ILMU PENYAKIT PARASITER VETERINER

BLACK HEAD ( HISTOMONOSIS ) TRICHOMONOSIS

OLEH :
I GEDE BIM SHIDDI PRAMA PUTRA 1809511095
I NYOMAN WIDYA PUTRA ADNYANA 1809511096
KELAS C

FAKULTAS KEDOKTERAN HEWAN

UNIVERSITAS UDAYANA

DENPASAR

2020
 KATA PENGANTAR

Puji syukur kehadirat Tuhan Yang Maha Esa atas segala rahmat dan karunia
dari beliau sehingga tugas paper Black Head ( Histomonosis ) Trichomonosis ini dapat
tersusun hingga selesai. Adapun paper ini kami susun untuk memenuhi persyaratan
nilai tugas dalam mata kuliah Ilmu Penyakit Parasiter Veteriner.

Karena keterbatasan pengetahuan maupun pengalaman, kami yakin masih

banyak kekurangan dalam tugas paper ini. Oleh karena itu kami sangat mengharapkan
saran dan kritik yang membangun untuk kedepannya agar menjadi lebih baik lagi.

Denpasar, April 2020

Penyusun

ii
 DAFTAR ISI

KATA PENGANTAR .............................................................................................. ii

DAFTAR ISI ........................................................................................................... iii
DAFTAR GAMBAR ............................................................................................... iv
BAB I PENDAHULUAN ......................................................................................... 1
1.1 Latar Belakang............................................................................................ 1
1.2 Rumusan Masalah ....................................................................................... 2
1.3 Tujuan ........................................................................................................ 2
BAB II TINJAUAN PUSTAKA ............................................................................... 3
2.1 Etiologi............................................................................................................ 3
2.2 Siklus Hidup .................................................................................................... 4
2.3 Perubahan patologi .......................................................................................... 4
2.4 Diagnosa ......................................................................................................... 6
2.5 Gejala Klinik .................................................................................................. 7
2.6 Cara Penularan ................................................................................................ 8
2.7 Pengendalian, Pengobatan dan Pencegaahan ................................................... 9
BAB III PENUTUP ................................................................................................ 10
3.1 Kesimpulan ................................................................................................... 10
DAFTAR PUSTAKA ............................................................................................. 11

iii
 DAFTAR GAMBAR

Gambar 1. Gambaran black head dari unggas……………………………………….3

iv
 BAB I
PENDAHULUAN

1.1 Latar Belakang

Pentingnya asupan makanan yang dikonsumsi oleh masyarakat menjadi

tolak ukur dalam pemenuhan gizi yang seimbang baik dari sumber karbohidrat, protein,
asam lemak, serat, vitamin dan mineral. Asupan gizi seimbang tersebut yang akan
menjadi faktor terpenting yang berperan dalam menunjang kesehatan seseorang.
Seperti halnya kesadaran manusia akan pentingnya protein dalam tubuh baik protein
nabati maupun hewani dimana sumber protein tersebut berupa asam amino yang
berfungsi sebagai pembangun dan pengatur dalam tubuh manusia. Sumber protein
sendiri berasal dari tumbuh-tumbuhan (nabati) dan berasal dari hewan (hewani) yang
mana sumber protein hewani mempunyai kandungan asam amino yang banyak
dibandingkan dengan protein nabati. Salah satu sumber protein hewni yang mudah
didapatkan yaitu dari olahan daging unggas yakni ayam, sehingga hal tersebut perlu
diperhatikan dengan baik, karena tidak menutup kemungkinan ayam yang akan
dikonsumsi tersebut terjangkit oleh berbagai macam penyakit yang dapat menyerang
unggas salah satunya Histomoniasis.

Etiologi Histomoniasis atau yang sering disebut dengan blackhead

merupakan suatu penyakit yang disebabkan oleh parasit yang bernama Histomonas
meleagridis dimana penyakit tersebut menyerang unggas baik itu kalkun dan ayam.
Tanda unggas terserang penyakit tersebut biasanya akan menimbulkan gejala seperti
perubahan feses yang berwarna kekuning-kuningan, kulit dikepala berwarna kebiru-
biruan dan kondisi unggas yang terlihat mengantuk, bulu kusan, berjalan dengan kaku
serta sayap yang menggantung.

1
1.2 Rumusan Masalah

1. Apa yang dimaksud Etiologi Histomoniasis?

2. Bagaimana siklus hidup dari parasit Histomonas meleagridis?
3. Bagimana perubahan patologik, gejala klinis, dan dianogsa yang terjadi pada
unggas?
4. Bagimana cara penularan, cara mencengah/mengendalikan, dan cara untuk
mengobati?

1.3 Tujuan

Untuk menambah pemahaman bagi para pembaca mengenai Etiologi

Histomoniasis, siklus hidup, perubahan patologik, diagnosa, gejala klinis, cara
penularan dan cara mencengah atau mengendalikan serta cara mengobati. Agar
nantinya pembaca dapat membedakan dengan baik dan jelas mengenai unggas yang
masih sehat dengan unggas yang sudah terserang penyakit blackhead.

2
 BAB II
TINJAUAN PUSTAKA

2.1 Etiologi

Histomoniasis disebabkan oleh protozoa Histomonas meleagridis. beberapa

jenis bakteri misalnya Escherichia coli, biasanya merupakan faktor pendukung
timbulnya penyakit tersebut karena efeknya yang ersifat sinergitik. Histomoniasis
meleagridis membutuhkan vektor mekanik, yaitu cacing sekum Heterakis gallinarum
dan beberapa jenis cacing tanah yang hidup di lingkungan peternakan

Histomonad dapat ditemukan didalam epitel usus cacing sekum yang sangat
muda atau cacing yang baru menetas. Cacing tanah dapat bertindak sebagai hospes
transpor yang merupakan tempat menetasnya telur Heterakis gallinarum dan
selanjutnya cacing muda yang infektif akan tinggal didalam jaringan. Dalam hal ini,
cacing tanah mengumpulkan cacing Heterakis gallinarumdari dari lingkaran
peternakan. Pada ayam yang terinfeksi oleh Heterakis gallinarum , maka larva yang
terinfeksi oleh histomonas meleagridis akan mencapai sekum dalam waktu yang
singkat setelah diingesti oleh ayam

Histomonas sp, bentuk bebas tidak dapat bertahan lama, tetapi protozoa tersebut akan
lebih resisten jika terdapat didalam telur cacing sekum atau dalam bentuk didalam
cacing tanah.

( Gambar 1. Gambaran black head dari unggas)

3
2.2 Siklus Hidup

Histomonas meleagridis memiliki siklus hidup yang kompleks. Histomonas

meleagridis ini tidak dapat bertahan baik di lingkungan, dan akan cepat mati.
Kemampuan untuk menembus dan bertahan hidup di dalam telur cacing Heterakis
gallinarum yang ada di sekum membuat histomonas meleagridis dapat bertahan hidup
lama. Perlindungan tambahan didapat apabila telur cacing yang keluar dari sekum
unggas dimakan oleh cacing tanah. Lapangan tempat tinggal kalkun yang terinfeksi
Histomonas meleagridis biasanya akan tetap terinfeksi selama bertahuntahun. Siklus
hidup dari Histomonas meleagridis bisa secara langsung dan tidak langsung. Siklus
hidup secara langsung : tertelannya tropozoit (tetapi tropozoit tidak dapat hidup lebih
dari beberapa jam setelah keluar bersama tinja). Cara penularan yang lebih penting
adalah tertular melalui telur cacing sekum Hetarakis gallinarum, Histomonas
meleagridis mula-mula menyerang zona germinal dari varium dan berkembang secara
ektra-seluler, selanjutnya menembus oositoosit yang sedang berkembang dan akhirnya
ditemukan di dalam telur dan sebagai sumber penular. Siklus hidup secara tidak
langsung : Histomonas meleagridis hidup di dalam telur cacing Heterakis gallinarum
yang berada disekum keluar bersamaan dengan feses. Telur yang sudah terinfeksi
Histomonas meleagridis termakan oleh cacing tanah. Cacing tanah yang
mengkonsumsi telur yang sudah terinfeksi histomonas tetap aktif dan telur cacing ini
bisa bertahan hidup lama di dalam tubuh cacing tanah. Kalkun mengkonsumsi cacing
tanah yang membawa histomonas meleagridis dan akan terinfeksi.

2.3 Perubahan patologi

Lesi yang ditimbulkan oleh histomonasiasis dapat dihubungkan dengan adanya

penetrasi histomonad pada dinding sekum dan bermultiplikasi, dan kemudian
memasuki sirkulasi darah dan akhirnya berparasit pada hati.

4
Perubahan Makroskopik

Lesi primer yang ditimbulkan oleh histomonasiasis dapat ditemikan pada

sekum dan hati. Setelah histomonad menginfeksi sekum maka dinding sekum akan
menebal dan hiperamik. Lumen sekum akan mengalami distensi dan terisi oleh masa
padat menyerupai keju yang terdiri atas hancuran jaringan nekrotik, eksudat,
komponen darah, hancuran sel, dan bakteri. Dinding sekum dapat mengalami ulserasi
dan selanjutnya dapat mengalami perforasi pada organ tersebut dan peritonitis yang
bersifat difus dab berbau busuk.

Lesi pada hati biasanya terdiriatas daerah nekrosis berwarna kekuning kuningan yang
berbentuk sirkular yang menyerupai kawah dengan diameter 1cm dan dikelilingi oleh
cincin yang menonjol di atas permukann hati. Bentuk lesi pada hati dapat bervariasi,
meskipun bentuk lesi sirkular paling sering dijumpai pada kasus histomonasiasis. Pada
infeksi berat, lesi pada hati dapat berukuran kecil, banyak dan letaknya berada di bawah
permukaan hati dan meliputi sebagian besar organ tersebut. Hati dapat membesar dan
berwarna hijau atau kecoklatan, kadang pada paru, ginjal, limpa dan mesenterium dapat
ditemukan adanya daerah nekrosis yang berbentuk bulat dan berwarna keputih-putihan.

Perubahan Mikroskopis

Invasi awal pada dinding sekum ditandai dengan adanya hiperemia dan
infiltrasi heterofil. Sekitar satu minggu pasca infeksi, sejumlah histomonad akan
terlihat pada daerah lamina propia sebagai benda ovoid dalam lekuk (lakuna) yang
tercat pucat. Pada periode tersebut akan dijumpai juga adanya sejumlah besar limfosit,
makrofag dan heterofil. Lumen sekum dapat terisi suatu massa yang berbentuk pasta
yang terdiri atas suatu epitel yang mengalami fibrin, deskuamasi, eritrosit, leukosit, dan
feses. Sekitar 2 minggu pasca inavasi dapat dijumpai adanya sejumlah giant cell pada
jaringan sekum.

Lesi yang mengalami degenerasi akan menunjukkkan adanya kumpulan

limfosit yang tersebar diseluruh jaringan sekum, inding sekum akan menjadi sangat
tipis dan kripta memendek. Lesi awal pada hati terdiri atas infiltrasi heterofil, monosit

5
dan limfosit disekitar pembuluh darah. Setelah 2 minggu pasca invasi akan terlihat
infiltasi makrofag dan limfosit yang ektensif dan sejumlah heterofil. Hepatosit di
bagian tengah dari lesi akan mengalami nekrosis dan disintegrasi, Pada periode tersebut
dapat ditemukan adanya sejumlah histomonad dalam lakuna disekitar bagian tepi lesi.
Jika proses infeksi berlanjut maka nekrosis akan lebih ekstensif dan histomonad
akanditemukan pada umumnya sebagai suatu benda kecil di dalm makrofag. Jika
terjadi penyembuhan, maka akn dijumpai adnya foki limfosit yang disertai oleh daerha
fibriosis dan hepatosit yang mengalami degenerasi.

2.4 Diagnosa

Diagnosis sangkaan di dasarkan pada gejala klinis dan perubahan patologi yang
spesifik untuk penyakit tersebut. Untuk diagnosa akhir dapat didasarkan pada
identifikasi histomonad dengan cara pemeriksaan mikrokopis secara langsung atau
setelah jaringan diwarnai dengan cat tertentu meliputi hematosiklin dan eosin (H&E)
atau periodic accid schiff (PAS). Isolasi histomonas melagridis secara in vitro dapat
dilakukan pad medium Dwyer’s yang dimodifikasi. Pada uji tersebut contoh jaringan
harus diambil dari unggas yang baru mati.

Pemeriksaan terhadap histomonad dapat juga dilakukan secara langsung

menggunakan bahan yang berasal dari bagian ujung lateral lesi pada sekum atau hati.
Protozoa tersebut dapat diidentifikasi denagn memeriksa adanya gerakan pseudopia
pada preparat tetes pada larutan yang mengandung lesi dari usus atau hati.

Penyakit yang mirip dengan histomoniasis adalah koksidiosis dan

salmonelosis. Koksidiosis dapt dibedakan dengan histomoniasis denagn pemeriksaan
mikroskopik dengan adnya ookista. Demekian juga salmonelosis dapat dibedakakan
dari histomoniasis engan adnya isolasi dan pemeriksaan bakteri.

6
2.5 Gejala Klinik

Histomoniasis terutama ditemukan pada unggas yang berumur kurang dari 12

minggu. Walaupun penyakit tersebut telah dilaporkan pada sejenis ayam hutan, burung
puyuh, dan ayam mutiara, jenis unggas yang paling peka adalah kalkun. Meskipun
ayam dapat terinfeksi dengan mudah, penyakit yang timbul biasanya lebih ringan
dibandingkan dengan penyakit yang timbul pada kalkun. Ayam berumur 4-6 minggu
dan kalkun berumur 3-12 minggu bersifat sangan sensitif terhadap infeksi histomonas
meleagridis

Lesi yang timbul oleh histomoniasis biasanya lebih parah jika terjadi infeksi
campuran dengan clostridium perfringens atau escherichia . Coli. Gejala awal akibat
histomoniasis pada kalkun meliputi feses yang berwarna kekuning kuningan,
mengantuk, sayap menggantung, berjalan dengan langkah yang kaku, mata tertutup,
kepala digantung, anoreksia, bapsu makan meningkat, bulu kusam dan berdiri. Kulit
didaerah kepala berwarna kebiru-biruan (sianotik) , tetapi dapat juga berwarna normal.
Sehunbungan dengan adanya sianosis tersebut, sehingga histomoniasis juga dikenal
dengan nama black head. Setelah 12 hari masa infeksi kalkun akan mengalami
emisiasi.

Masa inkubasi penyakit tersebut sekitar 7-12 hari dan biasanya berlangsung
khronik sampai unggas tersebut mati. Infeksi pada ayam mungkin bersifat ringan atau
tidak teramati, tetapi dapat juga berlangsung parah dan menyebabkan mortalitas yang
tinggi . Kotoran yang berwarna kekuning kuningan jarang ditemukan pada ayam, tetapi
kotoran yang berwarna merah campuran darah yang berasal dari sekum dapat diamati
pada ayam. Mortalitas pada kalkun muda umr 3-12 minggu mencapai 50%. Mortalitas
akibat histomonasiasis pada ayam biasanya rendah tetapi pada sejumlah kasus bisa
mencapai >30%.

 Histomonas terutama ditemukan pada unggas kurang dari 12 minggu, ayam

berumur 4-6 minggu dan kalkunberumur 3-12 minggu bersifat sensitif
terhadap infeksi Histomonas meleagridis.

7
  Lesi yang ditimbukan oleh Histomonas meleagridis biasanya lebih parah jika
terjadi infeksi sekunder oleh Clostridium perfringrs atau Escherichia coli.
 Gejala awal akibat histomoniasis pada kalkun meliputi feces yang berwarna
kekuning kuningan menyerupai belerang, mengantuk,sayap menggantung,
berjalan dengan langkah yang kaku, mata tertutup, kepala digantung
mendekati badan, anoreksia, nafsu minum mengkat, bulu kusam dan berdiri.
Kulit dikepala berwarna kebiru biruan(sianotik) tetapi dapat juga berwarna
normal.berhubungan dengan sianotik tersebut maka histomoniasis dikenal
juga dengan nama BLACK HEAD. Sekitar 12 hari pasca infeksi, maka kalkun
biasanya mengalami emasiasi.
 Masa inkubasi penyakit tersebut berkisar 7-12 haridan biasanya berlangsung
kronis sampai ayam tersebut mati. kotoran berwarna kuning seperti belerang
jarang terjadi, tetapi Kotoran yang bercampur darah yang berasal dari sekum
dapat diamati. Mortalitas pada kalkun muaumur 3-12 minggudapat mencapai
50%, sedangkan pada ayam hanya 30 %.

2.6 Cara Penularan

Protozoa tersebut dapat dikeluarkan bersama feses ayam yang terinfeksi dan
dalam telur cacing heterakis gallinarum. Penularan biasanya terjadi jiak ungags yang
sensitive menelan telur cacingsekum yang ifeksi selanjutnya larva histomonad akan
dibebaskan dari larva heterakis sp. di dalam sekum.

Histomonad berreplikasi didalam jaringan sekum. Kemudian bermigrasi ke

dalam hati melalui sirkulasi darah. Cacing tanah juga menelan telur cacing sekum dan
telur tersebut menetas dan membentuk kista didalam jaringan cacing tanah.

Protozoa tersebut sangat resistan jika berada didalam telur cacin, larva, atau
cacing tana, dan akan mencemari lingkungan peternakan. Histomonas meleagridis akan
ditularkan dari ayam/kalkun pada periode pemeliharaan satu ke lainnya jika menelan
cacing tanah atau telur cacing sekum yang terinfeksi oleh protozoa tersebut.

8
2.7 Pengendalian, Pengobatan dan Pencegaahan

Mengingat bahwa penularan histomoniasis melalui telur hesterakis sp, maka

cara pengendalian yang baik dengan membasmi cacing sekum atau cacing tanah atau
mencegah agar cacing tidak kontak dengan ayam. Selain itu juga diperlukan
pengamanan biologik dengan sanitasi dan desinfeksi yang optimal diperlukan untuk
mencegah adanya histomoniasis.

Unggas yang terinfeksi oleh histomonas meleagridis dapat diobati dengan

beberapa obat yaitu nitrofuran, nitromidazol dan nitrason untuk pencegahan. Jika telah
terjadi letupan penyakit tersebut maka perlu pengobatan dangn dosis rendah melalui
pakan dalam waktu yang panjang. Pada kasus yang akut pengobatan biasanya
dilakukan 5-7 hari.

9
 BAB III
PENUTUP

3.1 Kesimpulan

Histomoniasis merupakan suatu penyakit asal protozoa pada berbagai jenis

unggas, terutama ayam dan kalkun. Penyakit tersebut dikenal juga dengan nama
enterohepatitis (black head) dan bersifat oleh adanya foki nekrotik pada hati dan
ulserasi pada sekum. Histomoniasis disebabkan protozoa Histomonas meleagridis.
Beberapa jenis bakteri misalnya Escherichia coli, biasanya merupakan faktor
pendukung timbulnya penyakit tersebut karena efek yang bersifat sinergis. Histomonas
meleagridis membutuhkan vektor mekanik, yaitu cacing sekum Heterakis gallinarum
dan beberapa cacing tanah yang hidup di peternakan. Histomonas ditemukan didalam
epitel usus cacing yang sangat muda atau cacing yang baru menetas. Bentk bebas tidak
dapat bertahan lama tetapi protozoa tersebut akan lebih resisten jika terdapat didalam
telur cacing atau dalam bentuk kista didalamcacing tanah

10
 DAFTAR PUSTAKA

Abdullah et al. 2013. Pathological changes in turkeys liver associated with

Histomoniasis in Duhok City,Kurdistan Region, Iraq. Iraq : Iraqi Journal
of Veterinary Sciences, Vol. 28, No. 1, 2014 (55-59)

Ariputuamijaya.2010.histomoniasis.(https://ariputuamijaya.wordpress.com/2011/1
2/10/histomoniasis/ ).

Faris Makkawaru, Wuri Wulandari, dan Tyas Noormalasari H. 2013. MAKALAH

PARASITOLOGI VETERINER: ENDOPARASIT .(
https://pdfslide.net/documents/endoparasit-makalah-histomonas-
meleagridis.html.)

Patra et al. 2013. Prevalence of Histomonas meleagridis in Broiler Chicken in

Different Parts of Mizoram, India. India : International Journal of Poultry
Science. 12 (2): 98-101.

Rangga tabbu, Charles. 2002. Penyakit Ayam dan Penanggulanganya. Yogyakarta

: Kanisius. Hal. 40-44. Roni et Agustin. 2004. Aneka Penyakit Pada Ayam
dan Cara Mengatasinya. Jakarta : Agromedi

11
687002
brief-report2017
VDIXXX10.1177/1040638716687002Characterization of histomoniasis in peafowlClarke et al.

Brief Communication

Journal of Veterinary Diagnostic Investigation

Pathologic and molecular characterization of 2017, Vol. 29(2) 237­–241

© 2017 The Author(s)
Reprints and permissions:
histomoniasis in peafowl (Pavo cristatus) sagepub.com/journalsPermissions.nav
DOI: 10.1177/1040638716687002
https://doi.org/10.1177/1040638716687002
jvdi.sagepub.com

Lorelei L. Clarke,1 Robert B. Beckstead, Jeffrey R. Hayes, Daniel R. Rissi

Abstract. Histomonas meleagridis is a flagellate protozoan organism that can cause severe necrotizing typhlitis and
hepatitis in gallinaceous birds. Peafowl (Pavo spp.) have been shown to be susceptible to histomoniasis in experimental
settings, but there are few reports of natural histomoniasis in this species. A retrospective study of the archived cases at
2 veterinary diagnostic laboratories in the United States yielded 5 cases of peafowl with gross and histologic findings
characteristic of histomoniasis. Lesions included bilateral, transmural fibrinonecrotic typhlitis and multifocal necrotizing
hepatitis with associated trophozoites morphologically consistent with H. meleagridis. There was no evidence of Heterakis
gallinarum infestation in the studied cases. DNA was extracted from formalin-fixed, paraffin-embedded liver and ceca from
all 5 cases and was analyzed using multiple sets of primers with subsequent sequencing and genotyping. Four samples were
positive for H. meleagridis, and 1 sample was positive for both H. meleagridis and Tetratrichomonas gallinarum. These
results confirm that peafowl develop clinical disease similar to that described previously in other gallinaceous birds infected
by H. meleagridis. The role of T. gallinarum remains unknown and further research is necessary to elucidate its role, if any, in
the pathogenesis of the observed lesions.

Key words: Histomonas meleagridis; peafowl; polymerase chain reaction.

Introduction and/or necrosis.2 Necrotic lesions can also be present in the

Histomonas meleagridis (phylum Parabasalia, class Tritricho-
monadea, order Tritrichomonadida, family Dientamoebidae/
Protrichomonadinae) is an anaerobic protozoan parasite
existing in either flagellated or amoeboid forms.4,11 It has a
worldwide distribution and transmission occurs primarily via
ingestion of embryonated eggs of the cecal nematode Het-
erakis gallinarum containing H. meleagridis trophozoites or
by ingestion of earthworms that have ingested nematode
eggs.4,9–11 The life cycle of the parasite H. meleagridis begins
in the ceca of host birds infected with adult H. gallinarum
worms. H. meleagridis infects the H. gallinarum ovary by an
unknown mechanism so that trophozoite-laden H. gallina-
rum eggs are shed into the environment with the feces. H.
gallinarum then develop into larvae containing H. meleagri-
dis in the soil. When susceptible birds ingest H. gallinarum
larvae from the environment, the H. meleagridis passengers
are ingested as well. H. gallinarum will then travel through
the gastrointestinal tract to the ceca, where the larvae will
molt and release the trophozoites into the cecal lumen.11 Free
trophozoites can survive in the external environment for a
few hours, but remain viable for up to 2 y within the nema-
tode eggs.9
Histomoniasis (blackhead disease, typhlohepatitis, infec-
tious enterohepatitis, histomonosis) is characterized by cecal
mucosal-to-transmural necrosis with formation of luminal
cores. Hepatic lesions are variably present and consist of
portal or multifocal-to-coalescing heterophilic granulomas
kidneys, bursa of Fabricius, spleen, air sacs, lungs, pancreas,
and proventriculus.14 Protozoal organisms presumably reach
other organs through the portal system after cecal and hepatic
infection has been established.11 H. meleagridis virulence
appears to be determined by the protozoal genetics, infec-
tious dose, and influence of cohabiting cecal bacteria (Esch-
erichia coli, Clostridium perfringens; Bacillus subtilis in
turkeys) and protozoa (Eimeria tenella in chickens).1,5,11
H. meleagridis causes disease in most gallinaceous birds,
including pheasants, chickens, turkeys, partridges, and
quails. Turkeys are notoriously susceptible to infection, with
outbreak mortality rates approaching 100%.4,11 Ring-necked
pheasants are relatively resistant to disease and are consid-
ered a reservoir host for the pathogen.10 Experimental infec-
tion of peafowl (Pavo cristatus) and other gallinaceous birds
(chukar, guinea fowl, bobwhite quail, pheasants, and others)
have been attempted and indicate variable susceptibility
among species.11 These experimental infections suggest that
Department of Pathology and Athens Veterinary Diagnostic
Laboratory, College of Veterinary Medicine (Clarke, Rissi), and
Department of Poultry Science, College of Agricultural and Environmental
Sciences (Beckstead), University of Georgia, Athens, GA; and Animal
Disease Diagnostic Laboratory, Ohio Department of Agriculture,
Reynoldsburg, OH (Hayes).
1
Corresponding author: Lorelei L. Clarke, Department of Pathology,
College of Veterinary Medicine, University of Georgia, 501 D.W. Brooks
Drive, Athens, GA 30602. lclarke@uga.edu
238
Clarke et al.
Table 1.  Primers used for polymerase chain reaction in 5 cases
of histomoniasis in peafowl.
PCR assay/
Primer Sequence 5′–3′ Reference
PCR-1
 ITSF TGCTTCACTTCAGCGGGTCTTCC 5 72°C for 1 min; followed by a final elongation step at 72°C
 ITSR CGGTAGGTGAACCTGCCGTTGG 5 for 10 min. Following amplification, all PCR amplicons from
PCR-2
 18S-F GCAGTTAAAACGCTCGTAGTC 1 agarose gel, stained,c and visualized with blue light. DNA was
 18S-R AACGCTAGACAGGTCAACCC 1 purified using extraction kitsd and ligated into a vectorc per
PCR-3
 Detect-F GGTTCATGCTGTACTATTGAG Current study
 Detect-R GTGAACAATTTCACGCACC Current study
peafowl may have increased susceptibility to H. meleagridis
compared with other gallinaceous birds.9 There are few
reports describing naturally occurring disease in peafowl, but
commercially raised birds suffered outbreaks similar to those
described in chickens and turkeys.5 Our study describes the
pathologic and molecular features of 5 cases of histomonia-
sis in peafowl.
We performed a retrospective search for cases of histomo-
niasis in peafowl that were submitted for autopsy at the Uni-
versity of Georgia Athens Veterinary Diagnostic Laboratory
(Athens, Georgia) and the Ohio Department of Agriculture
Animal Disease Diagnostic Laboratory (Reynoldsburg,
Ohio) between 2000 and 2015. All relevant information
(clinical history, pathology report, and ancillary testing) was
reviewed. Hematoxylin and eosin–stained slides from all
cases were also reviewed. Tissues available varied among
cases, but ceca and liver were examined in all cases.
DNA was extracted from formalin-fixed, paraffin-embed-
ded liver and ceca using DNA extraction kitsa per the manu-
facturer’s instructions. Extracted DNA from each tested case
was analyzed by polymerase chain reaction (PCR) using 3
different sets of primers to amplify the internal transcribed
spacer (ITS) region (PCR-1), the 18S rRNA gene (PCR-2),
and a conserved region upstream of the β-tubulin gene (PCR-
3; Table 1). PCR components included 1–2 μL of extracted
DNA in a 25-μL reaction containing PCR beadsb and 20 pM
each of forward and reverse primers. Nuclease-free water was
used as a negative control to detect contamination, and DNA
isolated from a laboratory-propagated strain of H. meleagri-
dis was included as a positive control. In PCR-1, the ITS
region was amplified using Trichomonadidae-family wide
ITSF and ITSR primers described in previous studies (Table
1).8 Cycling parameters for the amplification were 1 cycle of
95°C for 1 min followed by 35 cycles of 94°C for 15 s, 48°C
for 15 s, 72°C for 1 min, and a final extension at 72°C for 15
min. In PCR-2, the 18S rRNA gene of H. meleagridis was
amplified using primers described previously (Table 1).1
Cycling parameters for the amplification were as follows: 1
cycle of 95°C for 1 min; 35 cycles of 95°C for 15 s, 53°C for
15 s, and 72°C for 1 min; followed by final elongation step at
72°C for 10 min. In PCR-3, novel detection primers to
amplify a region upstream of the β-tubulin gene identified by
genetic sequencing of H. meleagridis are described (Table 1).
Cycling parameters for the amplification were 1 cycle of
95°C for 1 min; 35 cycles of 95°C for 15 s, 45°C for 15 s, and
all 3 reactions were separated by gel electrophoresis using 1%
the manufacturer’s instructions. The DNA transformation
procedure was performed using competent cellse and 2 mL of
ligation-reaction per the manufacturer’s instructions. Compe-
tent cells containing the vector with PCR product insert were
detected by plating 50 μL of the transformation mixture on
lysogeny broth (LB) agar plates supplemented with 100 mg/
mL of carbenicillin. Two to 3 colonies, if available, were iso-
lated and propagated in LB supplemented with 100 mg/mL of
carbenicillin. Plasmid DNA was isolated using a kitf per the
manufacturer’s instructions. Sequencing of the inserts was
performed using pJET 1.2 forward and reverse sequencing
primers at the Integrated Biotechnology Laboratories (Uni-
versity of Georgia, Athens, Georgia). Sequences obtained
from our study and other related sequences were aligned
using a multisequence alignment program.15
Reported ages of the retrieved cases ranged from 3 wk to
16 mo (Table 2). Gross findings were fairly consistent among
the cases and consisted of bilateral necrotic cecal cores of
white-to-tan, fibrinous-to-caseous material (4 of 5), marked
cecal distention (4 of 5), with occasional cecal wall thicken-
ing and transmural necrosis (1 of 5; Fig. 1). Cases 3–5 had
hepatomegaly and multifocal hepatic necrosis, as evidenced
by multiple white-to-gray, 1–2 mm diameter, subcapsular
foci that were distributed throughout the parenchyma. These
foci occasionally had a central area of depression with a sur-
rounding ring of hemorrhage. Histologically, all cases had
fibrinonecrotic typhlitis and necrotizing hepatitis. The cecal
mucosa was effaced by necrosis and hemorrhage with loss of
stromal structures. The lamina propria was expanded by het-
erophils and macrophages, with fewer lymphocytes and
plasma cells that also extended to the submucosa, muscle
layers, and serosa (Fig. 2). Within these lesions were multi-
ple, extracellular and intrahistiocytic, round, 10–20 µm
diameter, periodic acid–Schiff (PAS) reaction positive proto-
zoal trophozoites with central dark nuclei (Fig. 2 inset). Tro-
phozoites were also present within intraluminal debris and
infiltrating into less affected adjacent lamina propria and
submucosa. Expanding the liver were multiple, extensive
areas of necrosis characterized by hepatocytes with shrunken,
hypereosinophilic cytoplasm and pyknotic nuclei that were
surrounded by layers of epithelioid macrophages and hetero-
phils with fewer lymphocytes and plasma cells and
intralesional protozoa. Overall, there were fewer protozoal
organisms in the liver than in the ceca. Protozoal organisms
were also less frequently associated with overt necrosis. Two
 Characterization of histomoniasis in peafowl 239

Table 2.  Signalment, origin, and pathologic and diagnostic features of 5 cases of histomoniasis in peafowl.*

PCR

Case Sex Age Origin ITS 18S rRNA Detection Sequencing results
1 F 3 wk UGA-AVDL + + + Histomonas meleagridis
2 M 3 wk UGA-AVDL + + + H. meleagridis
3 M 16 mo ODA-ADDL – + + H. meleagridis
4 M 16 mo ODA-ADDL + + + H. meleagridis; Tetratrichomonas gallinarum
5 M 16 mo ODA-ADDL – + + H. meleagridis

* F = female; M = male; ODA-ADDL = Ohio Department of Agriculture Animal Disease Diagnostics Laboratory; UGA-AVDL = University of Georgia
Athens Veterinary Diagnostic Laboratory.

Figures 1–4.  Histomoniasis in peafowl (Pavo cristatus).

Figure 1.  A cross-section of both ceca from a male peafowl (case 2) reveals diffuse mural thickening.
Figure 2.  Extensive mucosal stromal collapse (top) and mural effacement (bottom) by heterogranulomatous inflammation in the ceca of
a male peafowl (case 2). H&E. Bar = 100 μm. Inset. Intralesional protozoal trophozoites are surrounded by a clear halo. Periodic acid–Schiff
reaction. Bar = 50 μm.
Figure 3.  Periportal hepatocyte degeneration and necrosis (asterisk) with a few heterophils are detected in less affected cases (e.g., case
2). H&E. Bar = 50 μm.
Figure 4.  Extensive necrosis and associated heterogranulomatous inflammation are observed in more severe cases (e.g., case 5). H&E.
Bar = 200 μm. Inset. Intralesional protozoal trophozoites are abundant, and some are within macrophages or multinucleate giant cells
(arrow). H&E. Bar = 50 μm.

juvenile birds (cases 1, 2) lacked gross hepatic lesions and
had less severe histologic changes in the liver compared to
the older birds (Figs. 3, 4). Hepatic lesions in these 2 juvenile
birds were primarily portal. Less frequent changes included
necrotizing airsacculitis with intralesional protozoa (2 of 5),
areas of pulmonary necrosis surrounded by epithelioid mac-
rophages and multinucleate giant cells (necrogranulomas)
with intralesional fungal hyphae (1 of 5), and ingluvial can-
didiasis (1 of 5).
Reported ancillary tests included fecal flotation and fecal
smears, as well as aerobic, anaerobic, and Salmonella spp.
bacterial culture. No birds were positive on fecal smear for
coccidia or other protozoa. E. coli and C. perfringens were
isolated from both the intestine and liver in case 4. No birds
240
Clarke et al.
were positive for Salmonella spp. Only case 3 was reported
to have received treatment prior to death, including metroni-
dazole, fenbendazole, and enrofloxacin.
All tested birds were positive on at least 2 of the 3 PCR
reactions (Table 2). The ITS region did not amplify in cases
3 and 5, whereas the 18S rRNA region and novel detection
primers described to be specific for H. meleagridis did
amplify appropriate sequences in all 5 cases. The remaining
3 cases were positive using all 3 primer sets. Case 4 was
positive by sequencing for both H. meleagridis and T. gal-
linarum.
There is some evidence that young turkeys and chickens
are thought to be more susceptible to infection with H.
meleagridis, although mature turkey flocks can also experi-
ence severe disease.9 A similar age-related trend is suggested
by our data set, wherein the age range of affected peafowl
varied from juvenile to young adult birds. However, given
the small number of birds in our study, it is difficult to ascer-
tain the extent of this correlation. The gross and histologic
changes in the current cases were consistent among the sam-
ples and were compatible with previous descriptions of his-
tomoniasis in other gallinaceous birds.4,9,11 Concurrent
infections with other pathogens, similar to our observations,
have also been described previously and may be related to
concurrent immunosuppression in affected birds.11 Hepatic
lesions in our study were not as severe as those seen in tur-
keys, which was also noted in previous experimental histo-
moniasis in peafowl.9 These lesions tend to be portal at early
stages of infection, but become more extensive as the disease
progresses.4 Although no information on clinical course was
available from our cases, the fact that the hepatic lesions in
the 2 juvenile birds (cases 1, 2) were less severe and primar-
ily portal when compared to the older birds (cases 3–5) may
imply that the juvenile birds may have died at an earlier stage
of infection. There are reports of H. meleagridis genotype 2
causing more severe cecal changes without concurrent
hepatic lesions, implying that affected tissues may depend
directly or indirectly on genetically modified parasitic viru-
lence factors.3
There was no evidence of H. gallinarum infestation in any
of the examined cases in our study, which is also consistent
with previous experimental infections in peafowl.9 To our
knowledge, H. gallinarum infection without concurrent H.
meleagridis infection has not been attempted or described in
peafowl and, therefore, it is unknown how susceptible pea-
fowl are to H. gallinarum infection. Species differences in
susceptibility have been described in other gallinaceous
birds, which could explain our findings.16 Alternatively,
severe pathologic changes in the ceca caused by H. melea-
gridis infection may provide an inhospitable environment for
H. gallinarum.9,16 In such cases, where H. gallinarum is
unable to complete its life cycle, the magnitude of clinical
disease in susceptible birds caused by H. meleagridis should
depend on the number of infected eggs present in the soil or
shed by carrier species (chickens and pheasants) in contact
with peafowl. Other forms of transmission, such as cloacal
drinking and reverse peristalsis, ingestion of insects, and
through human handlers have been documented in poultry,11
but it is unknown if any of these alternative routes are rele-
vant to the disease spread in our cases.
Many of the phylogenetic studies examining H. meleagri-
dis isolates and other parabasalid protozoa have focused on
the internal transcribed spacer 1–5.8S rRNA–internal tran-
scribed spacer 2 (ITS1-5.8S-ITS2) regions of the ribosomal
gene, which are noncoding sequences with less conservation
pressure, leading to high genetic variability.1,5,8,17 Multiple
sequence variants, however, can exist within a single isolate,
necessitating the need for C-profiling or sequencing to accu-
rately characterize H. meleagridis strains.8 Subtyping into 2
phylogenetically distinct genotypes has been done using
sequences at the 18S rRNA and rpb1 loci, but these analyses
still require deep sequencing.1 The novel detection primers
described in our study were designed to obtain a uniquely
sized amplicon of H. meleagridis that would allow diagnosti-
cians to distinguish H. meleagridis isolates from other para-
basalid organisms without relying on sequencing. In the
small sample size in this study, PCR results correlated with
sequencing results. Sequencing was still necessary to distin-
guish the single case of dual infection of H. meleagridis and
T. gallinarum (case 4). It is difficult to interpret the presence
of T. gallinarum genetic sequences in this case. Further
research would be necessary to determine a possible role of
T. gallinarum in the development of the observed lesions in
these cases or a potential H. meleagridis/T. gallinarum coin-
fection. In an early pilot study, our novel primers were able
to detect T. gallinarum infection in a subset of peafowl cases
originally diagnosed as histomoniasis (data not shown).
Although the ability of T. gallinarum to cause disease in the
lower intestinal tract of birds is debatable given inconsistent
experimental results,12 reports of naturally occurring T. gal-
linarum infection in gallinaceous and anseriform birds have
been described.5,6,13 Our results, however, may imply that
coinfections with H. meleagridis and T. gallinarum or with T.
gallinarum alone may be more common than currently
expected.
Differentiating H. meleagridis from other parabasalid
organisms or even from other kingdoms of pathogenic
agents may not be precise or accurate using only routine
histologic examination. It has long been considered diffi-
cult to distinguish H. meleagridis on light microscopy
from fungal organisms, necessitating the use of special
stains such as PAS or Grocott methenamine silver.11 It may
be also difficult to distinguish H. meleagridis and T. gal-
linarum on cecal smears, which was one of the standard
means of detection of Histomonas for many decades.5 For
these reasons, routine histopathology and immunohisto-
chemistry should be interpreted in conjunction with PCR
using species-specific primers for H. meleagridis as a
 Characterization of histomoniasis in peafowl
more accurate and specific detection tool in cases of histo-
moniasis.2,7 Specific primers and in situ probes have
already been developed for both H. meleagridis and T. gal-
linarum for this purpose in other avian species.2,7 Analysis
of pooled ceca and liver samples by PCR specific for the
ITS region has reported higher rates of detection compared
with cloacal swabs and PCR of other organs.5 Distinguish-
ing between the 2 organisms has implications in under-
standing transmission and, therefore, in biosecurity and
disease prevention as well.
Further directions for this work include evaluating our
novel detection PCR primers on a wider set of samples and
avian species to establish their sensitivity and specificity.
Investigating the relationship between H. meleagridis and T.
gallinarum may also further elucidate the interaction of these
organisms in instances of potential coinfections. Because
most peafowl are raised on soil that likely contains H. gal-
linarum or its eggs, it may be a protective measure for these
birds to not be housed with chickens or pheasants that may
carry H. meleagridis, or to raise birds indoors to prevent con-
tact with contaminated soil.
Authors’ contributions
LL Clarke contributed to conception and design of the study; con-
tributed to acquisition, analysis, and interpretation of data; and
drafted the manuscript. RB Beckstead contributed to design of the
study and to analysis and interpretation of data. JR Hayes contrib-
uted to design of the study and to acquisition and interpretation of
data. DR Rissi contributed to conception and design of the study
and to acquisition, analysis, and interpretation of data. All authors
critically revised the manuscript; gave final approval; and agreed
to be accountable for all aspects of the work in ensuring that ques-
tions related to the accuracy or integrity of any part of the work are
appropriately investigated and resolved.
Sources and manufacturers
a. DNA extraction mini kit, Qiagen, Valencia, CA.
b. Ready-to-go PCR beads, GE Scientific, Piscataway, NJ.
c. SYBRsafe, Thermo Fisher, Waltham, MA.
d. GeneJet gel extraction kit, Thermo Fisher, Waltham, MA.
e. EZ competent cells, Qiagen, Valencia, CA.
f. GeneJet plasmid miniprep kit, Thermo Fisher, Waltham, MA.
Declaration of conflicting interests
The author(s) declared no potential conflicts of interest with
respect to the research, authorship, and/or publication of this
article.
Funding
The author(s) received no financial support for the research, author-
ship, and/or publication of this article.
241
References
1. Bilic I, et al. Multi-locus typing of Histomonas meleagridis
isolates demonstrates the existence of two different genotypes.
PLoS One 2014;9:e92438.
2. Grabensteiner E, Hess M. PCR for the identification and dif-
ferentiation of Histomonas meleagridis, Tetratrichomonas gal-
linarum and Blastocystis spp. Vet Parasitol 2006;142:223–230.
3. Grafl B, et al. Aberrant clinical appearance and pathomorphol-
ogy noticed during an outbreak of histomonosis indicates a
different pathogenesis of Histomonas meleagridis genotype 2.
Avian Dis 2015;59:452–458.
4. Hauck R, Hafez HM. Experimental infections with the proto-
zoan parasite Histomonas meleagridis: a review. Parasitol Res
2013;112:19–34.
5. Hauck R, et al. Detection of DNA of Histomonas meleagridis
and Tetratrichomonas gallinarum in German poultry flocks
between 2004 and 2008. Avian Dis 2010;54:1021–1025.
6. Liebhart D, et al. A single strain of Tetratrichomonas gal-
linarum causes fatal typhlohepatitis in red-legged partridges
(Alectoris rufa) to be distinguished from histomonosis. Avian
Pathol 2014;43:473–480.
7. Liebhart D, et al. In-situ hybridization for the detection and
identification of Histomonas meleagridis in tissues. J Comp
Pathol 2006;135:237–242.
8. Lollis L, et al. Molecular characterization of Histomonas
meleagridis and other parabasalids in the United States
using the 5.8S, ITS-1, and ITS-2 rRNA regions. J Parasitol
2011;97:610–615.
9. Lund EE, Chute AM. Heterakis and Histomonas infections
in young peafowl, compared to such infections in pheasants,
chickens, and turkeys. J Wildl Dis 1972;8:352–358.
10. Lund EE, Chute AM. The ring-necked pheasant (Phasianus
colchicus torquatus) as a host for Heterakis gallinarum and
Histomonas meleagridis. Am Midl Nat 1972;87:1–7.
11. McDougald LR. Blackhead disease (histomoniasis) in poultry:
a critical review. Avian Dis 2005;49:462–476.
12. Norton RA. Pathogenicity of a strain of Trichomonas gallina-
rum in turkeys and its possible interaction with cecal coccidia.
Avian Dis 1997;41:670–675.
13. Richter B, et al. First report of typhlitis/typhlohepatitis caused
by Tetratrichomonas gallinarum in three duck species. Avian
Pathol 2010;39:499–503.
14. Sentíes-Cué G, et al. Systemic histomoniasis associated with
high mortality and unusual lesions in bursa of Fabricius, kidneys,
and lungs in commercial turkeys. Avian Dis 2009;53:231–238.
15. Thompson JD, et al. CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix
choice. Nucleic Acids Res 1994;22:4673–4680.
16. Tompkins DM, et al. Differential impact of a shared nematode
parasite on two gamebird hosts: implications for apparent com-
petition. Parasitology 2001;122:187–193.
17. van der Heijden HM, et al. Genotyping of Histomonas melea-
gridis isolates based on internal transcribed spacer-1 sequences.
Avian Pathol 2006;35:330–334.
 Histomoniasis (Blackhead)

ROSS NOTE Jose J. Bruzual, Senior Poultry Veterinarian; Colin Adams, Company Veterinarian

INTRODUCTION
Histomoniasis or Blackhead is a complex disease process. Although primarily affecting turkeys
with lesions in the ceca and liver, blackhead can also have a significant impact on chickens
(where lesions are often confined to the ceca only).

Blackhead is caused by the protozoan flagellate, Histomonas (H.) meleagridis, which has a
broad host range, infecting gallinaceous birds including, pheasants, partridges, and bobwhite
quails in addition to chicken and turkeys.

With the ban on many of the drugs used to fight the disease, and changes in animal husbandry
like reusing litter and/or increased stocking density, blackhead has re-emerged in many areas
including North America and Europe. The focus for control of blackhead is now on prevention
and the use of new diagnostic methods to better understand how to manage and eradicate the
disease.

VECTORS (CARRIERS OF DISEASE) AND TRANSMISSION

1. Ingestion of the adult common cecal worm (Heterakis gallinarum) or their

embryonated ova (eggs) infected with H. meleagridis. Heterakis gallinarum is the only
worm known to serve as an intermediate host for blackhead. After a series of divisions, a
uniquely adapted, very small form of H. meleagridis actively invades the reproductive tract
of the cecal worm and is subsequently shed within the infected worm egg. Cecal worm
eggs are extremely resistant to environmental conditions and may remain infective for 2-3
years; there is some anecdotal/circumstantial evidence of a link between ground works
(e.g. disturbing the litter to de-cake or during clean out or any other general disturbance of
the ground) and histomonas breaks (the ground works may recirculate buried caecal worm
eggs).
2. Transport of the infected cecal worm egg by one of several other potential disease
carriers or transport hosts. These include earthworms (which may ingest the eggs)
or mechanical disease carriers such as flies or rodents which may simply transport the
sticky eggs on their bodies. PCR (Polymerase chain reaction; a technique that allows
analysis of DNA) has shown that black/darkling beetles (Alphitobius diaperinus) may
contain H. meleagridis DNA, providing evidence of their role as a potential vector. People
and equipment can also act as disease carriers and flood water may act as a trigger for
increased earthworm activity.
3. Direct transmission of H. meleagridis through cloacal drinking. Proven in turkeys
only, this may be the reason why spread of disease appears to be more rapid in turkeys
compared to chickens. Experimental direct oral inoculation of H. meleagridis (direct
administration of the protozoa itself) has low success due to the parasites’ susceptibility
to the acidic crop and gizzard. However, when H. meleagridis is administered in turkeys
intracloacally or via “cloacal drinking” blackhead disease manifests.

Outside the host (or intermediate host: Heterakis gallinarum), H. meleagridis has a low
persistency and survival time, although it has been shown to survive for up to 9 hours in water
or fecal material. There is also some evidence that a cyst like stage can develop allowing the
protozoa to survive for extended periods in the environment, although this is as yet unproven.

An Aviagen Brand
 Ross Note – Histomoniasis (Blackhead)

Disease Transmission and Process

Histomoniasis Biosecurity
Vectors (disease carriers) (Blackhead) Dirt floors and litter with cecal
worms and eggs are a RISK
Ingestion of cecal worm eggs, larvae or
Do not pile or spread litter nearby
adults
Do no re-use contaminated litter
Ingestion of earthworms containing eggs
Do not place birds on untreated
infected with histomonads
Organism dirt floors
Possibly by transmission from
Ensure adequate cleaning and
beetles/flies mechanically carrying the ingested
disinfection procedures are in place
histomonads
Change clothing and footwear
Rodents, equipment and other fomites
between sheds
such as clothes, footwear, etc.
Do not move equipment between sheds
Flood water may act as a trigger for
earthworm activity Organism
reaches ceca

Cecal wall
Cecal worms
thickening
(Heterakis gallinarum)
and damage
Eggs passed in feces

Cecal cores
develop

Organism
Facilitated by
enters blood
concurrent infection
stream and with bacteria/coccidia
reaches liver

Liver may
present with
necrotic
lesions

CLINICAL SIGNS
AND DEATH

2
 Ross Note – Histomoniasis (Blackhead)

CLINICAL SIGNS AND DIAGNOSIS

Turkeys suffering from blackhead disease show ruffled feathers, drooped wings, apathy and sulphur colored (yellow)
droppings. Clinical signs in chickens may be less clear than in turkeys, or even go unnoticed, but can result in high
mortality. Cecal discharge (droppings) may contain blood. Uniformity may be affected by a blackhead challenge in
rear and, in lay, a drop in egg production may occur.

Clinical signs normally develop 7-14 days after infection although in experimental infections pathology can be seen
between 5 and 19 days post infection. Field observations suggest that co-infection with coccidia, mostly E. tenella,
may increase clinical signs. Initially the ceca will become swollen with a thickened wall; in more advanced cases,
cecal cores develop (accumulations of clotted blood and tissue). Liver lesions are highly variable, but typically
manifest as circular depressed target-like areas up to 1 cm/0.4 inch in diameter. However, in chickens, liver lesions
do not always develop despite the development of cecal cores.

If blackhead is suspected, birds should be submitted to a diagnostic lab for post mortem examination.
• Macroscopically (via necropsy/autopsy). It is important to differentiate between infections with agents such as
salmonellosis and coccidiosis as the lesions created by these infections can be easily mistaken for Histomoniasis
lesions (all three entities can produces cecal cores). However, cecal lesions together with liver lesions are
representative of a blackhead infection.
• Microscopically. The protozoa can easily be found in affected ceca and livers. This should be confirmed with
histopathology (taking tissues samples to confirm the presence of histomads), at least for the first case in an
outbreak.

Studies within Europe have found two different genotypes of H. meleagridis – Genotype 1 and Genotype 2. The
differences between these two genotypes and the effect this has on the severity or harmfulness of the disease
(virulence) between and within the genotypes needs further research.

OTHER DIAGNOSTIC / SCREENING TOOLS

1. Diagnostic examination of blood serum (serology) – Indirect sandwich ELISA (Enyme Linked Immunosorbent
Assay; a technique to measure the presence of antibodies) is available but, as yet, not sufficiently reliable as a
sole diagnostic tool due its potential to produce false positives. Currently this is not an effective screening test.
2. PCR – Several substrates have been trialed including boot and cloacal swabs, but dust appears to be the
substrate that is most suitable for a house diagnosis. Blackhead PCR kits vary in their sensitivity and specificity
and the kit selected should be chosen following the most up to date scientific advice available. Flocks confirmed
positive for blackhead with autopsy and histology will nearly always have a positive PCR result. However,
positive PCR results are also possible when there are no clinical signs in the current flock and this can make
interpretation challenging. These positive PCR results may be false positives or cross reactions; frequently there
is a good correlation with previous blackhead outbreaks on the farm despite current flocks being clinically normal.

Note: PCR does not indicate presence of viable Histomonas but rather presence of Histomonas DNA.

CONTROL AND PREVENTION

Due to the limited number of drugs available for treating blackhead prevention is key.
• Biosecurity. Good biosecurity between and within sheds is paramount. Outside clothing and footwear should be
completely changed before entering poultry sheds; it is recommended that footwear is changed before entering
each house using a biosecurity barrier system (a physical barrier prior to entry to the shed between which
footwear must be changed). Movement of equipment between houses and on and off farms should be considered
carefully and avoided if possible. Any equipment that does need to be moved should be thoroughly cleaned and
disinfected. In areas with gallinaceous wild birds in the farm environment the risk is likely to be higher.
• If blackhead is diagnosed in one shed, then good between shed biosecurity will help to prevent the disease
from spreading to other sheds. Increasing the temperature in the shed to dry the litter may also reduce the
survival of the Histomonads in the litter.

3
 Ross Note – Histomoniasis (Blackhead)

• Litter removal. The complete removal of litter between flocks is recommended, especially after an outbreak and
appropriate clean-out and disinfection procedures should be in place. Any sheds affected by blackhead should
undergo a thorough and detailed cleanout and disinfection, possibly requiring extended clean-out time, and
including the use of disinfectant products particularly effective against cecal worm eggs like sodium hypochlorite,
quaternary ammonia and phenols. Litter should be removed from the sheds with as little contamination of the
area outside the sheds as possible. Flaming floors and filling in cracks, together with removing dust from all areas
of farm (not just sheds), may also help to reduce infection pressure.
• Cleanout protocols which include deep cleaning with industrial sweepers, the use of iodine, lime and also
salting floors (granular feed grade only) in addition to using new litter have proven essential and successful
even for dirt floors under field conditions. However, caution is advised, as salt has the potential to rust metal.
• Reducing primary disease carriers/intermediate hosts (i.e. cecal worms). This is one of the key steps in the
strategy for blackhead control. Consistent, early, and scheduled worming following veterinarian advice will help
reduce exposure to cecal worms/eggs and the Histomonads they carry.
• Treating for more than one day (3-5 days) has been shown to be more effective in some situations.
• There is evidence that using the same wormer for each treatment can lead to the development of resistance.
To avoid this product rotation is recommended; avoid using the same product for more than three consecutive
wormings.
• Vermin control. Consistent and effective rodent and insect control should be a core part of the biosecurity
strategy for the farm. Besides cecal worms and earthworms, other organisms could serve as mechanical disease
carriers. Therefore, control measures should also include actions to reduce darkling beetles, flies, and rodents
among others. Measures should be taken to minimize the possibility of flooding as this will increase the presence
of earthworms. If flooding does occur disinfection of the flooded area must take place due to the potential
increased presence of earthworms in dirt floor houses.
• Coccidiosis caused by E. tenella has been identified as an aggravating factor for blackhead.
• Blackhead is more likely to spread to the liver when coccidiosis is also present.
• The number of birds with severe lesions is increased when both Histomonads and E. tenella are present in
the bird. As such, strategies to keep E. tenella under control are important.
• In many instances, there have also been blackhead cases identified right after E. necatrix, E. brunetti and E.
maxima active infections.
• Vitamin supplementation, especially with fat-soluble vitamins A, E, D3, and K is a good practice. Absorption of
fat soluble vitamins is decreased when intestinal diseases, such as blackhead occur.
• Good intestinal health. With the withdrawal of effective treatments, there is increasing interest in the
development and use of alternative intestinal health products to mitigate blackhead disease issues. Nutritional
products include: prebiotics, probiotics, organic acids, plant extracts, essential oils, enzymes, and volatile fatty
acids, among others.
• Currently these products are supported by limited research, with results on their effects on blackhead being
conflicting. For example, oregano-based products are reputed to have some limiting effect on the impact of
blackhead but it has been difficult to prove this in the field.
• Control of E. coli. Although H. meleagridis is described as the causative agent of blackhead, it has been
demonstrated that the parasite fails to cause clinical disease in the absence of bacteria. When E. coli and
H. meleagridis were given to turkeys with no other bacteria present, the disease manifested. Several control
strategies for E. coli had been used. The use of live and killed E. coli vaccines, organic acids via feed or water
and the use of yeast cell based products that trap the bacteria and minimize their replication at the ceca, appear
to decrease the severity of blackhead and may be helpful in the face of an outbreak.
• Vaccination. Histomonas vaccination based upon an attenuated clonal strain of H. meleagridis has been shown
to be highly effective in experimental trials. However, further efforts are needed to standardize the production and
optimize the administration of the vaccine in the field, and currently there is no commercially available vaccine.

4
 Ross Note – Histomoniasis (Blackhead)

CONCLUSIONS
Histomoniasis (blackhead) is a complex disease and much is still to be learned about the parasite that causes it.
Introduction into a flock can occur in different ways and transmission between birds can occur with or without a
disease carrier (vector; the role of cyst like stages still needs to be determined).

Since there are no available drugs to treat the disease, a multi-factorial approach is required to try and reduce or
eliminate blackhead from an affected farm and prevent the problem including:
1. Improving biosecurity and having suitable cleanout procedures in place is essential.
2. Reducing buildup of cecal worms as the intermediate host and other potential vectors, e.g.,
• have an strong insect and rodent control program in place.
• deworm birds regularly (have a deworming protocol in place).
• thoroughly clean, disinfect and change litter after an outbreak.
• consider the use of specific floor treatment protocols.
3. The use of prebiotics, probiotics, phytogenics, organic acids and E. coli vaccines appear to help decrease the
presentation of the clinical disease.
4. Having a plan of action with the local or company veterinarian to deal with the local situation and challenges is
always good.

Useful articles:
1. McDougald, L.R. 2003. Other Protozoan Diseases of the Intestinal Tract- Histomoniasis (Blackhead). In:
Diseases of Poultry. Y.M. Saif (ed.) 11th ed. Iowa State University Press, Ames, IA: 1001 -1006.
2. Dawe, J. and C.L. Hofacre, April 2002. With Hygromycin Gone, What are Today’s Worming Options? The Poultry
Informed Professional: Issue 60; 1-8.
3. Clark, F.D. and R.A. Norton, Jan/Feb 1998. Histomoniasis-an unwelcome houseguest returns. Turkey World.
0708-AVN-015
4. Hess, M. and McDougald, L. Diseases of Poultry 13th edition.
5. McDougal, L.R. 2005. Blackhead Disease (Histomonas) in Poultry: A Critical Review. Avian Diseases, 49:462-
476.
6. Clark, S. and Kimminau, E. 2017. Critical Review: Future Control of Blackhead Disease (Histomonas) in Poultry.
Avian Diseases, 61:281-288.
7. Liebhart, D., Ganas, P., Sulejmanovic, T. and Hess, M. 2017. Histomonas in Poultry: Previous and Current
Strategies for Prevention and Therapy. Avian Pathology, 46 No. 1: 1-18.
8. Hess M., Liebhart D., Bilic I., and Ganas P. 2015. Histomonas Meleagridis-New insights into an old pathogen.
Veterinary Parasitology 208: 67-76
9. Huber K., Gouilloud L. and Zenner L. 2007. A preliminary study of natural and experimental infection of the
lesser mealworm Alphitobius diaperinus (Coleoptera: Tenebrionidae) with Histomonas meleagridis (Protozoa:
Sarcomastigophora). Avian Pathology 36 (4): 279-282.

5
 ®

www.aviagen.com
Privacy Policy: Aviagen® collects data to effectively communicate and provide information to you about our products and our business. This data may
include your email address, name, business address and telephone number. To view the full Aviagen privacy policy visit Aviagen.com.

Aviagen and the Aviagen logo, and Ross® and the Ross logo are registered trademarks of Aviagen in the US and other countries.
All other trademarks or brands are registered by their respective owners.

© 2019 Aviagen.

0319-AVNR-105