Anda di halaman 1dari 10

PAPER

EPIDEMIOLOGI FLU SINGAPORE

Dosen Pengampu : Sustriayu N, PhD

DISUSUN OLEH :
Nama : Monika Yoke Lusiani
NIM : 13.93.0056

PROGRAM STUDI MAGISTER HUKUM KESEHATAN


UNIVERSITAS KATHOLIK SOEGIJAPRANATA
SEMARANG
2014

FLU SINGAPORE
Flu Singapore adalah penyakit yang dikenal sebagai Hand, Foot, and
Mouth Disease (HFMD) dalam dunia kedokteran atau dalam Bahasa Indonesia
dikenal sebagai Penyakit Tangan, Kaki, dan Mulut (PTKM). Penyakit ini sudah
ada sejak tahun 1957 dan mulanya muncul di Toronto, Kanada. Istilah Flu
Singapore muncul karena saat itu banyak terjadi kasus dan kematian akibat
penyakit ini di Singapura. Karena gejala penyakit ini mirip dengan penyakit flu,
maka kemudian muncullah sebutan penyakit Flu Singapore. Pada tahun 1997,
31 anak meninggal dalam suatu wabah di Malaysia pada negara bagian Sarawak.
Pada tahun 1998, terjadi suatu wabah di Taiwan. Tercatat 405 anak sakit parah dan
78 meninggal. Jumlah kasus diperkirakan mencapai 1,5 juta kasus. Tahun 2006, 7
orang tewas dalam sebuah wabah di Kuching, Sarawak. Di Cina, wabah dimulai
pada Maret 2008 di Fuyang, Anhui, mengakibatkan terinfeksinya 25.000 anak, 42
meninggal. Pada tahun yang sama di Singapura dilaporkan lebih dari 2600 kasus.
Di Vietnam 2300 kasus dan 11 meninggal, Mongolia 1600 kasus, dan Brunei 1053
kasus. Awal tahun 2009 dilaporkan adanya kematian sebanyak 17 anak pada
wabah di Shandong, dan 18 anak di Henan, Cina. Di Indonesia penyakit ini
dimulai dari Jakarta, awal tahun 2009 dilaporkan terdapat 8 kasus, pada akhir
April lembaga-lembaga kesehatan di pusat kesehatan masyarakat Jakarta
mendukung penggunaan termal scanner di bandara untuk pencegahan, terutama
mereka yang habis pulang dari Singapura. Banyak pula orang yang mengatakan
bahwa penyakit ini disebabkan karena penyakit kuku-mulut dari hewan yang
menular kepada manusia. Padahal sebenarnya penyakit HFMD ini bukan penyakit
yang menular dari hewan dan juga bukan merupakan penyakit flu.
HFMD atau dikenal juga dengan sebutan PTKM merupakan penyakit
infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae,
genus Enterovirus, terutama virus Coxsackie Grup A, khususnya tipe A16. Di
dalam famili Picornaviridae, terbagi menjadi genus Enterovirus dan Rhinovirus.
Di dalam genus Enterovirus, terdiri dari Poliovirus, tipe 1-3 Coxsackievirus
kelompok A, tipe 1-24 (tidak ada tipe 23) Coxsackievirus kelompok B, tipe 1-6
Echovirus, tipe 1-34 (tidak ada tipe 10 dan tipe 28) dan Enterovirus, tipe 68-71.

Enterovirus adalah penghuni sementara saluran pencernaan manusia dan dapat


diisolasi dari tenggorokan atau usus bawah. Enterovirus yang bersifat
sitopatogenik

(Poliovirus,

Echovirus,

dan

beberapa

Coxsackievirus),

pertumbuhannya dapat segera terjadi pada suhu 36C sampai 37C dalam biakan
primer sel ginjal manusia dan monyet. Coxsackievirus yang termasuk dalam
genus Enterovirus, terbagi menjadi kelompok A dan B. Coxsackievirus kelompok
A serotipe tertentu menyebabkan penyakit herpangina Penyakit Tangan, Kaki,
dan Mulut (PTKM) dan konjungtivitis hemoragik akut. Coxsackievirus kelompok
B dapat menyebabkan penyakit pleurodinia, miokarditis, perikarditis, dan
meningoensefalitis. Penyebab HFMD yang paling sering pada pasien rawat jalan
adalah Coxsackievirus A16, sedangkan yang memerlukan perawatan karena
keadaannya lebih berat atau timbul komplikasi sampai menyebabkan pasien
meninggal disebabkan oleh Enterovirus 71.
Coxsackievirus A16 memiliki ukuran partikel 27 nm virion RNA
messenger 31% RNA di virion bersifat stabil dalam pH asam (pH 3,0-5,0)
selama 1-3 jam komposisi RNA: A=30%, U=24%, G=23%, C=23% memiliki
berat jenis apung kira-kira 1,34 gram /ml dalam CsCl. Virus ini sangat infektif
pada mencit yang baru lahir, yaitu dapat menyebabkan miositis yang meluas
dalam otot-otot lurik mencit yang baru lahir sehingga mengakibatkan kelumpuhan
lemas tanpa gejala-gejala lain. Sifat antigen dari Coxsackievirus yaitu sekurangkurangnya sekarang dikenal 29 tipe imunologik Coxsackievirus yang berlainan,
23 tipe terdaftar dalam kelompok A (termasuk Coxsackievirus A16) dan 6 tipe
terdaftar dalam kelompok B.
Virus yang termasuk genus Enterovirus, menular lewat mulut atau
tenggorokan. Virus menular pada jaringan mukosal dari tenggorokan, usus, atau
keduanya, akhirnya masuk ke dalam aliran darah dan meningkatkan akses ke
dalam sel dan menetapkan target organ tubuh, misalnya sumsum tulang belakang,
miokardium, dan kulit. Virus umumnya berada di dalam tenggorokan selama 1
minggu pertama dari atau saat sakit dan terdapat pada feses dari 1-4 minggu
setelah serangan penyakit, saat itu virus tersebut sudah dapat diisolasi dari urat
saraf tulang belakang, otak, hati, dan pada kulit yang luka.

Penyakit Tangan, Kaki, dan Mulut (PTKM) yang disebabkan oleh


Coxsackievirus A16 ini, sangat menular dan sering terjadi pada musim panas.
PTKM adalah penyakit yang sering terjadi pada kelompok masyarakat yang
berpenduduk padat dan umumnya menyerang anak-anak berusia antara 2 minggu
sampai 5 tahun (kadang sampai 10 tahun). Orang dewasa jarang menderita
penyakit tersebut karena daya tahan tubuhnya lebih kuat, walau kadang orang
dewasa bisa juga terserang penyakit ini. Penularannya melalui jalur fekal-oral
(pencernaan) dan saluran pernapasan, yaitu dari droplet, pilek, air liur, tinja, cairan
vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk,
baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak
ada vektor tetapi ada pembawa (carrier) seperti lalat dan kecoa. Kontak dalam
keluarga merupakan sumber utama infeksi Coxsackievirus A16 ini. Begitu virus
sudah masuk dalam keluarga, semua orang yang rentan dalam keluarga tersebut
biasanya terkena infeksi, meskipun tidak semuanya memiliki gejala klinis yang
nyata. Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM
lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi Coxsackievirus A16 ini
adalah 2 5 hari.
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan
nyeri tenggorokan yang timbul 1-2 hari sebelum timbul enantem. Enantem adalah
manifestasi yang paling sering pada PTKM. Lesi dimulai dengan vesikel yang
cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi
krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai
palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul
berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki,
pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong.
Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadi bula dan
biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi
menghilang tanpa bekas.
Mula-mula demam tinggi 2-3 hari, diikuti sakit faringitis, tidak ada nafsu
makan, pilek, gejala seperti flu pada umumnya yang tak mematikan. Timbul
vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan (lidah,
gusi, pipi sebelah dalam) terasa nyeri sehingga sukar untuk menelan. Bersamaan

dengan itu timbul rash/ruam atau vesikel, papulovesikel yang tidak gatal ditelapak
tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong.
Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu
dirawat di rumah sakit. Contoh penyakit Tangan, Kaki, dan Mulut (PTKM) dapat
dilihat pada gambar berikut:

Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit.
Gejala yang cukup berat tersebut antara lain:
-

Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C.

Demam tidak turun-turun

Takikardia

Takipneu

Malas makan, muntah, atau diare berulang dengan dehidrasi.

Letargi, lemas, dan mengantuk terus

Nyeri pada leher, lengan, dan kaki

Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial

Keringat dingin

Fotofobia (tidak tahan melihat sinar)

Ketegangan pada daerah perut

Halusinasi atau gangguan kesehatan

Komplikasi penyakit ini adalah:


-

Meningitis aseptik

Ensefalitis

Myocarditis (Coxsackievirus Carditis) atau pericarditis

Acute Flaccid Paralysis

Diagnosis banding penyakit ini adalah :

Vesicular Pharyngitis (Herpangina) - EV 70

Acute Lymphonodular Pharyngitis - Cox A 10


Sampel dapat diambil dari tinja, usap rektal, cairan serebrospinal dan

usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.


Spesimen dibawa dengan Hanks Virus Transport. Isolasi virus dengan cara
biakan sel dengan suckling mouse inoculation. Setelah dilakukan Tissue
Culture, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA,
CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan
titer. Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi virus :
- Immuno histochemistry (in situ)
- Imunofluoresensi antibodi (indirek)
- Isolasi dan identifikasi virus.
2. Deteksi RNA :
RT-PCR
Primer : 5 CTACTTTGGGTGTCCGTGTT 3
5 GGGAACTTCGATTACCATCC 3
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71
(BrCr, Nagoya) pada sel Vero. Uji elisa sedang dikembangkan. Sebenarnya
secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat
mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.
Penatalaksanaan kasus flu singapore seperti di bawah ini :
1. Istirahat yang cukup
2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja
berdasarkan keadaan klinis yang ada. Dapat diberikan:

Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

Pengobatan simptomatik:

Antiseptik di daerah mulut

Analgesik, misalnya parasetamol

Cairan cukup untuk dehidrasi yang disebabkan sulit minum karena demam

Pengobatan suportif lainnya (misalnya gizi)

Penyakit ini adalah self limiting diseases, yaitu dapat sembuh dengan
sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh
menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi
tersebut diatas. Anak yang menderita penyakit ini harus tetap mandi, namun ketika
menggosok tubuh dengan sabun harus perlahan agar bintil berairnya tidak pecah.
Bila demam penderita sangat tinggi, dapat dibantu dengan kompres dan obat
penurun panas. Jika bagian kulit yang terdapat ruam dan bintil berair terasa gatal,
dapat ditaburi dengan bedak pengurang rasa gatal. Bintil yang pecah dapat diberi
salep antibiotik untuk mencegah menyebarnya infeksi. Pasien yang tidak mau
makan dan minum, tubuhnya akan menjadi kekurangan cairan (dehidrasi),
sehingga rentan terhadap infeksi yang lebih berat. Untuk pasien seperti itu, maka
perlu dirawat di rumah sakit agar mendapat terapi cairan yang cukup. Dalam
jumlah kecil, juga terdapat pasien yang mengalami komplikasi yang cukup berat
yaitu ensefalitis (radang selaput otak). Pasien HFMD dengan ensefalitis memiliki
gejala demam yang terus menerus tinggi dan hilang kesadaran. Bila seperti itu,
maka harus segera dibawa ke pusat pelayanan kesehatan terdekat agar pasien bisa
mendapatkan perawatan yang memadai dan intensif.
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang
baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan
kepadatan lingkungan, kebersihan (Higiene dan Sanitasi) lingkungan maupun
perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan
selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi
peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi. Selalu
waspada dan segera berobat apabila anak tidak mau makan-minum, muntah terusmenerus dan selalu mengantuk tapi anak sukar dibangunkan. Anak yang terserang
penyakit ini bisa dipertinggi daya tahan tubuhnya dengan tetap makan secara
teratur, dengan gizi yang baik, makanan hendaknya cukup mengandung protein

dan kalori. Dianjurkan minum sebanyak mungkin, terutama sari buah segar,
sekaligus untuk mencukupi kebutuhan vitamin dan mineral anak yang terserang
penyakit ini, sebaiknya sari buah yang diberikan berupa jus buah, seperti jus
jambu, jeruk, mangga atau apel. Bila perlu anak tidak bersekolah selama satu
minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu
diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah
gejala hilang, yang penting menjaga kebersihan perorangan. Di Rumah sakit,
Universal Precaution harus dilaksanakan. Penyakit ini belum dapat dicegah
dengan vaksin (Imunisasi).
Ruam dan bintil berair membuat PTKM kadang dianggap sebagai
penyakit lain, seperti cacar air. PTKM sebenarnya berbeda dengan cacar air,
perbedaannya yaitu :

Pada PTKM biasanya ruam dan bintil berair hanya terdapat di daerah tangan,
kaki, dan mulut, sedangkan pada campak dan cacar air, ruam timbul mulai
dari daerah tubuh hingga ke wajah, tangan, dan kaki

Pada PTKM, bila bintil berairnya pecah, setelah sembuh tidak menimbulkan
bekas, sedangkan pada cacar air setelah pecah bintil berair akan menjadi
keropeng

Selain ruam dan bintil berair, yang paling khas pada PTKM adalah luka di
dalam mulut, terutama lidah yang sangat nyeri, sedangkan pada cacar air
tidak ada luka di dalam mulut.

UPAYA PEMERINTAH DALAM HAL INI

Meningkatkan survailans epidemiologi (perlu definisi klinik)

Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM


untuk memotong rantai penularan

Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM

Menjaga kebersihan perorangan

Bila anak tidak dirawat, harus istirahat di rumah karena daya tahan tubuhnya
menurun dan agar si anak tidak menularkan penyakitnya ke balita lain

Menyiapkan

sarana kesehatan

tentang

pelaksanaan Universal Precaution nya.

tatalaksana

PTKM

termasuk

DAFTAR PUSTAKA
Collier, L., 1998, Microbiology and Microbial Invection Virology, volume I, ninth
edition, 486, 487, 494, Oxford University Press, New York
Jawetz, dkk., 1996, Mikrobiologi Kedokteran, 471, 472, 478, 479, EGC Press,
Jakarta
Johnson, A., 1994, Microbiology and Immunology, 147, Binarupa Aksara, Jakarta
Journal of Clinical Microbiology, October 2001, p.3690-3692, Vol. 39, No. 10
Majalah Dokter Kita, Februari 2008, edisi 02, tahun III, 68-69, PT Dian Rakyat,
Jakarta
Anonim, 2008, Hand-Foot-Mouth Disease, http://www.infeksi.com/articles.php?
lng=in&pg=44
Anonim,

2008,
Mencegah
Penyakit
Flu
Singapura,
http://www.freelists.org/archives/pistons92/06-2004/msg00018.html

Anonim,

2008,
PTKM,
http://www.nlm.nih.gov/medlineplus/ency/images/ency/tnails/2941t

Anonim,

2008,
Coxsackievirus
A16,
http://vietnamnet.vn/dataimages/200604/original/images943451_coxR1