OLEH :
I GEDE BIM SHIDDI PRAMA PUTRA 1809511095
I NYOMAN WIDYA PUTRA ADNYANA 1809511096
KELAS C
UNIVERSITAS UDAYANA
DENPASAR
2020
KATA PENGANTAR
Puji syukur kehadirat Tuhan Yang Maha Esa atas segala rahmat dan karunia
dari beliau sehingga tugas paper Black Head ( Histomonosis ) Trichomonosis ini dapat
tersusun hingga selesai. Adapun paper ini kami susun untuk memenuhi persyaratan
nilai tugas dalam mata kuliah Ilmu Penyakit Parasiter Veteriner.
Penyusun
ii
DAFTAR ISI
iii
DAFTAR GAMBAR
iv
BAB I
PENDAHULUAN
1
1.2 Rumusan Masalah
1.3 Tujuan
2
BAB II
TINJAUAN PUSTAKA
2.1 Etiologi
Histomonad dapat ditemukan didalam epitel usus cacing sekum yang sangat
muda atau cacing yang baru menetas. Cacing tanah dapat bertindak sebagai hospes
transpor yang merupakan tempat menetasnya telur Heterakis gallinarum dan
selanjutnya cacing muda yang infektif akan tinggal didalam jaringan. Dalam hal ini,
cacing tanah mengumpulkan cacing Heterakis gallinarumdari dari lingkaran
peternakan. Pada ayam yang terinfeksi oleh Heterakis gallinarum , maka larva yang
terinfeksi oleh histomonas meleagridis akan mencapai sekum dalam waktu yang
singkat setelah diingesti oleh ayam
Histomonas sp, bentuk bebas tidak dapat bertahan lama, tetapi protozoa tersebut akan
lebih resisten jika terdapat didalam telur cacing sekum atau dalam bentuk didalam
cacing tanah.
3
2.2 Siklus Hidup
4
Perubahan Makroskopik
Lesi pada hati biasanya terdiriatas daerah nekrosis berwarna kekuning kuningan yang
berbentuk sirkular yang menyerupai kawah dengan diameter 1cm dan dikelilingi oleh
cincin yang menonjol di atas permukann hati. Bentuk lesi pada hati dapat bervariasi,
meskipun bentuk lesi sirkular paling sering dijumpai pada kasus histomonasiasis. Pada
infeksi berat, lesi pada hati dapat berukuran kecil, banyak dan letaknya berada di bawah
permukaan hati dan meliputi sebagian besar organ tersebut. Hati dapat membesar dan
berwarna hijau atau kecoklatan, kadang pada paru, ginjal, limpa dan mesenterium dapat
ditemukan adanya daerah nekrosis yang berbentuk bulat dan berwarna keputih-putihan.
Perubahan Mikroskopis
Invasi awal pada dinding sekum ditandai dengan adanya hiperemia dan
infiltrasi heterofil. Sekitar satu minggu pasca infeksi, sejumlah histomonad akan
terlihat pada daerah lamina propia sebagai benda ovoid dalam lekuk (lakuna) yang
tercat pucat. Pada periode tersebut akan dijumpai juga adanya sejumlah besar limfosit,
makrofag dan heterofil. Lumen sekum dapat terisi suatu massa yang berbentuk pasta
yang terdiri atas suatu epitel yang mengalami fibrin, deskuamasi, eritrosit, leukosit, dan
feses. Sekitar 2 minggu pasca inavasi dapat dijumpai adanya sejumlah giant cell pada
jaringan sekum.
5
dan limfosit disekitar pembuluh darah. Setelah 2 minggu pasca invasi akan terlihat
infiltasi makrofag dan limfosit yang ektensif dan sejumlah heterofil. Hepatosit di
bagian tengah dari lesi akan mengalami nekrosis dan disintegrasi, Pada periode tersebut
dapat ditemukan adanya sejumlah histomonad dalam lakuna disekitar bagian tepi lesi.
Jika proses infeksi berlanjut maka nekrosis akan lebih ekstensif dan histomonad
akanditemukan pada umumnya sebagai suatu benda kecil di dalm makrofag. Jika
terjadi penyembuhan, maka akn dijumpai adnya foki limfosit yang disertai oleh daerha
fibriosis dan hepatosit yang mengalami degenerasi.
2.4 Diagnosa
Diagnosis sangkaan di dasarkan pada gejala klinis dan perubahan patologi yang
spesifik untuk penyakit tersebut. Untuk diagnosa akhir dapat didasarkan pada
identifikasi histomonad dengan cara pemeriksaan mikrokopis secara langsung atau
setelah jaringan diwarnai dengan cat tertentu meliputi hematosiklin dan eosin (H&E)
atau periodic accid schiff (PAS). Isolasi histomonas melagridis secara in vitro dapat
dilakukan pad medium Dwyer’s yang dimodifikasi. Pada uji tersebut contoh jaringan
harus diambil dari unggas yang baru mati.
6
2.5 Gejala Klinik
Lesi yang timbul oleh histomoniasis biasanya lebih parah jika terjadi infeksi
campuran dengan clostridium perfringens atau escherichia . Coli. Gejala awal akibat
histomoniasis pada kalkun meliputi feses yang berwarna kekuning kuningan,
mengantuk, sayap menggantung, berjalan dengan langkah yang kaku, mata tertutup,
kepala digantung, anoreksia, bapsu makan meningkat, bulu kusam dan berdiri. Kulit
didaerah kepala berwarna kebiru-biruan (sianotik) , tetapi dapat juga berwarna normal.
Sehunbungan dengan adanya sianosis tersebut, sehingga histomoniasis juga dikenal
dengan nama black head. Setelah 12 hari masa infeksi kalkun akan mengalami
emisiasi.
Masa inkubasi penyakit tersebut sekitar 7-12 hari dan biasanya berlangsung
khronik sampai unggas tersebut mati. Infeksi pada ayam mungkin bersifat ringan atau
tidak teramati, tetapi dapat juga berlangsung parah dan menyebabkan mortalitas yang
tinggi . Kotoran yang berwarna kekuning kuningan jarang ditemukan pada ayam, tetapi
kotoran yang berwarna merah campuran darah yang berasal dari sekum dapat diamati
pada ayam. Mortalitas pada kalkun muda umr 3-12 minggu mencapai 50%. Mortalitas
akibat histomonasiasis pada ayam biasanya rendah tetapi pada sejumlah kasus bisa
mencapai >30%.
7
Lesi yang ditimbukan oleh Histomonas meleagridis biasanya lebih parah jika
terjadi infeksi sekunder oleh Clostridium perfringrs atau Escherichia coli.
Gejala awal akibat histomoniasis pada kalkun meliputi feces yang berwarna
kekuning kuningan menyerupai belerang, mengantuk,sayap menggantung,
berjalan dengan langkah yang kaku, mata tertutup, kepala digantung
mendekati badan, anoreksia, nafsu minum mengkat, bulu kusam dan berdiri.
Kulit dikepala berwarna kebiru biruan(sianotik) tetapi dapat juga berwarna
normal.berhubungan dengan sianotik tersebut maka histomoniasis dikenal
juga dengan nama BLACK HEAD. Sekitar 12 hari pasca infeksi, maka kalkun
biasanya mengalami emasiasi.
Masa inkubasi penyakit tersebut berkisar 7-12 haridan biasanya berlangsung
kronis sampai ayam tersebut mati. kotoran berwarna kuning seperti belerang
jarang terjadi, tetapi Kotoran yang bercampur darah yang berasal dari sekum
dapat diamati. Mortalitas pada kalkun muaumur 3-12 minggudapat mencapai
50%, sedangkan pada ayam hanya 30 %.
Protozoa tersebut dapat dikeluarkan bersama feses ayam yang terinfeksi dan
dalam telur cacing heterakis gallinarum. Penularan biasanya terjadi jiak ungags yang
sensitive menelan telur cacingsekum yang ifeksi selanjutnya larva histomonad akan
dibebaskan dari larva heterakis sp. di dalam sekum.
Protozoa tersebut sangat resistan jika berada didalam telur cacin, larva, atau
cacing tana, dan akan mencemari lingkungan peternakan. Histomonas meleagridis akan
ditularkan dari ayam/kalkun pada periode pemeliharaan satu ke lainnya jika menelan
cacing tanah atau telur cacing sekum yang terinfeksi oleh protozoa tersebut.
8
2.7 Pengendalian, Pengobatan dan Pencegaahan
9
BAB III
PENUTUP
3.1 Kesimpulan
10
DAFTAR PUSTAKA
Ariputuamijaya.2010.histomoniasis.(https://ariputuamijaya.wordpress.com/2011/1
2/10/histomoniasis/ ).
11
687002
brief-report2017
VDIXXX10.1177/1040638716687002Characterization of histomoniasis in peafowlClarke et al.
Brief Communication
Abstract. Histomonas meleagridis is a flagellate protozoan organism that can cause severe necrotizing typhlitis and
hepatitis in gallinaceous birds. Peafowl (Pavo spp.) have been shown to be susceptible to histomoniasis in experimental
settings, but there are few reports of natural histomoniasis in this species. A retrospective study of the archived cases at
2 veterinary diagnostic laboratories in the United States yielded 5 cases of peafowl with gross and histologic findings
characteristic of histomoniasis. Lesions included bilateral, transmural fibrinonecrotic typhlitis and multifocal necrotizing
hepatitis with associated trophozoites morphologically consistent with H. meleagridis. There was no evidence of Heterakis
gallinarum infestation in the studied cases. DNA was extracted from formalin-fixed, paraffin-embedded liver and ceca from
all 5 cases and was analyzed using multiple sets of primers with subsequent sequencing and genotyping. Four samples were
positive for H. meleagridis, and 1 sample was positive for both H. meleagridis and Tetratrichomonas gallinarum. These
results confirm that peafowl develop clinical disease similar to that described previously in other gallinaceous birds infected
by H. meleagridis. The role of T. gallinarum remains unknown and further research is necessary to elucidate its role, if any, in
the pathogenesis of the observed lesions.
Table 1. Primers used for polymerase chain reaction in 5 cases 72°C for 10 min. In PCR-3, novel detection primers to
of histomoniasis in peafowl. amplify a region upstream of the β-tubulin gene identified by
PCR assay/ genetic sequencing of H. meleagridis are described (Table 1).
Primer Sequence 5′–3′ Reference Cycling parameters for the amplification were 1 cycle of
95°C for 1 min; 35 cycles of 95°C for 15 s, 45°C for 15 s, and
PCR-1
ITSF TGCTTCACTTCAGCGGGTCTTCC 5 72°C for 1 min; followed by a final elongation step at 72°C
ITSR CGGTAGGTGAACCTGCCGTTGG 5 for 10 min. Following amplification, all PCR amplicons from
PCR-2 all 3 reactions were separated by gel electrophoresis using 1%
18S-F GCAGTTAAAACGCTCGTAGTC 1 agarose gel, stained,c and visualized with blue light. DNA was
18S-R AACGCTAGACAGGTCAACCC 1 purified using extraction kitsd and ligated into a vectorc per
PCR-3 the manufacturer’s instructions. The DNA transformation
Detect-F GGTTCATGCTGTACTATTGAG Current study
procedure was performed using competent cellse and 2 mL of
Detect-R GTGAACAATTTCACGCACC Current study
ligation-reaction per the manufacturer’s instructions. Compe-
tent cells containing the vector with PCR product insert were
detected by plating 50 μL of the transformation mixture on
peafowl may have increased susceptibility to H. meleagridis lysogeny broth (LB) agar plates supplemented with 100 mg/
compared with other gallinaceous birds.9 There are few mL of carbenicillin. Two to 3 colonies, if available, were iso-
reports describing naturally occurring disease in peafowl, but lated and propagated in LB supplemented with 100 mg/mL of
commercially raised birds suffered outbreaks similar to those carbenicillin. Plasmid DNA was isolated using a kitf per the
described in chickens and turkeys.5 Our study describes the manufacturer’s instructions. Sequencing of the inserts was
pathologic and molecular features of 5 cases of histomonia- performed using pJET 1.2 forward and reverse sequencing
sis in peafowl. primers at the Integrated Biotechnology Laboratories (Uni-
We performed a retrospective search for cases of histomo- versity of Georgia, Athens, Georgia). Sequences obtained
niasis in peafowl that were submitted for autopsy at the Uni- from our study and other related sequences were aligned
versity of Georgia Athens Veterinary Diagnostic Laboratory using a multisequence alignment program.15
(Athens, Georgia) and the Ohio Department of Agriculture Reported ages of the retrieved cases ranged from 3 wk to
Animal Disease Diagnostic Laboratory (Reynoldsburg, 16 mo (Table 2). Gross findings were fairly consistent among
Ohio) between 2000 and 2015. All relevant information the cases and consisted of bilateral necrotic cecal cores of
(clinical history, pathology report, and ancillary testing) was white-to-tan, fibrinous-to-caseous material (4 of 5), marked
reviewed. Hematoxylin and eosin–stained slides from all cecal distention (4 of 5), with occasional cecal wall thicken-
cases were also reviewed. Tissues available varied among ing and transmural necrosis (1 of 5; Fig. 1). Cases 3–5 had
cases, but ceca and liver were examined in all cases. hepatomegaly and multifocal hepatic necrosis, as evidenced
DNA was extracted from formalin-fixed, paraffin-embed- by multiple white-to-gray, 1–2 mm diameter, subcapsular
ded liver and ceca using DNA extraction kitsa per the manu- foci that were distributed throughout the parenchyma. These
facturer’s instructions. Extracted DNA from each tested case foci occasionally had a central area of depression with a sur-
was analyzed by polymerase chain reaction (PCR) using 3 rounding ring of hemorrhage. Histologically, all cases had
different sets of primers to amplify the internal transcribed fibrinonecrotic typhlitis and necrotizing hepatitis. The cecal
spacer (ITS) region (PCR-1), the 18S rRNA gene (PCR-2), mucosa was effaced by necrosis and hemorrhage with loss of
and a conserved region upstream of the β-tubulin gene (PCR- stromal structures. The lamina propria was expanded by het-
3; Table 1). PCR components included 1–2 μL of extracted erophils and macrophages, with fewer lymphocytes and
DNA in a 25-μL reaction containing PCR beadsb and 20 pM plasma cells that also extended to the submucosa, muscle
each of forward and reverse primers. Nuclease-free water was layers, and serosa (Fig. 2). Within these lesions were multi-
used as a negative control to detect contamination, and DNA ple, extracellular and intrahistiocytic, round, 10–20 µm
isolated from a laboratory-propagated strain of H. meleagri- diameter, periodic acid–Schiff (PAS) reaction positive proto-
dis was included as a positive control. In PCR-1, the ITS zoal trophozoites with central dark nuclei (Fig. 2 inset). Tro-
region was amplified using Trichomonadidae-family wide phozoites were also present within intraluminal debris and
ITSF and ITSR primers described in previous studies (Table infiltrating into less affected adjacent lamina propria and
1).8 Cycling parameters for the amplification were 1 cycle of submucosa. Expanding the liver were multiple, extensive
95°C for 1 min followed by 35 cycles of 94°C for 15 s, 48°C areas of necrosis characterized by hepatocytes with shrunken,
for 15 s, 72°C for 1 min, and a final extension at 72°C for 15 hypereosinophilic cytoplasm and pyknotic nuclei that were
min. In PCR-2, the 18S rRNA gene of H. meleagridis was surrounded by layers of epithelioid macrophages and hetero-
amplified using primers described previously (Table 1).1 phils with fewer lymphocytes and plasma cells and
Cycling parameters for the amplification were as follows: 1 intralesional protozoa. Overall, there were fewer protozoal
cycle of 95°C for 1 min; 35 cycles of 95°C for 15 s, 53°C for organisms in the liver than in the ceca. Protozoal organisms
15 s, and 72°C for 1 min; followed by final elongation step at were also less frequently associated with overt necrosis. Two
Characterization of histomoniasis in peafowl 239
Table 2. Signalment, origin, and pathologic and diagnostic features of 5 cases of histomoniasis in peafowl.*
PCR
Case Sex Age Origin ITS 18S rRNA Detection Sequencing results
1 F 3 wk UGA-AVDL + + + Histomonas meleagridis
2 M 3 wk UGA-AVDL + + + H. meleagridis
3 M 16 mo ODA-ADDL – + + H. meleagridis
4 M 16 mo ODA-ADDL + + + H. meleagridis; Tetratrichomonas gallinarum
5 M 16 mo ODA-ADDL – + + H. meleagridis
* F = female; M = male; ODA-ADDL = Ohio Department of Agriculture Animal Disease Diagnostics Laboratory; UGA-AVDL = University of Georgia
Athens Veterinary Diagnostic Laboratory.
juvenile birds (cases 1, 2) lacked gross hepatic lesions and with intralesional fungal hyphae (1 of 5), and ingluvial can-
had less severe histologic changes in the liver compared to didiasis (1 of 5).
the older birds (Figs. 3, 4). Hepatic lesions in these 2 juvenile Reported ancillary tests included fecal flotation and fecal
birds were primarily portal. Less frequent changes included smears, as well as aerobic, anaerobic, and Salmonella spp.
necrotizing airsacculitis with intralesional protozoa (2 of 5), bacterial culture. No birds were positive on fecal smear for
areas of pulmonary necrosis surrounded by epithelioid mac- coccidia or other protozoa. E. coli and C. perfringens were
rophages and multinucleate giant cells (necrogranulomas) isolated from both the intestine and liver in case 4. No birds
240
Clarke et al.
were positive for Salmonella spp. Only case 3 was reported shed by carrier species (chickens and pheasants) in contact
to have received treatment prior to death, including metroni- with peafowl. Other forms of transmission, such as cloacal
dazole, fenbendazole, and enrofloxacin. drinking and reverse peristalsis, ingestion of insects, and
All tested birds were positive on at least 2 of the 3 PCR through human handlers have been documented in poultry,11
reactions (Table 2). The ITS region did not amplify in cases but it is unknown if any of these alternative routes are rele-
3 and 5, whereas the 18S rRNA region and novel detection vant to the disease spread in our cases.
primers described to be specific for H. meleagridis did Many of the phylogenetic studies examining H. meleagri-
amplify appropriate sequences in all 5 cases. The remaining dis isolates and other parabasalid protozoa have focused on
3 cases were positive using all 3 primer sets. Case 4 was the internal transcribed spacer 1–5.8S rRNA–internal tran-
positive by sequencing for both H. meleagridis and T. gal- scribed spacer 2 (ITS1-5.8S-ITS2) regions of the ribosomal
linarum. gene, which are noncoding sequences with less conservation
There is some evidence that young turkeys and chickens pressure, leading to high genetic variability.1,5,8,17 Multiple
are thought to be more susceptible to infection with H. sequence variants, however, can exist within a single isolate,
meleagridis, although mature turkey flocks can also experi- necessitating the need for C-profiling or sequencing to accu-
ence severe disease.9 A similar age-related trend is suggested rately characterize H. meleagridis strains.8 Subtyping into 2
by our data set, wherein the age range of affected peafowl phylogenetically distinct genotypes has been done using
varied from juvenile to young adult birds. However, given sequences at the 18S rRNA and rpb1 loci, but these analyses
the small number of birds in our study, it is difficult to ascer- still require deep sequencing.1 The novel detection primers
tain the extent of this correlation. The gross and histologic described in our study were designed to obtain a uniquely
changes in the current cases were consistent among the sam- sized amplicon of H. meleagridis that would allow diagnosti-
ples and were compatible with previous descriptions of his- cians to distinguish H. meleagridis isolates from other para-
tomoniasis in other gallinaceous birds.4,9,11 Concurrent basalid organisms without relying on sequencing. In the
infections with other pathogens, similar to our observations, small sample size in this study, PCR results correlated with
have also been described previously and may be related to sequencing results. Sequencing was still necessary to distin-
concurrent immunosuppression in affected birds.11 Hepatic guish the single case of dual infection of H. meleagridis and
lesions in our study were not as severe as those seen in tur- T. gallinarum (case 4). It is difficult to interpret the presence
keys, which was also noted in previous experimental histo- of T. gallinarum genetic sequences in this case. Further
moniasis in peafowl.9 These lesions tend to be portal at early research would be necessary to determine a possible role of
stages of infection, but become more extensive as the disease T. gallinarum in the development of the observed lesions in
progresses.4 Although no information on clinical course was these cases or a potential H. meleagridis/T. gallinarum coin-
available from our cases, the fact that the hepatic lesions in fection. In an early pilot study, our novel primers were able
the 2 juvenile birds (cases 1, 2) were less severe and primar- to detect T. gallinarum infection in a subset of peafowl cases
ily portal when compared to the older birds (cases 3–5) may originally diagnosed as histomoniasis (data not shown).
imply that the juvenile birds may have died at an earlier stage Although the ability of T. gallinarum to cause disease in the
of infection. There are reports of H. meleagridis genotype 2 lower intestinal tract of birds is debatable given inconsistent
causing more severe cecal changes without concurrent experimental results,12 reports of naturally occurring T. gal-
hepatic lesions, implying that affected tissues may depend linarum infection in gallinaceous and anseriform birds have
directly or indirectly on genetically modified parasitic viru- been described.5,6,13 Our results, however, may imply that
lence factors.3 coinfections with H. meleagridis and T. gallinarum or with T.
There was no evidence of H. gallinarum infestation in any gallinarum alone may be more common than currently
of the examined cases in our study, which is also consistent expected.
with previous experimental infections in peafowl.9 To our Differentiating H. meleagridis from other parabasalid
knowledge, H. gallinarum infection without concurrent H. organisms or even from other kingdoms of pathogenic
meleagridis infection has not been attempted or described in agents may not be precise or accurate using only routine
peafowl and, therefore, it is unknown how susceptible pea- histologic examination. It has long been considered diffi-
fowl are to H. gallinarum infection. Species differences in cult to distinguish H. meleagridis on light microscopy
susceptibility have been described in other gallinaceous from fungal organisms, necessitating the use of special
birds, which could explain our findings.16 Alternatively, stains such as PAS or Grocott methenamine silver.11 It may
severe pathologic changes in the ceca caused by H. melea- be also difficult to distinguish H. meleagridis and T. gal-
gridis infection may provide an inhospitable environment for linarum on cecal smears, which was one of the standard
H. gallinarum.9,16 In such cases, where H. gallinarum is means of detection of Histomonas for many decades.5 For
unable to complete its life cycle, the magnitude of clinical these reasons, routine histopathology and immunohisto-
disease in susceptible birds caused by H. meleagridis should chemistry should be interpreted in conjunction with PCR
depend on the number of infected eggs present in the soil or using species-specific primers for H. meleagridis as a
Characterization of histomoniasis in peafowl 241
ROSS NOTE Jose J. Bruzual, Senior Poultry Veterinarian; Colin Adams, Company Veterinarian
INTRODUCTION
Histomoniasis or Blackhead is a complex disease process. Although primarily affecting turkeys
with lesions in the ceca and liver, blackhead can also have a significant impact on chickens
(where lesions are often confined to the ceca only).
Blackhead is caused by the protozoan flagellate, Histomonas (H.) meleagridis, which has a
broad host range, infecting gallinaceous birds including, pheasants, partridges, and bobwhite
quails in addition to chicken and turkeys.
With the ban on many of the drugs used to fight the disease, and changes in animal husbandry
like reusing litter and/or increased stocking density, blackhead has re-emerged in many areas
including North America and Europe. The focus for control of blackhead is now on prevention
and the use of new diagnostic methods to better understand how to manage and eradicate the
disease.
Outside the host (or intermediate host: Heterakis gallinarum), H. meleagridis has a low
persistency and survival time, although it has been shown to survive for up to 9 hours in water
or fecal material. There is also some evidence that a cyst like stage can develop allowing the
protozoa to survive for extended periods in the environment, although this is as yet unproven.
An Aviagen Brand
Ross Note – Histomoniasis (Blackhead)
Histomoniasis Biosecurity
Vectors (disease carriers) (Blackhead) Dirt floors and litter with cecal
worms and eggs are a RISK
Ingestion of cecal worm eggs, larvae or
Do not pile or spread litter nearby
adults
Do no re-use contaminated litter
Ingestion of earthworms containing eggs
Do not place birds on untreated
infected with histomonads
Organism dirt floors
Possibly by transmission from
Ensure adequate cleaning and
beetles/flies mechanically carrying the ingested
disinfection procedures are in place
histomonads
Change clothing and footwear
Rodents, equipment and other fomites
between sheds
such as clothes, footwear, etc.
Do not move equipment between sheds
Flood water may act as a trigger for
earthworm activity Organism
reaches ceca
Cecal wall
Cecal worms
thickening
(Heterakis gallinarum)
and damage
Eggs passed in feces
Cecal cores
develop
Organism
Facilitated by
enters blood
concurrent infection
stream and with bacteria/coccidia
reaches liver
Liver may
present with
necrotic
lesions
CLINICAL SIGNS
AND DEATH
2
Ross Note – Histomoniasis (Blackhead)
Clinical signs normally develop 7-14 days after infection although in experimental infections pathology can be seen
between 5 and 19 days post infection. Field observations suggest that co-infection with coccidia, mostly E. tenella,
may increase clinical signs. Initially the ceca will become swollen with a thickened wall; in more advanced cases,
cecal cores develop (accumulations of clotted blood and tissue). Liver lesions are highly variable, but typically
manifest as circular depressed target-like areas up to 1 cm/0.4 inch in diameter. However, in chickens, liver lesions
do not always develop despite the development of cecal cores.
If blackhead is suspected, birds should be submitted to a diagnostic lab for post mortem examination.
• Macroscopically (via necropsy/autopsy). It is important to differentiate between infections with agents such as
salmonellosis and coccidiosis as the lesions created by these infections can be easily mistaken for Histomoniasis
lesions (all three entities can produces cecal cores). However, cecal lesions together with liver lesions are
representative of a blackhead infection.
• Microscopically. The protozoa can easily be found in affected ceca and livers. This should be confirmed with
histopathology (taking tissues samples to confirm the presence of histomads), at least for the first case in an
outbreak.
Studies within Europe have found two different genotypes of H. meleagridis – Genotype 1 and Genotype 2. The
differences between these two genotypes and the effect this has on the severity or harmfulness of the disease
(virulence) between and within the genotypes needs further research.
1. Diagnostic examination of blood serum (serology) – Indirect sandwich ELISA (Enyme Linked Immunosorbent
Assay; a technique to measure the presence of antibodies) is available but, as yet, not sufficiently reliable as a
sole diagnostic tool due its potential to produce false positives. Currently this is not an effective screening test.
2. PCR – Several substrates have been trialed including boot and cloacal swabs, but dust appears to be the
substrate that is most suitable for a house diagnosis. Blackhead PCR kits vary in their sensitivity and specificity
and the kit selected should be chosen following the most up to date scientific advice available. Flocks confirmed
positive for blackhead with autopsy and histology will nearly always have a positive PCR result. However,
positive PCR results are also possible when there are no clinical signs in the current flock and this can make
interpretation challenging. These positive PCR results may be false positives or cross reactions; frequently there
is a good correlation with previous blackhead outbreaks on the farm despite current flocks being clinically normal.
Note: PCR does not indicate presence of viable Histomonas but rather presence of Histomonas DNA.
Due to the limited number of drugs available for treating blackhead prevention is key.
• Biosecurity. Good biosecurity between and within sheds is paramount. Outside clothing and footwear should be
completely changed before entering poultry sheds; it is recommended that footwear is changed before entering
each house using a biosecurity barrier system (a physical barrier prior to entry to the shed between which
footwear must be changed). Movement of equipment between houses and on and off farms should be considered
carefully and avoided if possible. Any equipment that does need to be moved should be thoroughly cleaned and
disinfected. In areas with gallinaceous wild birds in the farm environment the risk is likely to be higher.
• If blackhead is diagnosed in one shed, then good between shed biosecurity will help to prevent the disease
from spreading to other sheds. Increasing the temperature in the shed to dry the litter may also reduce the
survival of the Histomonads in the litter.
3
Ross Note – Histomoniasis (Blackhead)
• Litter removal. The complete removal of litter between flocks is recommended, especially after an outbreak and
appropriate clean-out and disinfection procedures should be in place. Any sheds affected by blackhead should
undergo a thorough and detailed cleanout and disinfection, possibly requiring extended clean-out time, and
including the use of disinfectant products particularly effective against cecal worm eggs like sodium hypochlorite,
quaternary ammonia and phenols. Litter should be removed from the sheds with as little contamination of the
area outside the sheds as possible. Flaming floors and filling in cracks, together with removing dust from all areas
of farm (not just sheds), may also help to reduce infection pressure.
• Cleanout protocols which include deep cleaning with industrial sweepers, the use of iodine, lime and also
salting floors (granular feed grade only) in addition to using new litter have proven essential and successful
even for dirt floors under field conditions. However, caution is advised, as salt has the potential to rust metal.
• Reducing primary disease carriers/intermediate hosts (i.e. cecal worms). This is one of the key steps in the
strategy for blackhead control. Consistent, early, and scheduled worming following veterinarian advice will help
reduce exposure to cecal worms/eggs and the Histomonads they carry.
• Treating for more than one day (3-5 days) has been shown to be more effective in some situations.
• There is evidence that using the same wormer for each treatment can lead to the development of resistance.
To avoid this product rotation is recommended; avoid using the same product for more than three consecutive
wormings.
• Vermin control. Consistent and effective rodent and insect control should be a core part of the biosecurity
strategy for the farm. Besides cecal worms and earthworms, other organisms could serve as mechanical disease
carriers. Therefore, control measures should also include actions to reduce darkling beetles, flies, and rodents
among others. Measures should be taken to minimize the possibility of flooding as this will increase the presence
of earthworms. If flooding does occur disinfection of the flooded area must take place due to the potential
increased presence of earthworms in dirt floor houses.
• Coccidiosis caused by E. tenella has been identified as an aggravating factor for blackhead.
• Blackhead is more likely to spread to the liver when coccidiosis is also present.
• The number of birds with severe lesions is increased when both Histomonads and E. tenella are present in
the bird. As such, strategies to keep E. tenella under control are important.
• In many instances, there have also been blackhead cases identified right after E. necatrix, E. brunetti and E.
maxima active infections.
• Vitamin supplementation, especially with fat-soluble vitamins A, E, D3, and K is a good practice. Absorption of
fat soluble vitamins is decreased when intestinal diseases, such as blackhead occur.
• Good intestinal health. With the withdrawal of effective treatments, there is increasing interest in the
development and use of alternative intestinal health products to mitigate blackhead disease issues. Nutritional
products include: prebiotics, probiotics, organic acids, plant extracts, essential oils, enzymes, and volatile fatty
acids, among others.
• Currently these products are supported by limited research, with results on their effects on blackhead being
conflicting. For example, oregano-based products are reputed to have some limiting effect on the impact of
blackhead but it has been difficult to prove this in the field.
• Control of E. coli. Although H. meleagridis is described as the causative agent of blackhead, it has been
demonstrated that the parasite fails to cause clinical disease in the absence of bacteria. When E. coli and
H. meleagridis were given to turkeys with no other bacteria present, the disease manifested. Several control
strategies for E. coli had been used. The use of live and killed E. coli vaccines, organic acids via feed or water
and the use of yeast cell based products that trap the bacteria and minimize their replication at the ceca, appear
to decrease the severity of blackhead and may be helpful in the face of an outbreak.
• Vaccination. Histomonas vaccination based upon an attenuated clonal strain of H. meleagridis has been shown
to be highly effective in experimental trials. However, further efforts are needed to standardize the production and
optimize the administration of the vaccine in the field, and currently there is no commercially available vaccine.
4
Ross Note – Histomoniasis (Blackhead)
CONCLUSIONS
Histomoniasis (blackhead) is a complex disease and much is still to be learned about the parasite that causes it.
Introduction into a flock can occur in different ways and transmission between birds can occur with or without a
disease carrier (vector; the role of cyst like stages still needs to be determined).
Since there are no available drugs to treat the disease, a multi-factorial approach is required to try and reduce or
eliminate blackhead from an affected farm and prevent the problem including:
1. Improving biosecurity and having suitable cleanout procedures in place is essential.
2. Reducing buildup of cecal worms as the intermediate host and other potential vectors, e.g.,
• have an strong insect and rodent control program in place.
• deworm birds regularly (have a deworming protocol in place).
• thoroughly clean, disinfect and change litter after an outbreak.
• consider the use of specific floor treatment protocols.
3. The use of prebiotics, probiotics, phytogenics, organic acids and E. coli vaccines appear to help decrease the
presentation of the clinical disease.
4. Having a plan of action with the local or company veterinarian to deal with the local situation and challenges is
always good.
Useful articles:
1. McDougald, L.R. 2003. Other Protozoan Diseases of the Intestinal Tract- Histomoniasis (Blackhead). In:
Diseases of Poultry. Y.M. Saif (ed.) 11th ed. Iowa State University Press, Ames, IA: 1001 -1006.
2. Dawe, J. and C.L. Hofacre, April 2002. With Hygromycin Gone, What are Today’s Worming Options? The Poultry
Informed Professional: Issue 60; 1-8.
3. Clark, F.D. and R.A. Norton, Jan/Feb 1998. Histomoniasis-an unwelcome houseguest returns. Turkey World.
0708-AVN-015
4. Hess, M. and McDougald, L. Diseases of Poultry 13th edition.
5. McDougal, L.R. 2005. Blackhead Disease (Histomonas) in Poultry: A Critical Review. Avian Diseases, 49:462-
476.
6. Clark, S. and Kimminau, E. 2017. Critical Review: Future Control of Blackhead Disease (Histomonas) in Poultry.
Avian Diseases, 61:281-288.
7. Liebhart, D., Ganas, P., Sulejmanovic, T. and Hess, M. 2017. Histomonas in Poultry: Previous and Current
Strategies for Prevention and Therapy. Avian Pathology, 46 No. 1: 1-18.
8. Hess M., Liebhart D., Bilic I., and Ganas P. 2015. Histomonas Meleagridis-New insights into an old pathogen.
Veterinary Parasitology 208: 67-76
9. Huber K., Gouilloud L. and Zenner L. 2007. A preliminary study of natural and experimental infection of the
lesser mealworm Alphitobius diaperinus (Coleoptera: Tenebrionidae) with Histomonas meleagridis (Protozoa:
Sarcomastigophora). Avian Pathology 36 (4): 279-282.
5
®
www.aviagen.com
Privacy Policy: Aviagen® collects data to effectively communicate and provide information to you about our products and our business. This data may
include your email address, name, business address and telephone number. To view the full Aviagen privacy policy visit Aviagen.com.
Aviagen and the Aviagen logo, and Ross® and the Ross logo are registered trademarks of Aviagen in the US and other countries.
All other trademarks or brands are registered by their respective owners.
© 2019 Aviagen.
0319-AVNR-105