPS Journal 2004;6:E29.
146. Dokka S, Toledo D, Shi X, Castranova V, Rojanasakul Y. Oxygen
radical-mediated pulmonary toxicity induced by some cationic
liposomes. Pharm Res 2000;17:521-5.
147. Filion MC, Philips NC. Toxicity and immunomodulatory activity of
liposomal vectors formulated with cationic lipids toward immune
effector cells. Biochim Biophys Acta 1997;1329:345-56.
148. Freimark BD, Blzinger HP, Florack VJ. Cationic lipids enhance
cytokine and cell influx levels in the lung following administration of
plasmid: Cationic lipid complexes. J Immunol 1998;160:4580-6.
149. Lee H, Williams SK, Allison SD, Anchordoquy TJ. Analysis of self-
assembled cationic lipid-DNA gene carrier complexes using flow field-
flow fractionation and light scattering. Anal Chem 2001;73:837-43.
150. Audouy S, Molema G, De Leij L, Hoekstra D. Serum as a modulator
of lipoplex-mediated gene transfection: Dependence of amphiphile cell
type and complex stability. J Gene Med 2000;2:465-76.
151. Liu F, Qi H, Huang L, Liu D. Factors controlling the efficiency
of cationic lipid-mediated transfection in vivo via intravenous
administration. Gene Ther 1997;4:517-23.
152. Wheeler CJ, Felgner PL, Tsai YJ. A novel cationic lipid greatly
enhances plasmid DNA delivery and expression in mouse lung. Proc
Natl Acad Sci USA 1996;93:11454-9.
153. Patil SD, Rhodes DG. Influence of divalent cations on the conformation
of phosphorothioate oligodeoxynucleotides: A circular dichroism study
Nucleic Acids Res 2000;28:2439-45.
154. Fillion P, Desjardins A, Sayasith K, Lagace J. encapsulation of DNA
September - October 2009 Indian Journal of Pharmaceutical Sciences
in negatively charged liposomes and inhibition of bacterial gene
expression with fluid-liposome encapsulated antisense oligonucleotides.
Biochim Biophys Acta 2001;1515:44-54.
155. Lakkaraju A, Dubinsky JM, Low WC, Rehman YE. Neurons are
protected from excitotoxic death by p53 antisense oligonuclotides
delivered in anionic liposomes. J Biol Chem 2001;276:32000-7.
156. Patil SD, Rhodes DG. Conformation of oligodeoxynucleotides
associated with anionic liposomes. Nucleic Acids Res 2000;28:4125-9.
157. Patil SD, Rhodes DG, Burgess DJ. Biophysical characterization of
anionic lipoplexes. Biochim Biophys Acta - Biomembranes 2005;7:E61-
77.
158. Lee RJ, Huang L. Lipidic vector systems for gene transfer. Crit Rev
Ther Drug Carrier Syst 1997;14:173-206.
159. Guo W, Gosselin MA, Lee RJ. Characterization of a novel diolein-
based LPD II vector for gene delivery. J Control Release 2002;83:121-
32.
160. Perrie Y, Gregoriadis G. Liposome-entrapped plasmid DNA:
Characterization studies. Biochim Biophys Acta 2000;1475:125-32.
161. Venugopalan P, Jain S, Sankar S, Singh P, Rawat A, Vyas SP. pH-
sensitive liposomes: Mechanism of triggered release to drug and gene
delivery prospects. Pharmazai 2002;57:659-71.
162. Maclean AL, Symonds G, Ward R. Immunoliposomes as targeted
delivery vehicles for cancer therapeutics. Int J Oncol 1997;11:325-32.
163. Legendre JY, Szoka FC Jr. Delivery of plasmid DNA into mammalian
cell lines using pH-sensitive liposomes: Comparision with cationic
liposomes. Pharm Res 1992;9:1235-42.
164. Reddy JA, Low PS. Enhanced folate receptor mediated gene therapy
using a novel pH-sensitive lipid formulation. J Control Release
2000;64:27-37.
165. Sviridov YV, Zhadanov RI, Podobed OV, Tsvetkova TA, Konstantinov
I, Bogdanenko EV. The LacZ gene transfer into L929 cells and [14C]-
DNA tissue distribution following intraperitoneal administration of new
pH-sensitive lipoplexes in mice. Cytobios 2001;106:7-14.
166. Xu L, Huang CC, Huang W. Systemic tumor-targeted gene delivery
by anti-transferrin receptor scFv-immunoliposomes. Mol Cancer Ther
2002;1:337-46.
167. Shi N, Zhang Y, Zhu C, Boado RJ, Pardridge WM. Brain-specific
expression of an exogenous gene after IV administration. Proc Natl
Acad Sci USA 2001;98:12754-9.
168. Khaw BA, da Silva J, Vural I, Narula J, Torchilin VP. Intracytoplasmic
gene delivery for in vitro transfection with cytoskeleton-specific
immunoliposomes. J Control Release 2001;75:199-210.
169. Krauss WC, Park JW, Kirpotin DB, Hong K, Benz CC. Emerging
antibody-based HER2 (ErbB- 2/new) therapeutics. Breast Disease
2000;11:113-24.
170. Schatzlein A. Nano-treatment to torpedo cancer. Available from: http://
news.bbc.co.uk/2/hi/health/7935592.stm. [cited in 2009 Mar 10].
171. James WB, Alexander JS, Susie SB, Scott R, Robert H, Kamaljit B,
et al. Effect of gene therapy on visual function in Leber’s congenital
amaurosis. N Engl J Med 2008;358:2231-9.
172. Albert MM, Francesca S, Aric AP, Edward NP, Federico M, Jeannette
B, et al. Safety and efficacy of gene transfer for Leber’s congenital
amaurosis. N Engl J Med 2008;358:2240-8.
173. Ben H. Doctors test gene therapy to treat blindness. Available from:
http://www.reuters.com/article/ scienceNews/idUSL016653620070501?
pageNumber=1/. [cited in 2007 May 1].
174. Scott M. Dual gene therapy suppresses lung cancer in preclinical test.
Available from: http://www.newswise.com/p/articles/view/526526/.[cited
in 2007 Jan 11].
175. Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC,
Sherry RM, et al. Cancer regression in patients mediated by transfer of
genetically engineered lymphocytes. Available from: http://www.cancer.
gov/newscenter/pressreleases/MelanomaGeneTherapy/. [cited in 2006
Aug 31].
176. Anil A. Undercover genes slip into the brain. Available from: http://
www.newscientist.com/section/science-news/. [cited in 2003 Mar 22].
177. Bob H. Gene therapy may switch off Huntington’s. Available from:
497
 www.ijpsonline.com

http://www.newscientist.com/section/ science-news/. [cited in 2003 Mar
13].
178. Danny P. Subtle gene therapy tackles blood disorder. Available from:
http://www.newscientist.com/section/ science-news/. [cited in 2002 Oct
11].
179. Emma Y. ‘Miracle’ gene therapy trial halted. Available from: http://
www.newscientist.com/section/science-news/. [cited in 2002 Oct 3].
180. Sylvia PW. DNA nanoballs boost gene therapy. Available from: http://
www.newscientist.com/section/science -news/. [cited in 2002 May 12].
181. Jennifer FW. Murine Gene Therapy Corrects Symptoms of Sickle Cell
Disease. The Scientist 2002;16:36. Available from: http://www.the-
scientist.com. [cited in 2002 Mar 18].
Accepted 12 September 2009
Revised 25 August 2009
Received 08 February 2008
Indian J. Pharm. Sci., 2009, 71 (5): 488-498

498 Indian Journal of Pharmaceutical Sciences September - October 2009

Published by Oxford University Press on behalf of the International Epidemiological Association International Journal of Epidemiology 2012;41:177–187
ß The Author 2012; all rights reserved. Advance Access publication 28 January 2012 doi:10.1093/ije/dyr232

Epigenetics, epidemiology and mitochondrial

DNA diseases
Patrick F Chinnery,1* Hannah R Elliott,1 Gavin Hudson,1 David C Samuels2 and Caroline L Relton1
1
Institute of Genetic Medicine, Newcastle University, Newcastle upon Tyne, NE1 3BZ, UK and 2Center for Human Genetics
Research, Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, TN, USA
*Corresponding author. Mitochondrial Research Group, Institute of Genetic Medicine, Newcastle University, Newcastle upon Tyne,
NE1 3BZ, UK. E-mail: patrick.chinnery@ncl.ac.uk

Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024

Accepted 19 December 2011
Over the last two decades, the mutation of mitochondrial DNA
(mtDNA) has emerged as a major cause of inherited human dis-
ease. The disorders present clinically in at least 1 in 10 000 adults,
but pathogenic mutations are found in approximately 1 in 200 of
the background population. Mitochondrial DNA is maternally in-
herited and there can be marked phenotypic variability within the
same family. Heteroplasmy is a significant factor and environmen-
tal toxins also appear to modulate the phenotype. Although genetic
and biochemical studies have provided part of the explanation, a
comprehensive understanding of the incomplete penetrance of
these diseases is lacking—both at the population and family
levels. Here, we review the potential role of epigenetic factors in
the pathogenesis of mtDNA diseases and the contribution that epi-
demiological approaches can make to improve our understanding in
this area. Despite being previously dismissed, there is an emerging
evidence that mitochondria contain the machinery required to epi-
genetically modify mtDNA expression. In addition, the increased
production of reactive oxygen species seen in several mtDNA dis-
eases could lead to the epigenetic modification of the nuclear
genome, including chromatin remodelling and alterations to DNA
methylation and microRNA expression, thus contributing to the
diverse pathophysiology observed in this group of diseases. These
observations open the door to future studies investigating the role
of mtDNA methylation in human disease.
Keywords DNA methylation, epigenomics, mitochondrial diseases, mtDNA,
mitochondrial

Introduction complexes I and II. Electron flux through the respira-

Mitochondrial biogenesis
Mitochondria are the primary source of intracellular
energy in the form of adenosine triphosphate (ATP).
ATP is synthesized by more than 100 proteins orga-
nized into five respiratory chain complexes on the
inner mitochondrial membrane. Reduced cofactors
generated from the intermediary metabolism of carbo-
hydrates, proteins and fats donate electrons to
tory chain is linked to the expulsion of protons from
within the mitochondrial matrix into the
inter-membrane space. This generates an electro-
chemical gradient that is harnessed by complex V
(ATP synthase) to synthesize ATP. ATP is required
for all active cellular processes, from the maintenance
of ionic gradients across cell membranes to muscle
contraction, so a deficiency of ATP synthesis can

177
178 INTERNATIONAL JOURNAL OF EPIDEMIOLOGY

have catastrophic effects for the cell, organ and

individual.1
The mitochondrial respiratory chain has a dual gen-
etic origin. Thirteen key proteins are synthesized from
multiple copies of circular double-stranded DNA pre-
sent within each mitochondrion: the mitochondrial
genome or mtDNA. mtDNA also codes for 24 RNA
genes that are required for intra-mitochondrial pro-
tein synthesis.2 However, the vast majority of respira-
tory chain components and proteins required for the
synthesis, expression and regulation of mitochondrial
genes are encoded by the cell nucleus.3 Efficient mito-
chondrial function is thus critically dependent on the
concerted action of two genomes, and mitochondrial

Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024

diseases can be due to mutations of either nuclear
DNA or mtDNA (Figure 1).4 This review will focus
on mtDNA and disease, although some of the down-
stream consequences could equally apply to mito-
chondrial disorders due to primary nuclear gene
defects, especially if these are mediated through sec-
ondary mtDNA damage.

MtDNA and human diseases

Human mtDNA was first sequenced in 1981,2 and the
first pathogenic mutations were identified <10 years
later.5,6 More than 200 different molecular defects
have subsequently been described in patients with
mitochondrial diseases.7 Point mutations can affect
the various structural subunits of the respiratory
chain, or compromise protein synthesis through the
RNA genes. Alternatively, large-scale deletions of
mtDNA remove one or more essential genes.
Duplications of mtDNA have been described in asso-
ciation with mtDNA deletions, but it remains unclear
whether they cause a biochemical defect.8
There are three major differences between mtDNA
and nuclear DNA, which are relevant for our under-
standing of human disease. First, mammalian cells
contain many copies of mtDNA, ranging from a few
hundred to hundreds of thousands, depending on the
cell type. Although the amount of mtDNA appears to
be tightly regulated in a tissue-specific manner, this
can change over time through poorly understood
regulatory mechanisms.9 Secondly, pathogenic muta-
tions can affect a varying proportion of the many
mtDNA molecules—from 1% to 100%, and every pos-
sibility in between. This situation is known as hetero-
plasmy. The percentage level of the mutation can vary
from person to person and even between adjacent
cells within the same individual.10 Cells that contain
a high percentage level of mutant mtDNA express a
biochemical defect. This is often associated with a
reduced amount of wild-type mtDNA.11 Tissue and
organs that contain many affected cells lead to the
clinical features of disease. Thirdly, for all practical
purposes, mtDNA is exclusively inherited down the
maternal line.12 This means that men with mtDNA
disease cannot pass on the disorder to their offspring.
Women harbouring heteroplasmic mtDNA mutations
Figure 1 A schematic representation of mitochondrial and
nuclear genomes and their inter-relation with epigenetic
factors. The nuclear genome is coiled around histone octa-
mers to form nucleosomes. The tails of histone proteins are
decorated with a variety of modifications that influence the
regulation of gene expression. Permissive histone markings
allow transcription from DNA to RNA, post-transcription
processing to mRNA and translation to polypeptides and
thus proteins. Nuclear-encoded mitochondrial proteins are
then translocated into the mitochondrion. mtDNA also en-
codes genes essential for intra-mitochondrial protein syn-
thesis, but this genome is not histone bound. In addition to
mRNA, miRNA are also transcribed from nuclear DNA and
can interfere with mRNA to induce degradation or suppress
translation. miRNAs can influence mitochondrial metabol-
ism and some miRNAs are known to directly activate the
generation of ROS. Furthermore, miRNAs influence the
expression of DNMT and HDAC enzymes. ROS produced by
mitochondria or other endogenous sources can damage the
mtDNA genome directly as well as influence epigenetic
machinery at several levels, either through damage to
miRNA or through the alteration of histone modifications.
DNMTs translocate to the mitochondria and bind to
mtDNA, although evidence that this is to effect epigenetic
regulation remains elusive. HDAC, histone deacetylase;
mRNA, messenger RNA; ROS, reactive oxygen species
pass on very different levels of mutation to each of
their children. This occurs because only a small group
of maternal mtDNA is transmitted to the offspring
(the mtDNA genetic bottleneck),13,14 which leads to
a statistical sampling effect and rapid shifts in the
heteroplasmy level within a single generation.
A further consequence of strict maternal transmis-
sion is that the mtDNA undergoes negligible inter-
molecular recombination at the population level.15
As a result, mtDNA in the human population has

acquired polymorphic variants that subdivide the
population into geographical clusters.16 The major
clusters are called mtDNA haplogroups. There is
emerging evidence that these haplogroups have
subtle biochemical consequences,17 providing a poten-
tial explanation for the genetic association of common
polymorphic variants of mtDNA with complex com-
mon human diseases such as ischaemic stroke, dia-
betes and Parkinsons disease (reviewed in ref. 17).17
Although contentious, these polymorphic variants
may also have shaped human evolution in response
to the environment.18
Unanswered questions
Although phenotypic heterogeneity of primary mtDNA
diseases can be partly explained by differences
in mtDNA heteroplasmy, several major questions
remain unanswered. For some common mtDNA dis-
eases, all maternal relatives carry only the mutated
mtDNA—a situation known as ‘homoplasmic mutant’.
Leber hereditary optic neuropathy (LHON) is a
common cause of inherited visual failure.19 In Euro-
peans, LHON is primarily due to one of three patho-
genic mutations of the mtDNA: m.11778G4A;
m.3460G4A; m.14484T4C, which are found in 490%
of the affected individuals.20 The disease is maternally
transmitted and typically presents in young adult life
with sequential painless visual loss, but only 40% of
the men and 10% of the women become affected,
despite all usually being homoplasmic for the causa-
tive mtDNA mutation.21 Several additional factors
have been implicated in the pathophysiology, includ-
ing the background mtDNA haplogroup,22 which ap-
pears to involve epistatic effects through common
polymorphisms in the mtDNA cytochrome b
gene.23,24 Cigarette smoking and alcohol intake are
the major risk factors for the visual loss in LHON
families,25 and nuclear genetic mapping studies impli-
cate interacting nuclear genes.26,27 Finally, the homo-
plasmic mutations that cause LHON are found in
approximately 1 in 300 of the background popula-
tion,28 but only cause blindness in approximately 1
in 20 000.29 LHON can therefore be considered as a
complex disease trait, with several genetic and envir-
onmental factors interacting to cause the disease.
Other examples include the m.1555A4G mutation
that causes isolated (non-syndromic) deafness both
spontaneously and in response to environmental
exposure to aminoglycoside antibiotics.30 Again, the
m.1555A4G mutation is found in approximately 1 in
300 of the population.28 These, and other examples,
highlight a recurring theme: that homoplasmic
mtDNA mutations are present in control subjects,
only rarely cause disease and most strikingly cause
tissue-specific phenotypes that differ from mutation
to mutation. The reasons for the variable penetrance
and tissue specificity are not known, and could well be
due to the epigenetic modification of the mitochon-
drial genome, which influences intra-mitochondrial
EPIGENETICS, EPIDEMIOLOGY AND MTDNA 179
transcription or nuclear genes known to influence or
modulate mitochondrial function.
Could epigenetic mechanisms involving
mtDNA provide the answer?
Evidence for mtDNA associated changes in DNA
methylation
MtDNA molecules are arranged in clusters, called
nucleoids, which are tethered to the mitochondrial
membrane and devoid of histones.9,31 Based on
early experimental evidence in frogs and HeLa
cells,32 the prevailing view has been that mitochon-
dria lack the machinery required for DNA methyla-
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
tion. However, several strands of evidence suggest
that this is not the case. Bioinformatic analysis
across several species shows a lower frequency of
CG dinucleotides than would be expected by chance
(Figure 2a), implying a selective force acting against
CpG sites in mtDNA. For comparison, the CpG frac-
tion in the human nuclear genome is only 25% of the
expected frequency, but this rises to 45% in exons.33
Secondly, the distribution of CpG sites is not even
across the human mtDNA sequence (Figure 2b),
with a low frequency in tRNA genes and a high fre-
quency in OL, the origin of mtDNA light strand rep-
lication. This raises the possibility that the
methylation of OL could influence mtDNA replication.
The location of the 435 predicted CpG sites present in
the mitochondrial genome is shown in Figure 3. It
can be seen that the CpG sites appear to cluster,
and when considered in relation to the 3358 poly-
morphic variants in the mitochondrial genome, more
than half of the CpG sites in the mitochondrial
genome co-locate with polymorphic variants. These
observations clearly require further investigation.
Patterns of mtDNA methylation were first described
in the mouse in the early 1980s,34 but at very low
levels (<5%). These data comprised a ‘global’ measure
of DNA methylation but without single base pair
resolution, which is now far more tractable following
recent technical developments. More recently, several
key regions involved in the regulation of mtDNA gene
expression were shown to be relatively protected from
methylation in vitro within cultured human cell
lines.35 Intriguingly, these regions included OL, des-
pite the high CpG content. Inducing mtDNA tran-
scription appeared to decrease in vivo methylation,
whereas inducing mtDNA replication led to increased
methylation. The relatively low level of mtDNA
methylation under standard cell-culture conditions
could be related to the structural arrangement of
mtDNA within nucleoids and associated nucleoid
proteins.35
Finally, DNA methyltransferase 1 (DNMT1) has re-
cently been shown to translocate into mitochondria
through a mitochondrial targeting pre-peptide se-
quence found upstream of the mature peptide,
enabling direct access to mtDNA.36 DNMT1 binds to
the mtDNA within the mitochondrial matrix, and the
180 INTERNATIONAL JOURNAL OF EPIDEMIOLOGY
Figure 2 The distribution of CpG sites in mtDNA. (a) The
observed frequencies of the 16 dinucleotides divided by the
expected frequencies for a random sequence based on the
individual nucleotide frequencies. Values are plotted for the
human mtDNA sequence plus 60 other mammalian species.
(b) The density of the CpG sites in different sections of the
human mtDNA sequence (rCRS), normalized by the average
density of 0.026 per site. P-values are calculated by
chi-square tests with Yates correction. OL and OH locations
were taken from the mtDNA function locations list at
MITOMAP (www.MitoMap.org) without alteration. OL was
defined as 5721–5798 and OH was defined as 110–441
level of intra-mitochondrial DNMT1 is up-regulated by
genes known to regulate mitochondrial biogenesis,
including NRF1 and PGC1 .36 There, therefore, ap-
pears to be a mechanism in place to enable the regu-
lation of intra-mitochondrial gene expression through
the methylation of mtDNA cytosine residues.
A key observation is the modulation of mtDNA
methylation in response to oxidative stress. The in-
duction of reactive oxygen species (ROS) with sub-
lethal doses of H2O2 has been shown to decrease
mtDNA methylation (although it is also possible
that nucleoids remodel into a more compact state dur-
ing oxidative stress to provide a more insulated envir-
onment for mtDNA).35 Although controversial, there
is evidence implicating increased ROS production in
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
Figure 3 The location of CpG sites in the mitochondrial
genome relative to mitochondrial haplogroup defining
polymorphisms. The image shows the mitochondrial
genome (centre), showing the position and relative size of
each of the 13 major mitochondrial genes, the origins of
heavy-strand and light-strand replication (OH and OL, re-
spectively) as well as both the light-strand and heavy-strand
promoter sites (PL and PH, respectively). Shown in the
middle (in red) are the relative frequencies and positions of
3358 mtDNA variants (MAF ¼ 0.01–49.6% of 2147 full
European mtDNA sequences). The outer ring (in black)
shows the relative position of each of the 435 predicted CpG
sites
mtDNA diseases,1 raising the possibility that the sup-
pression of mtDNA methylation acts as a compensa-
tory response to mtDNA damage, thus increasing gene
expression from residual intact mtDNA molecules.
Furthermore, the influence of endogenous exposures,
including ROS, has also been implicated in mitochon-
drial disease due to nuclear gene as well as mtDNA
defects.37,38 The altered DNA methylation of the
nuclear genome could therefore mediate the down-
stream consequences of pathogenic mtDNA mutations
through hitherto unknown pathways, perhaps not
directly related to ATP synthesis, nor indeed even dir-
ectly related to mitochondrial function. If correct,
then the tissue-specific expression of nuclear genes
could contribute to the tissue selectivity in mtDNA
diseases, and a variable epigenetic signature could ex-
plain the phenotypic variability of mitochondrial
disorders.
In keeping with these hypotheses, recent evidence
using an agnostic global assessment of DNA methy-
lation showed that cells deplete in mtDNA showed
altered DNA methylation of the nuclear genome,
which was rescued upon the repletion of mtDNA—
implicating the mitochondrion as an important deter-
minant of epigenetic status.36 This raises the

possibility that the increased ROS production in
mitochondrial diseases downregulates nuclear–
mitochondrial genes, further compromising respira-
tory chain activity. This would establish a vicious
cycle, generating further ROS and ultimately leading
to bio-energetic failure.
Figure 4 provides a preliminary appraisal of the level
of variation in DNA methylation in CpG island probes
in nuclear-encoded mitochondrial genes in a group of
24 normal individuals free of mitochondrial disease.
Array probes were assigned to ‘non-mitochondrial’
or ‘mitochondrial’ groups based on the CpG location.
Mitochondrial gene IDs were extracted from the
MitoProteome resource (www.mitoproteome.org)
and matched to gene IDs on the methylation array.
More than half (85%) of the gene IDs extracted from
mitoproteome were present on the methylation array.
It should also be noted that the non-mitochondrial
group is likely to include a number of probes targeting
proteins of unknown function and cellular location
that target the mitochondria. A total of 1239 mito-
chondrial probes and 26 339 non-mitochondrial
probes were analysed. One thousand and forty-two
mitochondrial probes and 18 964 non-mitochondrial
probes were located in CpG islands. Mitochondrial
probes were preferentially located within CpG islands
compared with non-mitochondrial probes (Fisher’s
exact P ¼ 1.058e22). Outside CpG islands, there was
no difference in methylation level between mitochon-
drial and non-mitochondrial genes. However, within
CpG islands, mitochondrial probes had lower levels
of methylation than non-mitochondrial probes.
Mitochondrial median (IQR) was 8.4 (6.5–13.7) and
Figure 4 DNA methylation levels in nuclear-encoded
mitochondrial genes in a control population. Twenty-four
healthy female adult samples were analysed for
genome-wide methylation using IlluminaÕ
HumanMethylation27 arrays. Probes were assigned to
‘non-mitochondrial’ or ‘mitochondrial’ groups as described
in the main text. Histogram shows the DNA methylation
distribution of CpG island probes assigned to
non-mitochondrial or mitochondrial groups
EPIGENETICS, EPIDEMIOLOGY AND MTDNA 181
non-mitochondrial median (IQR) was 9.7 (6.7–18.5),
with P ¼ 2.967e09. These observations relate to DNA
methylation patterns in peripheral blood cells and
may conceivably differ in other tissues, perhaps re-
flecting metabolic activity.
Since there is a general trend between the methy-
lation and level of transcription, this observation sug-
gests that nuclear mitochondrial genes might be more
actively expressed than their non-mitochondrial gene
counterparts. Further analysis of functional groupings
of genes could provide evidence of coordinated regu-
lation mediated through epigenetic mechanisms.
Direct measurement of methylation in different
regions of the mtDNA would also give further insight;
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
this is the focus of future work. Knowledge of mtDNA
methylation and DNA methylation of nuclear mito-
chondrial genes may play an important role in the
future epidemiological understanding of mitochon-
drial disorders.
A link between mitochondrial function and nuclear
DNA histone modifications
Histones are nuclear proteins around which the
nuclear DNA is wound. Nucleosomes are formed
from assembled groups of histones, and these nucleo-
somes are able to fold and wind into a higher order
structure. Histones and DNA that have assembled into
a condensed higher order structure form chromatin.
Histones can be modified by a number of post-
transcriptional modifications including acetylation,
phosphorylation, ubiquitination and methylation.
These modifications change their ability to regulate
or repair cellular processes. In general, DNA that is
less bound to histones is more transcriptionally active
than DNA that is bound.39
Although the mtDNA is known for its lack of pro-
tective histones (one of the reasons why mtDNA
mutations are relatively common), there is evidence
that some types of histones localize to the mitochon-
drial membrane.40 However, these levels are recorded
at much lower levels than in the nucleus. In the nu-
clear DNA, histone modifications are important in
transcriptional control. They can become altered in
diseases affecting nuclear-encoded mitochondrial pro-
teins, of which Friedreich ataxia is an example. This
disorder is caused by transcriptional silencing of the
FXN gene, which encodes a mitochondrial protein
involved in biosynthesis of iron–sulphur clusters.
It is characterized by a tri-nucleotide expansion,
which leads to the formation of densely packed
heterochromatin. The possibility of using histone dea-
cetylase inhibitors in the treatment of this disorder is
being investigated.41 The role of histone modifications
in the transcriptional regulation of other nuclear
mitochondrial genes warrants further attention.
MicroRNA and the mitochondrion
MicroRNAs (miRNAs) are highly conserved, 21-mer,
non-coding RNAs and are important regulators of
182 INTERNATIONAL JOURNAL OF EPIDEMIOLOGY
gene expression in human cells. Post-transcriptional
regulation by miRNAs has been reported in numerous
diseases, particularly in cancer.42 An explosion of
interest has led to more than 1000 mammalian
miRNAs being described. Following transcription
and a number of processing steps, mature miRNAs
regulate gene expression by binding to target
mRNAs, usually in the 3’-untranslated regions.
miRNAs may elicit their effect through a number of
routes, most commonly via the targeting of mRNA for
degradation or by suppression of mRNA translation.
The mechanisms of maturation and action of
miRNAs have been reviewed elsewhere.43 miRNAs
are important regulators of cellular function, and
since their effect is not part of the transcriptional ma-
chinery, they are able to quickly alter the cell’s ability
to translate mRNA in response to the surrounding
cellular environment. In the case of an mtDNA dis-
order, the immediate cellular environment may be
altered, hypothetically causing an miRNA-mediated
response.
Although there is no evidence, to date, to demon-
strate that mitochondrial disorders directly affect
miRNA expression, an increasing number of
miRNAs has been shown to be involved in the regu-
lation of mitochondrial metabolism. For example,
miR-210 is postulated to target both units of the elec-
tron transport chain and tri-carboxylic acid cycle,
reducing the rate of mitochondrial metabolism.44
Evidence suggests that another miRNA, miR-30, regu-
lates mitochondrial fission.44,45 In rats, it has been
postulated that a small pool of miRNAs is associated
with the mitochondria; these miRNAs appear to
modulate the expression of genes associated with
apoptosis, cell proliferation and differentiation.46
Many of these pathways are associated with re-
sponse to environmental stress such as hypoxia
and may lead to downstream ROS production. As
described earlier, this can affect other epigenetic
marks including methylation. Furthermore, a
number of miRNAs (including miR-210 and
miR-128a) are known to activate the generation of
ROS directly.44,47
To highlight the complexity and inter-related
nature of epigenetic regulation, recent studies have
demonstrated that DNA methylation and histone
modification not only regulate the expression of
miRNA genes but these marks are themselves regu-
lated by some miRNAs.48 A subset of miRNAs influ-
ences the expression of DNA methyltransferases and
histone deacetylases.49,50 Thus, it could be envisaged
that, for example, ROS-induced alteration of DNA
methylation patterns in the nuclear genome might
alter miRNA expression and this, in turn, could
impact upon other aspects of epigenetic regulation
and ultimately, possibly pleiotropically, upon disease
phenotype. Such complex interaction of epigenetic
regulation, however, is not unique to mitochondrial
disease.
Epidemiological approaches applicable to
investigating epigenetic variation in the
context of mitochondrial diseases
Conventional epidemiological study designs can be
applied to investigate the role of epigenetic variation
in relation to a variety of intermediate phenotypes
or diseases,51 including mitochondrial disease.
Epigenetic variation can be considered as a continu-
ous variable or phenotype and analysed using stand-
ard epidemiological methods, although with some
caveats relating to the largely non-normal distribution
of epigenetic data. Selecting the most appropriate
study design requires consideration not only of epi-
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
genetic phenomena but also of the idiosyncrasies of
mitochondrial genetics and the inheritance patterns of
mitochondrial diseases.
A case–control study design would allow the com-
parison of epigenetic patterns in subjects with mito-
chondrial disease and those without clinical signs of
disease and ideally without disease-causing mitochon-
drial mutations. Family-based studies, including trios
of mother, father and child, probably offer the most
powerful design to interrogate the relationship be-
tween epigenetic variation and mitochondrial disease,
this design having been widely used in the study of
mitochondrial diseases, given their maternal inherit-
ance patterns.52 The use of paternal controls has been
advocated in conventional epidemiological investiga-
tions when assessing maternal in utero effects.53 For
example, assessing the relationship of maternal smok-
ing and offspring birthweight and then comparing
this with paternal smoking and offspring birthweight
will give some indication of likely confounding.
Similar risk estimates from both paternal and mater-
nal analyses would be suggestive of confounding, as
maternal smoking, if a causal biological birthweight-
reducing mechanism, should have a much larger
influence than paternal smoking.
Epigenetic modifications have inherent features that
must be considered in designing epidemiological stu-
dies. Epigenetic patterns change over time with a high
degree of plasticity in early life and stochastic,
age-related loss of fidelity in older age.54 Therefore,
any cross-sectional appraisal, for example, of DNA
methylation could only be confidently associated
with any specific outcome at the time of sampling.
This, however, should not detract from the potential
utility of epigenetic marks as diagnostic or prognostic
biomarkers. Serial sampling or longitudinal study de-
signs can overcome some of these limitations. Unlike
genetic epidemiology, which is robust to the vagaries
of confounding and reverse causation that plague
conventional observational epidemiology, epigenetic
epidemiology is not. Potential confounders such as
age, smoking and diet should be routinely considered
in epigenetic studies for this reason.
Numerous environmental factors are known to
impact upon the epigenome;55 indeed, this has fuelled
interest in epigenetics as a biological mechanism

mediating environmental influences on complex dis-
ease risk,56 including mitochondrial diseases. As men-
tioned earlier in the context of LHON, environmental
factors of particular relevance to the aetiology of mito-
chondrial diseases include smoking and alcohol
intake.
For the reasons outlined in the introduction, further
complexity arises when studying the potential role
of the epigenetic modification of mtDNA in mitochon-
drial diseases. Different levels of heteroplasmy7—both
within and between individuals—and the influence of
background polymorphic variation (haplogroups)24
confound the relationship between mtDNA genotype
and clinical phenotype for common pathogenic
mtDNA mutations. The factors must be accounted
for in any epidemiological approach.
Methods of measuring epigenetic variation
relevant to investigating mitochondrial
diseases
Technologies available for the analysis of epigenetic
variation have undergone rapid development in
recent years, harnessing the methodological advances
from the broader field of genomics. The highly
detailed annotation of nuclear genome-wide DNA
methylation is now a realistic proposition,57,58 and
less detailed, high-throughput appraisal of genome-
wide DNA methylation is a cost-effective approach
to highlight areas of differential nuclear DNA methy-
lation.59 A wide repertoire of techniques is available
to quantify DNA methylation, assess histone modifi-
cations or measure miRNA expression levels in the
context of nuclear DNA (reviewed in detail else-
where),60 and could be applied to investigate the
influence of mitochondrial dysfunction on the nuclear
epigenome.
DNA from peripheral blood samples is frequently
used in population-based studies, primarily due to
its ease of collection and storage. The suitability of
using DNA from peripheral blood for analysing DNA
methylation has been questioned, especially since the
DNA methylation pattern may not be representative
of the disease-relevant target tissue. Measuring DNA
methylation in blood has recently been reviewed.61
Additionally, DNA methylation is known to vary be-
tween blood cell types, further complicating ana-
lysis.62,63 However, DNA methylation variation in
peripheral blood has been proposed as a marker for
a number of cancers63,64 and complex diseases includ-
ing type 2 diabetes.65 More recent studies have begun
to account for blood-cell type differences.63,65The
tissue-specific nature of epigenetic patterns may
hold additional relevance for mitochondrial studies,
where the heteroplasmic load of mtDNA mutations
varies between tissues59 and peripheral blood DNA
might only be appropriate to analyse if heteroplasmy
levels reflect those of the relevant target tissue.
Some of the approaches that can be readily applied
to the direct analysis of mtDNA are summarized
EPIGENETICS, EPIDEMIOLOGY AND MTDNA 183
below. These are not intended to be exhaustive,
merely illustrative.
Bisulphite sequencing
The bisulphite modification of DNA forms the basis of
a number of methods to detect and quantify the level
of methylation in a given sample, including bisulphite
sequencing. The bisulphite modification of DNA pro-
vides a way of differentiating between cytosine bases
in CpG sites that are methylated and those which are
not. Methylated cytosine bases have a methyl group
bound to the carbon-5 position of their pyrimidine
ring. During bisulphite treatment, 5-methylcytosine
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
(5-mC) residues are protected, but cytosine residues
that are unmethylated are converted to uracil.
Although widely used, bisulphite treatment denatures
a high proportion of the template DNA, thus reducing
the number of longer length templates for down-
stream applications. The availability of longer frag-
ments has been studied in depth.66 Despite this
length limitation, a number of downstream methods
can be employed to measure how much of the
original template was methylated. The simplest of
these methods is sequencing of the bisulphite-
modified DNA. Bisulphite sequencing is a well-
established method, is able to assess single CpG
sites and is relatively quick to perform, and is a
tractable undertaking in the context of the 16 kb
mitochondrial genome. However, it does not allow
the percentage methylation at a given site to be quan-
tified. During sequencing, methylated and unmethy-
lated bases are differentiated on the basis of detecting
a cytosine or thymidine base at a given CpG site.
More recently, second-generation sequencing has
been used to quantify methylation state at high reso-
lution;57,67 this approach could also be utilized in the
quantification of methylation in the mitochondrial
genome.
It is worth noting that bisulphite modification does
not differentiate between 5-mC and 5-hydroxy-
methylcytosine (5-hmC), which occurs when a
methyl group followed by a hydroxyl group is added
to a cytosine residue. The existence of 5-hmC to date
has been reported in the brain and ES cells, but it is
unknown whether this form of covalent epigenetic
modification occurs in mtDNA. The relative biological
roles of 5-mC and 5-hmC have been described.68
5-hmC has also been shown to be involved in mam-
malian transcriptional regulation.69 To measure the
contribution from each of these methylation species,
another method should be used, for example, methy-
lated DNA immunoprecipitation (MeDIP) using anti-
bodies to 5-mC or 5-hmC. Platforms are now coming
online that have the capability to undertake single
molecular, real-time sequencing that can distinguish
between 5-mC and 5-hmC. For example, the Pacific
Biosciences PACBIO RS platform and Helicos
BioSciences Corporation’s Genetic Analysis platforms
currently lead the way in this area.
184 INTERNATIONAL JOURNAL OF EPIDEMIOLOGY
PyrosequencingÕ
PyrosequencingÕ is a sequence by synthesis method
to detect the methylation of CpG sites over a short
region of DNA, typically between 50 and 100 bp in
length.
It uses a bisulphite-modified DNA template,
from which amplicons are generated in a standard
polymerase chain reaction (PCR) using a biotin-
labelled primer. A sequencing primer is annealed to
single-stranded PCR amplicons and incubated with a
cocktail of enzymes and substrates. During this
sequencing by synthesis method, deoxyribonucleotide
triphosphates (dNTPs) are added sequentially to the
template, and light produced in the luciferase-
catalysed reaction is recorded. The light detected is
proportional to the number of nucleotides incorpo-
rated. By recording the signal from the incorporation
of C or T dinucleotides at a CpG site, the site-specific
percentage of methylated DNA template can be quan-
tified. This method has been reported to have a de-
tection limit of 2–5%.70 PyrosequencingÕ has been
widely used as a method for detecting methylation.
Drawbacks include the low to medium throughput
(96-well plates) and the small number of CpG sites
that can be investigated in one read, thus requiring
multiple amplicons to cover a sizeable region.
SequenomÕ EpiTYPERÕ
The EpiTYPERÕ platform, as with PyrosequencingÕ ,
relies on the initial generation of bisulphite-modified
DNA and measures DNA methylation. Modified DNA
is amplified by PCR using primers designed to target
the region of interest, then is subjected to in vitro
transcription. This step generates a single-stranded
RNA molecule that is cleaved in a base-specific
manner. The resulting fragments are analysed by
matrix-assisted laser desorption ionization time-of-
flight mass spectrometry (MALDI-TOF MS). This
method is rapid and high throughput. Small amounts
of input DNA are required (10–20 ng) and CpG
methylation in up to 400 bases can be detected. The
detection limit of the method is 5%,71 although
some reports suggest it is slightly lower at 3%.72
One of the main drawbacks of this method is that
CpG sites in close proximity to each other are often
not resolved following RNA cleavage. This results in
CpG methylation values that are averages of a pair or
group of CpG sites. Overlapping and duplicated sig-
nals arising from fragments of the same mass also
complicate analysis. However, this method has been
used widely to measure methylation in genomic DNA
and could be used in future to assess mtDNA
methylation.
Whole-genome methylation arrays
Whole-genome DNA methylation arrays have been
developed, which allow high throughput analysis of
DNA methylation, the most recent of which is the
IlluminaÕ HumanMethylation450 BeadChip.73 This
array utilizes beads with target-specific probes to
measure methylation at individual CpG sites.
Although none of these probes anneal to mtDNA, a
number of them bind nuclear targets that are import-
ant for mitochondrial function (as discussed earlier).
Chromatin modifications
As described earlier, mtDNA lacks protective histones
and so cannot condense to form nucleosomes.
Instead, mtDNA is packaged with proteins to form
nucleoids. Protein–DNA interactions are commonly
analysed by chromatin immunoprecipitation (ChIP)
followed by a further downstream analysis of the ex-
tracted DNA (and protein).74 mtDNA-packaging pro-
teins such as Abf2 have also been successfully
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
characterized using ChIP-like procedures.75
miRNA expression
Expression of characterized miRNAs can be measured
using array-based methods, which are currently able
to measure in the region of 1100 human miRNAs.76,77
Quantitative PCR methods are also commonly used,
either in profiling miRNAs using one of a number of
commercially available panels or in analysis of single
miRNAs.77 RNA is typically extracted from tissue or
cells with enrichment for small RNA molecules.78
Following the identification of miRNAs, which have
altered expression, the downstream evaluation of
target gene expression in putative miRNA targets
can be employed.
Transcriptome sequencing
Relative transcript abundance (between individual
tRNAs, mRNAs and rRNAs), RNA variation and
post-translational modification can be investigated
by using next-generation sequencing (NGS) of puri-
fied mitochondria RNA. By marrying the depth of
NGS, by resequencing a relatively small genome,
with parallel analysis of RNA ends (PARE), the
global schema of polycistron cleavage can be
investigated.79
Summary and future direction
In summary, there is a strong motivation to explore
the role of epigenetic mechanisms in mtDNA disease,
as epigenetic factors may serve to explain the
observed phenotypic heterogeneity, variable pene-
trance and pronounced environmental triggers in
this group of disorders.
Epidemiological approaches can contribute to know-
ledge and understanding in this nascent field, as they
have done in defining the prevalence of pathogenic
mtDNA mutations in the general population.28 Well-
characterized patient populations, including the de-
tailed information of polymorphic variation in the
mitochondrial genome and haplogroup categories,
will greatly assist in this endeavour, as epigenetic
variation can not only be investigated in relation to
the presence or absence of clinically diagnosed disease
status but can also probe the relationship between the
mitochondrial genome, epigenetic signatures and a
 EPIGENETICS, EPIDEMIOLOGY AND MTDNA 185

multitude of phenotypic traits. Furthermore, the
evolutionary role of CpG sites in the mitochondrion
remains unexplored and the epidemiological investi-
gation of their distribution at a population level may
well provide insight into the processes of mitochon-
drial genetic selection.
Technologies are now available to directly assess
epigenetic variation in both the mitochondrial and
nuclear genome in relation to mitochondrial disease.
The challenge remains, should correlative observa-
tions be made, to discern whether these are causal
in the pathogenesis of mitochondrial disease itself,
in a broader array of common complex diseases in
which mitochondrial dysfunction has been implicated,
receives funding from the Medical Research Council
(UK), the Association Française contre les Myopathies
and the UK NIHR Biomedical Research Centre for
Ageing and Age-related Disease award to the
Newcastle upon Tyne Foundation Hospitals NHS
Trust. H.R.E. is a UK Medical Research
Council-funded postdoctoral fellow and G.H. is a
Wellcome Trust-funded postdoctoral fellow. D.C.S. is
supported by a National Institute of Health/National
Institute of General Medical Sciences grant
R01GM073744. C.L.R. receives funding from the
Medical Research Council (MRC), Biotechnology and
Biological Sciences Research Council (BBSRC),

Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024

Wellcome Trust and numerous charitable sources.
or whether such associations are non-causal
epiphenomena.

Funding
P.F.C. is a Wellcome Trust Senior Fellow in Clinical
Science and a UK National Institute for Health
Research (NIHR) Senior Investigator who also
Acknowledgements
Professor Debbie Lawlor is gratefully acknowledged
for use of IlluminaÕ HumanMethylation27 BeadChip
data generated as part of a Wellcome Trust-funded
project she leads.

KEY MESSAGES
 Mitochondrial DNA mutations cause disease that is often influenced by environmental factors and
that is characterized by variable penetrance.
 Epigenetic mechanisms may play a role at multiple levels: within the mitochondrial genome itself,
through the regulation of expression of mitochondrially targeted genes or through changes induced
more widely in the nuclear genome as a consequence of mitochondrial dysfunction.
 Technologies are now available to investigate the relationship between epigenetic patterns and mito-
chondrial and nuclear genomes. Epidemiological approaches can contribute to advancing knowledge
in this field.

References 9
1
Wallace DC. Colloquium paper: bioenergetics, the origins
10
of complexity, and the ascent of man. Proc Natl Acad Sci
U S A 2011;107(Suppl 2):8947–53.
2
Anderson S, Bankier AT, Barrell BG et al. Sequence and
11
organization of the human mitochondrial genome. Nature
1981;290:457–65.
3
Smeitink J, van den Heuvel L, DiMauro S. The genetics
and pathology of oxidative phosphorylation. Nat Rev Genet
2001;2:342–52.
12
4
Zeviani M, Di Donato S. Mitochondrial disorders. Brain
2004;127:2153–72.
5
Holt I, Harding AE, Morgan-Hughes JA. Deletion of
muscle mitochondrial DNA in patients with mitochon-
drial myopathies. Nature 1988;331:717–19.
6 13
Wallace DC, Singh G, Lott MT et al. Mitochondrial DNA
mutation associated with Leber’s hereditary optic neur-
opathy. Science 1988;242:1427–30.
7
Taylor RW, Turnbull DM. Mitochondrial DNA mutations
14
in human disease. Nat Rev Genet 2005;6:389–402.
8
Schon E, Hirano M, DiMauro S. Mitochondrial encepha-
lomyopathies: clinical and molecular analysis. J Bioenerg
Biomemb 1994;26:291–99.
Holt IJ. Zen and the art of mitochondrial DNA mainten-
ance. Trends Genet 2010;26:103–9.
Lightowlers RN, Chinnery PF, Turnbull DM, Howell N.
Mammalian mitochondrial genetics: heredity, hetero-
plasmy and disease. Trends Genet 1997;13:450–55.
Durham SE, Samuels DC, Cree LM, Chinnery PF. Normal
levels of wild-type mitochondrial DNA maintain cyto-
chrome c oxidase activity for two pathogenic mitochon-
drial DNA mutations but not for m.3243A–4G. Am J Hum
Genet 2007;81:189–95.
Poulton J, Bredenoord AL. 174th ENMC international
workshop: Applying pre-implantation genetic diagnosis
to mtDNA diseases: implications of scientific advances
19–21 March 2010, Naarden, The Netherlands.
Neuromuscul Disord 2010;20:559–63.
Cree LM, Samuels DC, de Sousa Lopes SC et al. A reduc-
tion of mitochondrial DNA molecules during embryogen-
esis explains the rapid segregation of genotypes. Nat Genet
2008;40:249–54.
Wai T, Teoli D, Shoubridge EA. The mitochon-
drial DNA genetic bottleneck results from replication
of a subpopulation of genomes. Nat Genet 2008;40:
1484–88.
186 INTERNATIONAL JOURNAL OF EPIDEMIOLOGY
15
Elson JL, Andrews RM, Chinnery PF, Lightowlers RN,
Turnbull DM, Howell N. Analysis of European mtDNAs
for recombination. Am J Hum Genet 2001;68:145–53.
16
Torroni A, Achilli A, Macaulay V, Richards M,
Bandelt HJ. Harvesting the fruit of the human mtDNA
tree. Trends Genet 2006;22:339–45.
17
Gomez-Duran A, Pacheu-Grau D, Lopez-Gallardo E et al.
Unmasking the causes of multifactorial disorders:
OXPHOS differences between mitochondrial haplogroups.
Hum Mol Genet 2010;19:3343–53.
18
Ruiz-Pesini E, Mishmar D, Brandon M, Procaccio V,
Wallace DC. Effects of purifying and adaptive selection
on regional variation in human mtDNA. Science 2004;
303:223–26.
19
Sadun AA, Morgia CL, Carelli V. Leber’s hereditary optic
neuropathy. Curr Treat Options Neurol 2011;13:109–17.
20
Harding AE, Sweeney MG, Govan GG, Riordan-Eva P.
Pedigree analysis in Leber hereditary optic neuropathy
families with a pathogenic mtDNA mutation. Am J Hum
Genet 1995;57:77–86.
21
Riordan-Eva P, Sanders MD, Govan GG, Sweeney MG,
Da Costa J, Harding AE. The clinical features of Leber’s
hereditary optic neuropathy defined by the presence of a
pathogenic mitochondrial DNA mutation. Brain 1995;118:
319–37.
22
Brown MD, Sun F, Wallace DC. Clustering of Caucasian
Leber hereditary optic neuropathy patients containing the
11778 or 14484 mutations on an mtDNA lineage. Am J
Hum Genet 1997;60:381–87.
23
Carelli V, Achilli A, Valentino ML et al. Haplogroup effects
and recombination of mitochondrial DNA: novel clues
from the analysis of Leber hereditary optic neuropathy
pedigrees. Am J Hum Genet 2006;78:564–74.
24
Hudson G, Carelli V, Spruijt L et al. Clinical expression of
Leber hereditary optic neuropathy is affected by the mito-
chondrial DNA-haplogroup background. Am J Hum Genet
2007;81:228–33.
25
Kirkman MA, Yu-Wai-Man P, Korsten A et al. Gene–
environment interactions in Leber hereditary optic neur-
opathy. Brain 2009;132:2317–26.
26
Hudson G, Keers S, Man PY et al. Identification of an
x-chromosomal locus and haplotype modulating the
phenotype of a mitochondrial DNA disorder. Am J Hum
Genet 2005;77:1086–91.
27
Shankar SP, Fingert JH, Carelli V et al. Evidence for a
novel x-linked modifier locus for Leber hereditary optic
neuropathy. Ophthalmic Genet 2008;29:17–24.
28
Elliott HR, Samuels DC, Eden JA, Relton CL,
Chinnery PF. Pathogenic mitochondrial DNA mutations
are common in the general population. Am J Hum Genet
2008;83:254–60.
29
Man PY, Griffiths PG, Brown DT, Howell N, Turnbull DM,
Chinnery PF. The epidemiology of Leber hereditary optic
neuropathy in the north east of England. Am J Hum Genet
2003;72:333–39.
30
Guan MX, Enriquez JA, Fischel-Ghodsian N et al. The
deafness-associated mitochondrial DNA mutation at pos-
ition 7445, which affects tRNASer(UCN) precursor pro-
cessing, has long-range effects on NADH dehydrogenase
subunit ND6 gene expression. Mol Cell Biol 1998;18:
5868–79.
31
Satoh M, Kuroiwa T. Organisation of multiple nucleoids
and DNA molecules in mitochondria of a human cell. Exp
Cell Res 1991;196:137–40.
32
Dawid IB. 5-methylcytidylic acid: absence from mito-
chondrial DNA of frogs and HeLa cells. Science 1974;184:
80–81.
33
Saxonov S, Berg P, Brutlag DL. A genome-wide analysis
of CpG dinucleotides in the human genome distinguishes
two distinct classes of promoters. Proc Natl Acad Sci U S A
2006;103:1412–17.
34
Pollack Y, Kasir J, Shemer R, Metzger S, Szyf M.
Methylation pattern of mouse mitochondrial DNA.
Nucleic Acids Res 1984;12:4811–24.
35
Rebelo AP, Williams SL, Moraes CT. In vivo methylation
of mtDNA reveals the dynamics of protein-mtDNA inter-
actions. Nucleic Acids Res 2009;37:6701–15.
36
Shock LS, Thakkar PV, Peterson EJ, Moran RG,
Taylor SM. DNA methyltransferase 1, cytosine methyla-
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
tion, and cytosine hydroxymethylation in mammalian
mitochondria. Proc Natl Acad Sci U S A 2011;108:3630–35.
37
Carelli V, Ghelli A, Bucchi L et al. Biochemical features of
mtDNA 14484 (ND6/M64V) point mutation associated
with Leber’s hereditary optic neuropathy. Ann Neurol
1999;45:320–28.
38
Carelli V, Ross-Cisneros FN, Sadun AA. Mitochondrial
dysfunction as a cause of optic neuropathies. Prog Retin
Eye Res 2004;23:53–89.
39
Berger SL. The complex language of chromatin regulation
during transcription. Nature 2007;447:407–12.
40
Choi YS, Hoon Jeong J, Min HK et al. Shot-gun proteomic
analysis of mitochondrial D-loop DNA binding proteins:
identification of mitochondrial histones. Mol Biosyst 2011;
7:1523–36.
41
Rai M, Soragni E, Chou CJ et al. Two new pimelic diphe-
nylamide HDAC inhibitors induce sustained frataxin
upregulation in cells from Friedreich’s ataxia patients
and in a mouse model. PLoS One 2010;5:e8825.
42
Farazi TA, Spitzer JI, Morozov P, Tuschl T. miRNAs in
human cancer. J Pathol 2011;223:102–15.
43
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism,
and function. Cell 2004;116:281–97.
44
Chen Z, Li Y, Zhang H, Huang P, Luthra R.
Hypoxia-regulated microRNA-210 modulates mitochon-
drial function and decreases ISCU and COX10 expression.
Oncogene 2010;29:4362–68.
45
Li J, Donath S, Li Y, Qin D, Prabhakar BS, Li P. miR-30
regulates mitochondrial fission through targeting p53 and
the dynamin-related protein-1 pathway. PLoS Genet 2010;
6:e1000795.
46
Kren BT, Wong PY, Sarver A, Zhang X, Zeng Y, Steer CJ.
MicroRNAs identified in highly purified liver-derived
mitochondria may play a role in apoptosis. RNA Biol
2009;6:65–72.
47
Venkataraman S, Alimova I, Fan R, Harris P, Foreman N,
Vibhakar R. MicroRNA 128a increases intracellular ROS
level by targeting Bmi-1 and inhibits medulloblastoma
cancer cell growth by promoting senescence. PLoS One
2010;5:e10748.
48
Sato F, Tsuchiya S, Meltzer SJ, Shimizu K. MicroRNAs
and epigenetics. FEBS J 2011;278:1598–609.
49
Yan H, Choi AJ, Lee BH, Ting AH. Identification and
functional analysis of epigenetically silenced microRNAs
in colorectal cancer cells. PLoS One 2011;6:e20628.
50
Wang H, Wu J, Meng X et al. MicroRNA-342 inhibits
colorectal cancer cell proliferation and invasion by direct-
ly targeting DNA methyltransferase 1. Carcinogenesis 2011;
32:1033–42.

51
Michels KB. The promises and challenges of epigenetic
epidemiology. Exp Gerontol 2010;45:297–301.
52
Chinnery PF, Thorburn DR, Samuels DC et al. The inher-
itance of mitochondrial DNA heteroplasmy: random drift,
selection or both? Trends Genet 2000;16:500–5.
53
Macdonald-Wallis C, Tobias JH, Davey Smith G,
Lawlor DA. Parental smoking during pregnancy and off-
spring bone mass at age 10 years: findings from a pro-
spective birth cohort. Osteoporos Int 2011;22:1809–19.
54
Waterland RA, Michels KB. Epigenetic epidemiology of
the developmental origins hypothesis. Annu Rev Nutr
2007;27:363–88.
55
Mathers JC, Strathdee G, Relton CL. Induction of epigen-
etic alterations by dietary and other environmental fac-
tors. Adv Genet 2010;71:3–39.
56
Bell CG, Beck S. The epigenomic interface between
genome and environment in common complex diseases.
Brief Funct Genomics 2010;9:477–85.
57
Lister R, Pelizzola M, Dowen RH et al. Human DNA
methylomes at base resolution show widespread epige-
nomic differences. Nature 2009;462:315–22.
58
Li Y, Zhu J, Tian G et al. The DNA methylome of human
peripheral blood mononuclear cells. PLoS Biol 2010;8:
e1000533.
59
Sandoval J, Heyn HA, Moran S et al. Validation of a DNA
methylation microarray for 450,000 CpG sites in the
human genome. Epigenetics 2011;6:692–702.
60
Beck S. Taking the measure of the methylome. Nat
Biotechnol 2010;28:1026–28.
61
Terry MB, Delgado-Cruzata L, Vin-Raviv N, Wu HC,
Santella RM. DNA methylation in white blood cells: as-
sociation with risk factors in epidemiologic studies.
Epigenetics 2011;6:828–37.
62
Wu HC, Delgado-Cruzata L, Flom JD et al. Global methy-
lation profiles in DNA from different blood cell types.
Epigenetics 2011;6:76–85.
63
Teschendorff AE, Menon U, Gentry-Maharaj A et al. An
epigenetic signature in peripheral blood predicts active
ovarian cancer. PLoS One 2009;4:e8274.
64
Moore LE, Pfeiffer RM, Poscablo C et al. Genomic DNA
hypomethylation as a biomarker for bladder cancer sus-
ceptibility in the Spanish Bladder Cancer Study: a
case-control study. Lancet Oncol 2008;9:359–66.
65
Toperoff G, Aran D, Kark JD et al. Genome-wide survey
reveals predisposing diabetes type 2-related DNA methy-
lation variations in human peripheral blood. Hum Mol
Genet 2012;21:371–83.
EPIGENETICS, EPIDEMIOLOGY AND MTDNA 187
66
Ehrich M, Nelson MR, Stanssens P et al. Quantitative
high-throughput analysis of DNA methylation patterns
by base-specific cleavage and mass spectrometry. Proc
Natl Acad Sci U S A 2005;102:15785–90.
67
Bock C, Tomazou EM, Brinkman AB et al. Quantitative
comparison of genome-wide DNA methylation mapping
technologies. Nat Biotechnol 2010;28:1106–14.
68
Huang Y, Pastor WA, Shen Y, Tahiliani M, Liu DR, Rao A.
The behaviour of 5-hydroxymethylcytosine in bisulfite
sequencing. PLoS One 2010;5:e8888.
69
Wu H, D’Alessio AC, Ito S et al. Genome-wide analysis of
5-hydroxymethylcytosine distribution reveals its dual
function in transcriptional regulation in mouse embryonic
stem cells. Genes Dev 2011;25:679–84.
70
Lillycrop KA, Phillips ES, Torrens C, Hanson MA,
Downloaded from https://academic.oup.com/ije/article/41/1/177/649968 by guest on 15 January 2024
Jackson AA, Burdge GC. Feeding pregnant rats a
protein-restricted diet persistently alters the methylation
of specific cytosines in the hepatic PPAR alpha promoter
of the offspring. Br J Nutr 2008;100:278–82.
71
Ehrich M, Field JK, Liloglou T et al. Cytosine methylation
profiles as a molecular marker in non-small cell lung
cancer. Cancer Res 2006;66:10911–18.
72
Wong HL, Byun HM, Kwan JM et al. Rapid and quanti-
tative method of allele-specific DNA methylation analysis.
Biotechniques 2006;41:734–39.
73
Bibikova M, Barnes B, Tsan C et al. High density DNA
methylation array with single CpG site resolution.
Genomics 2011;98:288–95.
74
Jiang C, Pugh BF. Nucleosome positioning and gene
regulation: advances through genomics. Nat Rev Genet
2009;10:161–72.
75
Kucej M, Kucejova B, Subramanian R, Chen XJ,
Butow RA. Mitochondrial nucleoids undergo remodeling
in response to metabolic cues. J Cell Sci 2008;121:1861–68.
76
Xing L, Todd NW, Yu L, Fang H, Jiang F. Early detection
of squamous cell lung cancer in sputum by a panel of
microRNA markers. Mod Pathol 2010;23:1157–64.
77
Camarillo C, Swerdel M, Hart RP. Comparison of micro-
array and quantitative real-time PCR methods for mea-
suring MicroRNA levels in MSC cultures. Methods Mol Biol
2011;698:419–29.
78
Schmittgen TD, Lee EJ, Jiang J et al. Real-time PCR quan-
tification of precursor and mature microRNA. Methods
2008;44:31–38.
79
Mercer TR, Neph S, Dinger ME et al. The human mito-
chondrial transcriptome. Cell 2011;146:645–58.
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

Table Of Content

Journal Cover ................................................. 2

Author[s] Statement .......................................... 3
Editorial Team ................................................ 4
Article information ............................................ 5
Check this article update (crossmark) ............................... 5
Check this article impact ......................................... 5
Cite this article ................................................ 5
Title page .................................................... 6
Article Title ................................................... 6
Author information ............................................. 6
Abstract ..................................................... 6
Article content ................................................ 7

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
1/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
2/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

Originality Statement
The author[s] declare that this article is their own work and to the best of their
knowledge it contains no materials previously published or written by another person, or
substantial proportions of material which have been accepted for the published of any
other published materials, except where due acknowledgement is made in the article.
Any contribution made to the research by others, with whom author[s] have work, is
explicitly acknowledged in the article.

Conflict of Interest Statement

The author[s] declare that this article was conducted in the absence of any commercial
or financial relationships that could be construed as a potential conflict of interest.

Copyright Statement
Copyright © Author(s). This article is published under the Creative Commons Attribution
(CC BY 4.0) licence. Anyone may reproduce, distribute, translate and create derivative
works of this article (for both commercial and non-commercial purposes), subject to full
attribution to the original publication and authors. The full terms of this licence may be
seen at http://creativecommons.org/licences/by/4.0/legalcode

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
3/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

EDITORIAL TEAM
Editor in Chief
Dr. Hindarto, Universitas Muhammadiyah Sidoarjo, Indonesia

Managing Editor
Mochammad Tanzil Multazam, Universitas Muhammadiyah Sidoarjo, Indonesia

Editors
Fika Megawati, Universitas Muhammadiyah Sidoarjo, Indonesia

Mahardika Darmawan Kusuma Wardana, Universitas Muhammadiyah Sidoarjo, Indonesia

Wiwit Wahyu Wijayanti, Universitas Muhammadiyah Sidoarjo, Indonesia

Farkhod Abdurakhmonov, Silk Road International Tourism University, Uzbekistan

Bobur Sobirov, Samarkand Institute of Economics and Service, Uzbekistan

Evi Rinata, Universitas Muhammadiyah Sidoarjo, Indonesia

M Faisal Amir, Universitas Muhammadiyah Sidoarjo, Indonesia

Dr. Hana Catur Wahyuni, Universitas Muhammadiyah Sidoarjo, Indonesia

Complete list of editorial team (link)

Complete list of indexing services for this journal (link)

How to submit to this journal (link)

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
4/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

Article information

Check this article update (crossmark)

(*)
Check this article impact

Save this article to Mendeley

(*)
Time for indexing process is various, depends on indexing database platform

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
5/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

Comparison of the Quality of DNA Template Isolation Results of the

Resin Method with and Without Centrifugation

Perbandingan Kualitas DNA Template Hasil Isolasi Metode Resin

dengan dan Tanpa Sentrifugasi

Liah Dwi Jayanti, liadwijayanti8@gmail.com, (0)

Universitas Muhammadiyah Sidoarjo, Indonesia

Miftahul Mushlih, mif.mushlih@umsida.ac.id, (1)

Universitas Muhammadiyah Sidoarjo, Indonesia

(1)
Corresponding author

Abstract

The centrifugation process is able to separate the blood into several components, including
the buffy coat. Buffy coat contains white blood cells that have a cell nucleus which is the
source of DNA. This research uses descriptive experimental method. The samples used were
16 venous blood samples consisting of 8 samples without centrifugation (wholeblood) and 8
samples centrifuged (buffycoat). DNA isolation using the resin method. Quantitative analysis
was performed using a UV-Vis spectrometer. The results showed that the average
concentration and purity of DNA in the centrifuged sample was higher than in the sample
without centrifugation. The result of this research is that the centrifuged sample (buffycoat)
can be used for the DNA isolation process and has a higher purity and concentration value
than the sample without centrifugation (wholeblood).

Published date: 2021-07-31 00:00:00

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
6/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

Pendahuluan
Deoxyribonucleic acid (DNA) merupakan asam nukleat yang menyusun informasi genetik pada makhluk hidup.DNA
juga berperan dalam pengendali sifat dan ciri morfologi seperti pigmen kulit, warna serta bentuk rambut, strktur
jari serta watak khusus seseorang. Tujuan utama isolasi DNA ialah untuk memisahkan DNA dari bahan lainnya
semacam protein, lemak, dan karbohidrat. Kualitas DNA yang baik yang diperoleh dari hasil ekstraksi merupakan
syarat dasar yang harus dipenuhi dalam studi molekuler [1] . Isolasi DNA mempunyai 3 prinsip yaitu: lysis sel,
ekstraksi sel, serta presipitasi [2] .

Pada proses sentrifugasi sampel darah akan menjadi 3 (tiga) bagian terpisah yaitu sel darah merah (eritrosit),
band putih (buffy coat) yang terdiri dari sel darah putih (leukosit) dan trombosit (< 1%) serta plasma darah [3] .
Buffy coat merupakan sel darah putih yang mengandung konsentrat DNA [4].

Metode resin merupakan metode yang menggunakan resin chelex yang ditambahkan secara langsung pada sampel
atau bahan pemeriksaan. Resin Chelex dapat menjaga sampel dari enzim DNAse yang aktif selama proses
ekstraksi. Metode Resin Chelex juga memiliki tahapan yang sederhana sehingga resiko untuk kontaminan lebih
sedikit. Selain kelebihan, metode Resin Chelex juga mempunyai kekurangan diantaranya yaitu DNA atau RNA yang
dihasilkan terlalu sedikit [5].

Pada riset sebelumnya menunjukkan bahwa nilai WBC atau sel darah putih berhubungan dengan konsentrasi DNA
yang dihasilkan. Yakni semakin tinggi leukosit maka akan semakin besar konsentrasi DNA yang diperoleh [6].
Sehingga dengan adanya penelitian ini diharapkan dapat mengkonfirmasi penggunaan sentrifugasi untuk
meningkatkan jumlah dan kualitas DNA yang dihasilkan. Serta dapat mengoptimalisasi analisa PCR pada analisis
perbandingan kualitas DNA template hasil isolasi metode resin chelex dengan dan tanpa sentrifugasi.

Metode Penelitian
Penelitian ini bersifat deskriptif eksperimental dengan teknik random sampling. ethical clearance disetujui oleh
Fakultas Kedotekteran Gigi Universitas Airlangga nomor 186/HRECC.FODM/IV/2021. Penelitian ini dilakukan di
Laboratorium Biologi Molekular Universitas Muhammadiyah Sidoarjo Pada bulan Februari sampai April 2021
dengan menggunakan 16 sampel yang terdiri dari 8 sampel whole blood dan 8 sampel buffy coat serta
menggunakan teknik random sampling. Subyek pada penelitian ini yaitu Mahasiswa Universitas Muhammadiyah
Sidoarjo. Sampel darah yang diperoleh kemudian dilakukan isolasi DNA dengan Metode Resin Chelex modifikasi.
Kemudian dianalisa secara kuantitatif menggunakan spektrofotometer UV-Vis dan secara kualitatif menggunakan
Elektroforesis. Kemudian data yang diperoleh dianalisa menggunakan spss versi 16.

Hasil dan Pembahasan

Dari hasil penelitian yang telah dilakukan didapati pada sampel tanpa sentrifugasi memiliki kemurnian rata- rata
1,29 dan konsentrasi sebesar 287,5 ng/µl. Dan pada sampel dengan sentrifugasi memiliki kemurnian rata-rata 1,29
serta konsentrasi DNA sebesar 316,7 ng/µl.

Gambar 1. Grafik pengukuran DNA menggunakan UV-Vis spektrofotometer

Berdasarkan pada Gambar 1. Sampel DNA tersebut memiliki nilai kemurnian diatas 1,1 dengan konsentrasi 232,9
ng/µl. Grafik tersebut memiliki pergerseran panjang gelombang ke arah batokromik (Red Shift) [7] .Jika dilihat
pada bentuk dari gelombang pengukuran pada grafik, sampel DNA tersebut terkontaminasi oleh EDTA [8]. Adanya
kontaminasi tersebut mengakibatkan nilai konsentrasi pada DNA tidak menunjukkan nilai yang sebenarnya
sehingga hal ini juga berpengaruh pada tidak munculnya band pada saat elektroforesis. Pemurnian DNA yang tidak
sempurna menyebabkan DNA masih mengandung polisakarida, senyawa fenolik atau kontaminan lainnya, sehingga
dengan meningkatnya nilai konsentrasi DNA maka kontaminan juga akan bertambah [9].

Uji statistik menggunakan uji Paired sampel t test dilakukan untuk melihat perbedaan indeks kemurnian serta
konsentrasi DNA antar sampel. Didapatkan hasil untuk konsentrasi DNA dengan nilai p-value sebesar 0,353 (>0,05)
sehingga dapat disimpulkan bahwa tidak terdapat perbedaan yang signifikan pada konsentrasi DNA sampel tanpa
sentrifugasi dan sampel dengan sentrifugasi. Kemudian pada kemurnian DNA didapatkan nilai p-valuesebesar
0,213 (>0,05) hal ini berarti tidak terdapat perbedaan yang signifikan pada kemurnian DNA sampel tanpa
sentrifugasi dan sampel dengan sentrifugasi.

Gambar 2. Hasil elektroforesis DNA Genom pada sampel tanpa sentrifugasi (wholeblood). (M: Marker 100 bp,
Sampel: R1, R2, R3, R4, R5, R6, R7 dan R8)

Pada gambar 2 menunjukkan hasil visualisasi UV Transilluminator pada sampel DNA genom tanpa sentrifugasi
tidak menghasilkan pita. Menurut penelitian yang dilakukan Puspitasari hal ini bisa disebabkan karena pada

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
7/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

metode

resin memiliki kelemahan diantaranya DNA dan RNA yang dihasilkan relatif sedikit, serta tahap pemanasan yang
dilakukan selama proses ekstraksi dapat merusak struktur rantai ganda DNA yang dihasilkan.

Gambar 3. Hasil elektroforesis DNA Genom pada sampel dengan sentrifugasi (buffycoat). (M: Marker 100 bp,
Sampel: RS1, RS2, RS3, RS4, RS5, RS6, RS7 dan RS8).

Visualisasi sampel DNA genom dengan sentrifugasi didapati pada semua sampel dengan kode RS1, RS2, RS3, RS4,
RS5, RS6, RS7 dan RS8 tidak terbentuk pita DNA. Hal ini dapat diakibatkan karena pada isolasi DNA metode resin
menghasilkan DNA atau RNA yang relatif sedikit. sehingga perlu adanya amplifikasi DNA untuk digunakan proses
pengujian selanjutnya.

Gambar 4. Hasil elektroforesis produk PCR pada sampel tanpa sentrifugasi (wholeblood). (M: Marker 100 bp,
Sampel: R1, R2, R3, R4, R5, R6, R7 dan R8).

Pada gambar 4 menunjukkan hasil visualisasi menggunakan UV Transilluminator pada sampel DNA tanpa
sentrifugasi yang telah diamplifikasi dengan PCR menunjukkan adanya pita DNA yang terbentuk pada sampel
dengan kode R1, R2, R4, R6, R7 serta R8 dengan ketebalan pita yang tipis. Namun pada sampel dengan kode R3
dan R4 tidak terbentuk pita. Hal ini dapat diakibatkan kurangnya kuantitas DNA yang terambil pada saat persiapan
proses PCR. Menurut penelitian sebelumnya jika kuantitas DNA didalam esktrak kurang, maka dapat
mempengaruhi keberhasilan proses selanjutnya seperti halnya proses PCR [10].

Kuantitas DNA yang digunakan untuk proses PCR tidak boleh kurang dari 1.0 ng. Serta kekurangan lain pada
metode ini yaitu dapat terlarutnya bahan chelating agent yang digunakan dalam metode resin chelex,sehingga
menyebabkan kurang optimalnya kinerja enzim taq polymerase pada proses PCR [11].

Gambar 5. Hasil elektroforesis produk PCR pada sampel dengan sentrifugasi (buffycoat). (M: Marker 100 bp,
Sampel: RS1, RS2, RS3, RS4, RS5, RS6, RS7 dan RS8.

Pada gambar 5 tersebut sampel DNA hasil PCR yang sudah di sentrifus dapat diketahui bahwa pada semua sampel
dengan kode RS1, RS2, RS3, RS4, RS5, RS6, RS7 dan RS8 memiliki pita yang cukup jelas. Hal ini dikarenakan pada
sampel tersebut darah yang diisolasi hanya berupa buffycoat nya saja. Hal ini sesuai dengan penelitian yang
dilakukan Siswanto et al yang mana pada sampel buffy coat merupakan sebagian besar mengandung sel darah
putih yang mempunyai inti sel tempat dimana DNA berada.

Dalam penelitian sebelumnya Huang et al., mengatakan bahwa faktor yang mempengaruhi keberhasilan isolasi
DNA darah ialah WBC, metode penyimpanan, kondisi sampel serta metode isolasi DNA [12] .

Kesimpulan
Kesimpulan pada penelitian ini adalah pada sampel Buffy coat memiliki kemurnian serta konsentrasi yang lebih
tinggi dibandingkan pada sampel DNA tanpa sentrifugasi Whole blood. Berdasarkan analisis uji Paired sampel T
Test tidak menunjukkan perbedaan secara signifikan (sig0,353).

References
1. Syafaruddin, Randriani, E., & Santoso, T. J. (2011). Efektivitas dan efisiensi teknik isolasi dan purifikasi dna
pada jambu mete. J Ristri, 2(2), 151–160.
2. Nurhayati, B., & Darmawati, S. (2017). Biologi Sel dan Molekuler. Kemenkes BPPSDM.
3. Darmawan, A., & Irawan, R. (2015). Mengenal CPOB Untuk Produk Darah. Medical, 3(2), 111–118.
armaididarmawan@yahoo.com
4. Siswanto, J. E., Berlian, T., Putricahya, E., Panggalo, L. V, & Yuniani, L. (2016). Isolasi DNA pada Sampel
Darah Tepi dan Buccal pada Bayi Penderita ROP: Perbandingan Hasil Uji Konsentrasi dan Indeks
Kemurnian (Vol. 18, Issue 4).
5. Marwayana, O. N. (2015). Ekstraksi asam deoksiribonukleat (DNA) dari sampel jaringan otot. Oseana, XL,
1–9.
6. Philliphs, K., McCallum, & Welch, L. (2012). A Comparison of methods for forensic DNA extraction:
Chelex-100 and the QIAGEN DNA investigation kit (manual and automated). http://pubmed.ncbi.nlm
7. Puspitasari, P., Rinata, E., Dijaya, R., Aprilia, S., Trikumalasari, D., Nur Azzah, L., Fanani, Q., Mushlih, M.,
Aliviameita, A., & Delta, D. (2019). Quality of Genom in Type II Diabetes Mellitus Patients in Viewed of
Temperature, Storage Duration, Number of Leukocyte. Medical Laboratory Technology Journal, 5(2), 96.
https://doi.org/10.31964/mltj.v0i0.229
8. Suharti, T. (2017). Dasar-dasar Spektrofotometri UV-Vis dan Spektrofotometri Massa untuk penentuan
struktur senyawa organik. AURA CV. Anugrah Utama Raharja.

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
8/9
 Indonesian Journal of Innovation Studies
Vol. 15 (2021): July
DOI: 10.21070/ijins.v15i.551 . Article type: (Innovation in Health Science)

9. Mushlih, M. (2019). BIOLOGI MOLEKULER “Aplikasi Dasar di Dunia Kesehatan.” UMSIDA Press.
10. Pharmawati, M. (2009). Optimalisasi Ekstraksi Dna Dan Pcr-Rapd Pada Grevillea Spp. (Proteaceae). Jurnal
Biologi, 13(1), 12–16.
11. Sutrisno, I. K., Arundina, I., & Sosiawan, A. (2013). Identifikasi bite marks dengan ekstraksi DNA metode
Chelex ( Bite marks identification with Chelex methods in DNA extraction ). 46(2), 107–112.
12. Chen, W. C., Kerr, R., May, A., Ndlovu, B., Sobalisa, A., Duze, S. T., Joseph, L., Mathew, C. G., & Babb De
Villiers, C. (2018). The Integrity and Yield of Genomic DNA Isolated from Whole Blood Following Long-Term
Storage at -30°C. Biopreservation and Biobanking, 16(2), 106–113. https://doi.org/10.1089/bio.2017.0050

ISSN 2598-9936 (online), https://ijins.umsida.ac.id, published by Universitas Muhammadiyah Sidoarjo

Copyright © Author(s). This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC
BY).
9/9

Powered by TCPDF (www.tcpdf.org)

 Review Article Open Acc J of Toxicol
Volume 2 Issue 5 - March 2018
Copyright © All rights are reserved by Afroze Alam
DOI : 10.19080/OAJT.2018.02.555600

Chemotherapy Treatment and Strategy

Schemes: A Review
Afroze Alam1,5*, U Farooq2, Ruchi Singh1, VP Dubey1, Shailendra Kumar3, Rashmi Kumari1, Kamlesh Kumar
Naik4, BD Tripathi1 and KL Dhar5
1
Narayan Institute of Pharmacy, India
2
Faculty of Dentistry, Taif University, Saudi Arabia
3
Govt Pharmacy Institute, India
4
Nandha College of Pharmacy, India
5
Faculty of Pharmaceutical Sciences, Shoolini University, India
Submission: November 03, 2017; Published: March 29, 2018
*Corresponding author: Afroze Alam, Narayan Institute of Pharmacy, Bihar, India, Tel: ; Fax: +91-1792308000;
Email:

Abstract
Chemotherapy treatments are used to inhibit vigorously growing malignant cells with anticancer agents. This type of therapy may be used
to cure and try a patient to produce palliative relief and symptomatic relaxation in the advance stages of cancer. In general, chemotherapy is
given in cyclic manners. Patients are administered with anticancer drug during regular weekly or bi-weekly sessions. After the completion of
certain cyclic session, treatment is stopped for several fixed periods to allow the patient to rest and their body to re-establish from the toxic
effects of anticancer drugs. Generally, six or more chemotherapeutic cycles are needed in cancer patient and often a combined chemotherapy
would be preferred. Anticancer drugs are used to destroy not only to specific cancer cell but equally affect the normal cell that developing under
normal circumstances, such as those in the digestive tract, bone marrow and hair follicles. Combination chemotherapy is always preferred
over traditional therapies, such as radiotherapy, surgery or other cytotoxic drugs. The mechanism of action of each therapy is different for
inhibiting cell division and proliferation of rapidly growing cell. Each treatment has their specific side effects. A large numbers of treatment
strategy are available to fight with cancer, depending upon the severity and stage of cancer, type of cancer, and the affected body parts. The
review describes the alternative methods that combine chemotherapy with other treatment strategies have been explored in order to improve
treatment selectivity, reduce recurrence and improve the quality of life of patients.

Keywords: Chemotherapy; Cytotoxic agents; Radiotherapy; Non-pharmacological treatment; Cell proliferation; Hypertheramia

Introduction
meaning thereby is that chemotherapy also destroy cells that
Chemotherapy literally means the use of chemicals in
divide rapidly under normal circumstances: digestive tract,
order to inhibit malignant cell or to the infectious agents of a
cell in bone marrow and hair follicles. There is a most common
disease such as micro-organism without much affecting the
side effects observed during the period of chemotherapy
host cells [1]. Therefore, the treatment can be broadly divided
treatment: mucositis (inflammation of the lining of the digestive
into two categories - cancer chemotherapy and antimicrobial
tract), alopecia (hair loss) and myelosuppression (decreased
chemotherapy. The drugs belong to these categories, are
production of blood cells, hence also immunosuppression) [4].
different from the others as they are generally intended to kill or
Most of the monoclonal antibodies are not indiscriminately
inhibit the target organism and have no or minimal effect on host
cytotoxic and act by targeting proteins that are over expressed
cell [2]. Earlier, it was considered that the chemotherapeutic
in cancer cells and essential for their proliferation [5]. This kind
agents were restricted to synthetic compounds but, now a
of treatments is generally referred as targeted therapy (distinct
day many more natural products are marketed as potential
from classical chemotherapy) is always administered together
chemotherapeutic agents or antibiotics. The present status
with traditional chemotherapeutic agents in cancer treatment
demands that both the synthetically as well as naturally or
regimen. Furthermore, in addition to the combined and targeted
microbiologically produced drugs need to be included together.
chemotherapy, some of the newer strategy have also been
In traditional chemotherapy, all the anticancer drugs are
explored particularly the use of light (phototherapy) and heat
cytotoxic in nature to both cancer as well as normal cells [3],

Open Acc J of Toxicol. 2018; 2(5): OAJT.MS.ID.555600 (2018) 001

 Open Access Journal of Toxicology

(hyperthermia) techniques. In some of the strategy where, the therapy is used.

drugs that converted to cytotoxic agent only upon the exposure
of light is called photo chemotherapy or photodynamic therapy
[6].
Treatment strategies
Now a day, many strategies have been adapted to
administered chemotherapeutic drugs. Chemotherapeutic drugs
may be used with a curative purpose or it may be aimed to prong
life.
a) Combined chemotherapy is the one kinds of treatment
strategy where more one type of therapy can be adopted at a
time to treat cancer, such as radiation therapy, surgery and/
or hypertheremia. However, induction chemotherapy is used
for the first time treatment of cancer with anticancer drug
[7].
b) Consolidation chemotherapy is generally given after
remission in order to prolong the overall disease-free time
and improve overall survival [8].
d) In combined chemotherapy, different dugs are having
different kinds of mechanism of action and their side
effects. The most advantage of combined chemotherapy is to
minimize the chances of development of resistance to any
one the drug. Also the drugs can be administered at lower
dose with minimal side effects and toxicity
e) .Neoadjuvant chemotherapy is used prior to a local
treatment such as surgery, and is meant to shrink the
primary tumor [9]. It is also used to a condition where a high
risk of micrometastatic disease observes.
f) This therapy (Neoadjuvant chemotherapy) can be used
where there is a little a chance or evidence of cancer present
and also there is risk of recurrence. It is also beneficial to kill
the cancerous cells that have proliferated to other part of the
body [10].
g) Maintenance chemotherapy is one where a repeated
low-dose is used to treat for prolong remission.

c) Intensification chemotherapy is identical to h) Salvage chemotherapy is useful to simply decrease

consolidation therapy but a different drug than induction tumor load and increase life expectancy [11] (Table 1).
Table 1: Common combination chemotherapeutic regimen [1].

Cancer Type Drugs Acronym

Mustine, Vincristine, Procarbazine, Prednisolone MOPP

Hodgkin’s Disease
Doxorubicine, Bleomycine, Vinblastine, Dacarbazine ABVD

Cyclophsphamide, Methotraxate, 5-Fluorouracil CMF

Breast Cancer
Doxorubicine, Cyclophsphamide AC
Germ Cell Tumor Bleomycin, Etopside, Cisplatin BEP
Stomach Cancer Epirubicine, Capecetabine, Cisplatin EXC
Epirubicine, Cisplatin, 5- Fluorouracil ECF
Bladder Cancer
Methotraxate, Vincristine, Doxorubicine, Cisplatin MVAC
Non-Hodgkin’s Lymphoma Cyclophsphamide, Doxorubicine, Vincristine, Prednisolone CHOP
Lung Cancer Cyclophsphamide, Doxorubicine, Vincristine CAV
Colorectal Cancer 5- Fluorouracil, Folonic acid, Oxaliplatin FOLFOX

All the above chemotherapeutic regimens are given to
the patient that may be capable of withstand the treatment. A
patient can be able to continue the chemotherapy or whether the
dose reduction is needed, for that a performance status is always
used as a measure. Because less cell death is observed in tumor
with each treatment, doses repetitions are required to reduce
the size of the tumor. Current chemotherapy regimens are used
to treat in cyclic manners, with the duration and frequency of
treatments limited by toxicity to the patient [12].
Cytotoxic agents and targeted therapy
Targeted therapies are known to be a relatively new approach
for cancer treatment, and the therapy significantly overcome
many of the issues observed during the use of traditional
anticancer drugs [13]. The intense toxicity observed with the
administration of anticancer drugs is because of the cytotoxic
agent that targets non-specific cell. They can inhibit or kill any
rapidly growing or developing cell, tumor or normal. Targeted
therapies are directly involved to affect cellular proteins,
which are responsible to produce abnormal cell growth [14].
This shows that there is a need of the high dose to cancer cells
with relatively low dose to others normal cells. Different type
of cancer can be treated by the use of specific type of proteins
or even on a patient basis under targeted therapies. Moreover,
the side effects observed are relatively less as compare to the
traditional anticancer drugs. Initially, the target therapies were
supposed to be only selective for one protein. However, now
it is quite clear that one drug can bind in a specific range of

How to cite this article: Afroze Alam, U Farooq, Ruchi Singh, VP Dubey, Shailendra Kumar, et al. Chemotherapy Treatment and Strategy Schemes: A
002
Review. Open Acc J of Toxicol. 2018;2(5): 555600. DOI: 10.19080/OAJT.2018.02.555600.
 Open Access Journal of Toxicology
protein target [15]. An example target for targeted therapy is
the protein produced by the Philadelphia chromosome, a genetic
lesion found commonly in chronic myelomonocytic leukemia.
This fusion protein has enzyme activity that can be inhibited by
imatinib a small molecule drug [16].
Chemotherapy Treatment Strategy Using Hyperthermia.
In traditional chemotherapy, there is a major drawback of the
lack of selectivity, leads to various side- effects, such as alopecia
(hair loss), blood disorder, fatigue, nausea and vomiting. So, there
is a need to explore other treatment strategy where application
of heat (Hyperthermia) is accompanied together with other
chemotherapies in order to improve treatment selectivity,
reduce recurrence and improve the quality of life of patients. It
has been observed that surgical removal of solid tumor generally
fails in total remission and therefore a combination therapy
must be accompanied by anticancer drugs with radiotherapy or
hyperthermia or targeted therapy etc. One new approach, which
may achieve these goals, is to the use of hyperthermia technique
along with other mode of chemotherapy. In the hyperthermia
process a fractionated or continued dose is delivered at the target
site that can increase the sensitivity of tumor to chemotherapy,
radiotherapy, immunotherapy and immune-based strategies
[17]. However, this kind of new approach where the successful
application of hyperthermia (where heat is applied only at the
tumor site) together with other chemotherapeutics has led to
renewed interest in the field of modern chemotherapy. The major
objective of hyperthermia is to make tumor cells more sensitive
towards the therapeutic agents and facilitate drug release from
thermo responsive nano carriers (usually below 43°C, referred
to as mild hyperthermia) or, at higher temperatures, directly
inducing necrosis (above 43°C, referred to as thermal ablation)
[18]. Furthermore, cancer cells are more sensitive towards
thermal environment than normal tissues between 42-45°C with
a directly proportional relationship between tissue death and
the temperature or exposure time. The mechanism of action of
hyperthermia is accompanied by various way where the cells or
tissues leading to an enhanced antitumor response. In general,
hyperthermia inhibits cell functions, increase permeability and
modify fluidity, disrupt stability and shape of cell membrane,
impending trans membrane transport proteins and cell surface
receptors [19].
Transfer of heat, away from tumor cells is directly
proportional to the rate and volume of tumor perfusion [20],
and assuming that the process is more efficient in malignant
tissue compared to healthy tissue [21], enforcing selectivity of
hyperthermia. However, the significant effects of hyperthermia
are supposed to be on protein as they undergo denaturation
and precipitation at temperature > 40°C. Although the effects
on lipids are mostly reversible, but the effect on DNA where,
double strand break and effect produced is substantial and
non-reversible. This basically inhibits many cellular processes
such as cell cycle arrest, replication and synthesis of DNA and
alters protein synthesis, leading to inhibition of cell proliferation
How to cite this article: Afroze Alam, U Farooq, Ruchi Singh, VP Dubey, Shailendra Kumar, et al. Chemotherapy Treatment and Strategy Schemes: A
003
Review. Open Acc J of Toxicol. 2018;2(5): 555600. DOI: 10.19080/OAJT.2018.02.555600.
and death [22,23]. There are a number of other strategies that
oncologists can use to regulate chemotherapy.
Targeted Therapy
Targeted therapies specifically target a protein or other
molecules and have the benefit of reducing chemo side effects.
Hormone Therapy
Activated hormone receptors change the way that a gene is
expressed. That means these receptors change the way that the
gene behaves, often stimulating cell growth. Hormone-sensitive
cancer cells have extra hormone receptors [24].
Dose-Dense Chemotherapy
Dose-dense chemotherapy treatment refers to treatments
that are timed to occur close together. If conventionally scheduled
chemotherapy treatments are once every three weeks, the dose-
dense schedule might be once every two weeks. This strategy is
used for more advanced cancers that are starting to spread [25].
Combined Modality Chemotherapy
Combined modality simply means using more than one type
of therapy to treat the cancer. If the cancer is aggressive and at
stage 3, the treatment includes surgery, chemotherapy, radiation,
and then a year of Herceptin.
Palliative Chemotherapy
Palliative therapy is treatment that is given to improve
quality of life. The purpose of palliative care is to ease pain and
reduce the tumor size to improve organ function, rather than to
eliminate the cancer altogether. While it is often thought of as a
long-term end-of-life strategy to provide comfort, palliative care
can also be a temporary addition to the treatment strategy at any
point in the process to address a quality-of-life issue [26].
Photodynamic therapy (PDT)
It is a ternary treatment for cancer involving a photo
sensitizer, tissue oxygen, and light (often using lasers.
Photodynamic therapy can be used as treatment for basal cell
carcinoma (BCC) or lung cancer; PDT can also be useful in
removing traces of malignant tissue after surgical removal of
large tumors [27].
Cancer immunotherapy
Cancer immunotherapy refers to a diverse set of therapeutic
strategies designed to induce the patient’s own immune system
to fight the tumor [28]. Contemporary methods for generating
an immune response against tumors include intravesical BCG
immunotherapy for superficial bladder cancer, and use of
interferon and other cytokines to induce an immune response in
renal cell carcinoma and melanoma patients.
Conclusion
There are so many types of treatments that this is not an
exhaustive listing of all the chemotherapy strategies available
 Open Access Journal of Toxicology
to oncologists. Research continues to develop new treatments
and more strategies for using existing treatments. Further
improvements of this treatment strategy will undoubtedly
involve the development of more efficient anticancer drugs.
The strategy reported herein, i.e. based on modifying clinically
approved drugs certainly holds promise. However, further
validation of all this approaches are still needed as authentic
strategy also display relevant therapeutic properties under
normal conditions and to determine whether it has advantages
over the well-established use of chemotherapeutics, some of
which are progressing through clinical trials.
Acknowledgment
The authors thank to Narayan Institute of Pharmacy
and Faculty of Pharmaceutical Sciences, Shoolini University
BajholSolan H.P. (India) for providing research facilities.
References
1. Knoepfler PS (2009) Deconstructing stem cell tumorigenicity: a
roadmap to safe regenerative medicine. Stem cells 27(5): 1050-1056.
2. Drusano GL (2004) Antimicrobial pharmacodynamics: critical
interactions of’ bug and drug. Nat Rev Microbiol 2(4): 289-300.
3. Ferrara N, Kerbel RS (2005) Angiogenesis as a therapeutic target.
Nature 438(7070): 967-974.
4. Conklin KA (2000) Dietary antioxidants during cancer chemotherapy:
impact on chemotherapeutic effectiveness and development of side
effects. Nutr Cancer 37(1): 1-8.
5. Wang S, Placzek WJ, Stebbins JL, Mitra S, Noberini R, et al. (2012)
Novel targeted system to deliver chemotherapeutic drugs to EphA2-
expressing cancer cells. J Med Chem 55(5): 2427-2436.
6. J Sanchez-Barcelo E, D Mediavilla M (2014) Recent patents on light
based therapies: photodynamic therapy, photothermal therapy and
photoimmunotherapy. Recent Pat Endocr Metab Immune Drug Discov
8(1): 1-8.
7. Adam R, Pascal G, Castaing D, Azoulay D, Delvart V, et al. (2004) Tumor
progression while on chemotherapy: a contraindication to liver
resection for multiple colorectal metastases?. Ann Surg 240(6): 1052-
1061.
8. Einhorn LH, Crawford J, Birch R, Omura G, Johnson DH, et al. (1988)
Cisplatin plus etoposide consolidation following cyclophosphamide,
doxorubicin, and vincristine in limited small-cell lung cancer. J Clin
Oncol 6(3): 451-456.
9. Buzdar AU, Singletary SE, Theriault RL, Booser DJ, Valero V, et al. (1999)
Prospective evaluation of paclitaxel versus combination chemotherapy
with fluorouracil, doxorubicin, and cyclophosphamide as neoadjuvant
therapy in patients with operable breast cancer. J Clin Oncol 17(11):
3412-3417.
10. Peters III WA, Liu PY, Barrett RJ, Stock RJ, Monk BJ, et al. (2000)
Concurrent chemotherapy and pelvic radiation therapy compared
with pelvic radiation therapy alone as adjuvant therapy after radical
surgery in high-risk early-stage cancer of the cervix. J Clin Oncol 18(8):
1606-1613.
11. Fishman PN, Pond GR, Moore MJ, Oza A, Burkes RL, et al. (2006) Natural
history and chemotherapy effectiveness for advanced adenocarcinoma
of the small bowel: a retrospective review of 113 cases. American J Clin
Oncol 29(3): 225-231.
How to cite this article: Afroze Alam, U Farooq, Ruchi Singh, VP Dubey, Shailendra Kumar, et al. Chemotherapy Treatment and Strategy Schemes: A
004
Review. Open Acc J of Toxicol. 2018;2(5): 555600. DOI: 10.19080/OAJT.2018.02.555600.
12. Green MR, Manikhas GM, Orlov S, Afanasyev B, Makhson AM, et al.
(2006) Abraxane®, a novel Cremophor®-free, albumin-bound particle
form of paclitaxel for the treatment of advanced non-small-cell lung
cancer. Ann Oncol 17(8): 1263-1268.
13. Cho K, Wang XU, Nie S, Shin DM (2008) Therapeutic nanoparticles for
drug delivery in cancer. Clin Cancer Res 14(5): 1310-1316.
14. Peer D, Karp JM, Hong S, Farokhzad OC, Margalit R, et al. (2007)
Nanocarriers as an emerging platform for cancer therapy. Nat
Nanotechnol 2(12): 751-760.
15. Higueruelo AP, Jubb H, Blundell TL (2013) Protein–protein interactions
as druggable targets: recent technological advances. Curr Opin
Pharmacol 13(5): 791-796.
16. Fabian MA, Biggs WH, Treiber DK, Atteridge CE, Azimioara MD, et al.
(2005) A small molecule-kinase interaction map for clinical kinase
inhibitors. Nat Biotechnol 23(3): 329-336.
17. Needham D, Dewhirst MW (2001) The development and testing of a
new temperature-sensitive drug delivery system for the treatment of
solid tumors. Adv Drug Deliv Rev 53(3): 285-305.
18. Zhang Z, Wang J, Nie X, Wen T, Ji Y, et al. (2014) Near infrared laser-
induced targeted cancer therapy using thermoresponsive polymer
encapsulated gold nanorods. J Am Chem Soc 136(20): 7317-7326.
19. Alvarez-Berríos MP, Castillo A, Mendéz J, Soto O, Rinaldi C, et al. (2013)
Hyperthermia potentiation of cisplatin by magnetic nanoparticle
heaters is correlated with an increase in cell membrane fluidity. Int J
Nanomedicine 8: 1003-1013.
20. Khaled AR, Vafai K (2003) The role of porous media in modeling flow
and heat transfer in biological tissues. Int J Heat Mass Transf 46 (26):
4989-5003.
21. Jori G (1996) Tumour photosensitizers: approaches to enhance the
selectivity and efficiency of photodynamic therapy. J Photochem
Photobiol B 36(2): 87-93.
22. Evan GI, Vousden KH (2001) Proliferation, cell cycle and apoptosis in
cancer. Nature 411(6835): 342-348.
23. Clavel CM, Nowak-Sliwinska P, Păunescu E, Dyson PJ (2015)
Thermoresponsive fluorinated small-molecule drugs: a new concept
for efficient localized chemotherapy. Med Chem Comm 6(12): 2054-
2062.
24. Feldman BJ, Feldman D (2001) The development of androgen-
independent prostate cancer. Nat Rev Cancer 1(1): 34-45.
25. Del Mastro L, De Placido S, Bruzzi P, De Laurentiis M, Boni C, et al. (2015)
Fluorouracil and dose-dense chemotherapy in adjuvant treatment of
patients with early-stage breast cancer: an open-label, 2× 2 factorial,
randomised phase 3 trial. The Lancet 385(9980): 1863-1872.
26. Alberts SR, Horvath WL, Sternfeld WC, Goldberg RM, Mahoney MR, et
al. (2005) Oxaliplatin, fluorouracil, and leucovorin for patients with
unresectable liver-only metastases from colorectal cancer: a North
Central Cancer Treatment Group phase II study. J Clin Oncol 23(36):
9243-9249.
27. Brown SB, Brown EA, Walker I (2004) The present and future role of
photodynamic therapy in cancer treatment. Lancet Oncol 5(8): 497-
508.
28. Curiel TJ (2007) Tregs and rethinking cancer immunotherapy. J Clin
Invest 117(5): 1167-1174.
 Open Access Journal of Toxicology

This work is licensed under Creative

Commons Attribution 4.0 License
Your next submission with Juniper Publishers
DOI: 10.19080/OAJT.2018.02.555600 will reach you the below assets
• Quality Editorial service
• Swift Peer Review
• Reprints availability
• E-prints Service
• Manuscript Podcast for convenient understanding
• Global attainment for your research
• Manuscript accessibility in different formats
( Pdf, E-pub, Full Text, Audio)
• Unceasing customer service

Track the below URL for one-step submission

https://juniperpublishers.com/online-submission.php

How to cite this article: Afroze Alam, U Farooq, Ruchi Singh, VP Dubey, Shailendra Kumar, et al. Chemotherapy Treatment and Strategy Schemes: A
005
Review. Open Acc J of Toxicol. 2018;2(5): 555600. DOI: 10.19080/OAJT.2018.02.555600.
Journal of Aquatic Science & Management, Vol. 6, No. 2, 33-38 (October 2018) e-ISSN 2337-5000
Graduate Program, UNSRAT, Manado, Indonesia – Asosiasi Pengelola Sumber Daya Perairan Indonesia
(Online submissions – http://ejournal.unsrat.ac.id/index.php/jasm/index)

DNA extraction and amplification of the rbcL (ribulose-1,5-

bisphosphate carboxylase/oxygenase large subunit) gene of red
seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency
Ekstraksi DNA dan Amplifikasi gen rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase
large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi
Kabupaten Minahasa Utara

Irvan R. Hengkengbala*1, Grevo S. Gerung2, and Stenly Wullur2

1
Program Studi Magister Ilmu Perairan, Pascasarjana, Universitas Sam Ratulangi,
Jl. Kampus Unsrat Bahu, Manado 95115, Sulawesi Utara, Indonesia.
2
Fakultas Perikanan dan Ilmu Kelautan, Universitas Sam Ratulangi, Jl. Kampus Unsrat Bahu,
Manado 95115, Sulawesi Utara, Indonesia.
*E-mail: richardirvan444@gmail.com

Abstract: The quality of DNA extraction and gene amplification in algae are influenced by several factors including
the characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in
one species of algae may fail for another type of algae. The present study was aimed to examine several DNA
extraction techniques and rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene
amplifications of Gracilaria sp. collected in Bahoi, North Minahasa (126043’48’’N 12501’33”E). DNA genom of
Gracilaria sp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and
commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of
rbcL gene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-
AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC
TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilaria sp. was
successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcL
gene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated by
a sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.

Keywords: DNA; gene rbcL, red algae; Gracilaria sp.; minahasa regency.

Abstrak: Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya
adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang
berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya. Penelitian ini
dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL (ribulose-1,5-
bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilaria sp. dari perairan Bahoi, Minahasa
Utara (126043’48’’N 12501’33”E). Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional
(CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kit
dan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcL dilakukkan menggunakan 2 pasang primer (rbcL-
aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F
ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealing
berbeda (45 dan 500C). DNA genom alga (Gracilaria sp.) dapat diekstraksi menggunakan prosedur Geneaid
DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcL of Gracilaria sp. dapat
diamplifikasi menggunakan pasangan primer rbcL 1F dan 724R pada suhu annealing 500C yang ditandai dengan
adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne). Munculnya pita DNA target
pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.

Kata-kata kunci: DNA; gen rbcL; alga merah; Gracilaria sp.; kabupaten minahasa utara.

PENDAHULUAN (Gerung, 2004). Jenis alga yang paling banyak

terdapat di perairan Indonesia adalah Gracilaria,
Alga merupakan salah satu sumber daya hayati Eucheuma, Hypnea, Sargassum, Turbinaria,
perairan yang tumbuh melimpah di Indonesia Gelidium (Sahri and Suparmi, 2009). Gracilaria
33
 Journal of Aquatic Science & Management, Vol. 6, No. 2 (October 2018)
merupakan jenis alga merah dari famili
Gracilariaceae yang banyak ditemukan di perairan
Indonesia (Sahri and Suparmi, 2009). Gracilaria
terdiri dari 230 spesies (Lyra et al., 2015), yang
habitatnya tersebar luas dari perairan pantai tropis,
daerah temperatur sedang, sampai di daerah
beriklim dingin. Jenis alga dari genus Gracilaria
memiliki nilai ekonomis penting untuk
memproduksi agar (Oyieke and Kokwaro, 1995;
Vinobaba et al., 2016), menghasilkan etanol
(Amanullah et al., 2013), sebagai pakan abalone
(Iyer et al., 2004; Marinho-Sariano and Bourret,
2005), immunostimulan untuk udang (Maningas et
al, 2013; Arizo et al., 2016), pengelolaan limbah
(Sahu and Sahoo, 2013) serta untuk pengobatan
penyakit (kanker, AIDS, peradangan, artritis,
infeksi virus, bakteri dan jamur) (Almeida et al.,
2011).
Analisis molekuler alga genus Gracilaria
menggunakan sekuens gen rbcL (ribulose-1,5-
bisphosphate carboxylase/oxygenase large subunit)
telah dilakukan oleh beberapa peneliti, antara lain,
yaitu Destombe dan Douglas (1991), Freshwater et
al. (1994), Belorin et al. (2002), Gurgel et al.
(2003), dan Lyra et al. (2015). Akan tetapi, ekstrak-
si DNA dan amplifikasi gen rbcL dari jenis alga ini
seringkali sulit didapat dalam jumlah dan kualitas
yang ideal untuk analisis molekuler selanjutnya
(Tuney and Sukatar, 2001). Ekstraksi DNA sebagai
langkah paling awal yang dilakukan untuk analisis
molekuler, seringkali mendapatkan hasil berbeda
untuk masing-masing jenis alga, yang mana
prosedur yang berhasil digunakan pada satu jenis
alga dapat saja gagal digunakan untuk jenis alga
lain (Doyle and Doyle, 1987). Beberapa faktor pem-
batas untuk mendapatkan DNA berkualitas dari alga
adalah pada karakter dinding sel, komponen
polisakarida kompleks, kandungan polifenol dan
metabolit sekunder yang dihasilkan setiap jenis alga
(Doyle and Doyle, 1990; Phillips et al., 2001;
Tuney dan Sukatar, 2010).
Sejauh ini, prosedur ekstraksi DNA alga
dilakukan dengan berbagai metode, baik
konvensional (Hong et al.,1997; Wattier et al.,
2000; Phillips et al., 2001) maupun menggunakan
kit ekstraksi komersil (Geraldino et al., 2009;
Ruenes, 2010; Kim et al., 2012; Tan Ji, 2013; Yang
et al., 2013). Metode konvensional ekstraksi DNA
alga (Doyle and Doyle, 1987) seringkali telah
melalui beberapa bentuk modifikasi prosedur yang
disesuaikan kondisi masing-masing jenis alga yang
diteliti; sedangkan penggunaan kit ektraksi komersil
dapat menghasilkan kualitas hasil ekstraksi berbeda
untuk setiap pabrikan. Penelitian ini dilakukan
untuk mengetahui efektifitas metode ekstraksi DNA
34
menggunakan teknik konvensional dan kit ekstraksi
komersil untuk mendapatkan total DNA serta
menentukan kondisi PCR ideal untuk
mengamplifikasi gen rbcL pada alga merah
Gracilaria sp.
MATERIAL DAN METODA
Ekstraksi DNA genomik alga Gracilaria sp
Sampel alga Gracilaria sp. berasal dari
perairan Desa Bahoi, Kecamatan Likupang Barat,
Kabupaten Minahasa Utara (pada titik koordinat
126043’48’’ LU-12501’33” BT). Sampel diambil
dalam keadaan segar dan dimasukkan ke dalam
tabung facon 50 ml, yang telah berisi etanol
absolute; diberi label dan dibawa ke Laboratorium
Biologi Molekuler dan Farmasitika Laut, Fakultas
Perikanan dan Ilmu kelautan, Universitas Sam
Ratulangi, untuk analisis molekuler selanjutnya.
Isolasi DNA alga dilakukan dengan meng-
gunakan metode Cetyltrimethylammonium Bromide
(CTAB) (Gurgui and Piel, 2010 dalam Uria, 2013)
dan menggunakan metode ekstraksi DNA dari
innuPrep Plant DNA Kit (Jerman) dan Geneaid
Genomic Plant Mini Kit (Korea). Isolasi DNA
genomik menggunakan CTAB diawali dengan
merendam 1 gram thalus Gracilaria sp. dalam
nitrogen cair digerus hingga menjadi bubuk;
direndam dalam larutan lisis buffer (50 mM Tris-Cl
pH 7,5, 50 mM EDTA, 700 mM NaCl, 2% Sarkosil,
8 M Urea) sebanyak 500 µl dan diinkubasi pada
suhu 600C selama 60 menit. Sampel selanjutnya
diekstraksi (sebanyak 2 kali) dengan fenol/kloro-
form/isoamil-alkohol (25:24:1) dan disentrifugasi
pada kecepatan 11.000 rpm selama 5 menit.
Supernatan selanjutnya ditambahkan dengan
kloroform sebanyak 1 kali volume larutan dan
disentrifugasi pada 11.000 rpm untuk menghilang-
kan sisa fenol.
Pengendapan polisakarida dilakukan
dengan menambahkan 0.5% CTAB dan menginku-
basi sampel pada suhu 600C selama 10 menit;
kemudian sentrifugasi pada 11.000 rpm selama 5
menit. Pengendapan DNA dilakukan dengan
menambahkan etanol absolut 95% sebanyak 2 kali
volume supernatan, kemudian disentrifugasi pada
kecepatan maksimum selama 3 menit. Pelet DNA,
selanjutnya, dicuci dengan menggunakan etanol
70% dingin sebanyak dua kali untuk menghilangkan
sisa garam dan CTAB. Pelet DNA dikering-
anginkan dan dilarutkan dengan 50 µl ddH20 atau
EB buffer (EDTA 10 mM, Tris-Cl 50 mM, pH 7.0).
Isolasi DNA alga menggunakan innuPrep
Plant DNA Kit dilakukan berdasarkan prosedur
 Hengkengbala et al.: DNA extraction and amplification of the rbcL …
manual dari innuPrep Plant DNA Kit. Sampel alga
Gracilaria sp. diambil dari bagian thalus sebanyak
25 mg, direndam dalam nitrogen (N2) cair, digerus
menggunakan mortar dan pestel steril.
Hasil homogenasi ditambahkan pada larutan
lisis 400 µl dan Proteinase K sebanyak 25 µl,
divortex selama 5 detik dan diinkubasi selama 3 jam
pada suhu 550C menggunakan thermoblock. Sampel
dipindahkan ke dalam prefilter yang ditempatkan
dalam tabung receiver 2,0 ml dan disentrifugasi
pada kecepatan 12.000 rpm selama 1 menit.
Sebanyak 200 µl larutan pengikat SBS ditambahkan
ke dalam sampel yang dianalisis dan dihomogenkan
menggunakan pipet. Sampel dimasukkan ke dalam
spin filter dan ditempatkan dalam tabung receiver
2,0 ml yang baru kemudian disentrifugasi pada
12.000 rpm selama 2 menit. Spin filter dipindahkan
dalam tabung receiver 2,0 ml yang baru,
ditambahkan larutan pencuci HS sebanyak 500 µl
dan disentrifugasi pada kecepatan 12.000 rpm
selama 1 menit. Sampel dipindahkan pada tabung
receiver 1,5 ml yang baru, ditambahkan 750 µl
larutan pencuci MS, disentrifugasi pada kecepatan
12.000 rpm. Sampel dipindahkan pada tabung
receiver 2,0 ml yang baru, disentrifugasi pada
kecepatan maksimum untuk menghilangkan sisa
etanol. Spin filter ditempatkan dalam tabung elusi
2,0 ml, ditambahkan 150 µl buffer elusi. Inkubasi
dilakukkan pada suhu ruang selama 5 menit dan
disentrifugasi pada kecepatan 10.000 rpm selama 1
menit.
Isolasi DNA menggunakan Genomic DNA
Mini Kit (Plant) Geneaid dilakukan mengikuti
prosedur manual dari Genomic DNA Mini Kit
(Plant) dari Geneaid yang dimodifikasi. Sampel
alga Gracilaria sp. ditimbang seberat 50 mg,
dimasukkan ke dalam tabung ependorf yang telah
diisi 400 µl buffer GPX1 dan digerus dengan
mikropestel. Sampel diinkubasi pada suhu 600C
selama 3 jam, diinversi setiap 15 menit. Elution
buffer yang akan digunakan pada tahap elusi
dipanaskan terlebih dahulu pada suhu 600C selama
10 menit. Setelah diinkubasi ditambahkan100 µl
buffer GP2, divortex dan diinkubasi dengan es
selama 3 menit. Sampel dipindahkan ke dalam yang
telah ditempatkan pada collection tube 2 ml, filter
column kemudian dibuang setelah disentrifugasi
pada 10.000 x g selama 1 menit. Supernatan
dipindahkan ke dalam 1,5 ml microcentifuge tube.
GP3 buffer yang telah ditambah isopropanol
dimasukkan sebanyak 1,5 volume supernatan
kemudian di vortex selama 5 detik. Supernatan
dipindahkan dalam GD column yang telah
ditempatkan pada 2 ml collection tube dan
disentrifugasi pada 14.000-16.000 x g selama 2
35
menit. Hasil filtrasi dibuang. Buffer W1
ditambahkan sebanyak 400 µl kemudian
disentrifugasi pada 14.000-16.000 x g selama 30
detik, hasil filtrasi dibuang. Washing buffer yang
telah ditambah etanol dimasukkan sebanyak 600 µl,
disentrifugasi pada 14.000-16.000 x g selama 1
menit, filtrat dibuang. GD column yang telah
ditempatkan pada 2 ml collection tube baru,
disentrifugasi selama 3 menit pada 14.000-16.000 x
g untuk mengeringkan matriks kolom. Pencucian
dengan washing buffer diulangi sekali lagi
kemudian disentrifugasi pada 14.000-16.000 x g
selama 30 detik, filtrat dibuang. GD column yang
telah ditempatkan pada 2 ml collection tube baru,
disentrifugasi selama 3 menit pada 14.000-16.000 x
g untuk mengeringkan matriks kolom. Pindahkan
GD column pada 1,5 ml microcentifuge tube yang
baru. Tambahkan 100 µl elution buffer yang telah
dipanaskan atau TE buffer pada bagian tengah
matriks kolom. Diamkan selama 3-5 menit untuk
memastikan DNA larut dalam elution buffer atau
TE buffer dan disentrifugasi pada 14.000-16.000 x g
selama 30 detik.
Amplifikasi gen rbcL alga Gracilaria sp
Amplifikasi gen rbcL dilakukan mengguna-
kan mesin Polymerase Chain Reaction (PCR),
Biometra. DNA genom yang berhasil diektraksi
digunakan sebagai DNA template pada proses
amplifikasi. Komponen yang digunakan dalam
proses amplifikasi gen rbcL adalah 2x Ready to
Load Mastermix 12,5µl, masing-masing primer 1
µl, DNA template 1,5 µl, ddH2O 9 µl. Pasangan
primer yang digunakan adalah; pasangan primer
rbcL aF (5’-ATG TCA CCA CAA ACA GAG ACT
AAA GC-3’) dan rbcL aR (5’- GTA AAA TCA
AGT CCA CCR CG-3’) serta pasangan primer
rbcL-1F (5’ATGTCACCACAAACAGAAAC3’)
dan rbcL-724R (3’TCGCATGTACCTGCAG
TAGC5’) (Bafeel et al, 2012).
Amplifikasi gen rbcL dilakukan pada
kondisi suhu anneling berbeda, yaitu pada suhu
450C dan 500C menggunakan pengaturan suhu
gradient. Kondisi PCR dimulai dengan pre-
denaturasi pada suhu 950C selama 3 menit, diikuti
dengan 35 siklus proses yang terdiri atas; proses
denaturasi pada sushu 950C selama 30 detik, proses
annealing sesuai perlakukan (pada suhu 45 dan
500C) selama 40 detik dan proses elongasi pada
suhu 720C selama 50 detik. Proses akhir
amplifikasi dilakukan pada suhu 720C selama 2
menit. DNA hasil PCR divisualisasi menggunakan
elektroforesis gel agarosa 1%, 80 volt selama 40
menit dan diamati pada UV transiluminator.
 Journal of Aquatic Science & Management, Vol. 6, No. 2 (October 2018)
HASIL DAN PEMBAHASAN
Amplifikasi gen rbcL alga Gracilaria sp.
Amplifikasi gen rbcL dilakukan dengan
menggunakan primer rbcL aF-aR dan rbcL 1F-724
R dengan suhu annealing 500C dan 450C (Gambar
1).
Penggunaan primer gen rbcL pada suhu
annealing 500C dan 450C menunjukkan hasil
amplifikasi yang berbeda. Amplifikasi gen rbcL
menggunakan primer aF-aR pada suhu annealing
500C dan 450C tidak menunjukkan pita DNA pada
lintasan sampel. Dari hasil ini dapat diduga bahwa
penggunaan primer rbcL aF-aR tidak komplementer
dengan urutan basa pada DNA template. Pita DNA
hanya muncul pada hasil amplifikasi menggunakan
primer rbcL 1F-724R pada kondisi suhu annealing
500C sedangkan pada suhu annealing 450C tidak
terlihat pita DNA. Hasil tersebut mengindikasikan
bahwa pemilihan suhu annealing yang tepat dan
primer yang komplementer urutan basa dengan
DNA template pada proses amplifikasi dapat
mempengaruhi hasil amplifikasi gen target. Hasil
amplifikasi ini mendukung apa yang ditulis oleh
Rychlik et al. (1990) menyatakan bahwa pemilihan
suhu annealing yang tepat untuk primer merupakan
salah satu parameter keberhasilan proses
amplifikasi DNA dengan PCR. Rahayu and
Nugroho (2015) menyatakan bahwa salah satu
strategi untuk mendapatkan hasil amplifikasi yang
ideal adalah dengan menentukkan suhu annealing
Gambar 1. Hasil amplifikasi gen rbcL alga merah Gracilaria sp. pada suhu annealing 450C dan 500C
dengan primer berbeda; A). primer rbcL aF-aR, B). primer rbcL 1F-724R.
36
yang tepat dengan cara menaikkan atau menurunkan
suhu annealing secara bertahap 10C sampai tercapai
suhu yang sesuai.
Penggunaan primer rbcL 1F-724R dan suhu
annealing 500C, pita DNA target hasil amplifikasi
muncul pada posisi panjang nukleotida sedikit
diatas posisi pita marker 250 bp (1kb marker, Solis
Biodyne). Dapat diduga bahwa panjang nukleotida
yang dapat teramplifikasi menggunakan primer
rbcL 1F-724R dalam penelitian ini adalah sebesar
300 – 400 bp. Menurut Fay et al. (1997) hasil
amplifikasi penuh gen target dengan menggunakan
primer rbcL 1F-724R dapat diamati dengan
munculnya pita DNA pada panjang basa nukleotida
sekitar 723 bp. Munculnya pita DNA target pada
posisi antara 300-400 bp dalam penelitian ini
mengindikasikan keberhasilan amplifikasi gen
target secara parsial.
KESIMPULAN
DNA genom alga Gracilaria sp. specimen RLB1
berhasil diekstraksi dengan metode kit komersial
Geneaid Genomic DNA Mini Kit. Gen rbcL alga
Gracilaria sp. berhasil diamplifikasi dengan primer
forward 1F dan reverse 724R pada suhu annealing
500C pada kisaran 300-400 base pair. Posisi pita
pada kisaran tersebut mengindikasikan keberhasilan
amplifikasi gen target secara parsial.
 Hengkengbala et al.: DNA extraction and amplification of the rbcL …
Ucapan Terima Kasih: Terima kasih disampaikan
kepada Beivy Kolondam S.Si, M.Si, MS sebagai
kepala Laboratorium Bioteknologi Jurusan Biologi
FMIPA-Unsrat yang telah membantu dalam tahapan
ekstraksi DNA dan pengadaan primer untuk
amplifikasi.
REFERENSI
ALMEIDA, C.L.F., FALCAO, H.D., LIMA, G.R.
D., MONTENEGRO, C.D., LIRA, N.S. and DE
ATHAYDE, P.F. (2011) Bioactivities from
marine algae of the genus Gracilaria.
International Journal of Molecular Sciences,
12(7), 4550-4573.
AMANULLAH, T.R., KRISHNAN, D., BALAJI,
S.D. and GANESAN, K. (2013) Effective
production of ethanol-from-cellulose (EFC)
from cheap sources sawdust and seaweed
Gracilaria edulis. Advances in Applied Science
Research, 4(5), 213-222.
ARIZO, M.A.M., BERONCAL, R.A.G. and
CHUA, W.A.K.T. (2016) Immune response of
Macrobrachium rosenbergii immersed in
aqueous extract of Gracilaria edulis challenged
with white spot syndrome virus. AACL Bioflux,
9(2).
BELORIN, A.M., OLIVEIRA, M.C. and
OLIVEIRA, E.C. (2002) Phylogeny and sys-
tematics of the marine algal family
Gracilariaceae (Gracilariales, Rhodophyta)
based on SSU rDNA and ITS sequences of
Atlantic and Pacific species. Journal of
Phycology, 38, 551-563.
DESTOMBE, C.I. and DOUGLAS, S.E. (1991)
Rubisco Spacer Sequence Divergence in the
Rhodophyte Alga Gracilaria Verrucosa and
Closely Related Species. Curr. Genet. (5), 395-
8.
DOYLE, J.J. and DOYLE, J. (1990) Isolation of
plant DNA from fresh tissue. Focus, 12:13.
DOYLE, J.J. and DOYLE, J.L. (1987) A rapid
DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochem. Bull.
FAY, M.F., SWENSEN, S.M. and CHASE, M.W.
(1997) Taxonomic affinities of Medusagyne
oppositifolia (Medusagynaceae). Springer.
FRESHWATER, D.W., FREDERICQ, S.,
BUTLER, B.S, HOMMERSAND, M.H. and
CHASE, M.W. (1994) A Gene Phylogeny Of
The Red Algae (Rhodophyta) based on Plastid
rbcL. Proc. Natl. Acad. Sci. USA 91, 7281-
7285.
37
GERALDINO, J.P., CHANG, Y.E. and KIM, M.S.
(2009) Systematics of Hypnea asiatica sp. nov.
(Hypneaceae, Rhodophyta) Based on
Morphology and nrDNA SSU, Plastid rbcL, and
Mitochondrial Cox1. Taxon, 58(2), 606-616.
GERUNG, S.G. (2004) Biodiversity of Indonesian
seaweeds. In: Marine Science into the New
Millennium: New Perspective & Challenges.
Phang, S.M., Chong, V.C., Ho, S.C., Mokhtar,
N. and Sim, J.O.L. pp. 41-54.
GURGEL, C.F.D., LIAO, L.M., FREDERICQ, S.
and HOMMERSAND, M.H. (2003)
Systematics of Gracilariopsis (Gracilariales,
Rhodophyta) based on rbcL Sequence Analyses
and Morphological Evidence. Journal of
Phycology, 39, 154-171.
HONG, Y., KIM, S., POLNE-FULLER, M.,
GIBOR, A. (1997) DNA extraction conditions
from Porphyra perforata using LiCI. Journal of
Applied Phycology, 7, 101-107.
IYER, R., DE CLERCK, O., BOLTON, J.J. and
COYNE, V.E. (2004) Morphological and
taxonomic studies of Gracilaria and
Gracilariopsis species (Gracilariales,
Rhodophyta) from South Africa. South African
Journal of Botany, 70(4), 521-539.
KIM, K.M., IL, K.H. and YOON, H.S. (2012) Four
novel Gelidium species (Gelidiales,
Rhodophyta) discovered in Korea: G.
coreanum, G. jejuensis, G. minimum and G.
prostratum. Phycologia, 51.
LYRA, G. M., COSTA, E.S., DE JESUS P.B., DE
MATOS, J.C.G. and CAIRES, T.A. (2015)
Phylogeny Of Gracilariaceae (Rhodophyta):
Evidence from Plastid and Mitochondrial
Nucleotide Sequences. Journal of Phycology,
51, 356-366.
MANINGAS, M.B.B., GONZALEZ, P.G. and
OBIAS, M.M. (2013) Immune response of
Macrobrachium rosenbergii immersed in hot-
water extract of Gracilaria edulis. Philippine
Science Letters, 6(2).
MARINHO-SORIANO, E. and BOURRET, E.
(2005). Polysaccharides from the red seaweed
Gracilaria dura (Gracilariales, Rhodophyta).
Bioresource Technology, 96(3), 379-382.
OYIEKE, H.A. and KOKWARO, J.O. (1995)
Distribution and ecology of Gracilaria species
(Gracilariales, Rhodophyta) along the Kenyan
Coast. South African Journal of Marine
Science, 15(1), 43-48.
PHILLIPS, N., SMITH, C.M., MORDEN, C.W.
(2001) An effective DNA extraction protocol
for Brown Algae. Phycological Research, 49,
97-102.
 Journal of Aquatic Science & Management, Vol. 6, No. 2 (October 2018)
RAHAYU, D.A. and NUGROHO, E.D. (2015)
Biologi Molekuler dalam Perspektif
Konservasi. Plantaxia.
RUENES, J. (2010) DNA barcoding of Select
Freshwater and Marine Red Algae
(Rhodophyta). Cryptogamie, Algologie, 31 (4),
377-386.
RYCHLIK, W., SPENCER, W.J. and RHOADS,
R.E. (1990) Optimization of the annealing
temperature for DNA amplification in vitro.
Nucleic Acids Research, 18(21).
SAHRI, A. and SUPARMI. (2009) Mengenal
Potensi Alga : Kajian Pemanfaatan Sumber
Daya Alga Dari Aspek Industri Dan Kesehatan.
Sultan Agung, XLIV(118).
SAHU, N. and SAHOO, D. (2013) Study of
Morphology and agar contents in some
important Gracilaria species of Indian Coasts.
American Journal of Plant Sciences, 4, 52-59.
TAN, J. (2013) Molecular Studies of Kappaphycus
Doty and Eucheuma J. Agardh: Phylogenetics
and DNA Barcode Assess-ment. Thesis. Kuala
Lumpur: Institute of Biological Sciences
Faculty of Science University of Malaya.
38
TUNEY, I. and SUKATAR, A. (2010) DNA
extraction protocol from Brown Algae.
Biological Diversity and Conservation.
URIA, A. (2013) Investigating Natural Product
Biosynthesis in Uncultivated Symbiotic Bacteria
of the Marine Sponge Theonella swinhoei.
Disertation. Bonn: Universitat Bonn.
VINOBABA, P., KUMUDU and UMAKAN-
THAN, G. (2016) Distribution of Gracillaria
species (Gracillaria edulis, Rhodophyta) in
SriLanka. Researcher, 8(6), 50-58.
WATTIER, R.A., PRODOHL, P.A. and MAGGS,
C.A (2000) DNA Isolation Protocol for Red
Seaweed (Rhodophyta). Plant Molecular
Biology Reporter, 18, 275-281.
YANG, E.C., KIM, M.S., GERALDINO, P.J.L.,
SAHOO, D., SHIN, J. and BOO, S.M. (2013)
Mitochondrial cox1 and Plastid rbcL Genes of
Gracilaria vermiculophylla (Gracilaria-ceae,
Rhodophyta). Journal of Applied Phycology,
20, 161-168.
Received: 3 May 2018
Accepted: 15 July 2018